Vol. 169, No. 7JOURNAL OF BACTERIOLOGY, JUIY 1987, p. 3232-32360021-9193/87/073232-05$02.00/0Copyright © 1987, American Society for Microbiology

Identification of the Promoter of the Bacillus subtilis sdh OperonLARS MELIN,' KERSTIN MAGNUSSON,' AND LARS RUTBERG2*

Department ofBacteriology Karolinska Institutet, S-104 01 Stockholm,' and Department ofMicrobiology, University ofLund, Solvegatan 21, S-223 62 Lund,2 Sweden

Received 30 December 1986/Accepted 16 April 1987

The BaciUus subtilis sdhCAB operon contains the structural genes for the three subunits of themembranebound succinate dehydrogenase complex. An sd/-specific trasscript of about 3,450 nudeotides was

detected in vegetative bacteria. Sl nuclease mapping experiments showed that the sd/ operon is transcribedfrom a sigma43 promoter; the transcript starts at a guanosine residue 90 base pairs uptrm from the firstgene of the operon, sdhC. No sdh transcript was found in B. subtilis carrying the sdh-115 mutation, whichdecreases expression of the sdh operon by more than 99%. The sdh-115 mutation is a G-to-A tranition in the-35 region of the sigina-43 promoter. The sdh operon is sensitive to glucose repression. When the sdh promoterregion was used to drive transcription of the cat-86 gene this gene also became glucose repressed.

The Bacillus subtilis membranebound succinate dehydro-genase [SDH; EC 1.3.99.1, succinate:(acceptor) oxidoreduc-tase] complex contains equimolar amounts of three subunits:a flavoprotein, an iron-sulfur protein, and cytochrome b558(13). The level of SDH activity in the bacteria varies up to 5-to 10-fold, depending on the growth conditions. SDH issubject to glucose repression. The SDH activity increaseswhen growing bacteria enter stationary phase; this increaseis repressed by glucose (11, 23). Both glucose repression andpostexponential increase in enzyme activity are thought toreflect transcriptional control of the sdh genes. The struc-tural genes for the subunits of the SDH complex, sdhC(cytochrome b558), sdhA (flavoprotein), and sdhB (iron-sulfur protein), have been cloned and sequenced (12, 17, 18,24). The designation of these genes has recently been alteredto conform with the Escherichia coli sdh and frd operons(24). All three genes are closely linked and are thought toconstitute an operon (19, 24), which is transcribed in theorder sdhC, sdhA, sdhB. At least six sigma factors whichrecognize different promotor structures have been found inB. subtilis (5). The use of alternate promoters has beendescribed for several genes in B. subtilis, and minor forms ofRNA polymerase holoenzyme are known to be involved intemporal control of gene expression (5, 11, 15). In the sdhoperon, one sigma-43 and two possible sigma-32 promotersequences have been found upstream from sdhC (18). Theaim of the present experiments was to identify the promot-er(s) of the sdh operon.

MATERIALS AND METHODS

Bacteria and plasmids. The bacterial strains used were B.subtilis 3G18 (ade met trpC2) and 3G18 sdhAl2 (ade mettrpC2 sdhAl2 [8a]) and E. coli 5K (hsdR hsdM thi thr rpsTlacZ). Plasmid pKIM4 (Fig. la) is a derivative of pHV32(22), which carries the sdh promoter region, sdhC, and partof sdhA (17). pKIM115 is pKIM4 carrying mutation sdh-15.pLR1 is a derivative of the promoter-searching plasmidpPL603 (34); it carries a promoterless cat-86 gene andexpresses resistance to kanamycin.Media. The bacteria were maintained on tryptic blood agar

base (Difco); antibiotics were used as needed. Liquid cul-tures were grown in LB broth (20) or in nutrient sporulation

* Corresponding author.

medium (8); details are given in the respective figure legends.When used, antibiotics were added at the following concen-trations: chloramphenicol and kanamycin, 5 ,ug ml-'; ampi-cillin, 35 ,ug ml-l.Competent B. subtilis (1) and E. coli (20) were prepared by

published methods.Extraction of DNA and RNA. Plasmid DNA was prepared

by standard methods (20). RNA was purified from B. subtilisand E. coli by the hot-phenol method (32).

