IL-4 directly signals tissue-resident macrophages to ...

Article

The Rockefeller University Press $30.00J. Exp. Med. 2013 Vol. 210 No. 11 2477-2491www.jem.org/cgi/doi/10.1084/jem.20121999

2477

The number of resident macrophages (Ms) in several tissues can apparently be maintained without replenishment from blood monocytes and other hematopoietic precursors (Volkman et al., 1983; Kanitakis et al., 2004; Ajami et al., 2007; Klein et al., 2007; Murphy et al., 2008; Schulz et al., 2012; Yona et al., 2013) through in situ proliferation (Chorro et al., 2009; Davies et al., 2011; Jenkins et al., 2011; Hashimoto et al., 2013). Local proliferation restores homeostatic numbers of resident lung and peritoneal Ms after their loss as a result of acute inflammation (Davies et al., 2011; Hashimoto et al., 2013) but can act also as an inflammatory mechanism, leading to an outgrowth of tissueresident Ms beyond homeostatic levels. For example, infection with the rodent filarial nematode Litomosoides sigmodontis (Ls) causes a pleuritis characterized

by expansion of the resident M population to high densities equivalent to that reached by recruited monocytederived Ms during classical inflammation (Jenkins et al., 2011). Similarly, Langerhans cells and microglia increase in density via elevated selfrenewal during atopic dermatitis and experimental autoimmune encephalitis, respectively (Chorro et al., 2009; Ajami et al., 2011).

Proliferation, differentiation, and survival of Ms are controlled by the CSF1R ligands CSF1 and IL34 produced by local tissue stroma to regulate the density of resident Ms (Hume and MacDonald, 2012). CSF1 administration to mice can increase blood monocyte and tissue M numbers (Hume et al., 1988). Mice lacking

CORRESPONDENCE Stephen J. Jenkins: [email protected]

Abbreviations used: FSC, forward scatter; GI, gastrointestinal; Hp, Heligmosomoides polygyrus bakeri; Ls, Litomosoides sigmodontis; M, macrophage; SSC, side scatter.

G.D. Thomas’s present address is La Jolla Institute for Allergy and Immunology, La Jolla, CA 92037.

IL-4 directly signals tissue-resident macrophages to proliferate beyond homeostatic levels controlled by CSF-1

Stephen J. Jenkins,1,2 Dominik Ruckerl,1 Graham D. Thomas,1 James P. Hewitson,1 Sheelagh Duncan,1 Frank Brombacher,4 Rick M. Maizels,1 David A. Hume,3 and Judith E. Allen1

1Institute of Immunology and Infection Research, School of Biological Sciences; and 2Medical Research Council Centre for Inflammation Research and 3The Roslin Institute and Royal (Dick) School of Veterinary Studies, College of Medicine and Veterinary Medicine; University of Edinburgh, Edinburgh EH8 9YL, Scotland, UK

4International Centre for Genetic Engineering and Biotechnology and University of Cape Town, 7925 Cape Town, South Africa

Macrophages (Ms) colonize tissues during inflammation in two distinct ways: recruitment of monocyte precursors and proliferation of resident cells. We recently revealed a major role for IL-4 in the proliferative expansion of resident Ms during a Th2-biased tissue nematode infection. We now show that proliferation of Ms during intestinal as well as tissue nema-tode infection is restricted to sites of IL-4 production and requires M-intrinsic IL-4R sig-naling. However, both IL-4R–dependent and –independent mechanisms contributed to M proliferation during nematode infections. IL-4R–independent proliferation was controlled by a rise in local CSF-1 levels, but IL-4R expression conferred a competitive advantage with higher and more sustained proliferation and increased accumulation of IL-4R+ compared with IL-4R cells. Mechanistically, this occurred by conversion of IL-4R+ Ms from a CSF-1–dependent to –independent program of proliferation. Thus, IL-4 increases the relative density of tissue Ms by overcoming the constraints mediated by the availability of CSF-1. Finally, although both elevated CSF1R and IL-4R signaling triggered proliferation above homeostatic levels, only CSF-1 led to the recruitment of monocytes and neutrophils. Thus, the IL-4 pathway of proliferation may have developed as an alternative to CSF-1 to increase resident M numbers without coincident monocyte recruitment.

© 2013 Jenkins et al. This article is distributed under the terms of an Attribution– Noncommercial–Share Alike–No Mirror Sites license for the first six months after the publication date (see http://www.rupress.org/terms). After six months it is available under a Creative Commons License (Attribution–Noncommercial– Share Alike 3.0 Unported license, as described at http://creativecommons.org/ licenses/by-nc-sa/3.0/).

The

Journ

al o

f Exp

erim

enta

l M

edic

ine

Dow

nloaded from http://rupress.org/jem

/article-pdf/210/11/2477/1209264/jem_20121999.pdf by guest on 04 January 2022

2478 IL-4 drives macrophage proliferation | Jenkins et al.

entirely independent of the CSF1R. However, these experiments revealed a significant contribution of IL4R–independent, CSF1Rdependent M proliferation during nematode infection. We further demonstrate that IL4R expression confers a major competitive advantage to Ms, such that IL4R+ cells rapidly outcompete those lacking receptor expression.

RESULTSIL-4–dependent proliferation does not require the CSF1RWe used delivery of IL4c as a reductionist approach to investigate whether IL4 acts via the CSF1R to drive expansion of resident serous cavity Ms. Ki67 expression was used to determine the frequency of all F4/80High Ms in cycle, as described previously (Jenkins et al., 2011), whereas a 3h BrdU pulse before necropsy or high level of Ki67 expression (Ki67High) was used to identify cells in S phase (Fig. S1 A; Landberg et al., 1990). Intracellular staining for RELM and/or Ym1 was used as a marker of alternative activation. Consistent with the established role of CSF1 in regulating steadystate M levels (Davies et al., 2013), proliferation observed in control PBStreated mice was completely blocked by treatment with antiCSF1R mAb (Fig. 1 A). In contrast, neither elevated proliferation nor marker induction by IL4c was affected by antibody treatment (Fig. 1 A). The only influence of blocking CSF1R on IL4c treatment was to reduce the final M number (Fig. 1 A). Daily oral gavage of GW2580, an inhibitor of the CSF1R tyrosine kinase, also had no effect on IL4–induced M proliferation or alternative activation (Fig. 1 B). Furthermore, Csf1r gene expression was significantly reduced in FACSpurified peritoneal Ms 24 h after injection of IL4c (Fig. 1 C). As expected, because the ligand is cleared by receptormediated endocytosis (Hume and MacDonald, 2012), CSF1R blockade resulted in elevated levels of CSF1 in the tissue and bloodstream (Fig. 1 D), thereby confirming the effectiveness of the antibody. However, CSF1 production was not increased in response to IL4 (Fig. 1 D). Thus, in the context of IL4 delivery, there was no evidence of CSF1R involvement in proliferation and alternative activation.

IL-4–driven proliferation requires M-intrinsic IL-4R signalingWe next addressed the possibility that IL4 signals directly to Ms to induce proliferation. We used LysMcreIl4ra/lox mice to delete the IL4R chain on myeloid cells including Ms and neutrophils (Herbert et al., 2004). Injection of IL4c into LysMcreIl4ra/lox mice resulted in elevated proliferation of F4/80High Ms in the cavities as well as elevated frequencies of alternatively activated Ms (Fig. 2 A). Nevertheless, M proliferation was lower in LysMcreIl4ra/lox mice than in Il4ra/lox controls (pleural, P < 0.01; peritoneal, P < 0.001; Fig. 2 B). Costaining for RELM and BrdU (Fig. 2 B) revealed that RELM+ Ms from LysMcreIl4ra/lox mice underwent significantly greater levels of proliferation than RELM cells. Because RELM expression is a known marker of IL4R engagement on Ms (Jenkins and Allen, 2010) and LysMCre is relatively inefficient (Hume, 2011), the data

the CSF1R exhibit an extreme deficit in resident Ms in many tissues (Dai et al., 2002), and the same cells are ablated in a timedependent manner after treatment with a blocking antiCSF1R antibody (MacDonald et al., 2010). A proliferative signal through the CSF1R has been shown to maintain homeostatic numbers of resident peritoneal Ms in the steadystate (Davies et al., 2013) and mediate repopulation of resident lung and peritoneal Ms after acute inflammation or experimental depletion (Davies et al., 2013; Hashimoto et al., 2013). CSF1R signaling can also control in vivo proliferation of monocytederived Ms, required for the population of the growing myometrium in pregnancy (Tagliani et al., 2011) or maintenance of recruited cells during the resolution phase of sterile peritonitis (Davies et al., 2013).

The Th2 lymphokine IL4 was first shown to regulate proliferation and accumulation of resident Ms in the context of filarial nematode infection. Moreover, serial administration of an rIL4 complex (IL4c) was sufficient to induce proliferation and accumulation of Ms throughout the body, including in the peritoneal cavity and liver (Jenkins et al., 2011), lung, and spleen (unpublished data), and to drive proliferation of recruited monocytederived cells (Jenkins et al., 2011). These studies did not reveal whether the actions of IL4 were direct or indirect.

Akt signaling is required for CSF1–mediated proliferation (Smith et al., 2000; Irvine et al., 2006; Huynh et al., 2012), and we have recently shown that intact Akt signaling is critically important for in situ M proliferation in response to IL4 (Rückerl et al., 2012). However, IL4 receptor (IL4R) signaling does not effectively activate Akt in Ms in vitro despite phosphorylating PKB (Heller et al., 2008), thus raising the possibility that IL4 acts via CSF1R signaling to induce Aktdependent M proliferation. Indeed, many important parallels exist between IL4– and CSF1–activated Ms. For example, both IL4 and CSF1 promote a suppressive and a prorepair phenotype in Ms (Alikhan et al., 2011). Furthermore, the transcription factors cMyc and KLF4 are critical for both the “alternative activation” state induced in Ms by engagement of the IL4R (Liao et al., 2011; Pello et al., 2012) and CSF1–dependent proliferation that occurs in the absence of Maf B and cMaf (Aziz et al., 2009). Thus, understanding the relationship between CSF1 and IL4 is important, not least because several groups have used CSF1 to generate human “M2” Ms (Verreck et al., 2004; Martinez et al., 2006; Fleetwood et al., 2007), which are often considered highly parallel to alternatively activated Ms driven by IL4.

