1

Identification of tyrosine residues in vascular endothelial growth factor receptor-2/FLK-1 involved in activation of phosphatidylinositol-3 kinase and cell proliferation✽

Volkan Dayanir§, Rosana D. Meyer, Kameran Lashkari‡, and Nader Rahimi¶ Boston University, School of Medicine, Departments of Ophthalmology and Biochemistry, 715 Albany St. Boston, MA 02118 and ‡Schepens Eye Research Institute, Department of Ophthalmology, Harvard Medical School, Boston, MA 02114 ¶Corresponding author: Nader Rahimi Boston University, School of Medicine Departments of Ophthalmology and Biochemistry 715 Albany St. Room L921, Boston, MA 02118 Tel: 617-638-5011 Fax: 617-638-5337 E.mail: nrahimi@bu.edu Running title: VEGFR-2 activates PI-3 kinase ✽ This work was supported in part by departmental grants from Research To Prevent Blindness, Inc, the Massachusetts Lions Eye Research Fund Inc and American Cancer Society, Massachusetts Division, Inc (NR). §Funded by TUBITAK (the Scientific and Technical Research Council of Turkey) NATO Science Scholarship and Turkish Education Foundation Scholarship Programs.

Copyright 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

JBC Papers in Press. Published on March 8, 2001 as Manuscript M009128200 by guest on M

arch 30, 2018http://w

ww

.jbc.org/D

ownloaded from

2

Abstract: Activation of vascular endothelial growth factor receptor-2 (VEGFR-2)

plays a critical role in vasculogenesis and angiogenesis. However, the

mechanism by which VEGFR-2 activation elicits these cellular events is not

fully understood. We recently constructed a chimeric receptor containing the

extracellular domain of human CSF-1R/c-fms, fused with the entire

transmembrane and cytoplasmic domains of murine VEGFR-2 (Rahimi et al.,

JBC 275: 16986-16992, 2000). In this study we used VEGFR-2 chimera

(herein named CKR) to elucidate the signal transduction relay of VEGFR-2 in

porcine aortic endothelial (PAE) cells. Mutation of tyrosines 799 and 1173

individually on CKR resulted in partial loss of CKR’s ability to stimulate cell

growth. Double mutation of these sites caused total loss of CKR’s ability to

stimulate cell growth. Interestingly, mutation of these sites had no effect on the

ability of CKR to stimulate cell migration. Further analysis revealed that

tyrosines 799 and 1173 are docking sites for p85 of PI-3 kinase. Pre-treatment

of cells with wortmannin, an inhibitor of PI-3 kinase, and rapamycin, a potent

inhibitor of S6 kinase, abrogated CKR-mediated cell growth. However,

expression of a dominant negative form of ras (N17ras) and inhibition of the

MAP kinase pathway by PD98059 did not attenuate CKR stimulated cell

growth. Altogether, these results demonstrate that activation of VEGFR-2

results in activation of PI-3 kinase and that activation of PI-3 kinase/S6kinase

pathway, but not Ras/MAPK is responsible for VEGFR-2 mediated cell growth.

by guest on March 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

3

Introduction Vascular endothelial growth factor receptor-1 (VEGFR-1/FLT-1) and

VEGFR-2 (FLK-1/KDR) belong to a subfamily of receptor tyrosine kinases

implicated in vasculogenesis and angiogenesis. The important contribution of

VEGFR-2 in vasculogenesis and angiogenesis was initially underscored by the

observation that homozygous knockout mice lacking VEGFR-2 exhibited

severe deficiency in vessel formation (1). Furthermore, introduction of either a

neutralizing antibody against VEGF or the dominant negative form of VEGFR-2

was able to block angiogenesis (2,3). On the other hand, VEGFR-1 activation

alone appears to play a less significant role in these cellular processes (4,5,6).

The mechanism by which VEGFR-2 activation evokes angiogenesis is

not well understood. It is presumed that these events are initiated by binding of

VEGF to VEGFR-2 leading to tyrosine phosphorylation of the dimerized

VEGFR-2 and subsequent phosphorylation of SH2-containing intracellular

signaling proteins including phospholipase C-γ1 (PLC-γ1), Src family tyrosine

kinases, and phosphatidylinositol-3 kinase (PI-3 kinase), adaptor molecules,

SHC, NCK and Ras GTPase-activating protein (7-10). The contributions of

individual signaling molecules to various aspects of angiogenesis and the

tyrosine sites on VEGFR-2 that potentially mediate their recruitment and

activation have not been fully investigated. Moreover, the data presented in the

literature is often inconsistent. Waltenberger et al., (1994), Abedi and Zachary

(1997) and Takahashi et al., (1997) have suggested that stimulation of

endothelial cells with VEGF results in no PI-3 kinase activation (7,8,11), while

by guest on March 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

4

others have shown that VEGFR-2 activation does indeed result in PI-3 kinase

stimulation, which may stimulate endothelial cell growth and survival (12,13).

