Identification of Unknown Bacteria Extracted from Flagstaff, AZ

Identification of Unknown Bacteria Extracted from Flagstaff, Arizona

Victoria Ziegler

BIO 205L Section E

Dannielle Jensen

November 3, 2014

Identification of Unknown Bacteria

INTRODUCTION

Bacteria affect soil fertility and how good of a source for antibiotics, herbicides,

and insecticides soil can be. Therefore, research on how to identify these microorganisms

is necessary because there are not many methods on how to categorize bacteria.

Microorganisms are the most diverse organisms on Earth, ranging from 10,000 to

10,000,000 species of bacteria in one single gram of soil (Fierer 2007). There are still

many bacterial species that are unknown; therefore we are far from having a complete

knowledge of bacteriology (Busse 1996). In the past, microbiologists have studied

bacterial strains grown in a laboratory, which created a huge barrier between finding

actual environmental bacteria outside of the laboratory (Fierer 2007). Now, bacteria can

be extracted from nature outside of the lab and identified through various stains,

biochemical tests, and the observation of morphological growth plates.

Bacteria are huge influences on soil and therefore how plants and animals sustain

life. Microorganisms are easily spread from soil to humans, plants, and animals through

touch and consumption of food grown from the ground. There are millions of different

species of bacteria in soil, and one simple pathogenic bacteria can easily be transferred to

any living thing and infect that host. The soil environment contains a heterogeneous

habitat, which allows many the many different types of microorganisms to co-exist. The

living creatures that are constantly around and touching the soil directly affect the soil’s

properties and how it functions (Bardgett 2002).

2


The overall objective is to isolate unknown bacteria from a cotton swab sample

taken from a twig in the soil of Flagstaff, Arizona. In the past it has been difficult to

define and approach every bacteria found with a specific identity or theory, due to the

spatial scale diversity of all microbes (Prosser 2007). To obtain this information one must

extract a substance from the environment and isolate a single species of bacteria from that

substance. The bacteria used in this study was extracted from a twig found in the soil of

Flagstaff, Arizona to attempt to isolate, characterize, and identify the bacteria. Through

the purification and isolation of the samples taken from Flagstaff, the specific genus and

species of the extracted unknown bacteria will be identified.

MATERIALS AND METHODS

The isolate was collected by a cotton swab sample taken from a twig in the soil of

Flagstaff, Arizona and was transferred onto a trypticase soy agar (TSA) plate. For the

next few months, the bacteria were transferred from the TSA plate using a sterile loop

and spread onto another TSA plate in order to purify the specimen. 2 isolation streaks

were performed to get a purified bacteria plate, then was streaked 9 more times

throughout the experiment to ensure a pure and fresh culture for each stain and

biochemical procedure.

A wet mount was performed to observe living bacteria in the isolation process. A

small portion of the culture was taken from the purified TSA plate and put onto a slide.

The bacteria were then immersed in water then covered with a slide cover. The slide was

3


quickly viewed under 10X objective lens, 40X objective lens, and 100X objective lens

with oil immersion using phase contrast illumination.

The following stains used many common procedures. All of the stains, besides the

capsule stain, were dry mounted and heat-fixed. All of the stains were viewed under 10X

objective lens, 40X objective lens, and 100X objective lens with oil immersion using

bright field illumination.

A simple stain was performed to observe the morphology of the organism. A

portion of the organism was extracted from a TSA plate and stained with methylene blue.

Bacillus megaterium was used as a control and displayed a rod-shaped organism. The

slide was viewed to potentially display blue rod-shaped or cocci cells.

A Gram stain was performed to determine whether the extracted bacteria were

Gram positive or negative. B. megaterium and Staphylococcus epidermidis were used as

positive controls while Escherichia coli was used as the negative control. The organism

media was trypticase soy agar and was covered with crystal violet. After the slide was

rinsed with distilled water, it was then covered with Gram’s iodine. In order to decolorize

the Gram-negative cells, the slide was rinsed with 70% ethanol followed by distilled

water. To make the Gram-negative cells visible and distinguishable from the Gram-

positive cells, safranin was added to the slide then rinsed with water. A positive result

will display purple cells, while a negative result will show pink cells representing its

pathogenicity.