This study seeks to determine the contribution of CSF1 to IL4–driven M proliferation and alternative activation. Alternatively activated Ms are a distinguishing feature of inflammation driven by helminth infections and allergy but may also appear in coldstressed adipose tissue (Nguyen et al., 2011; Karp and Murray, 2012), certain immunogenic tumors (DeNardo et al., 2009; Linde et al., 2012), and even the steadystate (Wu et al., 2011). Using direct delivery of IL4 and Th2biased infection models, we demonstrate that IL4–mediated proliferation requires Mintrinsic IL4R signaling that is

Dow



http://www.jem.org/cgi/content/full/jem.20121999/DC1

JEM Vol. 210, No. 11

Article

2479

context. Intracellular staining for RELM (not depicted) and Ym1 (Fig. 2 E) in these experiments confirmed an absolute requirement for intrinsic IL4R signaling to upregulate production of these archetypal alternative activation markers under this reductionist condition.

Both IL-4R–dependent and –independent pathways contribute to proliferation during nematode infectionThe Th2 cytokines IL4 and IL13 can both signal via the IL4R to drive alternative activation (Gordon and Martinez, 2010). In our previous study, nematodeassociated increased M proliferation was not entirely absent in Il4/ mice (Jenkins et al., 2011), suggesting a possible contribution from IL13. To assess the potential of IL13 to induce proliferation, mice were injected with IL13 complexed with a neutralizing antibody (IL13c). IL13c led to significant (P < 0.01) M proliferation, at a similar magnitude to IL4c delivery (Fig. 3 A), but as documented previously (Heller et al., 2008), IL13 was somewhat less effective at stimulating RELM production by Ms. To determine whether IL13 was responsible for the residual rise in proliferation observed in nematodeinfected Il4/ mice, we infected mice lacking the IL4R chain (Il4ra/). Proliferation and accumulation of pleural Ms after Ls infection were significantly (P < 0.001) reduced in Il4ra/ mice compared with WT controls (Fig. 3 B) but to no greater extent than in the Il4/ mice (Jenkins et al., 2011), suggesting no contribution of IL13. In contrast, marker induction in Ms was entirely dependent on IL4R signaling

suggest that IL4–dependent proliferation predominantly occurs in the subset of Ms that retain the IL4R in LysMcre Il4ra/lox animals.

To confirm this conclusion, Il4ra+/+Cd45.1+Cd45.2+ C57BL/6 mice were lethally irradiated and transplanted with a 50:50 mix of BM from Il4ra+/+Cd45.1+Cd45.2+ and Il4ra/ Cd45.2+/+Cd45.1null mice, so that cells derived from Il4ra/ BM could be distinguished from WT by a lack of CD45.1 expression. Bloodborne monocytes (Fig. 2 C) and other myeloid populations (not depicted) exhibited roughly equal proportions of CD45.1+ and CD45.1 cells 8 wk after reconstitution. This extends earlier data showing the key mediator of IL4R signaling, STAT6, has no intrinsic role in steadystate proliferation or survival of hematopoietic stem cells despite their ubiquitous IL4R+ expression (Bunting et al., 2004). Likewise, similar frequencies of Il4ra+/+ and Il4ra/ cells were detected in the resident F4/80High pleural and peritoneal cavity M populations in control mice treated with PBS (Fig. 2 D and not depicted). In contrast, Il4ra+/+ F4/80High Ms greatly outnumbered Il4ra/ cells in the pleural and peritoneal cavities of mice treated with IL4c. Indeed, only the IL4R+ population increased in number after treatment with IL4c (Fig. 2 D and not depicted), consistent with increased Sphase BrdU+ cells (Fig. 2 E) and Ki67+ cells (not depicted) being observed only in the CD45.1+ IL4R+ cells. Notably, steadystate levels of proliferation in PBStreated controls did not differ between Il4ra+/+ and Il4ra/ cells, suggesting IL4 is only important in an inflammatory

Figure 1. IL-4 drives CSF-1–independent M proliferation. (A) BL/6 mice were in-jected i.p. with IL-4c or PBS plus anti-CSF1R mAb (CSF1R), rat IgG (RIgG), or PBS on days 0 and 2. The proportion of F4/80High pleural Ms positive for Ki67, Ki67High, or RELM and total M numbers were determined by flow cytometry on day 2 after the last injec-tion. Graphs depict individual data for four mice/group. (B) As in A, but on day 3 after daily oral gavage with vehicle control or GW2580 on days 0–3. (C) Mice were injected with a single dose of PBS or IL-4c, and the expression of CSF1R mRNA was determined 24 h later in FACS-purified F4/80High perito-neal Ms. ***, P < 0.001 determined by two-tailed Student’s t test. Individual data for five mice/group are shown. (D) CSF-1 levels in pleural lavage fluid and serum from mice in A determined by ELISA. All data are representa-tive of two to three separate experiments, with the same results observed in the perito-neal cavity. (A–D) Horizontal bars indicate mean values.

Dow




by IL4c versus Ls infection revealed key differences: IL4c induced marker expression in peritoneal and pleural Ms before detectable proliferation (Fig. 3 C and Fig. S1 B), whereas during infection proliferation preceded marker expression (Fig. 3 D). The data indicate that IL4R–independent

(Fig. 3 B), and worm burdens did not significantly differ between strains at this stage of infection (not depicted). Hence, mechanisms independent of IL4R contribute to elevated M selfrenewal during nematode infection. Comparison of the kinetics of alternative activation and proliferation stimulated

Figure 2. M-intrinsic IL-4R signaling is essential for proliferation and alternative activation triggered by IL-4c. (A) LysMcreIl4ra/lox BALB/c mice were injected i.p. on days 0 and 2 with PBS or IL-4c, and peritoneal lavage cells were analyzed on day 4 by flow cytometry for BrdU incorporation or Ki67, RELM, and Ym1 versus F4/80 expression. Representative flow cytograms gated on F4/80High peritoneal Ms with frequencies depicting the mean ± SEM of four mice per group. (B) Il4ra/lox (Het), LysMcreIl4ra/lox (Lys), or Il4ra/ (/) BALB/c were treated with PBS (open) or IL-4c (closed) as in A, and BrdU incorporation by F4/80High pleural Ms was determined on day 3 together with the frequency of BrdU+ cells in RELM-positive (+) or negative () F4/80High Ms from the IL-4c–treated LysMcreIl4ra/lox group. *, P < 0.05; **, P < 0.01; and ***, P < 0.001 determined by ANOVA (left) or paired Student’s t test (right). Data are representative of four independent experiments inclusive of data in A, with three to four mice/group. (C) BL/6 Il4ra+/+Cd45.1+Cd45.2+ mice were lethally irradiated and reconstituted with a 50:50 mix of Il4ra+/+Cd45.1+Cd45.2+ and Il4ra/Cd45.1nullCd45.2+/+ congenic BM cells. The fre-quency of blood monocytes (gated as side scatter [SSC]lowCD11b+CD115+) derived from each BM was determined by analysis of CD45.1 and CD45.2 expression 8 wk later. A representative flow cytogram of CD45.1 and CD45.2 expression on blood monocytes is shown together with a graph depicting the frequency of CD45.1+ and CD45.1 monocytes in all blood leukocytes from 10 individual mice. (D) Mice from C were subsequently injected i.p. twice, 2 d apart, with PBS or IL-4c, and pleural lavage cells were analyzed 2 d after the last injection for CD45.1 and CD45.2 expression. Representative flow cyto-grams gated on all live F4/80High Ms are shown together with a graph depicting the total number of Il4ra+/+Cd45.1+ (closed circles) and Il4ra/Cd45.1null (open circles) pleural F4/80High Ms in each group, with individual data for five mice/group presented. (E) Representative flow cytograms depicting CD45.1 expression versus BrdU incorporation or Ym1 expression gated on single F4/80HighCD19 pleural Ms from mice in D, and graphs showing the proportion of Il4ra+/+Cd45.1+ (closed circles) and Il4ra/Cd45.1null (open circles) F4/80HighCD19 Ms positive for BrdU or Ym1 for individual mice. (C–E) Data are representative of two experiments. (B–E) Horizontal bars indicate mean values.

Dow




Article

2481

sustained (Fig. 3 C and Fig. S1 B). After two sequential IL4c doses at days 0 and 2, proliferation remained evident at day 4 (Fig. 1 A). We therefore titrated the dose of IL4c. As expected, proliferative activity required high doses of IL4,

proliferation occurs early during infection with subsequent peak proliferation driven by IL4.

Of note, proliferation induced by a single IL4c dose subsided after 4 d, whereas alternative activation markers were

Figure 3. IL-4R–dependent and –independent mechanisms of proliferation during nematode in-fection. (A) BL/6 mice were given a single i.p. injection of IL-13c, IL-4c, or PBS, and the proportion of BrdU+, Ki67+, and RELM+ F4/80High peritoneal Ms was de-termined 36 h later. Graphs depict individual data for six mice per group and are representative of two inde-pendent experiments. Horizontal bars indicate median values. Equivalent results were obtained in the pleural cavity. *, P < 0.05; **, P < 0.01; and ***, P < 0.001 deter-mined by Kruskal-Wallis test. (B) C57BL/6 (WT) and Il4ra/ (/) mice were infected with Ls, and the total number of F4/80High pleural Ms and the propor-tion positive for BrdU, Ki67, and RELM were deter-mined on day 10. Results are pooled from two experiments with 15–16 mice/group shown. Horizontal bars indicate mean values. **, P < 0.01; and ***, P < 0.001 determined by ANOVA. (C) BL/6 mice were given a single i.p. dose of IL-4c (solid line) or PBS (dashed line), after which the total number of pleural cavity F4/80High Ms and the proportion positive for RELM, Ki67High, or Ki67 were determined over a 4-d time course. Data are mean ± SEM of four mice/group and representative of two experiments, with the same re-sults obtained for peritoneal Ms. Day 0 represents naive. (D) As C but from Ls-infected (solid line) or naive (dashed line) mice. Data are mean ± SEM from four to five mice per group and representative of three experi-ments. (E) Representative flow cytograms of F4/80High peritoneal Ms 4 d after i.p. injection of PBS or IL-4c containing 5, 1.25, or 0.31 µg IL-4 on days 0 and 2. Frequencies are means with SEM in parentheses of three to six IL-4c–treated animals per group or a single value for pooled cells from three PBS-treated mice. A repeat using a single injection regimen verified dose effect for both of IL-4c and IL-13c.