The reason for the apparent inconsistency in the activation and

association of signaling molecules with VEGFR-2 is not known. It may be due

to the complexity of VEGFR-2 mediated signal transduction relay in endothelial

cells such as expression of VEGFR-1 and neuropilin-1 and 2 which may modify

or antagonize VEGFR-2 mediated signal transduction and its final biological

responses (5,14,15). To circumvent these issues, we have recently constructed

a chimeric receptor containing the extracellular domain of human CSF-1R/c-

fms, fused with the transmembrane and the cytoplasmic domains of murine

VEGFR-2. (5). This model permitted us to dissect the functions of VEGFR-2 in

endothelial cells by selectively stimulating the receptor with CSF-1. In this study

we used this chimeric receptor to elucidate the signal transduction relay

induced by VEGFR-2 in PAE cells. We show that mutation of tyrosine sites 799

and 1173 individually on CKR result in partial loss of CKR’s ability to stimulate

cell growth, while double mutation of these tyrosine sites result in complete

loss of CKR ability to stimulate endothelial cell growth. Mutation of these sites

however had no effect on CKR’s ability to stimulate cell migration. Further

analysis showed that tyrosines 799 and 1173 are binding sites for p85 of PI-3

kinase and that activation of PI-3 kinase is responsible for CKR-mediated

endothelial cell growth.

by guest on March 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

5

Materials and Methods

Reagents and Antibodies: Mouse anti-phosphotyrosine (PY-20), anti-PLC-γ,

anti-mouse and anti-rabbit secondary antibodies were purchased from

Transduction Laboratories (Lexington, KY). Rabbit anti-MAPK, anti-phospho-

MAPK, anti-phospho-S6 kinase and anti-phospho-AKT antibodies were

purchased from New England BioLabs (Boston, MA). Pan anti-Ras antibody was

purchased from Oncogene Science (Boston, MA). Rabbit anti-phospho-PLC-γ

antibody was purchased from Biosource (Camarillo, CA). Rabbit anti-VEGFR-2

antibody was made to amino acids corresponding to kinase insert of VEGFR-2.

Wortmannin and rapamycin were purchased from Sigma (St. Louis, MO).

PD98059 was purchased from Calbiochem (San Diego, CA). GST-SH2 fusion

proteins of p85 were purchased from UBI (Lake Placid, NY).

Cell lines: Porcine aortic endothelial (PAE) cells expressing chimeric CKR and

three mutants; CKR/F799, CKR/F1173 and CKR/F2 were established by a

retroviral system as described previously (5). Briefly, cDNA encoding for CKR,

CKR/F799, CKR/F1173 and CKR/F2 were cloned into retroviral vector, pLNCX2

and transfected into 293GPG cells. Viral supernatants were collected for 7 days,

concentrated by centrifugation and used as previously described (16).

Site-directed mutagenesis: The VEGFR-2 chimera (CKR) was used as a

template to construct the mutations. CKR was subcloned into pGEMT cloning

vector, and site-directed mutagenesis was carried out by using the Stratagene

site-directed mutagenesis kit. Site-directed mutagenesis primers for replacement

of tyrosines 799 and 1173 to phenylalanine were

by guest on March 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

6

CTGAAGACAGGCTTCTTGTCTATTGTC and CCGGATTTCGTTCGAAAAGG,

respectively. The resultant mutations were verified by sequencing and were

subsequently cloned into pLNCX2 vector by NotI and SalI sites.

Immunoprecipitation and Western Blotting: PAE cells expressing CKR and

CKR mutants were grown in semi-confluent culture condition in DMEM

containing 10% fetal bovine serum (FBS) supplemented with glutamate, penicillin

and streptomycin, and serum-starved overnight in DMEM. Cells were left either

resting or stimulated with 20 ng/ml CSF-1 for 10 min., at 37OC. Cells were

washed twice with H/S buffer (25mM HEPES, pH 7.4, 150mM NaCl, 2mM

Na3VO4) and lysed in lysis (EB) buffer (10mM Tris-HCl, 10% glycerol, pH 7.4,

5mM EDTA, 50mM NaCl, 50mM NaF, 1% Triton X-100, 1mM

phenylmethylsulfonyl fluoride, 2mM Na3VO4, and 20(µg/ml aprotinin). Proteins

were immunoprecipitated by using appropriate antibodies. Immunocomplexes

were bound to protein A Sepharose, and washed three times with 1.0 ml of EB.

Immunoprecipitates were resolved on a SDS-PAGE gel, and the proteins were

transferred to Immobilon membrane. For Western blot analysis, the membranes

were incubated for 60 minute in Block solution containing 10mM Tris-HCl, pH

7.5, 150mM NaCl, 10mg/ml BSA, 0.05% Tween 20. Membranes then were

incubated in Primary antibodies diluted in Block for another 60 minute.

Membrane was washed three times in Western rinse, incubated with HRP-

secondary antibody, washed and developed with ECL (NEN). Finally,

membranes were stripped by incubating them in a stripping buffer containing

by guest on March 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

7

6.25 mM Tris-HCl, pH 6.8, 2% SDS, and 100 mM β-mercaptoethanol, at 50 oC

for 30 min., washed in Western rinse and reprobed with antibody of interest.

PI3-kinase assay: PI-3 kinase activity was measured in immunoprecipitates

using anti-phosphotyrosine antibody (PY20), as previously described (17).

Briefly, immunoprecipitates were washed twice with 25 mM Hepes buffer pH 7.4

containing 1% NP-40, two times with 100 mM Tris-HCl, pH 7.4, 500 mM LiCl and

100 mM Na3VO4 and twice with 10 mM Tris-HCl, pH 7.4, 100 mM NaCl, 1 mM

EDTA and 100 mM Na3VO4. Finally, immunoprecipitates were resuspended in a

final volume of 10 µl of assay buffer containing a mixture of phosphatidylinositol

at a final concentration of 0.2 mg/ml, 0.88 mM ATP and 10 µCi [γ-32P]ATP. After

15 minutes of incubation at 30°C, the reaction was stopped by adding 20 µl of 6

N HCl and lipids were extracted by adding 160 µl of CH3OH: CHCl3 (1:1). The

phospholipids in the organic phase were recovered and spotted onto Silica Gel

TLC plate (Merk) pre-coated with 1% Na-tartarate. Migration was performed in

CH3OH:CHCl3:H2O:25% NH4OH, (45:35:7:3). The TLC plate was dried and

autoradiographed.