A capsule stain is a differential stain that was performed to determine if the cells

are able to form an extracellular capsule. Klebsiella pneumoniae was used as a positive

4


control. The cells were mixed in a trypticase soy broth and emulsified in Congo red.

Maneval’s stain was added after the Congo red air dried, then was rinsed and viewed.

An acid-fast stain is a differential stain and was performed to detect which cells

are able to retain a primary stain when treated with acid alcohol. The positive control

used was Mycobacterium smegmatis with B. megaterium as its negative control. The

media used was trypticase soy broth for the B. megaterium. The organisms were covered

with filter paper held by a clothespin. The slide was saturated with carbol fuchsin and

heated over a flame until it steamed and evaporated. As the paper would dry out, more

carbol fuchsin was added. Once a film was formed, the paper was removed and the slide

was rinsed with distilled water, decolorized with acid alcohol, and rinsed once more with

distilled water. The slide lastly was covered with methylene blue then rinsed to view

using bright field illumination. If the bacteria were not acid-fast, the slide would display

blue cells. If pink cells were present, these cells were pathogens and were acid-fast.

An endospore stain is a differential stain and was performed for the observation of

spores. A TSA stress plate contained the bacteria and was used with a control plate of B.

megaterium. The organism was covered with filter paper attached to the slide with a

clothespin. The slide was then saturated with malachite green and heated over a flame

until it began to steam. Malachite green was added as the metallic sheen formed, and the

paper seemed dried out. After the paper was removed, the slide was rinsed with distilled

water and covered with safranin. Pink cells should have been observed in the slide with

green spores for a positive result.

A catalase biochemical test was used to test for the presence of the catalase

enzyme. A portion of the environmental unknown was taken from an agar slant and

5


placed on a glass slide, then mixed with a drop of 3% H2O2. A positive test showed gas

bubbles, while the presence of no bubbles would have been a negative test.

An oxidase test was performed to determine if the cytochrome oxidase enzyme

was present. Pseudomonas aeruginosa was used as the positive control. A commercially

prepared test called a dry slide containing four separate windows impregnated with p-

phenylendiamine was used. A plastic Steri-loop was used to take some of the unknown

bacteria and spread onto one window of the test paper. After twenty seconds the results

were clear. For a positive test the tube turned purple, although for a negative test no color

change happened.

A carbohydrate fermentation test was performed to see if the bacteria had the

ability to ferment glucose, sucrose, lactose, and mannose. Four tubes were used and each

one contained a different sugar, a pH indicator phenol red, and a Durham tube. Some of

the environmental unknown was inoculated into each of the tubes and observed after

twenty-four and forty-eight hours. A positive test resulted in the liquid turning yellow

while a negative test had no color or was dark red/pink. The test could have also

produced gas in the Durham tubes.

The bacteria were tested to find out what their oxygen requirements were. The

bacteria could have potentially been an obligate aerobe, obligate anaerobe, facultative

anaerobe, microaerophile, or aerotolerant/indifferent. A Thioglycollate tube was used, as

long as less than 25% of the liquid in the tube was pink, which indicated oxygen was

already present. The tube was inoculated with the environmental unknown and then left

at room temperature for forty-eight hours. If there was dense growth at only the top of the

tube, the organism would have been an obligate anaerobe. If there was growth at only at

6


the bottom of the tube, then the organism would have been an obligate aerobe. If there

was growth throughout the whole tube but with more focused at the top, it would have

been a facultative anaerobe. If there was growth only at the top of the tube, but it became

denser the lower it went in the tube, it was a microaerophile. If there was growth

throughout the whole tube, the organism was indifferent or aerotolerant.

The bacteria were tested to see if they could reduce nitrate into nitrite through

anaerobic respiration. A tube of nitrate broth containing a Durham tube was inoculated

with a loop full of the environmental unknown. The tube was then incubated for twenty-

four to forty-eight hours, or until growth appeared. The tube was then refrigerated for the

remainder of the week, then observed after the full seven days since the inoculation. If

gas was observed the test was positive. If no gas was observed then ten to fifteen drops of

Nitrite A and Nitrite B reagents were added to the tube. If the culture became red after

fifteen minutes, the test would prove positive for nitrite and therefore nitrate reduction. If

a color change still did not happen, a small amount of zinc powder was added to the tube.