Blotting techniques. DNA was transferred to nitrocellulosefilters after separation on agarose gels by the method ofSouthern (29). Hybridization with labeled probes was donewith the same protocol. For RNA, total RNA was separatedon agarose-formaldehyde gels, transferred to nitrocellulosefilters, and hybridized with a probe as described previously(2).

S1 nuclease mapping. S1 nuclease mapping was doneessentially as described by Berk and Sharp (2).

General methods. Restriction enzymes, T4 polynucleotideligase, DNA polymerase I (Klenow fragnent), calf intestinalphosphatase, and polynucleotide kinase were from NewEngland BioLabs, Inc., or Boehringer GmbH and were usedas instructed by the manufacturers. Nick translation wasdone with a kit from Amersham Corp. DNA sequencing wasdone by the dideoxy chain-terminating method (27) by usingthe phage M13 system (21) and by using primers specific forthe sdh operon (18). SDH activity was measured as de-scribed previously (13), and chloramphenicol acetyltrans-ferase (CAT) activity was measured by a colorimetricmethod (28).

RESULTSIdentification of an sdh transript. Inspection of the nucle-

otide sequence upstream from sdhC has revealed a typicalsigma-43 promoter sequence and two possible sigma-32promoter sequences (18). All three sequences are locatedwithin 200 base pairs (bp) upstream from the ATG initiationcodon of sdhC. To show that this segment contains promot-ers which are active in vivo in B. subtilis and also to facilitatelater analysis of the sdh promoter region, the followingexperiment was done. Plasmid pLR1 is a derivative ofpPL603 (34). About 200 bp upstream, the promoterlesscat-86 gene of pLR1 contains a cloning cassette from bac-teriophage M13mp8 (21). A 520-bp Sau3A-PstI fragmentfrom pKIM31 (Fig. la) was cloned into BamHII-PstI-cleaved