Cell Proliferation: Proliferation assay was performed as described before (18).

Briefly, cells were plated at 2X104 cells/ml in 24-well plates containing DMEM

supplemented with 10% FBS, and incubated at 37 OC for 12h. Cells were then

washed once with PBS and serum-starved with DMEM containing 0.1% BSA for

30h. Cells were then given various concentrations of CSF-1 either immediately or

after pretreatment with various concentrations of PD98059 or Wortmannin as

indicated in the text. At the last 4h of incubation, cells were pulsed with [3H]

by guest on March 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

8

thymidine (0.2 µCi/ml) and harvested. Results for each group were collected

from four samples. Each experiment was repeated three times and essentially

the same results were obtained. The data are presented as fold increase over

control.

Migration Assay: Migration of PAE cells expressing CKR and CKR mutants was

assessed using the Boyden chamber (Neuro Probe, Gaithersburg, MD). CSF-1

was diluted in DMEM to a concentration of 5 ng/ml and placed in the bottom

wells of the chamber. Polycarbonate filters with 8µm pore size (Osmonics Inc,

Westboro, MA) were pre-incubated in 4ml of 0.02N acetic acid containing 400 µl

of 3.1 ng/ml, type I collagen (Collagen Biomaterials, Palo Alto, CA) for 30min.

Membranes were flipped several times during incubation, washed twice with

PBS, air dried, and placed between the upper and lower chambers of the

Boyden chamber. Semi-confluent cells were trypsinized and re-suspended in

DMEM to make a concentration of 1.5X106 cells/ml and 50 µl of this suspension

was loaded into each upper well. Chambers were incubated at 37 oC for 8 hours.

After incubation the membranes were removed, and fixed and stained with Quick

Diff (Dade International, Miami, FL), washed with water, and mounted on 75X50

mm glass slides (Fisher Scientific, Pittsburgh, PA) bottom side down. The top

cell layer was wiped off with a cotton-tipped applicator leaving only cells that had

crossed through the membrane. Representative areas were counted at 20X

magnification. Twelve wells were used for a given concentration of test

substance in each independent experiment. The experiment was repeated three

by guest on March 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

9

times and essentially the same results were obtained. The data are presented as

mean of cells ± standard deviation.

Results: Construction and expression of the tyrosine mutant VEGFR-2 chimeras: To elucidate the signal transduction relay induced by VEGFR-2 in

endothelial cells, we mutated tyrosines (Y) 799 and 1173 on the chimeric

VEGFR-2 (CKR), either individually or together by replacing them with

phenylalanine (F). These mutants were termed CKR/F799, CKR/F1173 and

CKR/F2. Tyrosines 799 and 1173 are located in the juxtamembrane and C-

terminus of CKR, respectively (Figure 1A). CKR and tyrosine mutant CKRs

were expressed in PAE cells using a retroviral system. To avoid clonal

variations, all experiments were performed on pooled G418-resistant clones

rather than on isolated clones.

PAE cells expressing either empty vector (pLNCX2), CKR, CKR/799,

CKR/F1173 and CKR/F2 were lysed and equal amounts of protein of total cell

lysates were subjected to Western blot analysis by using anti-VEGFR-2

antibody. Figure 1B shows that all the mutant receptors are expressed at

relatively comparable levels. Expression of CKR in PAE cells is relatively

similar to the expression of VEGFR-2 in primary adrenal microvascular

endothelial (ACE) cells (39). To ensure that all the G418-resistant cells are

indeed are positive for CKRs, we also subjected PAE cells expressing CKR

and tyrosine mutant CKRs to immunohistochemical analysis by using anti-

VEGFR-2 antibody. The result showed that all the G418-resistant cells are

expressing CKR (data not shown). Next, we investigated the tyrosine

by guest on March 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

10

phosphorylation of mutant receptors in response to CSF-1 stimulation. Serum-

starved PAE cells expressing CKR and various mutant receptors were

stimulated with CSF-1 (20 ng/ml) for 10 min, lysed and immunoprecipitated

with anti-VEGFR-2 antibody. The immunoprecipitated proteins were subjected

to anti-phosphotyrosine (pY) Western blot analysis. Figure 1C shows that CKR

and as well as all mutant receptors were tyrosine phosphorylated in a CSF-1

dependent manner, suggesting that mutant CKRs were active and that

replacement of tyrosines 799 and 1173 to phenylalanine in CKR did not

prevent it from responding to CSF-1 stimulation.

Tyrosines 799 and 1173 of CKR are required for CKR-mediated cell growth

but not cell migration.

To determine whether tyrosines 799 and 1173 are required for CKR

mediated biological responses in the endothelial cells, we subjected PAE cells

expressing CKR and mutant CKRs to DNA synthesis and migration assays. As

Figure 2A shows, stimulation of PAE cells expressing CKR with CSF-1 induced

their growth in a dose-dependent manner. The CSF-1 response in cells

expressing CKR/F799 and CKR/F1173 was partially reduced, specifically in PAE

cells expressing CKR/F799. Notably, CSF-1 response in cells expressing

CKR/F2 was significantly reduced and treatment of cells with higher

concentrations of CSF-1 also did not augment their growth stimulation. Also,

ability of tyrosine mutant CKRs to stimulate cell growth, were measured by

proliferation assays other than [3H] thymidine incorporation by using BrdU-ELISA

or counting of cells under microscope by using trypan blue exclusion approach.

by guest on March 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

11

Basically, similar results were obtained by using these assays (Data not shown).