If there was nitrate in the tube, it meant that Nitrite A and Nitrite B were already present.

The zinc powder would have reacted to the nitrate and therefore turned the solution red

after fifteen minutes. If the test turned red, the environmental was nitrite negative. If there

was still no color change, the nitrate was reduced to ammonia or nitrogen gas and was

therefore positive for nitrate reduction.

A motility test was then use to observe if the bacteria had flagellum. A bacteria

that is motile could be monotrichous, lophotrichous, amphitrichous, or peritrichous. A

tube of motility medium was inoculated using a needle rather than a loop full of the

environmental unknown. In order to inoculate the motility medium, the bacteria infected

7


needle was stabbed into the medium about two-thirds of its depth. After an incubation

period of twenty-four to forty-eight hours at room temperature, a positive test showed red

cloudiness around the stab pathway, but a negative test showed red only in the area of the

stab.

The Simmons citrate test was performed to see if the bacteria could transport

citrate and used it as its only carbon source. It also tested the pH of the organism. A

needle was used to transfer some of the environmental unknown into the agar, and then

was streaked up the agar in a zigzag fashion. The tube was then incubated at room

temperature for twenty-four to forty-eight hours, or until a color change was present. If

the agar turned from dark green to royal blue, the test was positive and the pH was above

7.6. If the agar had no color change, it was a negative result.

A urea hydrolysis test was performed to observe the potential presence of the

enzyme urease. Urea broth was inoculated with the environmental unknown and left at

room temperature for twenty-four to forty-eight hours. If there was urease in the bacteria,

the tube changed from yellow to a light cherry color, which indicated that ammonia was

released and the pH was raised to 8.1 or greater. If there was no change in the color, the

test was a negative result.

Kligler’s iron agar was used to test for the production of hydrogen sulfide. The

medium for the test contained ferrous sulfate, glucose, lactose, and phenol red. A needle

was used to take some of the unknown bacteria. The needle was then stabbed into a tube

of Kligler’s iron agar. The tube was left at room temperature to incubate for a period of

twenty-four hours. A positive test showed a dark precipitate formed in the tube, while a

negative resulted in no color or a yellow color.

8


A gelatinase test was performed to specifically test for the enzyme gelatinase. A

nutrient gelatin medium was used which contained peptone, beef extract, and gelatin. The

medium typically solidifies at four degrees Celsius and liquefies at temperatures above

thirty degrees Celsius. The gelatinase was stabbed with a needle covered with some of

the environmental unknown bacteria. After a week of incubating at room temperature, the

tube was placed in an ice bath at four degrees Celsius. If the gel stayed liquefied after

thirty minutes, it was a positive test, although if the gel stayed solidified it was a negative

result.

A starch hydrolysis test was used to observe if starch was present in the bacteria

and could by hydrolyzed by α-amylases. A small area on a starch-gelatin agar plate was

dabbed with some of the environmental unknown bacteria. The positive control for this

test was B. megaterium while the negative control was E. coli. The plate was incubated

for twenty-four to forty-eight hours in room temperature and refrigerated for the rest of

the week. After one week, a few drops of Gram’s iodine were added to the plate. A

positive test resulted in clear zones around the colonies that hydrolyzed the starch. No

change signified a negative result.

A casein hydrolysis test was performed to test for excretion of proteases, or

extracellular enzymes. The medium used for this experiment was one skim milk casein

agar plate. Like the starch hydrolysis test, B. megaterium was used for a positive control

while E. coli was the negative control. The unknown bacteria were dabbed in a small

circle in its appropriate section of the plate. The plate was then incubated at room

temperature for twenty-four to forty-eight hours, or until at least one clear zone appeared.

9


A positive test result showed clear zones around the culture, while a negative result

showed no change.

A lipid hydrolysis test was used to observe lipases in the bacteria. A spirit blue

agar plate was used to identify if the bacteria had lipases that could break down fats. In

the same fashion as the starch and casein hydrolysis tests, the unknown bacteria were

dabbed onto the plate. Serratia marcescens. was used as the positive control while E. coli

was used as the negative control. The plate was incubated for twenty-four to forty-eight

hours in room temperature. If the test was positive, a clear zone developed around the

organism. If it was negative, the area remained unchanged.