3232

on June 19, 2017 by guesthttp://jb.asm

.org/D

ownloaded from

PROMOTER OF THE B. SUBTILIS sdh OPERON 3233

a cyt__ _ I T-- I

a

B S P

Fp

~~~P

Bg I 1

FIG. 1. (a) General structure of the B. subtilis sdh operon, with some relevant restriction sites indicated. The sdh promoter is locatedwithin the 520-bp Sau3A-PstI fragnent. Parts of the operon have been subcloned in plasmids pKIM4 (17) and pKIM31, which were used inthe present work. Abbreviations: B, BamHI; E, EcoRI; P, PstI; and S, Sau3A. The bar represents 1 kb. (b) General structure of pSDP4. The520-bp Sau3A-PstI fragment which contains the sdh promoter region is drawn with double lines. The single line indicates the vector, with thecat-86 gene marked as a hatched box. Abbreviations: Kmr, kanamycin resistance gene from pUB110; ori, origin of replication of pSDP4; T,TaqI. Other abbreviations are defined in the legend to Fig. la.

pLR1. The fragment harbors the promoter sequences de-scribed above and extends 290 bp into the sdhC codingregion. The resulting plasmid, pSDP4 (Fig. lb), confersresistance to at least 50 jig of chloramphenicol ml-' in B.subtilis.The cat-86 gene in pSDP4 is carried on a 3.2-kilobase (kb)

BamHI-BglII fragment which does not include the origin ofreplication ofpLRl. This fragment was isolated, self-ligated,and used to transform B. subtilis 3G18, selecting for resist-ance to 5 jig of chloramphenicol ml-'. Such transformantscan arise only by integration of the fragment into the B.subtilis chromosome by homologous recombination (10, 22).Southern blotting (29) of DNA from one such transformant,3G18::sdp8 cleaved with PstI, confirmed that the BamHI-BglII fragment had integrated in tandem with the sdh operon(Fig. 2).To demonstrate the presence of an sdh transcript in B.

subtilis, RNA was extracted from several strains and frac-tionated by agarose gel electrophoresis under denaturingconditions. The RNA was then transferred to nitrocellulosefilters and hybridized to a nick-translated 520-bp Sau3A-PstIfragment from pKIM4. In strain 3G18, a transcript of about3,450 nucleotides (nt) was found (Fig. 3a). No transcriptwhich hybridized with the probe was found in strain 3G18sdhA12, a strain in which essentially all of the sdh operon,

CytA CA-86

I

a P

including the promoter region, is deleted (8a), which con-firms the specificity of the probe. Also, no transcript wasdetected in bacteria which carried the sdh-115 mutation.This mutation decreases expression of all three genes of thesdh operon by more than 99% (19; L. Hederstedt, unpub-lished data); sdh-15 is a promoter down mutation (seebelow). A 3,450-nt transcript was detected also in strain3G18(pSDP4) and in 3G18::sdp8 (Fig. 3b). In addition, a

a 2 3 b

3460-

23.s

16s-

1 2 3

SDH _

CAT

__

SDH

8(B/b) P

kb

FIG. 2. Structure of part of the 3G18::sdp8 chromosome carry-

ing the 3.2-kb BamHI-BgRI fragment from pSDP4. The arrows

indicate the approximate start and direction of transcription fromthe duplicated sdh promoter. S(B/b) is the Sau3A site generated byself-ligation of the 3.2-kb BamHI-BglII fragment. cytA denotes thetruncated cytochrome b558 (sdhC) gene. b, Bglll; other abbrevia-tions are defined in the legend to Fig. la.

FIG. 3. Filter hybridization of RNA (Northern blots) from dif-ferent B. subtilis strains with a nick-translated 520-bp Sau3A-PstIfragment from pKIM4 which contains the sdh promoter region andthe 5' half of the sdhC gene (see Fig. la). The bacteria were grownwith shaking at 37°C in 100 ml of LB medium in 1-liter flasks havingindentations. RNA was extracted from exponentially growing cells(A6w = 0.6) (32), fractionated by agarose gel electrophoresis underdenaturating conditions, transferred to nitrocellulose filters, andthen hybridized with the probe. RNA from the following strains wastested. (a) Lanes: 1, strain 3G18; 2, 3G18 sdhAl2; 3, strain 3G18sdh-115. (b) Lanes: 1, strain 3G18 sdh-115 2, strain 3G18::sdh8; 3,strain 3G18(pSDP4).

lp

i I 1--- b

pKIM4

pKIM 31 orn

VOL. 169, 1987

on June 19, 2017 by guesthttp://jb.asm

.org/D

ownloaded from

3234 MELIN ET AL.

a C b

2i _Iis" - 4

1

X f an

b .

bl vxN 3 ; @

:120-.