These results suggest that tyrosines 799 and 1173 both are required for CKR-

mediated cell growth. Surprisingly, CSF-1 stimulation of cells expressing mutant

CKRs caused profound morphological changes consistent with their

differentiation. This effect of CSF-1 was much more robust at higher

concentrations of CSF-1, suggesting that tyrosines 799 and 1173 may suppress

differentiation by either promoting cell proliferation or by other undetermined

mechanisms (Dayanir et al., unpublished data).

Because VEGFR-2 activity is associated with endothelial cell migration

(7), we also examined whether tyrosines 799 and 1173 on CKR was required for

CKR-mediated cell migration. To this end, PAE cells expressing CKR and mutant

CKRs were subjected to migration assay. The result showed that CSF-1

stimulation of PAE cells expressing CKR and mutant CKRs resulted in a

significant motility response. As Figure 2B shows stimulation of PAE cells

expressing CKR/F799, CKR/F1173 and CKR/F2 with CSF-1 resulted in similar

migration responses. Thus, tyrosines 799 and 1173 on VEGFR-2 seem to be

more involved in recruitment and activation signaling molecules concerned with

cell proliferation than cell migration in PAE cells.

Tyrosines 799 and 1173 of CKR are required for activation of PI-3 kinase

but not PLCγ1.

To test whether PI-3 kinase is activated by CKR and whether tyrosines

799 and 1173 are contributing to its recruitment by VEGFR-2, we first subjected

PAE cells expressing CKR and mutant CKRs to an in vitro PI-3 kinase assay.

by guest on March 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

12

Stimulation of PAE cells expressing CKR with CSF-1 resulted in strong activation

of PI-3 kinase, as judged by PI3P Production. However, PI3P production by

CKR/799 and CKR/F1173 was significantly lower than by CKR. CKR/F2 was

unable to stimulate PI3P production above baseline (Figure 3A).

It is conceivable that the CKR-mediated PI-3 kinase activation is

established by direct interaction between p85 of PI-3 kinase and CKR. To test

this possibility, serum-starved PAE cells expressing CKR, CKR/F799,

CKR/F1173 and CKR/F2 were stimulated with CSF-1, and cell lysates were

immunoprecipitated with anti-VEGFR-2 antibody. Protein precipitates were

electrophoresed and subjected to Western blotting using anti-p85 antibody. As

shown in Figure 3B, p85 was recovered from anti-VEGFR-2 immunoprecipitates

of cell lysates derived from cells expressing CKR but not from those of

CKR/F799, CKR/F1173 and CKR/F2. A long exposure of the blot showed trace

evidence of p85 in CKR/F799 and CKR/F1173 but not in CKR/F2 (data not

shown), suggesting that binding of p85 to CKR is not strong and both tyrosines

799 and 1173 may be acting as low affinity binding sites for p85. The inability to

detect p85 in cells expressing CKR/F799, CKR/F1173 and CKR/F2 was not

simply due to the absence of CKR itself, since CKR protein was detected equally

in each group (Figure 3C).

Previously it has been demonstrated that the SH2 domains of p85 are

required for complex formation between p85 and other tyrosine phosphorylated

proteins (19). To test the ability of the p85 SH2 domains to bind CKR, cell lysates

derived from PAE cells expressing CKR were examined for their capacity to bind

by guest on March 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

13

a GST-(N terminus) SH2 and GST-(C terminus) SH2. The complexed proteins

were eluted, and CKR was detected by immunobloting with an anti-VEGFR-2

antibody. In a lysate of CSF-1 stimulated CKR/PAE cells, both GST-SH2-NH2

and GST-SH2-COOH of p85 formed stable complexes with CKR but not in non-

stimulated cells. In contrast, incubation of the protein extracts with GST alone did

result in any binding to CKR (Figure 3D). These data show that p85 binds to

CKR in vivo and in vitro and that tyrosines 799 and 1173 play a role in this

association. p85 binding occurred via both SH2 domains of p85, although C-

terminus SH2 domain exhibited stronger binding to CKR than N-terminus in a

pull down experiment (Figure 3D). To analysis role of PI 3-kinase pathway in this

system we evaluated phosphorylation of Akt, a known downstream target of PI 3-

kinase. For this intention, serum-starved cells were stimulated with CSF-1 and

total cell lysates were subjected to an anti-phospho-Akt Western blot analysis.

The result showed that stimulation of cells expressing CKR results in activation

of Akt in a time dependent manner (Figure 3E). Collectively, these results

suggest that stimulation of VEGFR-2 results in PI-3 kinase activation and that

tyrosines 799 and 1173 of VEGFR-2 are responsible for its association with p85

and activation of p110 of PI-3 kinase.

To further characterize activation of signaling molecules by VEGFR-2, we

measured PLCγ1 activation. For this purpose, serum-starved cells were

stimulated with CSF-1 and cell lysates were either immunoprecipitated with an

anti-PLC-γ antibody and then subjected to anti-phosphotyrosine Western blot

analysis, or total cell lysates were subjected to an anti-phospho-PLC-γ Western

by guest on March 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

14

blot analysis. The results showed that CKR and the mutant CKRs were able to

stimulate tyrosine phosphorylation of PLC-γ and no appreciable decrease in

tyrosine phosphorylation of PLC-γ was observed among CKR/F799, CKR/F1173

or CKR/F2 in two different assays (Figure 4A and 4C). These results suggest

that tyrosines 799 and 1173 are not required for activation of PLC-γ and most

likely other tyrosine sites on VEGFR-2 may act as a docking sites for this

molecule. Therefore, it appears that mutations of tyrosines 799 and 1173 on

VEGFR-2 do not impair the ability of this receptor to activate PLC-γ, suggesting

that these sites preferentially serve as binding sites for p85 of PI-3 kinase.

PI-3 kinase/S6 kinase activation is required for CKR-mediated Cell growth.