A facultative anaerobe test was performed to test for aerotolerance in the bacteria.

A TSA plate in inoculated with the unknown bacteria and placed into an anaerobic jar.

Oxygen was chemically removed from the jar and incubated for one week in room

temperature. A positive test resulted in growth in the tube, while no growth signified a

negative result.

A biochemical test was performed to test for the presence of biofilm, or the ability

of the bacteria to allow planktonic microorganisms to attach to the substrate surface. A

tube that contained enriched 1% glucose TSB was inoculated with the unknown bacteria.

Staphylococcus auerus and Staphylococcus epidermidis were used as the positive

controls. The broth was incubated for one week at room temperature, marked where the

broth ended, and then was poured into a large beaker. The tube was then rinsed with a

phosphate buffered solution twice and air dried upside down. After the tube dried it was

filled above where the broth line was drawn with 0.1% crystal violet solution. The tubes

were then rinsed and air dried and observed. A positive result would have displayed a

10


purple colored film on the bottom or sides of the tube, while a negative test would have a

colorless and empty tube.

Molecular identification was attempted using the V4 region of 16S rDNA. The

20µL PCR reaction consisted of 7µL nanopure water, 1µL MgCl2 (25mM), 1µL of each,

forward and reverse, primer (10µM), and 10µL KAPA Fast HotStart Ready Mix (2X). A

small amount of culture was obtained with a pipette tip and mixed into the reagents. The

optimized thermal cycler protocol was 95°C for 10 minutes followed by 35 cycles of 15

seconds at 95°C, 15 seconds at 62°C, and 15 seconds at 72°C, with a final 30 second

extension at 72°C. PCR products were visualized with gel electrophoresis. Sequencing

was performed on an ABI Prism 3730XL DNA sequencer (Applied Biosystems, Foster

City, CA) and analyzed using the Unipro UGENE software package.

All methods are from Shand (2014).

RESULTS

The cell morphology was determined through a simple stain, which displayed

blue rod-shaped cells. The Gram reaction was positive as indicated by purple cells. The

capsule stain showed a dark blue background with red cells surrounded by a clear zone,

indicating that it was a positive result. The acid-fast stain showed blue cells representing

that the bacteria were negative and contained non-acid fast cells. The endospore stain was

positive because it displayed pink cells with green spores. The catalase biochemical test

showed a positive result as indicated by the presence of gas bubbles on a slide containing

the bacteria. The oxidase test turned out to be negative because the test had no color

11


change. Carbohydrate tests were performed using glucose, sucrose, lactose, and mannose.

The glucose tube produced acid when inoculated by the bacteria, presented by a color

change from pink to yellow. The sucrose tube produced acid and gas as indicated by a

color change to yellow and the presence of gas. The lactose tube remained unchanged

with no growth present. Lastly, the mannose tube produced acid and changed from pink

to yellow. The nitrate reduction test was observed at twenty-four and forty-eight hours

and contained no gas in the Durham tube. After one week in the fridge, it was observed

again and still contained no gas. After Nitrite A and Nitrite B were added to the tube and

turned pink, indicating that the test was positive for nitrate reduction. The oxygen

requirement test presented growth at the top of the tube at twenty-four hours, and growth

mainly at top but also throughout at forty-eight hours, which indicated that the bacteria

was a facultative anaerobe. The motility test was negative due to the presence of growth

solely in the stab area of the agar. The Kligler’s Iron was also negative when checked at

twenty-four and forty-eight hours because there was no color change. The gelatinase test

after one week was negative because the agar remained solidified after placement in four

degrees Celsius for thirty minutes. The starch hydrolysis test was positive after twenty-

four hours, as indicated by a clear zone around the organism. Simmons citrate test was

proven to be negative because there was no color change after twenty-four and forty-

eight hours. The biofilm test was negative due to the lack of growth in the tube and the

inability of the tube to retain color. The casein test was negative after twenty-four hours

as indicated by the lack of clear zones around the organism. The lipid test was also

negative after twenty-four hours due to the lack of clear zones on the plate. The urea test

was negative because there was no color change. Lastly, the PCR product was visualized