FIG. 4. Si nuclease mapping of the sdh promoter. The bacteria were grown in LB medium as described in the legend to Fig. 3 andharvested during exponential growth (A6N = 0.5 to 0.7) for RNA extraction. Si nuclease mapping was done essentially as described inreference 2. The end-labeled probe used as a SmaI-TaqI fiagment from pSDP4 (see Fig. lb) which contains the whole sdh promoter regionand which extends 29 nt into the sdhC gene. RNA from the foliowing strains was tested. (a) Lane A, strain 3G18; lane B, strain 3G18 sdh-11S.(b) Lanes 1, E. coli SK(pKIM4); 2, E. coli 5K(pKIM115); 3, strain 3G18; 4, 3G18(pSDP4); 5, 3G18::sdp8; 6, probe incubated without RNA.The rightmost lanes in panel a and the leftmost lanes in panel b are sequencing gels used for size determination of fragments.

smaller transcript of about 1,250 nt was found which repre-sents cat-86 transcription driven by the sdh promoter. Bothstrains contain larger amounts of cat-86 transcript comparedwith sdh. For strain 3G18(pSDP4), this is an expected genecopy effect. In 3G18::sdp8, this could reflect, for example,duplication of the integrated BamHI-BgllI fragment (36) orgreater stability of the cat-86 transcript.Mapping of the sdh promoter. The potential sigma-43

promoter starts 96 bp upstream from the ATG initiationcodon 6f sdhC, and the two tentative sigma-32 promotersstart 62 and 148 bp, respectively, upstream from the sameATG (18). The promoter sequences do not overlap. Toidentify the sdh promoter(s), the transcriptional start of thesdh transcript was mapped by Si nuclease protection exper-iments. RNA was extracted from different B. subtilis strainsand also from E. coli(pKIM4) and E. coli(pKIM115). Theprobe used was an SmaI-TaqI fragment from pSDP4. TheTaqI site starts at nt 29 in the sdhC coding region; the SmaIsite is located 5 bp upstream from the Sau3A site in pSDP4.In strain 3G18, a single protected fiagment of 120 nt wasfound, whereas no protected fragment was found in RNAfrom bacteria carrying the sdh-115 mutation (Fig. 4a). Asingle 120-nt protected fragment was detected also in RNAfrom strain 3G18(pSDP4), 3G18::sdp8, and E. coli(pKIM4)(Fig. 4b). These results place the transcriptional start of thesdh operon at a guanosine residue about 10 bp downstreamfrom the middle of the sigma43 -10 sequence (Fig. 5). Theyalso confirm a previous suggestion that, in pKIM4, sdhC istranscribed from its native promoter in E. coli (18). Inaddition to the 120-nt fragment, several minor fragments ofabout 100 nt each were found in RNA from E. coli(pKIM4).We do not know whether these latter fragments represent

Sou 3MITATAGCTCAAACAGGGGGGAGGATTACAGAATGATCCTGT 40

AATTCTTATGAAAAATTAAGCAAGAAATATATATTGATAA80AATAAAATTTTTCAATCAACTAATCAATTCGGAAAATTAT 120

(+1I31) (rbs x)AATTTAT6TACGCGTTTT CCTTTTGAG 160

(Orfx) -3200AGAAATTGTCAATAAATCTTAATAAAGTGCTTA

-10 +1

CAATTGAAAGAAGTGGGGGAAGAGATTTAGCACATTTCGC 240

(stop X)ACTTATCAAACAGGGQGTAAAGTA ATG TCT GGG AAC 278

rbs sadheAGA GAG TTT TAT TTT CGA AGA TTG CAT 305

Taq IFIG. 5. Nucleotide sequence of the sdh promoter region; the

numbering of the nucleotides is based upon that in reference 18. The-35 and -10 sequences of the promoter are underlined, the markedG residue at +1 indicates the transcriptional start, the proposedribosome-binding sequence for sdhC is underlined, and the start ofsdhC is indicated. The G residue, marked with an asterisk in the -35region, is mutated to an A residue in strain 3G18 sdh-11S. Withinsets of parentheses are shown the new transcriptional start found inE. coli 5K(pKIM115) (+1X), the proposed ribosome-binding site(rbsX), and the start (orfX) and stop (stopX) of the region coding fora small peptide upstream ofsdhC and which overlaps with this gene.

J. BACTERIOL.

on June 19, 2017 by guesthttp://jb.asm

.org/D

ownloaded from

PROMOTER OF THE B. SUBTILIS sdh OPERON 3235

additional transcriptional starts or degradation at the 5' endof the 120-nt fragment.