To evaluate the importance of PI-3 kinase further in CKR-mediated cell

growth, we used an additional approach by using wortmannin, a specific inhibitor

of PI-3 kinase (20). To this end, PAE cells expressing CKR, were pre-treated

with different concentrations of wortmannin, stimulated with CSF-1 and cells

subjected to a proliferation assay. Figure 5A shows that pretreatment of cells

with wortmannin effectively inhibits CSF-1 stimulated cell growth in a dose

dependent manner. This result combined with the site-directed mutagenesis data

(Figure 2A) strongly suggests that PI-3 kinase activation play a key role in

VEGFR-2 stimulated endothelial cell proliferation.

To further identify and define the involvement of PI-3 kinase-regulated

pathways in this system in particular, endothelial cell proliferation, we

investigated the role of p70 S6 kinase, a downstream target of PI-3 kinase. For

this reason, serum-starved PAE cells expressing CKR and tyrosine mutant CKRs

by guest on March 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

15

were stimulated with CSF-1 and total cell lysates were subjected to an anti-

phospho-S6 kinase Western blot analysis. The results showed that CKR is able

to stimulate phosphorylation of S6 kinase in a CSF-1 dependent manner.

CKR/F799 and CKR/F1173 were partially able to stimulate S6 kinase activation,

whereas CKR/F2 complelty failed to stimulate S6 kinase phosphorylation in the

same assay condition (Figure 5B). To establish whether S6 kinase activity is

required for CKR-mediated PAE cell proliferation, serum-starved CKR/PAE cells

were pretreated with rapamycin, an inhibitor of RAFT1 and as a consequence

downstream target of p70 S6 kinase (21). The result showed that rapamycin

effectively blocks CKR stimulated PAE cell growth (Figure 5C), suggesting that

PI-3 kinase/S6 kinase pathway is responsible for VEGFR-2 mediated endothelial

cell growth. Notably, treatment of PAE cells with rapamycin without CSF-1

stimulation also partly reduced basal growth of PAE cells, suggesting that S6

kinase activity is required for normal growth of PAE cells. This effect of

rapamycin does not appear due to high concentration of rapamycin, since at 10-

50 ng/ml it inhibited phosphorylation of S6 kinase approximately by 60 to 90%,

respectively (data not shown). As it is true for most of pharmacological agents,

rapamycin may also effect activation of signaling molecules other than S6 kinase

that might be involved in growth of PAE cells.

Activation Ras/MAPK pathway is not required for CKR-mediated cell

growth

Next we tested the capability of these mutant receptors to stimulate MAPK

activation. For this purpose, PAE cells expressing CKR and mutant CKRs were

by guest on March 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

16

serum-starved, stimulated with CSF-1, lysed and equal amount of proteins of

total cell lysates were subjected to Western blot analysis using anti-phospho-

MAPK antibody. The result shows that mutant CKRs are able to stimulate MAPK

with equal ability as compared to wild type CKR (Figure 6A). In addition,

phosphorylation of MAPK by mutant CKRs was not effected at least up to 30

minutes of stimulation with CSF-1 (data not shown).

To test whether MAPK activation plays a role in CKR-mediated cell growth, we

subjected PAE cells expressing CKR to proliferation assay in which cells were

pre-treated with PD98059, a potent and selective inhibitor of MAP kinase

inhibitor (22). As Figure 6C shows, PD98059 treatment of PAE cells expressing

CKR did not inhibit CKR mediated cell proliferation. Collectively, these data

suggest that although CKR activation results in robust MAPK activation, its

activity may not be required for CKR-mediated cell growth in PAE cells. To

assure that PD98059 at the concentration used in proliferation assay indeed is

inhibiting MAP kinase activation, we measured MAP kinase phosphorylation. As

Figure 6D shows pre-treatment of cells with PD98059 (50 µM) effectively

inhibited MAP kinase phosphorylation. Since, MAPK activation is mainly

mediated by Ras finally we assessed its role in this process. For this purpose, we

transiently over-expressed N17ras in CKR/PAE cells by a retrovirus system and

subjected them to proliferation assay. The result showed that expression of

dominant negative form of ras (N17 ras) only had a minor effect on the CSF-1

stimulated cell growth (Figure 7A). Figure 7B shows expression of N17 ras in

by guest on March 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

17

CKR/PAE cells. All together, these results suggest that activation of Ras/MAPK

pathway is not required for VEGFR-2 mediated PAE cell proliferation.

Discussion

Our study demonstrates that mutation of tyrosines 799 and 1173 on

VEGFR-2 abolishes binding of P85 of PI-3 kinase to CKR without impairing

CKR’s ability to activate PLC-γ and Ras/MAPK pathways. A single mutation of

799 and 1173 on CKR partially inhibited PI-3 kinase activation and cell

proliferation. Additionally, double mutation of tyrosines 799 and 1173 totally

abolished CKR’s ability to stimulate PI-3 kinase activation and endothelial cell

growth but not cell migration. These results suggest that distinct signaling

pathways are activated by VEGFR-2 and are responsible for the induction of

endothelial cell growth and likely for VEGF-induced angiogenesis. Consistent

with mutant CKRs, pre-treatment of cells with wortmannin, a potent inhibitor of

PI-3 kinase blocked CKR’s ability to stimulate cell growth. Activation of PI-3

kinase results in PIP3 production, which can activate Protein kinase C-ς (23),

AKT (24) and stimulation of p70 S6 kinase (25). Our results show that

rapamycin, a potent inhibitor of S6 kinase pathway (21), abrogates CKR

mediated cell growth, suggesting that PI-3 kinase/S6kinase pathway is

responsible for CKR mediated cell growth. Interestingly, it appears that activation

of PLCγ and Ras/MAPK pathways are not involved in VEGFR-2 stimulated

growth of PAE cells. Nonetheless activation of these enzymes by CKR strongly

suggest that these molecules are likely to participate in the other VEGF-induced

cellular processes such as cell migration and cell differentiation.