12


on the gel as a band at about 300 bp (base pairs). DNA sequencing resulted in high

quality sequence data. The sequence used from PCR procedures and run through the

BLAST website was

“TTAAGAAAAAAAAACGAGCAGAGGGCGGGGGGGGTAAGACCAAT

AGGCGGTTGTCGCGTCTGCTGTGAAAGCCCGGGGCTCAACCCCGGGGGGCAG

AGGGGACGGGGAGACTAGAGTGCAGTAGGGGAGACTGGAATTCCGGGTGTA

GCGGTGAAATGCGCAGATTTCAGGAGGAACACCGATGGCAAAGGCCGGTCTT

TGGGCTGTTACTGACCCTGAGGAGCGAAATCTGGGGAGCAAACCGGATAAAA

AAACCCGGGTGTCACAATCCACCACCCGCCCCCCCCCGGACAATTTTTTTTTA

GGAATAAAAAAAATGATCCCCCCGGGTCGGTGATACCCCCCCCTTTCCCCGG

GGCAAAAA.”

Table 1. Results of Stain and Biochemical Tests on Environmental Unknown

Cell morphology Rod

Gram reaction Positive Purple cells

Capsule Positive Dark blue background,

red cells, clear zone

Acid-Fast Negative blue

Endospore Positive pink

Catalase Positive gas bubbles

Oxidase Negative no color change

Carbohydrate Fermentation Glucose: acid, Sucrose:

acid+gas, Lactose: no

13


growth, Mannose: acid

Oxygen Requirements Facultative anaerobe Growth throughout the

whole tube, but mainly

at the top

Nitrate Reduction No gas nitrite positive

Motility Negative growth only in stab

Simmons Citrate Negative no color change

Urea Hydrolysis Negative no color change

Kligler’s Iron Agar Negative no color change

Gelatinase Negative gel remained solidified

Starch Hydrolysis Positive clear zone around

organism

Casein Hydrolysis Negative no clear zones

Lipid Hydrolysis Negative remained original color

Facultative Anaerobe Positive growth was present

Biofilm Negative no film or color present

DISCUSSION

In order to determine the identity of the isolated environmental unknown, one

must perform a series of stains and biochemical tests, as well as obtain morphological

information from growth plates. The stains that proved useful to being determining the

unknown isolate were the Gram and simple stains. The simple stain was performed to

14


determine the morphology of the unknown bacteria, which turned out to be rod shaped.

Following the simple stain, a Gram stain displayed purple cells, which indicated that the

bacteria were Gram positive. Biochemical tests were then performed to further identify

the organism. The bacteria were not motile and were catalase positive. PCR sequencing

was used to determine the DNA sequence and therefore identify the exact bacteria

observed. The PCR was successful because the reaction had the proper concentration of

all reagents, the appropriate primers were used, the correct amount of DNA template was

added, and the reaction mixture was not contaminated. Through the use of the BLAST

website generator, the DNA sequence showed that the bacteria observed was

Nesterenkonia or Kocuria. Although, both of these bacteria have cocci morphology and

have many different results in regards to biochemical and staining procedures. Kocuria

and Nesterenkonia both matched the DNA sequence at 92% identity and their expected

values were 7e-75. Kocuria did not match the genus I found using Bergey’s Manual. I

trust the information I found in Bergey’s Manual more because it correctly correlated

with the staining and biochemical procedures used to identify the unknown bacteria,

while the PCR sequencing identified a bacteria that did not match many of the tests

performed. Table 20.2 for facultatively anaerobic genera in Bergey’s Manual was used to

determine the bacteria genus. The table showed that the genus Corynebacterium was the

only one one the table that were gram positive rods, nonmotile, catalase positive, and live

in soil. Further research through Bergey’s Manual showed that all the results from the

tests performed matched the results of tests performed on Corynebacterium. Therefore,

through the uses of these methods, the bacteria were determined to be in the class

Corynebacterium.

15


Table 2.

Organism genus studied to determine unknown bacteria

Characteristics E.I. Corynebacteriu

m

xerosis

Nesterenkonia

lakusekhoensis

Kocuria

carniphila

Cell Morphology Rods Rods Short Rods Cocci

Oxidase - - - -

Urease - - - -

Nitrate reduction + + - +

Gelitanase - - - +

Lactose acid

production

- - - -

Correlation to

Unknown

7 out of 7

100%

6 out of 7

86%

5 out of 7

71%

- indicates a negative test, + indicates a positive test

More tests were then performed to determine the species of the Corynebacterium.