Dow




mice at this time (P < 0.001), and only in these cells did heightened proliferation remain evident at day 16 (Fig. 5 A). In contrast, production of Ym1 (Fig. 5 A) and RELM (not depicted) during infection was wholly dependent on Mintrinsic IL4R signaling. Consistent with the pattern of proliferation, both Il4ra+/+ and Il4ra/ populations significantly increased in number in the pleural cavity by day 10 after infection (P < 0.01), yet by day 16 the IL4R Ms, although still elevated in number (P < 0.05), were significantly outnumbered by the IL4R+ cells (Fig. 5 B; P < 0.05). The selective advantage provided by the IL4R was only observed in the F4/80High M population and not in other myeloid cells (Fig. 5 C). Thus, although confirming the existence of an IL4R–independent pathway of proliferation, these data show that direct IL4R signaling to Ms conveys a competitive advantage during infection at least in part by enhancing entry into cell cycle. These findings explain the emergence of

whereas induction of RELM was maximal at the lowest dose tested (Fig. 3 E). Thus, detection of alternative activation markers in the tissues is not synonymous with proliferation, as marker expression may only indicate prior or lowlevel exposure to IL4.

IL-4 switches Ms to CSF-1–independent proliferationWe used CSF1R blockade to assess the potential contribution of CSF1R signaling to the IL4R–independent proliferation that occurs during Ls infection. Mice were treated with antiCSF1R mAb between days 8 and 10 to coincide with the approximate onset of alternative activation (Fig. 3 D) and when IL4R–independent proliferation is detectable (Fig. 3 B). CSF1R blockade led to a significant reduction in infectioninduced proliferation of pleural Ms (Fig. 4 A), whereas alternative activation (Fig. 4 A), Th2 responses, and worm burden (not depicted) were unaffected. However, the response in the infected group appeared bimodal, with 13 of 20 antiCSF1R–treated mice showing almost complete inhibition of proliferation (Fig. 4 A, black squares), whereas the remaining animals were similar to controls (Fig. 4 A, gray squares). The antiCSF1R–treated infected animals in which highlevel proliferation remained evident showed the highest frequencies of Ym1+ Ms (Fig. 4 A, gray squares), and indeed the frequency of Ms able to proliferate in the presence of antiCSF1R correlated positively with Ym1+ Ms (Spearman r = 0.84, P < 0.0001). The data suggest that as the strength of Th2 response and corresponding IL4R signaling increased, the dependence on CSF1R signaling for Ms to proliferate and accumulate during tissue nematode infection declined. In other words, IL4 can substitute for CSF1.

CSF1 is increased in the circulation and local lesions in many infections, chronic inflammation, and malignancy (Chitu and Stanley, 2006; Hume and MacDonald, 2012). We therefore measured levels of cytokine in the pleural lavage fluid and serum. There was a modest increase in accumulation of CSF1 in the pleural cavity of infected antiCSF1R–treated mice compared with naive controls, but no increase in the serum (Fig. 4 B). No correlation was found between the level of pleural CSF1 and frequency of BrdU+ Ms in antiCSF1R–treated infected mice (Spearman r = 0.1398, P = 0.5565), consistent with IL4R signaling controlling CSF1–independent proliferation in these mice directly rather than via elevation of CSF1.

IL-4R expression provides a competitive advantage to Ms during nematode infectionWe next infected Il4ra+/+Cd45.1+: Il4ra/Cd45.1null mixed BM chimeric mice with Ls to investigate the relevance of Mintrinsic IL4R signaling in a setting in which IL4R–independent proliferation can occur. In contrast to the highly restricted response seen in these mice after IL4c injection (Fig. 2, D and E), increased proliferation of both Il4ra+/+ and Il4ra/ pleural F4/80High Ms was evident by day 10 after Ls infection (Fig. 5 A). However, the frequency of cycling cells was significantly greater in the IL4R+ population in all infected

Figure 4. Elevated CSF-1 production contributes to M prolifera-tion during tissue nematode infection. (A) BL/6 mice were infected with Ls and injected i.p. on day 8 with anti-CSF1R mAb (CSF1R), rat IgG (RIgG), or PBS. Total number of F4/80High pleural Ms and the proportion positive for BrdU, Ki67, or Ym1 were determined on day 10. Data are pooled from two experiments with 7, 13, and 20 mice for naive and PBS-, RIgG-, and anti-CSF1R–treated infected, groups, respectively. *, P < 0.05; and **, P < 0.01 determined by Kruskal-Wallis test. (B) CSF-1 levels in pleural lavage (left) or serum (right) from mice in A determined by ELISA. (A and B) Horizontal bars indicate median.

Dow




Article

2483

Figure 5. IL-4R signaling to Ms provides a competitive advantage during tissue nematode infection. (A) BL/6 Il4ra+/+Cd45.1+Cd45.2+ mice were lethally irradiated and reconstituted with a 50:50 mix of Il4ra+/+Cd45.1+Cd45.2+ and Il4ra/Cd45.1nullCd45.2+/+ congenic BM cells over 8 wk. Mice were infected with Ls, after which BrdU incorporation or Ym1 expression versus expression of CD45.1 was determined on single F4/80HighCD19 pleural Ms at days 10 and 16 after infection. Representative flow cytograms are shown, whereas graphs depict the proportion of IL-4R+CD45.1+ (closed

Dow




in our Ls model. Infection led to a two to threefold increase in cells in the peritoneal lavage, exclusively within the F4/80High M population. As expected for a Th2 setting, these Ms expressed RELM and Ym1 (Fig. 6 A). As in the Ls model, Il4/ mice had a reduced response, although a significant increase in BrdU+ (P < 0.001), Ki67+ (P < 0.001), and total Ms (P < 0.01) remained (Fig. 6 B). A minor population of Ym1+ Ms was also detected in infected Il4/ mice, suggesting a limited influence of IL13 (Fig. 6 B). Blockade of CSF1R signaling demonstrated a CSF1Rdependent component to the proliferative but not the alternative activation response (Fig. 6 C), and thus as in the Ls model, both CSF1R and IL4R signaling also contribute to M proliferation in this model. We also reexamined the relative importance of cellautonomous IL4R signaling in the Hp model. The majority of F4/80High Ms, but not other myeloid cell populations, were IL4R+ by day 14 after infection of Il4ra+/+Cd45.1+: Il4ra/Cd45.1null mixed BM chimeric mice, despite earlier accumulation of both IL4R+ and IL4R cells (Fig. 6 D). This competitive advantage was confirmed using LysMcreIl4ra/lox mice infected with Hp, in which the proportion of RELMpositive cells increased from 4% in naive mice (not depicted) to 25% at day 14 and 70% by day 28 (Fig. 6 E), by which point >50% of the Ms expressed IL4R detectable by flow cytometry (not depicted). Infection with a GI nematode thus led to a M response in the peritoneal cavity that mirrored the pleural cavity during infection with the filarial worm Ls. In both models, CSF1R and IL4R contributed independently to proliferation.

Differing consequences of CSF-1– versus IL-4-induced inflammationBecause both IL4 and CSF1 can induce local M proliferation, we sought to compare the Ms elicited by the two stimuli. To assess the contribution of CSF1 to cellular dynamics in the serous cavity, we used a new reagent, Fc–CSF1 designed for stable in vivo delivery of CSF1. We compared Fc–CSF1 with IL4c at similar molar doses that induced maximal levels of proliferation with both reagents (≥80% Ki67+ by 48 h; not depicted). Despite near identical levels of M proliferation at 24 h, only IL4c induced RELM (Fig. 7 A) or Ym1 (not depicted) production. Furthermore, Fc–CSF1

RELM+ pleural Ms in Mspecific IL4R–deficient LysMcreIl4ra/lox mice during the later phase of Ls infection (Fig. 5 D). Indeed, by day 60 after infection, RELM and YM1 expression by Ms is indistinguishable between WT and LysMcreIl4ra/lox mice (not depicted). IL4R expression on Ms in the LysMcreIl4ra/lox mice was confirmed by surface staining (Fig. 5 D). Thus, IL4R expression can give Ms a competitive advantage during a chronic Th2 inflammatory setting such as helminth infection.

Proliferation during infection requires adaptive immunity and is localized to the infection siteWe have previously established using Rag1/ mice that IL4– driven M proliferation per se does not require adaptive immunity (Jenkins et al., 2011). In the context of chronic nematode infection, however, M accumulation requires Th2 cells and MHC class II (Loke et al., 2007). We thus assessed the requirement for adaptive immunity in M proliferation during infection. There was a dramatic reduction in the number of F4/80+ Ms in nematodeinfected Rag1/ mice compared with WT controls, matched by a complete failure of the Ms to divide or upregulate alternative activation markers (Fig. 5 E). Consistent with a need for cognate antigenspecific interaction, proliferation and alternative activation were localized to the site of parasite infection in WT animals, with significantly (P < 0.05) elevated responses observed in the pleural but not the peritoneal cavity of infected mice (Fig. 5 F).