by guest on March 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

18

A number of groups have investigated the role PLCγ1 in VEGF-dependent

signal relay. The initial observations suggested that PLCγ activation is increased

in a VEGF stimulated cells (8,9,26). Subsequent study showed that tyrosine 951

on the human VEGFR-2 is a major binding site for PLCγ1 (27). In agreement with

this study our results demonstrate that tyrosines 799 and 1173 of mouse

VEGFR-2 are not required for PLCγ1 activation and likely tyrosine 951 is the

primary binding site for PLCγ1. In addition, our results demonstrate that although

PLCγ1 is activated by VEGFR-2, its activation is not required for VEGF-mediated

endothelial cell growth. Activation of PLCγ1 has been shown to stimulate cell

growth and migration in variety of cellular systems, however its role in VEGFR-2

mediated signal transduction and endothelial cell function is largely unknown.

Recently, it has been suggested that inhibition of PLCγ1 by pharmacological

mean blocks VEGF-stimulated sinusoidal endothelial cell growth (28). Since

sinusoidal cells express both VEGFR-1 and VEGFR-2, it is difficult to judge the

contributions of each receptor to the observed PLCγ1 activation.

Thus, it seems that tyrosines 799 and 1173 are novel p85 docking sites

for p85 of PI 3-kinase, although they may represent a low affinity binding sites for

P85. Amino acids residues surrounding tyrosine 799 (YLSIVM) and 1173

(YIVLPM) of VEGFR-2 do not correspond to conventional (Y-M/V/I/E-X-M) p85

binding sites (29,30). While, it is generally believed that SH2 domains of p85

preferentially bind to receptor tyrosine kinases through this motif, other binding

sites for p85 of PI -3 kinase have been described. For instance, p85 binding to

hepatocyte growth factor receptor family including c-Met, c-Ron and c-Sea is

by guest on March 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

19

mediated by the YVHV (31,32). Similarly, it has been demonstrated that amino

acids YVNA on VEGFR-1 is binding site for p85 (33).

Until now, little evidence existed for the involvement of PI-3 kinase in

VEGFR-2 mediated signal transduction and angiogenesis. The possibility that PI-

3 kinase may be involved could be inferred only from very indirect evidence.

Initial studies about the activation of PI-3 kinase by VEGFR-2 suggested that PI-

3 kinase is not activated by VEGFR-2 stimulation (7,8,11). However, subsequent

studies suggested that VEGF stimulation of endothelial cells results in activation

of PI-3 kinase and its activation may promote endothelial cell survival (12,13).

Furthermore, recently it has been shown that viral oncogenic PI-3 kinase

stimulates angiogenesis in the CAM assay by stimulating VEGF expression (34).

During angiogenesis VEGF induces endothelial cell migration, growth and

differentiation in a coordinated manner. Our current study suggests that specific

activation of VEGFR-2 in endothelial cells activates a number signaling

molecules including, PI-3 kinase, Akt, PLCγ1 and MAPK. Altogether, this

suggests that during angiogenesis stimulation of PI-3 kinase/S6 kinase pathway

by VEGFR-2 may influence endothelial cell growth and likely endothelial cell

survival leading to formation of new blood vessels. Previous studies have

suggested that activation of PI-3 kinase/S6 kinase pathway is essential for serum

and FGF-stimulated endothelial cell growth (35,36), implying that activation of PI-

3 kinase by a variety of factors in the endothelial cells serves as a molecular

switch to control cell proliferation.

by guest on March 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

20

Regulation of angiogenesis is the most critical step in the development of

tumors, ocular neovascularization and in inflammation (37,38). The results

presented in this work identify tyrosine residues of VEGFR-2 responsible for

recruiting and activation of PI-3 kinase and its role as a regulator of endothelial

cell growth. These findings are important to the understanding of the role

different signaling molecules to different aspects of angiogenesis. Further

studies will delineate the contributions of other signaling molecules to different

cellular processes involved during angiogenesis.

Acknowledgment: We thank Cyrus Vaziri (Cancer Research Center,

Boston University) for providing N17 ras construct. Rosana D Meyer is Medical

Fellow from Schepens Eye research Institute.

References:

1. Shalaby, F., Rossant, J., Yamaguchi, T. P., Gertsentein, M., Fu Wu, X.,

Breitman, M.L., and Schuh, A.C. (1995) Nature, 376, 62-66.

2. Millauer B, Shawver LK, Plate KH, Risau W, Ullrich A. (1994) Nature

367,576-579.

3. Kim KJ, Li B, Winer J, Armanini M, Gillett N, Phillips HS, Ferrara N. (1993)

Nature 362, 841-844

4. Fong GH, Zhang L, Bryce DM, Peng J. (1999) Development 126, 3015-

3025

5. Rahimi N, Dayanir V, Lashkari K. (2000) J Biol Chem. 275,16986-16992.

6. Hiratsuka S, Minowa O, Kuno J, Noda T, Shibuya M. (1998) Proc Natl Acad

Sci U S A. 95, 9349-9354

7. . Waltenberger, J., Calaesson-Welsh, L., Siegbahn, A., Shibuya, M., and

Heldin, C-H. (1994) J. Biol. chem, 269: 26988-26995

8. Takahashi T, Shibuya M. (1997) Oncogene 4, 2079-2089

by guest on March 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

21

9. Igarashi K, Isohara T, Kato T, Shigeta K, Yamano T, Uno I. (1998)

Biochem Biophys Res Commun. 246, 95-99

10. Guo D, Jia Q, Song HY, Warren RS, Donner DB. (1995) J Biol Chem. 270,

6729-6733

11. Abedi H, Zachary I. (1997) J Biol Chem. 272, 15442-15451

12. Thakker GD, Hajjar DP, Muller WA, Rosengart TK. (1999) J Biol Chem.

274, 10002-10007.

