Identification and Functional Analysis of dTDP-Glucose-4,6-Dehydratase Gene and Its Linked Gene Cluster in an AminoglycosideAntibiotics Producer of Streptomyces tenebrarius H6

Yu Du,* Tianbo Li,* Yiguang G. Wang, Huanzhang Xia

Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences, Peking Union Medical College, Tiantan Xili No1,Beijing 100050, China

Received: 5 August 2003 / Accepted: 14 January 2004

Abstract. Streptomyces tenebrarius H6 produces a variety of aminoglycoside antibiotics, such asapramycin, tobramycin, and kanamycin B. Primers were designed according to the highly conservedsequences of the dTDP-glucose-4,6-dehydratase genes, and a 0.6-kb PCR product was obtained from S.tenebrarius H6 genomic DNA. With the 0.6-kb PCR product as a probe, a BamHI 7.0-kb fragment wasisolated. DNA sequence analysis of the 7.0-kb fragment revealed four ORFs and an incomplete ORF. Insearch of databases, the deduced product of one ORF (orfE) showed 62% identity to the dTDP-glucose-4,6-dehydratase, StrE of S. griseus. Three other ORFs (orfG1, orfG2, and orfGM) showed 55%, 62%, and42% similarities, respectively, to glycosyltransferase from Clostridium acetobutylicum and mannosyl-transferase from Xanthomonas axonopodis pv. citri str. 306 and glycosyltransferase from Pseudomonasputida KT2440. Upstream of the orfE was an incomplete ORF, and the deduced product showed 56%similarity to dTDP-4-dehydrorhamnose, StrL from S. griseus. The function of the orfE gene was studiedby targeted gene disruption. The resulting mutant failed to produce tobramycin and kanamycin B, but stillproduced apramycin, suggesting that the orfE gene and linked gene cluster are essential for thebiosynthesis of tobramycin and kanamycin B in S. tenebrarius H6.

Aminoglycosides are both indispensable chemotherapeu-tics and interesting targets of basic research. The mostattractive aspects of aminoglycoside antibiotic researchcurrently are the emergent genetic and biochemical dataon their biosynthesis and regulation; the molecularmechanisms of resistance developed in both producersand clinically relevant pathogens; the molecular aspectsof interaction with cellular components in both pro-karyotes and human; and new fields of application andnew pharmacologically relevant targets such as the suc-cessful glycosidase inhibitors.

Naturally produced aminoglycosides have similarstructures and similar biosynthetic pathways. Despitemany efforts to understand the molecular genetics ofaminoglycoside antibiotics-producing actinomycetes,only two systems have been studied in detail to date,

those for streptomycins [11] and fortimicins (as-tromicins) [4], which contain the fully substituted ami-nocyclitol streptamine formed from myo-inositol [6].The molecular genetics of the biosynthesis of anothermajor group of classical aminocyclitol antibiotics thatcontain the 2-deoxystreptamine (DOS) moiety such askanamycin, tobramycin, and butirosin has not yet beenreported. In contrast to streptamine, 2-deoxystreptamineis biosynthesized from glucose-6-phosphate [6, 18].Only one paper described the identification of the btrCgene encoding 2-deoxy-scyllo-inosose synthase, a keyenzyme converting glucose-6-phosphate into 2-deoxy-scyllo-inosose, the initial step of the biosynthesis of the2-deoxystreptamine moiety from a butirosin-producingstrain B. circulans [9].

A variety of aminoglycoside antibiotics (Fig. 1),mainly apramycin, tobramycin, and kanamycin B (insmall amount) [7, 16, 19], are produced by Streptomycestenebrarius H6, which was orginally isolated from the

* These authors contributed equally.

Correspondence to: Y.G. Wang; email: wangyh456@hotmail.com

CURRENT MICROBIOLOGY Vol. 49 (2004), pp. 99–107DOI: 10.1007/s00284-004-4212-z Current

MicrobiologyAn International Journal© Springer-Verlag New York, LLC 2004

Sichuan province of China. Apramycin is an aminogly-coside broad-spectrum antibiotic that has unique octosestructure and is active with many Gram-negative bacteriaresistant to various aminoglycoside antibiotics. It is usedfor veterinary infections as well, especially in respiratoryinfections. Among aminoglycoside antibiotics, tobramy-cin exhibits the most potent activity against Pseudomo-nas aeruginosa. To understand the biosynthesis of thisclinically important antibiotic, the highly conserved se-quence of the dTDP-glucose-4,6-dehydratase gene wasused to explore the S. tenebrarius H6 tobramycin/kana-mycin or apramycin biosynthetic gene clusters.