Four carbohydrate fermentation tests were performed using glucose, mannose, lactose,

and sucrose. The bacteria fermented the glucose and produced acid. The mannose also

produced acid, which made it positive for acid. The lactose was a negative result because

no acid, gas, or growth occurred in the tube. Lastly, the sucrose test was positive because

it produced both acid and gas. The urea hydrolysis test was negative for the enzyme

16


urease because no color change occurred in the tube. The gelatinase test was a negative

result, because the gel remained solidified after a week of incubation and thirty minutes

in an ice bath. The casein hydrolysis produced no clear zones around the organism, which

indicated it was a negative result. The bacteria were lastly tested for the ability to reduce

nitrate to nitrite, which was a positive result. The bacteria were then identified as

Corynebacterium xerosis.

The isolate was identified through the various stains and biochemical tests as well

as through the use of Bergey’s Manual of Bacteriology. Bergey’s Manual Volume II was

used because the isolate was Gram positive. The organism was then identified as

belonging to the Corynebacterium family because it is a Gram positive irregular rod.

Bergey’s manual showed the Corynebacterium xerosis related to the data obtained from

the stains and biochemical tests. It showed glucose positive, mannose and sucrose

positive, lactose negative, urease positive, gelatinase negative, casein hydrolysis negative,

and nitrite positive (Sneath PHA 1986).

Many other bacteria came close and made it difficult to determine which

organism was correct according to the tests performed. Corynebaterium diphtheria for

example, was very similar to C. xerosis besides the fact that it was not able to ferment

sucrose. Corynebaterium pseudodiphtheriticum was also similar to the isolate that was

tested. C. pseudodiphtheriticum was also unable to ferment lactose, gelatinase negative,

negative for the casein hydrolysis test and could reduce nitrate to nitrite. This organism

differentiated from C. xerosis because it is unable to ferment sucrose, glucose, and

mannos. It is also urease positive. Lastly, Corynebacterium cystidis was considered to be

the environmental isolate, although only momentarily. It is similar to C. xerosis because

17


it is able to ferment glucose, unable to ferment lactose, gelatinase negative, and negative

for the casein hydrolysis test. In contrast, C. cystidis is unable to ferment mannose and

sucrose, is urease positive, and is unable to reduce nitrate to nitrite (Sneath PHA 1986).

Table 3.

Corynebacterium species studied to identify the environmental unknown

Characteristics E.I. C.

xerosis

C.

diphtheriae

C.

pseudodiphtheriticum

C.

cystidis

Glucose

fermentation

+ + + - +

Mannose

fermentation

+ + + - -

Lactose

fermentation

- - - - -

Sucrose

fermentation

+ + - - -

Gelatinase - - - - -

Urea

hydrolysis

- - - + +

Casein

hydrolysis

- - - - -

Nitrate

reduction

+ + + + -

Correlation to 8 out of 8 7 out of 8 4 out of 8 4 out of 8

18


Unknown 100% 88% 50% 50%

- indicates a negative test, + indicates a positive test, D indicates a variable outcome

The significance of this finding is that bacteria such as C. xerosis can grow in a

wide range of environments. It is important to isolate and research bacteria such as this

organism because bacteria can affect soil fertility and the animals and plants that inhabit

the area in which the bacteria are found. C. xerosis is able to survive in Flagstaff, Arizona

because it lives off of human skin, mucous membranes, and in soil. It lives on the human

hosts of Flagstaff, Arizona and is spread into the environment. It is able to live in soil at

temperatures around 37°C, hence the discovery of the bacteria in this experiment. The

bacteria used in this study were extracted from a twig from the soil of Flagstaff, Arizona

in the summer season, which is typically 27°C.