13. Gerber HP, McMurtrey A, Kowalski J, Yan M, Keyt BA, Dixit V, Ferrara N.

(1998) J Biol Chem. 273, 30336-30343.

14. Soker S, Takashima S, Miao HQ, Neufeld G, Klagsbrun M. Cell (1998) 92,

735-745.

15. Kendall RL, Wang G, Thomas KA. (1996) Biochem Biophys Res Commun.

226, 324-328

16. Ory DS, Neugeboren BA, Mulligan RC. (1996) Proc Natl Acad Sci U S A.

93:11400-11406

17. Rahimi N, Tremblay E, Elliott B. (1996) Biol Chem 271, 24850-24855

18. Rahimi N, Hung W, Tremblay E, Saulnier R, Elliott B. (1998) Biol Chem

273, 33714-33721

19. Sonyang, Z., Shoelson, S.E., Chaudhuri, M., Gish, G., Pasown, T., Roberts,

T., et al., (1993) Cell 72: 767-778

20. Yano H, Nakanishi S, Kimura K, Hanai N, Saitoh Y, Fukui Y, Nonomura Y,

Matsuda Y. (1993) J Biol Chem. 268, 25846-25856.

21. Lane HA, Fernandez A, Lamb NJ, Thomas G. (1993) Nature 363,170-1702

22. Alessi DR, Cuenda A, Cohen P, Dudley DT, Saltiel AR. (1995) J Biol Chem.

270, 27489-27494

23. Chou MM, Hou W, Johnson J, Graham LK, Lee MH, Chen CS, Newton AC,

Schaffhausen BS, Toker A. (1998) Curr Biol. 8,1069-1077

24. Stokoe D, Stephens LR, Copeland T, Gaffney PR, Reese CB, Painter GF,

Holmes AB, McCormick F, Hawkins PT. (1997) Science. 277, 567-570

25. Romanelli A, Martin KA, Toker A, Blenis J. (1999) Mol Cell Biol. 19, 2921-

2928

by guest on March 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

22

26. Cunningham SA, Arrate MP, Brock TA, Waxham MN. (1997) Biochem

Biophys Res Commun. 240,635-639

27. Wu LW, Mayo LD, Dunbar JD, Kessler KM, Baerwald MR, Jaffe EA, Wang

D, Warren RS, Donner DB. (2000) J Biol Chem. 275, 5096-50103

28. Takahashi T, Ueno H, Shibuya M. (1999) Oncogene 18, 2221-2230

29. Rameh LE, Chen CS, Cantley LC. (1995) Cell 83, 821-830

30. Carpenter CL, Cantley LC. (1996) Biochim Biophys Acta. 1288, M11-16

Derman MP, Chen JY, Spokes KC, Songyang Z, Cantley LG. (1996) J Biol

Chem. 271, 4251-4255

31. Ponzetto C, Bardelli A, Zhen Z, Maina F, dalla Zonca P, Giordano S,

Graziani A, Panayotou G, Comoglio PM. (1994) Cell 77, 261-271

32. Cunningham SA, Waxham MN, Arrate PM, Brock TA. (1995) J Biol Chem.

270, 20254-20257.

33. Jiang BH, Zheng JZ, Aoki M, Vogt PK. (2000) Proc Natl Acad Sci U S A. 97,

1749-1753

34. Vinals F, Chambard JC, Pouyssegur J. (1999) J Biol Chem. 274, 26776-

26782

35. Kanda S, Hodgkin MN, Woodfield RJ, Wakelam MJ, Thomas G, Claesson-

Welsh L. (1997) J Biol Chem. 272, 23347-23353

36. Risau, W., (1997) Nature, 386: 671-674

37. Folkman, J., and D’Amore, P. (1996) Cell 87,1153-1155

38. Rahimi, N and Kazlauskas A. (1999) Molecular Biology of the Cell 10, 3401-

3407

by guest on March 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

23

Figure 1. Schematic representation of the construction of the tyrosine

mutant chimera VEGFR-2, their expression and activation in PAE cells.

The tyrosine (Y) residues and amino acids surrounding 799 and 1173 and

replacement of these sites individually or together to phenylalanine (F) are

shown. CKR/F2 is corresponds to double mutations of 799 and 1173 (A). Semi

confluent PAE cells expressing pLNCX2, CKR, CKR/F799, CKR/F1173, and

CKR/F2 were lysed and blotted with anti-VEGFR-2 antibody (B). Serum-

starved semi confluent PAE cells expressing CKR and tyrosine mutant CKRs

were either non-stimulated or stimulated with 20ng/ml CSF-1, lysed and

immunoprecipitated with anti-VEGFR-2 antibody. The immunoprecipitated

proteins were collected, resolved on SDS-PAGE, transferred to Immobilon

membrane, and immunoblotted with anti-pY antibody. The same membrane

was reprobed with anti-VEGFR-2 antibody for protein level (D).