In E. coli(pKIM115), the 120-nt protected fragment wasnot found; instead, a longer fragment of 167 nt appeared(Fig. 4b), suggesting that a new transcriptional start wasused. This is surprising since we have not detected any B.subtilis cytochrome b558 in E. coli(pKIM115). Inspection ofthe sequence contained in the pKIM115 transcript revealed astrong ribosomal binding site (GGAGG) followed after sevenbases by an ATG initiating an open reading frame whichterminates with a TAA stop codon overlapping the startcodon of sdhC (Fig. 5) (18). Translation of this short peptidemay effectively block translation of sdhC from the samemRNA. Sequencing of the sdh-115 mutation has shown it tobe a G-to-A transition in the sigma-43 -35 sequence (Fig. 5).

In the experiments described above, in which RNA wasextracted from exponentially growing cells, we cannot ex-clude the possibility that a minor sdh promoter is activated,e.g., during sporulation. However, we have not been able todetect any increased SDH activity in 3G18 sdh-115 instationary-phase cultures grown in several different media,including nutrient sporulation medium (8).

Control of cat-86 expression from the sdh promoter. Theexperiments described above have identified the (major) sdhpromoter. In order to see whether control elements involvedin glucose repression were located within the 520-bp Sau3A-PstI fragment in pSDP4, the effect of glucose on cat-86expression was determined. In 3G18::sdp8, both SDH andCAT activities increased during stationary phase, and bothactivities were repressed by glucose (Fig. 6). Transcriptionof sdh starts at the same G nucleotide both in the presenceand in the absence of glucose (data not shown). No glucoseeffect on cat-86 expression was found in 3G18(pSDP4); thisfinding most likely reflects a gene copy number effect.

DISCUSSIONThe expected size of the B. subtilis sdh operon transcript

is about 3,300 nt, as calculated from the transcriptional startdetermined here and the proposed stem-loop terminationstructure downstream from the sdhB gene (24). In Northernblots, an sdh transcript of about 3,450 nt was found; this 5%difference from the calculated size could well be within theerror of the size determination. A new reading frame opens65 bp downstream from sdhB (24). The present size estimateof the sdh transcript, as well as the location of the termina-tion structure proposed above (24, 33), make it unlikely thatthis open reading frame is part of an sdh transcript.

S1 nuclease protection experiments using RNA from B.subtilis strains with the sdh promoter region in a chromo-somal or plasmid location have shown that the sdh transcriptstarts at a G residue located 10 bp downstream from themiddle of a typical sigma-43 -10 sequence. The sdh-115mutation, which decreases expression of the sdh operon bymore than 99%, is a G-to-A transition in the -35 sequence ofthe same sigma-43 promoter. The fact that we cannot detectany sdh transcript in bacteria carrying the sdh-115 mutation-makes it very unlikely that an alternative promoter, otherthan the sigma-43, can be used to transcribe the sdh operonat a rate required for normal functioning of the Krebs cycleduring growth. B. subtilis mutants which produce about 10%of wild-type SDH activity have an SDH-negative phenotype(L. Hederstedt, unpublished data); i.e., they accumulate andexcrete succinate. Although we cannot exclude the possibil-ity that some minor promoter can be used to transcribe thesdh operon, we conclude that the sigma-43 promoter de-scribed above is the (major) sdh promoter.

This promoter is also used to transcribe the sdhC gene inE. coli(pKIM4). However, when the promoter is weakenedby the sdh-15 mutation, a new transcriptional start 47 ntupstream from the wild-type start appears. This start is notused in B. subtilis. Upstream from this start there is a perfectsigma-70E, -10 box. The plasmid pKIM115 carries thewhole sdhC gene, yet the gene is not expressed in E. colialthough it is clearly transcribed from the "new" upstreampromoter. A possible explanation is that translation of asmall peptide that terminates within sdhC blocks translationof this gene.

Several enzymes in B. subtilis are glucose repressed (6, 7,23). For aconitase, there is fair evidence that glucose repres-sion causes a decreased transcriptional rate of the respectivegene, citB (26). The fact that cat-86 expression in 3G18: :sdp8is glucose repressed argues that, for sdh also, glucoserepression affects transcription.