IL-4–dependent M proliferation, alternative activation, and competitive advantage are features of intestinal nematode infectionOral infection of BALB/c mice with the gastrointestinal (GI) nematode Heligmosomoides polygyrus bakeri (Hp) leads to invasion of the submucosa of the duodenum where the worms undergo developmental maturation. Despite restriction of the worms to the GI tract, there is systemic dissemination of Th2 cells with selectivity for the peritoneal cavity (Mohrs et al., 2005). In Hpinfected mice, there was a striking increase in proliferation of F4/80High resident Ms by day 7 after infection in the peritoneal (Fig. 6 A) but not the pleural cavity (not depicted), consistent with the localized M proliferation observed

squares) and IL-4RCD45.1 (open squares) cells positive for BrdU or Ym1, with each line illustrating paired measurements from individual mice. Data are pooled from two experiments, with 11–12 mice/group. ***, P < 0.001 determined by paired Student’s t test. (B) CD45.1 and CD45.2 expression gated on all F4/80High pleural Ms from mice in A and graphical presentation of the total number of IL-4R+CD45.1+ (closed squares) and IL-4RCD45.2+/+ (open squares) subsets of these cells. *, P < 0.05; **, P < 0.01; and ***, P < 0.001 determined by Kruskal-Wallis test. (C) Frequency of IL-4R+CD45.1+ cells within CD115+CD11b+SSCLow blood monocytes and pleural cavity eosinophils (SSCHigh, F4/80Low, MHCII), DCs (CD11cHighMHCIIHigh), and F4/80High Ms at days 10 and 16 after infection of mice in A, with lines joining cells of individual mice. (D) Il4ra+/+ (WT), Il4ra/lox (Het), LysMcreIl4ra/lox (Lys), or Il4ra/ (/) mice were infected with Ls or left naive, and RELM and IL-4R staining on F4/80High pleural Ms was determined at day 17. Frequen-cies are means with SEM in parentheses of five to seven mice/group. The emergence of RELM+ Ms in LysMcreIl4ra/lox mice was confirmed in a fur-ther three independent experiments between days 14 and 60 after infection. (E) C57BL/6 (WT) or Rag1/ (/) mice were infected with Ls, and the total number of pleural cavity F4/80High Ms and the proportion incorporating BrdU or expressing Ym1 were determined on day 10, with mean and SEM of five mice/group shown. (F) As in E, but both peritoneal (PeC) and pleural (PleC) cavity F4/80High Ms from naive (open circles) or Ls-infected C57BL/6 mice were analyzed at 10 d after infection. Data are representative of three experiments with eight mice/group. *, P < 0.05; and **, P < 0.01 determined by Kruskal-Wallis test. (B and F) Horizontal bars indicate median values.

Dow




Article

2485

Figure 6. IL-4–dependent proliferation occurs during GI nematode infection and provides a competitive advantage to IL-4R+ Ms. (A) BALB/c mice were infected orally with Hp, and peritoneal lavage cells were assessed at day 7. Representative flow cytograms of all peritoneal cells showing gates and frequencies for all or BrdU+, Ki67+, RELM+ or Ym1+, F4/80High Ms. Data are representative of five experiments. (B) BALB/c (WT) or Il4/ (/) mice were infected with Hp (closed symbols) or left naive (open symbols), and the total peritoneal F4/80High Ms and the proportion

Dow




Nevertheless, IL4R+ Ms remain reliant on CSF1 for survival after IL4–driven expansion, as indicated by the reduced numbers observed after CSF1R blockade. Seemingly at odds with such a requirement, we found that IL4 treatment was accompanied by a sharp downregulation in M transcription of the CSF1R. However, lower levels of CSF1R signaling are required for M survival than are needed for their proliferation (Tushinski et al., 1982). CSF1 is likely present in the steadystate serous cavities in greater abundance than required for M survival given the evident homeostatic CSF1–dependent proliferation in these sites (Figs. 1 and 4; Davies et al., 2013). We suggest that IL4–mediated downregulation of CSF1R reduces local CSF1 consumption by individual cells, thereby maintaining sufficient tissue CSF1 levels to allow survival of the expanding M population. Such a model would explain how the basal levels of proliferation and total number of IL4R Ms in mixed BM chimeras appeared to be maintained at near normal steadystate levels after treatment with IL4c (Fig. 2 E) despite the large outgrowth of IL4R+ cells and without a corresponding increase in CSF1 production (Fig. 1 D). Together, our data suggest that IL4 and CSF1 are entirely distinct in terms of proliferation although CSF1 is still critical for survival in the context of IL4 expansion.

During nematode infection, our data suggest that CSF1 plays an early role in M proliferation but is superseded by IL4 presumably upon entry of Th2 cells. Supporting this, CSF1R blockade during infection almost completely inhibited proliferation in all WT animals except those exhibiting the highest levels of IL4 exposure, as indicated by the percentage of cells expressing alternative activation markers (Fig. 4 A). Furthermore, time course analysis during infection demonstrated that proliferation occurred before, but only peaked after, the onset of alternative activation (Fig. 3 D), whereas more sustained and higher proliferation was achieved by IL4R+ than IL4R cells in infected mixed BM chimeric mice (Fig. 5 A). Lastly, the restriction of proliferation and M accumulation to the infection site, and the absence of any such response in Rag1/ animals (Fig. 5, E and F), mirrors our previous findings that Ms fail to accumulate in a related nematode infection in the absence of Th2 cells (Loke et al., 2007). IL4 may also contribute to elevated tissue M density during infection through additional cellintrinsic mechanisms, for example, by reducing reliance on local glucose levels (Vats et al., 2006), inhibiting migration from the tissue

induced the recruitment of inflammatory cells including neutrophils and Ly6C+ monocytes (Fig. 7 B), consistent with its recently described ability to drive proinflammatory chemokine production (Tagliani et al., 2011) and acute monocytopenia (Ulich et al., 1990). In striking contrast, no inflammatory recruitment was seen with IL4c, consistent with the ability of IL4 to actively downregulate proinflammatory chemokines (Thomas et al., 2012). Thus although CSF1 and IL4 both induce M proliferation in the tissues, they have otherwise markedly different consequences. Additionally, these data demonstrate that elevated CSF1 signaling is sufficient to stimulate heightened proliferation (Fig. 7 A) and accumulation (not depicted) of resident Ms in vivo without need for additional signals that occur during infection/inflammation and provide some explanation for the elevated peritoneal M numbers seen in the original study of systemic CSF1 treatment of mice (Hume et al., 1988).

DISCUSSIONWe previously demonstrated the requirement for IL4 to achieve maximal proliferation of Ms during nematode infection and an absolute requirement for IL4R for M proliferation after IL4c delivery (Jenkins et al., 2011). Our working hypothesis was that IL4 acted indirectly via an intermediate cell, to stimulate production of a M mitogenic factor, such as CSF1, similar to the process by which a vitamin D3 analogue acts on keratinocytes to stimulate Langerhans cell proliferation (Chorro et al., 2009). This hypothesis was supported by our preliminary data in which IL4–driven proliferation was observed in mice apparently lacking IL4R on Ms. However, using mixed BM chimeric mice, we demonstrate that Mintrinsic IL4R signaling is required for M proliferation in response to endogenous or exogenous IL4. Furthermore, IL4–mediated proliferation was entirely independent of CSF1R signaling, in contrast to the homeostatic proliferation of cavityresident Ms, which is completely dependent on CSF1 (Fig. 1, A and B; and Fig. 4 A; Davies et al., 2013). Treatment with IL4c did not increase production of CSF1 in either serum or tissues, consistent with an intrinsic and CSF1–independent effect of IL4 on Ms. Thus, it would appear that IL4R signaling to Ms allows their substantial outgrowth above normal tissue levels at least in part by switching them to a CSF1–independent program of proliferation.

positive for BrdU, Ki67, Ym1, and RELM+ was determined on day 7. Data are representative of three experiments with three to four mice per group. *, P < 0.05; **, P < 0.01; and ***, P < 0.001 determined by ANOVA. (C) As in B but after treatment of BALB/c mice with anti-CSF1R mAb (CSF1R) or rat IgG (IgG) on day 6. (D) Il4ra+/+Cd45.1+Cd45.2+ mice were lethally irradiated and reconstituted for 8 wk with a 50:50 mix of Il4ra+/+Cd45.1+Cd45.2+ and Il4ra/Cd45.1nullCd45.2+ congenic BM cells before infection with Hp. The frequency of CD45.1+ cells in different leukocyte subsets in the peritoneal cavity in naive (open symbols) and Hp-infected mice (closed symbols) was determined on days 7 and 14 after infection. The graphs show total numbers of Il4ra+/+Cd45.1+ and Il4ra/Cd45.1null peritoneal F4/80High Ms obtained in naive (open) and infected (closed) mice at each time point. (E) Il4ra/lox (Het), LysMcreIl4ra/lox (Lys), or Il4ra/ (/) mice were infected with Hp, and RELM expression by F4/80High peritoneal Ms was deter-mined on days 14 and 28. (C–E) Data are from independent experiments performed once and are confirmatory of data from the Ls model. (B–E) Hori-zontal bars indicate mean values.

Dow




Article

2487

to IL4R+ Ms in IL4–treated or nematodeinfected mixed BM chimeric mice despite abundant IL10 detectable in the pleural lavage fluid during infection (not depicted). It would seem that the selective advantage of IL4R expression leads to accrual of a minor nongene–deleted population, which could account for the Ym1+ cells observed in LysMcreIl4ra/lox mice during schistosome infection (Dewals et al., 2010). Alternatively, Ms elicited by schistosome eggs may differ qualitatively from those found during nematode infection and IL4c injection, being capable of Ym1 production in response to IL10. In this respect, schistosome eggs elicit CCR2dependent inflammatory Ms (Chensue et al., 1996; Lu et al., 1998), contrasting with the residentderived cells in our systems (Jenkins et al., 2011). Furthermore, Il4ra/ and LysMcreIl4ra/lox mice show no defect in overall M numbers elicited to schistosome granulomas (Dewals et al., 2010), perhaps because of the proinflammatory nature of the eggs. Therefore, the balance of proliferation versus recruitment in Th2 settings almost certainly depends on integration of multiple inflammatory signals. Of relevance, variation of IL4c dose and delivery timing suggested that proliferation may only be apparent in environments in which critical IL4 thresholds are sustained.

(Thomas et al., 2012), or protecting against apoptosis, as occurs in other leukocytes (Wurster et al., 2002). Although the mixed Il4ra+/+: Il4ra/ BM mice do not reflect the natural distribution of IL4R expression in vivo, they are critically important for understanding how cellintrinsic IL4R signaling augments M numbers during nematode infection. Furthermore, the data generated using these mice may be relevant to circumstances in which differential IL4R expression does occur (Wermeling et al., 2013).