Corynebatcterium is a constantly changing and growing taxonomy, which makes

it hard to identify. In the past, coryneform bacteria have been identified through the Gram

stain and many other biochemical tests, such as performed in this trial. Although more

commercial systems have been developed such as BBL Crystal, API Rapid Coryne,

RapID CB Plus, 16S rRNA and DNA-dependent RNA polymerase β-subunit genes

(Adderson 2008). Bergey’s Manual of Bacteriology was used to identify these bacteria,

although it only lists fourteen species of Corynebacterium, while 11 more types have

been discovered since the manual was written (Funke 1997). There has also been some

discrepancy in literature describing this strain of Corynebacterium. The CDC and

Bergey’s Manual of Systematic Bacteriology have differentiating description of C.

xerosis and C. striatum, which made the identification process seem misleading (Coyle

1993). There are thousands of different identification methods, which can make it

19


difficult to identify bacteria without the use of many various types of tests and manuals

(Lányi 1988).

The genus Corynebacterium is also heterogeneous. The genus includes aerobic

and facultative anaerobic species, for example C. xerosis is a facultative anaerobe while

C. diphtheriae is an aerobe (Pascual 1995). Therefore, it is necessary to update and

continuously test this strain of bacteria, because it is less frequently isolated and viewed

as compared to other bacteria. Corynebacterium can be a very infectious strain of bacteria

and is a concern for many clinical studies on diseases. This means that these bacteria

should be isolated and tested more, so that drugs and vaccinations can be produced to

help the spread of infectious diseases (Jorgensen 2004). These bacteria live on human

hosts and are spread through the things that they touch. Corynebacterium are

opportunistic human pathogens that can also live in soil, and are very resistant to

antibiotics (Tauch 2006).

REFERENCES

Adderson, Elisabeth E. 2008. Identification of clinical coryneform bacterial isolates:

comparison of biochemical methods and sequence analysis of 16S rRNA and

rpoB genes. Clinical microbiology. 46.3:921-927.

Bardgett, Richard D. 2002. Causes and consequences of biological diversity in

soil. Zoology 105.4:367-375.

20


Busse, Hans-Jürgen, Ewald Denner, and Werner Lubitz. 1996. Classification and

identification of bacteria: current approaches to an old problem. Overview of

methods used in bacterial systematics. Biotechnology 47.1: 3-38.

Coyle, Marie B. 1993. Evidence of multiple taxa within commercially available reference

strains of Corynebacterium xerosis. Clinical microbiology 31.7: 1788-1793.

Fierer, Noah. 2007. Toward an ecological classification of soil bacteria. Ecology

(Durham), 88:1354-1364

Funke, Guido. 1997. Clinical microbiology of coryneform bacteria. Clin Microbio Rev.

10.1:125-159.

Jorgensen, James H. Need for susceptibility testing guidelines for fastidious or less-

frequently isolated bacteria. Clinical microbiology 42.2:493-496.

Lanyi, B. 1988. 1 Classical and Rapid Identification Methods for Medically Important

Bacteria. Methods in microbiol. 19:1-67.

Morgulis, Aleksandr, George Coulouris, Yan Raytselis, Thomas L. Madden, Richa

Agarwala, and Alejandro A. Schäffer (2008). Database Indexing for Production

MegaBLAST Searches. BLAST 24:1757-1764.

Pascual, Cristina. 1995. Phylogenetic analysis of the genus Corynebacterium based on

16S rRNA gene sequences. Systematic bacteriology 45.4:724-728.

Prosser, James I. 2007. The role of ecological theory in microbial ecology. Nature

reviews. Microbiology. 5:384-392.

Shand RF. 2014. Biology 205: microbiology lab manual. Flagstaff (AZ): Northern

Arizona University.

21


Sneath PHA, Mair NS, Sharpe ME, Holt JG, editors. 1986. Bergey's manual of

systematic bacteriology. Vol. 2. Baltimore (MD): Williams & Wilkins.

Whitman, W., Goodfellow, M., Kämpfer, P., Busse, H., Trujillo, M.E., Ludwig, W.,

Suzuki, K, editors. 1984. Bergey’s manual of systematic bacteriology. Vol. 5.

Baltimore (MD): Williams & Wilkins

Tauch, Andreas. 2000. The 51,409-bp R-plasmid pTP10 from the multiresistant clinical

isolate Corynebacterium striatum M82B is composed of DNA segments initially

identified in soil bacteria and in plant, animal, and human pathogens. Mol and

Gen Gens. MGG 263.1:1-11.

22

Identification of Unknown Bacteria Extracted from Flagstaff, AZ

Documents

Transcript of Identification of Unknown Bacteria Extracted from Flagstaff, AZ