In E. coli, glucose repression has been shown to operatevia affecting the levels of cyclic AMP in the cells, and themechanics of the regulation are known in considerable detail(4). Little is known about the corresponding mechanisms inB. subtilis. This latter bacterium is thought not to containcyclic AMP (3, 14), although there is at least one report tothe contrary (16). A number of glucose-resistant sporulationmutants of B. subtilis have been isolated (30, 31). One ofthese mutations has been located to the gene rpoD, whichcodes for the sigma-43 polypeptide (25, 33), and anothermutation maps in the rpoBC operon (30).

If glucose affects transcription in B. subtilis catabolite-repressed genes, it might be possible to identify someconserved nucleotide sequences in the promoter region of

1.0

Ia

0.0.-

0.6 F

0.4 F

2.0

1.5

Q

1.0

0.5

log To T1 T2 T3 T4Time (h)

FIG. 6. Effect of glucose on CAT and SDH activities in3G18::sdp8. The bacteria were grown in LB medium with andwithout 0.5% glucose as described in the legend to Fig. 3. When theculture entered stationary phase (To), samples were withdrawn atintervals and assayed for enzyme activity. The activities are ex-

pressed as micromoles per min per milligram of protein. Symbols:SDH activity with (O) or without (0) glucose; CAT activity with (D)or without (0) glucose.

IIt I -

VOL. 169, 1987

0.2

on June 19, 2017 by guesthttp://jb.asm

.org/D

ownloaded from

3236 MELIN ET AL.

such genes. So far, very few glucose-repressed genes havebeen sequenced, and so very few of their promoters havebeen mapped carefully. A comparison between the promoterregion for the gnt operon (9) and sdh aligned at the commonTTG of the -35 sequence shows that 9 of 12 bases(AAT'ITAAAtaTA) from -49 to -60 are identical. How-ever, since most B. subtilis sigma-43 promoters have veryAT-rich -40 to -60 regions, the significance of this homol-ogy is uncertain. Promoter regions from more glucose-repressed genes have to be characterized before sequencesspecifically involved in repression may be identified.

ACKNOWLEDGMENTS

We thank Alexander von Gabain for much help.This work was supported by a grant from the Swedish Medical

Research Council.

LITERATURE CITED1. Arwert, F., and G. Venena. 1973. Transformation in Bacillus

subtilis. Fate of newly introduced transforming DNA. Mol.Gen. Genet. 123:185-198.

2. Berk, A. J., and P. A. Sharp. 1977. Sizing and mapping of earlyadenovirus mRNAs by gel electrophoresis of S1 endonuclease-digested hybrids. Cell 12:721-723.

3. Bernlohr, R. W., M. K. Haddox, and N. D. Goldberg. 1974.Cyclic guanosine 3':5' monophosphate in Escherichia coli andBacillus licheniformis. J. Biol. Chem. 249:4329-4331.

4. Crombrugghe, B., S. Busby, and H. Buc. 1984. Cyclic AMPreceptor protein: role in transcription activation. Science 224:831-838.

5. Doi, R. H., and L.-F. Wang. 1986. Multiple procaryotic ribonu-cleic acid polymerase sigma factors. Microbiol. Rev. 50:227-243.

6. Fisher, S. H., and B. M nik. 1984. Isolation of Bacillussubtilis mutants pleiotropically insensitive to glucose cataboliterepression. J. Bacteriol. 157:942-944.

7. Fisher, S. H., and A. L. Sonenshein. 1984. Bacillus subtilisglutamine synthetase mutants pleiotropically altered in glucosecatabolite repression. J. Bacteriol. 157:612-621.

8. Fortagel, P., and E. Freese. 1968. Analysis of sporulationmutants. II. Mutants blocked in the citric acid cycle. J. Bacte-riol. 95:1431-1438.

8a.Frid6n, H., L. Hederstedt, and L. Rutberg. 1987. Deletion of theBacillus subtilis sdh operon. FEMS Microbiol. Lett.41:203-206.

9. Fujita, Y., and T. Fujita. 1986. Identification and nucleotidesequence of the promoter region of the Bacillus subtilis glucon-ate operon. Nucleic Acids Res. 14:1237-1252.

10. Haldenwang, W. G., C. D. B. Banner, J. F. Ofllngton, R. Losick,J. A. Hoch, M. B. O'Connor, and A. L. Sonenshein. 1980.Mapping a cloned gene under sporulation control by insertion ofa drug-resistance marker into the Bacillus subtilis chromosome.J. Bacteriol. 142:90-98.

11. Hanson, R. S., and D. P. Cox. 1967. Effect of different nutri-tional conditions on the synthesis of tricarboxylic acid cycleenzymes. J. Bacteriol. 93:1777-1787.