RELM and Ym1 were used here as surrogate markers of IL4R–experienced Ms. Elsewhere, Ym1 expression has been documented in Ms from LysMcreIl4ra/lox mice in the liver granulomas surrounding schistosome eggs and peritoneal cavity after injection of schistosome eggs (Dewals et al., 2010). Because Ym1 expression is reduced significantly by in vivo IL10 blockage, it was concluded that IL10 induces M Ym1 expression in these settings independently of IL4 (Dewals et al., 2010). However, we observed a large proportion of serous cavity Ms in LysMcreIl4ra/lox mice expressing Ym1 and RELM in response to IL4c injection and during infection with Ls or Hp, with costaining confirming IL4R expression. Moreover, expression of both Ym1 and RELM was exclusively restricted

Figure 7. CSF-1 but not IL-4 stimulates neutrophil and monocyte recruitment alongside elevated proliferation of resident tissue Ms. (A) BL/6 mice were injected i.p. with PBS, Fc–CSF-1, or IL-4c, and Ki67 and RELM expression by F4/80High peritoneal Ms was determined 24 h later. Representative flow cytograms show all live peritoneal lavage cells. Data are representative of two independent experiments. (B) Total Ly-6C+CD115+ mono-cytes and Ly-6CIntermediateSSCIntermediate neutro-phils in peritoneal lavage cells from mice in A and representative flow cytograms depicting gating strategies. Top flow cytograms also depict CD115+Ly6C monocytes/Ms (left gate), and bottom flow cytograms show the SSCHighLy6CLow eosinophil gate, both of which exhibited no change in total number. (A and B) Horizontal bars indicate mean values.

Dow




In summary, the impact of IL4 during infections is likely twofold: it increases numbers without the need for recruitment, whereas in the presence of recruitment it insures a noninflammatory environment by switching Ms to an alternatively activated phenotype. Thus, the numerical advantage provided by M IL4R expression combined with the antiinflammatory chemokine profile and alternative activation state ultimately leads to the development of a noninflammatory environment to contain worm infection and repair tissue regardless of M source.

MATERIALS AND METHODSMice. BALB/c Il4/ (NobenTrauth et al., 1996), Il4ra/, LysMcreIl4ra/lox, and Il4ra/lox mice (Herbert et al., 2004), C57BL/6 Il4ra/ and Rag1/ mice, and WT controls were bred and maintained in specific pathogen–free facilities at the University of Edinburgh. All experiments were permitted under a Project License granted by the Home Office UK and were approved by the University of Edinburgh Ethical Review Process. Experimental mice were age and sex matched. C57BL/6 Il4ra/ mice were generated by backcrossing from the BALB/c Il4ra/ strain a minimum of nine times. Competitive mixed BM chimeric mice were created by lethally irradiating C57BL/6 Cd45.1+Cd45.2+ mice with 11.5 Gy radiation administered in two doses 3 h apart, followed by i.v. injection of with 5 × 106 BM cells depleted of mature T cells using CD90 microbeads (Miltenyi Biotec) and comprised of a 1:1 mix of cells from C57BL/6 Cd45.2+/+Il4ra/ mice and C57BL/6 Cd45.1+Cd45.2+ mice. Chimeric animals were left for at least 8 wk before further experimental manipulation.

Parasites and reagents. Hp and Ls life cycles were maintained, and infective thirdstage larvae (L3) were obtained as described elsewhere (Behnke and Wakelin, 1977; Le Goff et al., 2002). Mice were infected with 200 Hp L3 by oral gavage or 25 Ls L3 by s.c. injection. IL4–anti–IL4 mAb complex (IL4c) was prepared as described previously (Finkelman et al., 1993), and unless stated otherwise, mice were injected i.p. with 5 µg of recombinant IL4 (13.5 kD; PeproTech) complexed to 25 µg 11B11 (Bio X Cell) or 100 µl PBS vehicle control on days 0 and 2, and peritoneal and pleural exudate cells were harvested on day 4. IL13–anti–IL13 complexes were similarly prepared using 5 µg of recombinant IL13 (12.3 kD; PeproTech) complexed to 25 µg eBio13A (eBioscience). Fc–CSF1 is a fusion protein of pig CSF1 with the Fc region of pig IgG1A (43.82 kD total) that was produced using mammalian cell line expression by Zoetis for D. Hume (UK patent application GB1303537.1). CSF1 was conjugated to Fc for increased stability in vivo. Extensive experiments in mice and pigs reveal that pig CSF1 is equally active in mice (Gow et al., 2012). The presence of endotoxinlike activity in Fc–CSF1 was tested in murine BMderived Ms. There was no detectable induction of the LPSresponsive TNF gene under conditions in which LPS induced the gene >1,000fold. Mice were injected i.p. with 20 µg Fc–CSF1 in PBS. Where specified, mice were given 1 mg BrdU i.p. 3 h before the experimental end point.

Isolation of cells from the peritoneal and pleural cavity. Mice were sacrificed by exsanguination via the brachial artery under terminal anesthesia. After sacrifice, pleural or peritoneal cavity exudate cells were obtained by washing of the cavity with lavage media comprised of RPMI 1640 containing 2 mM lglutamine, 200 U/ml penicillin, 100 µg/ml streptomycin, and 2 mM EDTA (Invitrogen). The first 2 or 3 ml of lavage wash supernatant from the pleural or peritoneal cavities, respectively, was frozen before analysis by ELSIA. Worm burden in the pleural lavage fluid of Lsinfected mice was determined by counting under a stereomicroscope (MZ9; Leica). Erythrocytes were removed by incubating with red blood cell lysis buffer. Cellular content of the cavities and organs was assessed by cell counting using a Casy TT cell counter (Roche) in combination with multicolor flow cytometry.

Flow cytometry. Equal numbers of cells or 20 µl of blood was stained for each sample. Blood samples were mixed and washed with Hank’s buffered

Steadystate proliferation in naive animals was not influenced by IL4R signaling in mixed BM chimeric mice, LysMcreIl4ra/lox mice, or in global IL4R–deficient animals, demonstrating that IL4 mediates density of cavity Ms only under conditions of inflammation and not homeostasis. IL4R signaling also had little or no bearing on the wholly CSF1–dependent elevated proliferation of resident peritoneal Ms that occurs during resolution of microbialinduced peritonitis (Davies et al., 2013). In this process, however, proliferation acts simply to restore the M population to its original level after depletion during the acute stage of inflammation (Davies et al., 2011) and is therefore akin to homeostatic maintenance rather than an inflammatory process. In keeping with this, the levels of CSF1 did not differ between naive and inflammatorychallenged mice in this study (Davies et al., 2013). Elevated levels of circulating CSF1 do occur in many disease states, and administration of CSF1 can greatly increase tissue M numbers in rodents and primates (Hume and MacDonald, 2012), but it is unclear whether this increase results from the outgrowth of resident Ms or recruitment of new monocytederived cells. Using a recombinant Fc–CSF1 fusion protein, we demonstrate that CSF1 efficiently stimulates proliferation of resident peritoneal Ms (Fig. 7 A). Furthermore, during nematode infection, we detected an approximate doubling in the number of IL4R–deficient Ms in mixed BM chimeras (Fig. 5 A) and in global Il4ra/ mice (Fig. 3 B), mirroring the twofold increase in local CSF1 production (Fig. 4 B). Elevated CSF1 can therefore act during an inflammatory episode to increase local numbers of resident tissue Ms and could play a more significant role in expansion of resident Ms in pathologies in which much higher CSF1 levels are observed (Hamilton, 2008).

Although both IL4 and CSF1 elicited proliferation of resident Ms, they differed fundamentally in other actions. In particular, injection of Fc–CSF1 also induced recruitment of Ly6C+ monocytes and neutrophils, consistent with studies elsewhere (Lenda et al., 2003; Tagliani et al., 2011), suggesting elevated CSF1 secretion may act as an emergency stopgap to rapidly fill the tissue M compartment. In contrast, we saw no evidence of increased recruitment of inflammatory cells after IL4c administration and previously observed recruitment of only low numbers during the early stages of Ls infection despite the large increase in resident tissue Ms (Jenkins et al., 2011). CSF1R signaling directly induces production of CCR2 ligands by tissue Ms to stimulate recruitment of Ly6C+ monocytes (Tagliani et al., 2011), whereas IL4 downregulates M production of CCL2, CCL7, and CCL3 during tissue nematode infection (Thomas et al., 2012). Although the finding that IL4–mediated proliferation is CSF1R independent was at first unexpected, our data suggest that this mechanism may have developed as an alternative to a CSF1 pathway to increase numbers of resident Ms without coincident increase in monocyte recruitment. This could be seen as an additional tissueprotective function of IL4 beyond induction of the immunoregulatory and prowound repair phenotype associated with alternative activation (Murray and Wynn, 2011).

Dow




Article

2489

M purification and gene expression. Gene expression analysis on Ms from IL4c– or PBStreated mice was performed on mRNA for which we have previously published data (Rückerl et al., 2012). In brief, 24 h after treatment of mice with PBS or IL4c, peritoneal Ms were sorted using a FACSAria cell sorter (BD) according to their expression of F4/80+, SiglecF, CD11b+, CD11c, B220, CD3 to purities >90%. Total RNA was then isolated using the miRNEasy kit (QIAGEN) according to the manufacturer’s instructions, measured using a NanoDrop (Thermo Fisher Scientific), and converted to cDNA with BioScript reverse transcription (Bioline) and p(dT)15 primers (Roche). Expression levels were quantified using LightCycler 480 SYBR Green I Master (Roche), with measurements performed on a LightCycler 480 (Roche). Expression of Csf1r (5CGAGGGAGACTCCAGCTACA3 and 5GACTGGAGAAGCCACTGTCC3) was normalized against Gapdh (5ATGACATCAAGAAGGTGGTG3 and 5CATACCAGGAAATGAGCTTG3).

Statistics. Data were logtransformed to achieve normal distribution and equal variance where required and then tested using oneway ANOVA or Student’s t test. Where equal variance or normal distribution was not achieved, Kruskal Wallace or Spearman correlation was used. Paired Student’s t test was used to determine differences between proliferation and alternative activation of CD45.1+ and CD45.1 Ms obtained from Lsinfected competitive mixed BM chimeric mice. Statistics were performed using Prism 5 (GraphPad Software). Each data point represents one animal.