Figure 2.Tyrosines 799 and 1173 are required for VEGFR-2 mediated cell

growth but not cell migration. Serum-starved PAE cells expressing wild type

CKR and tyrosine mutant CKRs were treated with different concentrations of

CSF-1 and DNA synthesis was measured by [3H] thymidine uptake. The results

are expressed as the mean of (cpm/well) ±SD of quadruplicates (A). The data

are expressed as a ratio of stimulated over non-stimulated samples. Same group

of cells were subjected to migration assay by plating the cells in top wells of

Boyden chamber. CSF-1 (5 ng/ml) or DMEM medium was placed in the bottom

chambers and incubated at 37oC for 8 hours. Cells that crossed the membrane

by guest on March 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

24

were fixed, stained and one representing field was counted. The results are

expressed as the mean of ±SD of twelve wells per each cell line (B).

Figure 3. Tyrosines 799 and 1173 of VEGFR-2 are required for PI-3 kinase

activation and for its association with p85 of PI-3 kinase. Serum-starved

PAE cells expressing wild type CKR and tyrosine mutant CKRs were treated with

CSF-1, washed, lysed, cell extracts were normalized for protein and

immunoprecipitated with anti-pY antibody. The immunoprecipitates were washed

and subjected to in vitro PI-3kinase assay. The products of the reaction were

analyzed by thin layer chromatography, visualized by autoradiography. The origin

and position of phosphatidylinositol 3-phosphate (PI3P) are indicated (A).

Serum-starved PAE cells expressing wild type CKR and tyrosine mutant CKRs

were treated with CSF-1 for 10 min, washed, lysed, cell extracts were normalized

for protein and immunoprecipitated with anti-VEGFR-2 antibody. The

immunoprecipitates were washed and subjected to western blot using anti-p85

antibody (B). The same membrane was stripped and reprobed with anti-VEGFR-

2 antibody (C). Serum-starved PAE cells expressing wild type CKR and tyrosine

mutant CKRs were stimulated with CSF-1 for 10 min, washed, lysed, and

incubated with Sepharose bound GST alone, GST-N-SH2-p85, or GST-C-SH2-

p85 fusion proteins. After extensive washing, the precipitated proteins were

subjected to western blot analysis using anti-VEGFR-2 antibody (D). Serum-

starved PAE cells expressing wild type CKR were stimulated with CSF-1 for 5-30

min, washed, lysed, cell extracts were normalized for protein level and subjected

to western blot using anti-phospho-Akt antibody (E).

by guest on March 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

25

Figure 4. Tyrosines 799 and 1173 of VEGFR-2 are not required for PLCγ1

activation. Serum-starved PAE cells expressing wild type CKR and tyrosine

mutant CKRs were stimulated with CSF-1 for 10 min, washed, lysed, cell extracts

were normalized for protein level. Immunoprecipitated with anti-PLCγ1 antibody

and subjected to western blot using anti-pY antibody (A). Total cell lysates were

subjected to western blot using anti-phosphoPLCγ1 antibody (C). The same

membranes were stripped and reprobed with anti-PLCγ1 antibody (B and D).

Figure 5. Wortmannin and rapamycin inhibit CKR-mediated cell

proliferation. Serum-starved PAE cells expressing wild type CKR pre-treated

with different concentrations of wortmannin (A) or rapamycin (C) and stimulated

with 1 ng/ml of CSF-1. DNA synthesis was measured by [3H] thymidine uptake

as described in Figure 2. The results are expressed as the mean of (cpm/well)

±SD of quadruplicates. The data are expressed as a ratio of stimulated over non-

stimulated samples. Serum-starved PAE cells expressing wild type CKR and

tyrosine mutant CKRs were stimulated with CSF-1, washed, lysed, cell extracts

were normalized for protein level and subjected to western blot using anti-

phospho-S6 kinase (p70) antibody (B).

Figure 6. Activation of MAP Kinase is not essential for CKR-mediated

cell proliferation. Serum-starved PAE cells expressing wild type CKR and

tyrosine mutant CKRs were stimulated with CSF-1 for 10 min, washed, lysed, cell

extracts were normalized for protein level and total cell lysates were subjected to

western blot using anti-phospho-MAPK antibody (A). The same membrane was

stripped and re-probed with anti-MAPK antibody (B). Serum-starved PAE cells

by guest on March 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

26

expressing wild type CKR were pre-treated with different concentrations of

PD98059, stimulated with 1 ng/ml CSF-1 and DNA synthesis was measured by

[3H] thymidine uptake. The results are expressed as the mean of (cpm/well) ±SD

of quadruplicates (C). The data are expressed as a ratio of stimulated over non-

stimulated samples. Serum-starved PAE cells expressing wild type CKR were

pre-treated with different concentrations of PD98059 or left non-treated for 30

min, stimulated with CSF-1 for 10 min, washed, lysed, cell extracts were

normalized for protein level and total cell lysates were subjected to western blot

using anti-phospho-MAPK antibody (D). The same membrane was stripped and

reprobed with anti-MAPK antibody (E).

Figure 7. Activation of Ras pathway is not necessary for CKR-mediated

cell proliferation: PAE cells expressing wild type CKR were infected with

retrovirus containing N17ras, cells were serum-starved for 24 hours and

stimulated with different concentrations of CSF-1, and DNA synthesis was

measured by [3H] thymidine uptake. The results are expressed as the mean of

(cpm/well) ±SD of quadruplicates (A). The data are expressed as a ratio of

stimulated over non-stimulated samples. PAE cells expressing wild type CKR

were infected with retrovirus containing N17ras, as described in part A, however

cells were lysed and subjected to western blot analysis by using anti-Ras

antibody (B).

by guest on March 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Volkan Dayanir, Rosana D. Meyer, Kameran Lashkari and Nader Rahimiproliferation

receptor-2/FLK-1 involved in activation of phosphatidylinositol-3 kinase and cell Identification of tyrosine residues in vascular endothelial growth factor

published online March 8, 2001J. Biol. Chem. 

  10.1074/jbc.M009128200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

by guest on March 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from