12. Hasnain, S., R. Sammons, I. Roberts, and C. M. Thomas. 1985.Cloning and deletion analysis of a genomic segment of Bacillussubtilis coding for the sdhABC (succinate dehydrogenase) andgerE (spore germination) loci. J. Gen. Microbiol. 131:2269-2279.

13. Hederstedt, L. 1986. Molecular properties, genetics and biosyn-thesis of Bacillus subtilis succinate dehydrogenase complex.Methods Enzymol. 126:399-414.

14. Ide, M. 1971. Adenyl cyclase of bacteria. Arch. Biochem.Biophys. 144:262-268.

15. Johnson, W. P., C. P. Moran, Jr., and R. Losick. 1983. Two

RNA polymerase sigma factors discriminate between overlap-ping promoters for a developmentally regulated gene. Nature(London) 302:800-804.

16. Mach, H., M. Hecker, and F. Mach. 1984. Evidence for thepresence of cyclic adenosine monophosphate in Bacillus sub-tilis. FEMS Microbiol. Lett. 22:27-30.

17. Magnusson, K., L. Hederstedt, and L. Rutberg. 1985. Cloningand expression in Escherichia coli of sdhA, the structural genefor cytochrome b,58 of the Bacillus subtilis succinate dehydro-genase complex. J. Bacteriol. 162:1180-1185.

18. Magnusson, K., M. K. Philps, J. R. Guest, and L. Rutberg.1986. Nucleotide sequence of the gene for cytochrome b558 ofthe Bacillus subtilis succinate dehydrogenase complex. J. Bac-teriol. 166:1067-1071.

19. Magusson, K., B. Rutberg, L. Hederstedt, and L. Rutberg.1983. Characterization of a pleiotropic succinate dehydrogen-ase-negative mutant of Bacillus subtilis. J. Gen. Microbiol.129:917-922.

20. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecularcloning: a laboratory manual. Cold Spring Harbor Laboratory,Cold Spring Harbor, N.Y.

21. Messing, J., and J. Vieira. 1982. A new pair of M13 vectors forselecting either DNA strand of double-digest restriction frag-ments. Gene 19:269-276.

22. Niaudet, B., A. Goze, and S. D. Ehrlich. 1982. Insertionalmutagenesis in Bacillus subtilis: mechanism and use in genecloning. Gene 19:277-284.

23. Ohne, M. 1975. Regulation of the dicarboxylic acid part of thecitric acid cycle in Bacillus subtilis. J. Bacteriol. 122:224-234.

24. Phillips, M. K., L. Hederstedt, S. Hasnain, L. Rutberg, and J. R.Guest. 1987. Nucleotide sequence encoding the flavoprotein andiron-sulfur protein subunits of the Bacillus subtilis PY79 suc-cinate dehydrogenase complex. J. Bacteriol. 169:864-873.

25. Price, C. W., and R. Doi. 1985. Genetic mapping of rpoDimplicates the major sigma factor of Bacillus subtilis RNApolymerase in sporulation initiation. Mol. Gen. Genet. 201:88-95.

26. Rosenkrantz, M. S., D. W. Dingman, and A. L. Sonenshein.1985. Bacillus subtilis citB gene is regulated synergistically byglucose and glutamine. J. Bacteriol. 164:155-164.

27. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequenc-ing with chain-terminating inhibitors. Proc. Natl. Acad. Sci.USA 74:5463-5467.

28. Shaw, W. V. 1975. Chloramphenicol acetyltransferase fromchloramphenicol-resistant bacteria. Methods Enzymol. 43:737-755.

29. Southern, E. 1979. Gel electrophoresis of restriction fragments.Methods Enzymol. 68:152-176.

30. Sun, D., and I. Takahashi. 1983. A catabolite-resistant mutationis located in the rpo operon of Bacillus subtilis. Can. J.Microbiol. 30:423-429.

31. Takahashi, I. 1979. Catabolite repression-resistant mutants ofBacillus subtilis. Can. J. Microbiol. 25:1283-1287.

32. von Gabain, A., J. G. Belasco, J. L. Schottel, A. C. Y. Chang,and S. N. Cohen. 1983. Decay of mRNA in Escherichia coli:investigation of the fate of specific fragments of transcripts.Proc. Natl. Acad. Sci. USA 80:653-657.

33. Wang, L.-F., and R. Doi. 1986. Nucleotide sequence andorganization of Bacillus subtilis RNA polymerase major sigma(43) operon. Nucleic Acids Res. 14:4293-4307.

34. Wlliams, D. M., E. J. Duvali, and P. S. Lovett. 1981. Cloningrestriction fragments that promote expression of a gene inBacillus subtilis. J. Bacteriol. 146:1162-1165.

35. Wong, S.-L., C. W. Price, D. S. Goddfarb, and R. Doi. 1984. Thesubtilisin E. gene of Bacillus subtilis is transcribed from a sigma37 promoter in vivo. Proc. Natl. Acad. Sci. USA 81:1184-1188.

36. Young, M. 1983. The mechanism of insertion of a segment ofheterologous DNA into the chromosome of Bacillus subtilis. J.Gen. Microbiol. 129:1497-1512.

J. BACTERIOL.

on June 19, 2017 by guesthttp://jb.asm

.org/D

ownloaded from