Online supplemental material. Fig. S1 shows that Ms in S phase express the highest levels of Ki67, such that gating on Ki67High cells provides an accurate estimate of their frequency and provides representative flow cytograms of Ki67, RELM, and Ym1 staining on peritoneal and pleural Ms at various times after IL4c injection. Fig. S2 shows the gating strategy used to determine frequency of M subsets from competitive mixed BM chimera experiments. Online supplemental material is available at http://www.jem.org/ cgi/content/full/jem.20121999/DC1.

We thank A. Fulton, S. Afrough, S. McGarvie, and E. Slattery for technical assistance and Dr. P. Taylor for critical reading of the manuscript.

This work was funded by the Medical Research Council UK (G0600818 and MR/K01207X/1 to J.E. Allen), with additional support from the Welcome Trust (strategic award for Centre for Immunity, Infection, and Evolution; 082611/Z/07/Z, PhD studentship to G.D. Thomas and grants to R.M. Maizels). F. Brombacher is a South African Research Chair holder supported by the National Research Foundation (South Africa) and South African Medical Research Council. D.A. Hume was supported by an Institute Strategic Programme Grant to the Roslin Institute from the Biotechnology and Biological Sciences Research Council (project grant BB/H012559/1).

The Fc–CSF-1 reagent is the subject of UK patent application GB1303537.1. The authors have no additional conflicting financial interests.

Submitted: 5 September 2012Accepted: 30 August 2013

REFERENCESAjami, B., J.L. Bennett, C. Krieger, W. Tetzlaff, and F.M. Rossi. 2007. Local self

renewal can sustain CNS microglia maintenance and function throughout adult life. Nat. Neurosci. 10:1538–1543. http://dx.doi.org/10.1038/ nn2014

Ajami, B., J.L. Bennett, C. Krieger, K.M. McNagny, and F.M. Rossi. 2011. Infiltrating monocytes trigger EAE progression, but do not contribute to the resident microglia pool. Nat. Neurosci. 14:1142–1149. http://dx.doi .org/10.1038/nn.2887

Alikhan, M.A., C.V. Jones, T.M. Williams, A.G. Beckhouse, A.L. Fletcher, M.M. Kett, S. Sakkal, C.S. Samuel, R.G. Ramsay, J.A. Deane, et al. 2011. Colonystimulating factor1 promotes kidney growth and repair via alteration of macrophage responses. Am. J. Pathol. 179:1243–1256. http://dx .doi.org/10.1016/j.ajpath.2011.05.037

Aziz, A., E. Soucie, S. Sarrazin, and M.H. Sieweke. 2009. MafB/cMaf deficiency enables selfrenewal of differentiated functional macrophages. Science. 326:867–871. http://dx.doi.org/10.1126/science.1176056

saline solution containing 2 mM EDTA (Invitrogen). Cells were stained with LIVE/DEAD (Invitrogen). All samples were then blocked with 5 µg/ml antiCD16/32 (2.4G2; produced inhouse) and heatinactivated normal mouse serum (1:20) in FACS buffer (0.5% BSA and 2 mM EDTA in Dulbecco’s PBS) before surface staining on ice with antibodies to F4/80 (BM8), SiglecF (E502440), Ly6C (AL21 or HK1.4), Gr1 (RB68C5), CD11b (M1/70), CD11c (N418), MHCII (M5/114.15.2), CD19 (eBio1D3), CD4 (GK1.5), CD3 (17A2), CD115 (AFS98), IL4R (mIL4RM1), CD45.1 (A20), or CD45.2 (104; eBioscience or BD). Erythrocytes in blood samples were lysed using FACS Lyse solution (BD).

Detection of intracellular RELM, Ym1, Ki67, and BrdU was performed directly ex vivo. Cells were stained for surface markers then fixed and permeabilized using FoxP3 staining buffer set (eBioscience). For BrdU staining, cells were incubated first with or without DNase for 30 min at 37°C. Cells were then stained with biotinylated goat antiYm1 (R&D Systems), purified polyclonal rabbit antiRELM (PeproTech), or directly labeled mAbs to Ki67 (B57) or antiBrdU (B44 or Bu20a; BD or BioLegend), followed by Zenon anti–rabbit reagent (Invitrogen) or streptavidinconjugated fluorochromes (BioLegend). Expression of Ym1, RELM, and Ki67 was determined relative to appropriate polyclonal or monoclonal isotype control, whereas incorporation of BrdU was determined relative to staining on nonDNase–treated cells. Analysis of proliferation and alternative activation was performed on single live cells, determined using LIVE/DEAD and forward scatter (FSC) width (FSCW) versus FSC area (FSCA), respectively, and subsequently gated on CD19 cells to remove B cell–M doublets. Analysis for calculation of total F4/80High Ms was performed on all cells. Samples were acquired using FACS LSRII or FACSCanto II using FACSDiva software (BD) and analyzed with FlowJo version 9 software (Tree Star).

Analysis of Ms from competitive mixed BM chimeras. Ms derived from Cd45.1+Il4ra+/+ BM appeared to have a greater tendency to form doublets with CD19+ B cells after injection of IL4c than cells derived from Cd45.1Il4ra/ BM, as judged by the high level of F4/80 expression on B cell–M doublets (Fig. S2 A), a marker which is known to be upregulated by IL4R signaling (Jenkins et al., 2011). If doublets were excluded from analysis, such bias in doublet formation would distort the ratio of WT to Il4ra/ Ms. Thus, cells were treated for 5 min with Accumax cell aggregate dissociation medium (eBioscience) immediately before fixation, and population frequency analysis was performed without a single cell gate applied. To further prevent bias induced by the few remaining doublets, the gate for CD45.1+ CD45.2+ cells was set to exclude events that deviated from the expected linear relationship of CD45.1 and CD45.2 on this population (Fig. S2 B, R1). Analysis of proliferation and alternative activation in these experiments was performed on CD19F4/80High Ms gated on single cells, using FSCW versus FSCA, to minimize the potential for false positives (Fig. S2 B, R2). Because of a minor bias toward more WT than Il4ra/ pleural Ms in naive chimeras, oneway ANOVA was used to analyze differences in cell numbers after infection, whereas paired statistical tests were used to analyze rates of proliferation and alternative activation, to better account for the variation in overall level of proliferation between mice.

CSF1R experiments. Mice were injected i.p. with 0.5 mg antiCSF1R mAb (clone AFS98), purified rat IgG control antibody, or PBS vehicle control either concurrent with IL4c injections or on day 8 after Ls infection or day 6 after Hp infection. AFS98 mAb and purified rat IgG control were produced inhouse from cultured hybridoma cells or from naive rat serum, respectively. The cfms kinase inhibitor GW2580 (LC Laboratories; Conway et al., 2005) was suspended in 0.5% hydroxypropylmethylcellulose and 0.1% Tween 20 using a Teflon glass homogenizer. Diluent control or 160 mg/kg GW2580 was administered daily by oral gavage from 1 h before initial dose of IL4c on day 0 to 5 h before mice were culled on day 3. Previous pharmacokinetic analysis has shown this daily dose regimen is as effective as twice daily administration of 80 mg/kg and maintains a serum concentration of the drug over 24 h above that estimated to achieve therapeutic effect (Priceman et al., 2010). Analysis of CSF1 in brachial arterial blood and pleural lavage fluid was performed according to the manufacturer’s instruction (PeproTech).

Dow





http://dx.doi.org/10.1038/nn2014

http://dx.doi.org/10.1038/nn2014

http://dx.doi.org/10.1038/nn.2887

http://dx.doi.org/10.1038/nn.2887

http://dx.doi.org/10.1016/j.ajpath.2011.05.037

http://dx.doi.org/10.1016/j.ajpath.2011.05.037

http://dx.doi.org/10.1126/science.1176056



by CSF1 and Interleukin 34. Cytokine. 60:793–805. http://dx.doi.org/ 10.1016/j.cyto.2012.08.008

Hamilton, J.A. 2008. Colonystimulating factors in inflammation and autoimmunity. Nat. Rev. Immunol. 8:533–544. http://dx.doi.org/10.1038/nri2356

Hashimoto, D., A. Chow, C. Noizat, P. Teo, M.B. Beasley, M. Leboeuf, C.D. Becker, P. See, J. Price, D. Lucas, et al. 2013. Tissueresident macrophages selfmaintain locally throughout adult life with minimal contribution from circulating monocytes. Immunity. 38:792–804. http://dx.doi.org/ 10.1016/j.immuni.2013.04.004

Heller, N.M., X. Qi, I.S. Junttila, K.A. Shirey, S.N. Vogel, W.E. Paul, and A.D. Keegan. 2008. Type I IL4Rs selectively activate IRS2 to induce target gene expression in macrophages. Sci. Signal. 1:ra17. http://dx.doi.org/ 10.1126/scisignal.1164795

Herbert, D.R., C. Hölscher, M. Mohrs, B. Arendse, A. Schwegmann, M. Radwanska, M. Leeto, R. Kirsch, P. Hall, H. Mossmann, et al. 2004. Alternative macrophage activation is essential for survival during schistosomiasis and downmodulates T helper 1 responses and immunopathology. Immunity. 20:623–635. http://dx.doi.org/10.1016/S10747613 (04)001074

Hume, D.A. 2011. Applications of myeloidspecific promoters in transgenic mice support in vivo imaging and functional genomics but do not support the concept of distinct macrophage and dendritic cell lineages or roles in immunity. J. Leukoc. Biol. 89:525–538. http://dx.doi.org/10 .1189/jlb.0810472

Hume, D.A., and K.P. MacDonald. 2012. Therapeutic applications of macrophage colonystimulating factor1 (CSF1) and antagonists of CSF1 receptor (CSF1R) signaling. Blood. 119:1810–1820. http://dx.doi.org/10 .1182/blood201109379214

Hume, D.A., P. Pavli, R.E. Donahue, and I.J. Fidler. 1988. The effect of human recombinant macrophage colonystimulating factor (CSF1) on the murine mononuclear phagocyte system in vivo. J. Immunol. 141:3405–3409.

Huynh, J., M.Q. Kwa, A.D. Cook, J.A. Hamilton, and G.M. Scholz. 2012. CSF1 receptor signalling from endosomes mediates the sustained activation of Erk1/2 and Akt in macrophages. Cell. Signal. 24:1753–1761. http://dx.doi.org/10.1016/j.cellsig.2012.04.022

Irvine, K.M., C.J. Burns, A.F. Wilks, S. Su, D.A. Hume, and M.J. Sweet. 2006. A CSF1 receptor kinase inhibitor targets effector functions and inhibits proinflammatory cytokine production from murine macrophage populations. FASEB J. 20:1921–1923. http://dx.doi.org/10.1096/ fj.065848fje

Jenkins, S.J., and J.E. Allen. 2010. Similarity and diversity in macrophage activation by nematodes, trematodes, and cestodes. J. Biomed. Biotechnol. 2010:262609. http://dx.doi.org/10.1155/2010/262609

Jenkins, S.J., D. Ruckerl, P.C. Cook, L.H. Jones, F.D. Finkelman, N. van Rooijen, A.S. MacDonald, and J.E. Allen. 2011. Local macrophage proliferation, rather than recruitment from the blood, is a signature of TH2 inflammation. Science. 332:1284–1288. http://dx.doi.org/10 .1126/science.1204351

Kanitakis, J., P. Petruzzo, and J.M. Dubernard. 2004. Turnover of epidermal Langerhans’ cells. N. Engl. J. Med. 351:2661–2662. http://dx.doi.org/ 10.1056/NEJM200412163512523

Karp, C.L., and P.J. Murray. 2012. Noncanonical alternatives: What a macrophage is 4. J. Exp. Med. 209:427–431. http://dx.doi.org/10.1084/ jem.20120295

Klein, I., J.C. Cornejo, N.K. Polakos, B. John, S.A. Wuensch, D.J. Topham, R.H. Pierce, and I.N. Crispe. 2007. Kupffer cell heterogeneity: functional properties of bone marrow derived and sessile hepatic macrophages. Blood. 110:4077–4085. http://dx.doi.org/10.1182/blood200702073841

Landberg, G., E.M. Tan, and G. Roos. 1990. Flow cytometric multiparameter analysis of proliferating cell nuclear antigen/cyclin and Ki67 antigen: a new view of the cell cycle. Exp. Cell Res. 187:111–118. http://dx.doi.org/ 10.1016/00144827(90)90124S

Le Goff, L., T.J. Lamb, A.L. Graham, Y. Harcus, and J.E. Allen. 2002. IL4 is required to prevent filarial nematode development in resistant but not susceptible strains of mice. Int. J. Parasitol. 32:1277–1284. http://dx.doi.org/ 10.1016/S00207519(02)00125X

Lenda, D.M., E. Kikawada, E.R. Stanley, and V.R. Kelley. 2003. Reduced macrophage recruitment, proliferation, and activation in

Behnke, J.M., and D. Wakelin. 1977. Nematospiroides dubius: stimulation of acquired immunity in inbred strains of mice. J. Helminthol. 51:167–176. http://dx.doi.org/10.1017/S0022149X0000746X

Bunting, K.D., W.M. Yu, H.L. Bradley, E. Haviernikova, A.E. KellyWelch, A.D. Keegan, and C.K. Qu. 2004. Increased numbers of committed myeloid progenitors but not primitive hematopoietic stem/progenitors in mice lacking STAT6 expression. J. Leukoc. Biol. 76:484–490. http://dx.doi .org/10.1189/jlb.0903440

Chensue, S.W., K.S. Warmington, J.H. Ruth, P.S. Sanghi, P. Lincoln, and S.L. Kunkel. 1996. Role of monocyte chemoattractant protein1 (MCP1) in Th1 (mycobacterial) and Th2 (schistosomal) antigeninduced granuloma formation: relationship to local inflammation, Th cell expression, and IL12 production. J. Immunol. 157:4602–4608.

Chitu, V., and E.R. Stanley. 2006. Colonystimulating factor1 in immunity and inflammation. Curr. Opin. Immunol. 18:39–48. http://dx.doi.org/ 10.1016/j.coi.2005.11.006

Chorro, L., A. Sarde, M. Li, K.J. Woollard, P. Chambon, B. Malissen, A. Kissenpfennig, J.B. Barbaroux, R. Groves, and F. Geissmann. 2009. Langerhans cell (LC) proliferation mediates neonatal development, homeostasis, and inflammationassociated expansion of the epidermal LC network. J. Exp. Med. 206:3089–3100. http://dx.doi.org/10.1084/jem .20091586

Conway, J.G., B. McDonald, J. Parham, B. Keith, D.W. Rusnak, E. Shaw, M. Jansen, P. Lin, A. Payne, R.M. Crosby, et al. 2005. Inhibition of colonystimulatingfactor1 signaling in vivo with the orally bioavailable cFMS kinase inhibitor GW2580. Proc. Natl. Acad. Sci. USA. 102:16078–16083. http://dx.doi.org/10.1073/pnas.0502000102

Dai, X.M., G.R. Ryan, A.J. Hapel, M.G. Dominguez, R.G. Russell, S. Kapp, V. Sylvestre, and E.R. Stanley. 2002. Targeted disruption of the mouse colonystimulating factor 1 receptor gene results in osteopetrosis, mononuclear phagocyte deficiency, increased primitive progenitor cell frequencies, and reproductive defects. Blood. 99:111–120. http://dx.doi.org/ 10.1182/blood.V99.1.111

Davies, L.C., M. Rosas, P.J. Smith, D.J. Fraser, S.A. Jones, and P.R. Taylor. 2011. A quantifiable proliferative burst of tissue macrophages restores homeostatic macrophage populations after acute inflammation. Eur. J. Immunol. 41:2155–2164. http://dx.doi.org/10.1002/eji.201141817

Davies, L.C., M. Rosas, S.J. Jenkins, C.T. Liao, M.J. Scurr, F. Brombacher, D.J. Fraser, J.E. Allen, S.A. Jones, and P.R. Taylor. 2013. Distinct bone marrowderived and tissueresident macrophage lineages proliferate at key stages during inflammation. Nat. Commun. 4:1886. http://dx.doi.org/10 .1038/ncomms2877

DeNardo, D.G., J.B. Barreto, P. Andreu, L. Vasquez, D. Tawfik, N. Kolhatkar, and L.M. Coussens. 2009. CD4(+) T cells regulate pulmonary metastasis of mammary carcinomas by enhancing protumor properties of macrophages. Cancer Cell. 16:91–102. http://dx.doi.org/10.1016/j.ccr.2009.06.018

Dewals, B.G., R.G. Marillier, J.C. Hoving, M. Leeto, A. Schwegmann, and F. Brombacher. 2010. IL4Ralphaindependent expression of mannose receptor and Ym1 by macrophages depends on their IL10 responsiveness. PLoS Negl. Trop. Dis. 4:e689. http://dx.doi.org/10.1371/journal .pntd.0000689

Finkelman, F.D., K.B. Madden, S.C. Morris, J.M. Holmes, N. Boiani, I.M. Katona, and C.R. Maliszewski. 1993. Anticytokine antibodies as carrier proteins. Prolongation of in vivo effects of exogenous cytokines by injection of cytokineanticytokine antibody complexes. J. Immunol. 151:1235–1244.

Fleetwood, A.J., T. Lawrence, J.A. Hamilton, and A.D. Cook. 2007. Granulocytemacrophage colonystimulating factor (CSF) and macrophage CSFdependent macrophage phenotypes display differences in cytokine profiles and transcription factor activities: implications for CSF blockade in inflammation. J. Immunol. 178:5245–5252.

Gordon, S., and F.O. Martinez. 2010. Alternative activation of macrophages: mechanism and functions. Immunity. 32:593–604. http://dx.doi .org/10.1016/j.immuni.2010.05.007

Gow, D.J., V. Garceau, R. Kapetanovic, D.P. Sester, G.J. Fici, J.A. Shelly, T.L. Wilson, and D.A. Hume. 2012. Cloning and expression of porcine Colony Stimulating Factor1 (CSF1) and Colony Stimulating Factor1 Receptor (CSF1R) and analysis of the species specificity of stimulation

Dow



http://dx.doi.org/10.1016/j.cyto.2012.08.008

http://dx.doi.org/10.1016/j.cyto.2012.08.008

http://dx.doi.org/10.1038/nri2356

http://dx.doi.org/10.1016/j.immuni.2013.04.004


http://dx.doi.org/10.1126/scisignal.1164795

http://dx.doi.org/10.1126/scisignal.1164795

http://dx.doi.org/10.1016/S1074-7613(04)00107-4

http://dx.doi.org/10.1016/S1074-7613(04)00107-4

http://dx.doi.org/10.1189/jlb.0810472


http://dx.doi.org/10.1182/blood-2011-09-379214


http://dx.doi.org/10.1016/j.cellsig.2012.04.022

http://dx.doi.org/10.1096/fj.06-5848fje

http://dx.doi.org/10.1096/fj.06-5848fje

http://dx.doi.org/10.1155/2010/262609



http://dx.doi.org/10.1056/NEJM200412163512523

http://dx.doi.org/10.1056/NEJM200412163512523

http://dx.doi.org/10.1084/jem.20120295



http://dx.doi.org/10.1016/0014-4827(90)90124-S

http://dx.doi.org/10.1016/0014-4827(90)90124-S

http://dx.doi.org/10.1016/S0020-7519(02)00125-X

http://dx.doi.org/10.1016/S0020-7519(02)00125-X

http://dx.doi.org/10.1017/S0022149X0000746X



http://dx.doi.org/10.1016/j.coi.2005.11.006

http://dx.doi.org/10.1016/j.coi.2005.11.006



http://dx.doi.org/10.1073/pnas.0502000102

http://dx.doi.org/10.1182/blood.V99.1.111

http://dx.doi.org/10.1182/blood.V99.1.111

http://dx.doi.org/10.1002/eji.201141817

http://dx.doi.org/10.1038/ncomms2877

http://dx.doi.org/10.1038/ncomms2877

http://dx.doi.org/10.1016/j.ccr.2009.06.018

http://dx.doi.org/10.1371/journal.pntd.0000689

http://dx.doi.org/10.1371/journal.pntd.0000689




Article

2491

murine macrophage proliferation in vivo. Blood. 120:2307–2316. http://dx.doi.org/10.1182/blood201202408252

Schulz, C., E. Gomez Perdiguero, L. Chorro, H. SzaboRogers, N. Cagnard, K. Kierdorf, M. Prinz, B. Wu, S.E. Jacobsen, J.W. Pollard, et al. 2012. A lineage of myeloid cells independent of Myb and hematopoietic stem cells. Science. 336:86–90. http://dx.doi.org/10.1126/science.1219179

Smith, J.L., A.E. Schaffner, J.K. Hofmeister, M. Hartman, G. Wei, D. Forsthoefel, D.A. Hume, and M.C. Ostrowski. 2000. ets2 is a target for an akt (Protein kinase B)/jun Nterminal kinase signaling pathway in macrophages of motheatenviable mutant mice. Mol. Cell. Biol. 20:8026–8034. http://dx.doi.org/10.1128/MCB.20.21.80268034.2000

Tagliani, E., C. Shi, P. Nancy, C.S. Tay, E.G. Pamer, and A. Erlebacher. 2011. Coordinate regulation of tissue macrophage and dendritic cell population dynamics by CSF1. J. Exp. Med. 208:1901–1916. http://dx.doi.org/ 10.1084/jem.20110866

Thomas, G.D., D. Rückerl, B.H. Maskrey, P.D. Whitfield, M.L. Blaxter, and J.E. Allen. 2012. The biology of nematode and IL4Rdependent murine macrophage polarization in vivo as defined by RNASeq and targeted lipidomics. Blood. 120:e93–e104. http://dx.doi.org/10.1182/ blood201207442640

Tushinski, R.J., I.T. Oliver, L.J. Guilbert, P.W. Tynan, J.R. Warner, and E.R. Stanley. 1982. Survival of mononuclear phagocytes depends on a lineagespecific growth factor that the differentiated cells selectively destroy. Cell. 28:71–81. http://dx.doi.org/10.1016/00928674(82)903762

Ulich, T.R., J. del Castillo, L.R. Watson, S.M. Yin, and M.B. Garnick. 1990. In vivo hematologic effects of recombinant human macrophage colonystimulating factor. Blood. 75:846–850.

Vats, D., L. Mukundan, J.I. Odegaard, L. Zhang, K.L. Smith, C.R. Morel, R.A. Wagner, D.R. Greaves, P.J. Murray, and A. Chawla. 2006. Oxidative metabolism and PGC1beta attenuate macrophagemediated inflammation. Cell Metab. 4:13–24. (published erratum appears in Cell Metab. 2006. 4:255) http://dx.doi.org/10.1016/j.cmet.2006.05.011

Verreck, F.A., T. de Boer, D.M. Langenberg, M.A. Hoeve, M. Kramer, E. Vaisberg, R. Kastelein, A. Kolk, R. de WaalMalefyt, and T.H. Ottenhoff. 2004. Human IL23producing type 1 macrophages promote but IL10producing type 2 macrophages subvert immunity to (myco)bacteria. Proc. Natl. Acad. Sci. USA. 101:4560–4565. http://dx.doi.org/10.1073/ pnas.0400983101

Volkman, A., N.C. Chang, P.H. Strausbauch, and P.S. Morahan. 1983. Differential effects of chronic monocyte depletion on macrophage populations. Lab. Invest. 49:291–298.

Wermeling, F., R.M. Anthony, F. Brombacher, and J.V. Ravetch. 2013. Acute inflammation primes myeloid effector cells for antiinflammatory STAT6 signaling. Proc. Natl. Acad. Sci. USA. 110:13487–13491. http://dx.doi.org/10.1073/pnas.1312525110

Wu, D., A.B. Molofsky, H.E. Liang, R.R. RicardoGonzalez, H.A. Jouihan, J.K. Bando, A. Chawla, and R.M. Locksley. 2011. Eosinophils sustain adipose alternatively activated macrophages associated with glucose homeostasis. Science. 332:243–247. http://dx.doi.org/10.1126/ science.1201475

Wurster, A.L., V.L. Rodgers, M.F. White, T.L. Rothstein, and M.J. Grusby. 2002. Interleukin4mediated protection of primary B cells from apoptosis through Stat6dependent upregulation of BclxL. J. Biol. Chem. 277:27169–27175. http://dx.doi.org/10.1074/jbc.M201207200

Yona, S., K.W. Kim, Y. Wolf, A. Mildner, D. Varol, M. Breker, D. StraussAyali, S. Viukov, M. Guilliams, A. Misharin, et al. 2013. Fate mapping reveals origins and dynamics of monocytes and tissue macrophages under homeostasis. Immunity. 38:79–91. http://dx.doi.org/10 .1016/j.immuni.2012.12.001

colonystimulating factor1deficient mice results in decreased tubular apoptosis during renal inflammation. J. Immunol. 170:3254–3262.

Liao, X., N. Sharma, F. Kapadia, G. Zhou, Y. Lu, H. Hong, K. Paruchuri, G.H. Mahabeleshwar, E. Dalmas, N. Venteclef, et al. 2011. Krüppellike factor 4 regulates macrophage polarization. J. Clin. Invest. 121:2736–2749. http://dx.doi.org/10.1172/JCI45444

Linde, N., W. Lederle, S. Depner, N. van Rooijen, C.M. Gutschalk, and M.M. Mueller. 2012. Vascular endothelial growth factorinduced skin carcinogenesis depends on recruitment and alternative activation of macrophages. J. Pathol. 227:17–28. http://dx.doi.org/10.1002/path.3989

Loke, P., I. Gallagher, M.G. Nair, X. Zang, F. Brombacher, M. Mohrs, J.P. Allison, and J.E. Allen. 2007. Alternative activation is an innate response to injury that requires CD4+ T cells to be sustained during chronic infection. J. Immunol. 179:3926–3936.

Lu, B., B.J. Rutledge, L. Gu, J. Fiorillo, N.W. Lukacs, S.L. Kunkel, R. North, C. Gerard, and B.J. Rollins. 1998. Abnormalities in monocyte recruitment and cytokine expression in monocyte chemoattractant protein 1deficient mice. J. Exp. Med. 187:601–608. http://dx.doi.org/10.1084/ jem.187.4.601

MacDonald, K.P., J.S. Palmer, S. Cronau, E. Seppanen, S. Olver, N.C. Raffelt, R. Kuns, A.R. Pettit, A. Clouston, B. Wainwright, et al. 2010. An antibody against the colonystimulating factor 1 receptor depletes the resident subset of monocytes and tissue and tumorassociated macrophages but does not inhibit inflammation. Blood. 116:3955–3963. http://dx.doi.org/ 10.1182/blood201002266296

Martinez, F.O., S. Gordon, M. Locati, and A. Mantovani. 2006. Transcriptional profiling of the human monocytetomacrophage differentiation and polarization: new molecules and patterns of gene expression. J. Immunol. 177:7303–7311.

Mohrs, K., D.P. Harris, F.E. Lund, and M. Mohrs. 2005. Systemic dissemination and persistence of Th2 and type 2 cells in response to infection with a strictly enteric nematode parasite. J. Immunol. 175:5306–5313.

Murphy, J., R. Summer, A.A. Wilson, D.N. Kotton, and A. Fine. 2008. The prolonged lifespan of alveolar macrophages. Am. J. Respir. Cell Mol. Biol. 38:380–385. http://dx.doi.org/10.1165/rcmb.20070224RC

Murray, P.J., and T.A. Wynn. 2011. Protective and pathogenic functions of macrophage subsets. Nat. Rev. Immunol. 11:723–737. http://dx.doi.org/ 10.1038/nri3073

Nguyen, K.D., Y. Qiu, X. Cui, Y.P. Goh, J. Mwangi, T. David, L. Mukundan, F. Brombacher, R.M. Locksley, and A. Chawla. 2011. Alternatively activated macrophages produce catecholamines to sustain adaptive thermogenesis. Nature. 480:104–108. http://dx.doi.org/10.1038/nature10653

NobenTrauth, N., G. Köhler, K. Bürki, and B. Ledermann. 1996. Efficient targeting of the IL4 gene in a BALB/c embryonic stem cell line. Transgenic Res. 5:487–491. http://dx.doi.org/10.1007/BF01980214

Pello, O.M., M. De Pizzol, M. Mirolo, L. Soucek, L. Zammataro, A. Amabile, A. Doni, M. Nebuloni, L.B. Swigart, G.I. Evan, et al. 2012. Role of cMYC in alternative activation of human macrophages and tumorassociated macrophage biology. Blood. 119:411–421. http://dx.doi.org/ 10.1182/blood201102339911

Priceman, S.J., J.L. Sung, Z. Shaposhnik, J.B. Burton, A.X. TorresCollado, D.L. Moughon, M. Johnson, A.J. Lusis, D.A. Cohen, M.L. IruelaArispe, and L. Wu. 2010. Targeting distinct tumorinfiltrating myeloid cells by inhibiting CSF1 receptor: combating tumor evasion of antiangiogenic therapy. Blood. 115:1461–1471. http://dx.doi.org/10.1182/blood 200908237412

Rückerl, D., S.J. Jenkins, N.N. Laqtom, I.J. Gallagher, T.E. Sutherland, S. Duncan, A.H. Buck, and J.E. Allen. 2012. Induction of IL4Rdependent microRNAs identifies PI3K/Akt signaling as essential for IL4driven

Dow






http://dx.doi.org/10.1128/MCB.20.21.8026-8034.2000





http://dx.doi.org/10.1016/0092-8674(82)90376-2

http://dx.doi.org/10.1016/j.cmet.2006.05.011







http://dx.doi.org/10.1074/jbc.M201207200



http://dx.doi.org/10.1172/JCI45444

http://dx.doi.org/10.1002/path.3989

http://dx.doi.org/10.1084/jem.187.4.601

http://dx.doi.org/10.1084/jem.187.4.601



http://dx.doi.org/10.1165/rcmb.2007-0224RC



http://dx.doi.org/10.1038/nature10653

http://dx.doi.org/10.1007/BF01980214





IL-4 directly signals tissue-resident macrophages to ...

Documents

Transcript of IL-4 directly signals tissue-resident macrophages to ...