Materials and Methods

Strains, plasmids, and growth conditions. Streptomyces tenebrariusH6, E. coli ET12567 (pUZ8002) [8] used as donor strain for conjuga-tion were obtained from Shenyang Pharmaceutical University; E. coliDH1 [8] was used as recipient for in vitro packaging, S. lividans TK24[8] was used for hetero-expression of orfE, and Bacillus subtilis (fromthis lab) was used as test organism for bioassay; Streptomyces-E. colibi-functional plasmid pKC505 [8] was used for construction ofgenomic library; plasmids pUC18 [13], pIJ2925 [8] were used forcloning and subcloning. Streptomyces-E. coli shuttle plasmid pHZ132

[1] was used for gene disruption; erythromycin-resistant gene ermE [3]in 1.7-kb KpnI fragment was excised from plasmid pWHM2 [17],cloned in pUC18, and then inserted in orfE as a selective marker in thegene disruption experiments. Agar medium (SM) for the S. tenebrariusH6 sporulation and the conjugation between S. tenebrarius H6 and E.coli; liquid medium (SGGP) for S. tenebrarius H6 mycelium growth;and (R2YE) for S. lividans TK24 protoplast formation and regenerationwere prepared as described by Hopwood et al. [8]. For antibioticsproduction in S. tenebrarius H6, fermentation was carried out by usingseed culture medium (glucose, 1.0 g; soy meal, 1.0 g; peptone, 0.3 g;yeast powder, 0.1 g; corn meal, 0.5 g; CaCO3, 0.1 g; distilled water to100 mL) and fermentation medium (glucose, 2.0 g; soluble starch,2.0 g; soy meal, 4.0 g; yeast powder, 0.5 g; CaCO3, 0.5 g; MgSO4 �

7H2O, 0.4 g; FeSO4, 0.005 g; ZnSO4, 0.003 g; NH4Cl, 0.3 g; soy oil,1.0 g; distilled water to 100 mL; pH 7.0) Agar (1.5%) was added to thefermentation medium to make fermentation agar medium. 2�YT me-dium used in conjugation was prepared as described by Hopwood et al.[8]. If necessary, erythromycin (Em) was added at a concentration of200 �g/mL; nalidixic acid was added at a concentration of 100 �g/mL.E. coli strains were grown in Luria-Bertani (LB) medium at 37°C,supplemented with 100 �g/mL ampicillin, 25 �g/mL chloromycetin, or25 �g/mL kanamycin when necessary. Bacillus subtilis was incubatedin bioassay medium (peptone, 0.6 g; beef extract, 0.15 g; yeast extract,0.6 g; glucose, 0.2 g; agar, 0.5 g; distilled water to 100mL; pH 7.0) at37°C.

Fig. 1. Aminoglucoside antibiotics produced byStreptomyces tenebrarius H6.

100 CURRENT MICROBIOLOGY Vol. 49 (2004)

Construction of genomic library. Genomic DNA of S. tenbrarius H6was partially digested with Sau3AI. After sucrose gradient centrifuga-tion, 20–30-kb fragments were collected, treated with alkaline phos-phatase, followed by ligating into shuttle cosmid vector pKC505. Theligated DNAs were packaged with in vitro packaging extract (pur-chased from Promega Corporation) and transduced into E. coli DH1.3000 transductants were picked, and the overall coverage of the ge-nome was over 99.926% in the constructed genomic library of S.tenebrarius H6.

Primers and PCR conditions. Primers 1, 2 were designed accordingto the highly conserved sequence of the dTDP-glucose-4,6-dehydratasegenes in streptomycin and other 6-deoxyhexose biosynthesis-related,antibiotics-producing strains. Primers s and a used for PCR in order toconfirm the orfE gene disruption were designed by referring to theupper part sequence of the orfE gene in the chromosome of S. tene-brarius H6 and to the internal part of ermE gene sequence:

Primer 1: 5�-GSGGSGSSGCSGGSTTCATSGG-3�Primer 2: 5�-GGGWRCTGGYRSGGSCCGTAGTTG-3� (R �

A/G, W � A/T, Y � C/T, S � C/G)Primer s: 5�-TCGTGCGGGGCGACATCT-3�Primer a: 5�-ATCGGCAGCACCCCAACC-3�PCR reactions were performed with S. tenebrarius H6 and orfE

disruption mutants genomic DNA as templates at 98°C for 4 min,followed by 30 cycles of 40 s at 96°C and 40 s at 55°C, 1.5 min at72°C, and an additional 5 min at 72°C. The PCR products were purifiedwith Wizard SV Gel and PCR Clean-Up System (purchased fromPromega Corporation) as described by the manufacturer.

DNA sequencing analysis. Plasmid pUC18 was used as DNA se-quencing vector. Sequencing was done by the dideoxy chain termina-tion method in Takara Company. ORF analysis was carried out withFramePlot 3.0beta (http://watson.nih.go.jp/�jun/cgi-bin/frameplot-3.0b.pl) based on G/C bias in codons in Streptomycetes. Deducedamino acid sequences were compared with the National Center forBiotechnology Information (NCBI) database by using the BasicBLAST search.

Gene disruption. The recombinant plasmid was constructed for tar-geted disruption of orfE. The erythromycin-resistance gene (ermE) wasexcised as a 1.7-kb KpnI fragment from plasmid pUC18/ermE and theninserted into the KpnI site of pIJ2925. A 0.6-kb SalI internal fragmentin the orfE gene, which extends from the 444-bp position to the1062-bp position, was also cloned into the SalI site of plasmid pIJ2925to give plasmid pIEK0.6. The 2.3-kb BglII fragment possessing orfE-ermE was released and cloned into the BamHI site of pHZ132, resultingin recombinant plasmid pHOE0.6.

Plasmid pHOE0.6 was introduced into the S. tenebrarius H6 byconjugation from E. coli ET12567/pUZ8002 according to the methoddescribed by Hopwood et al. [8]. Conjugation was carried out on SMmedium at 37°C for 20–22 h. After overlaying with erythromycin (200�g/mL) and nalidixic acid (100 �g/mL), incubation was continued at37°C for 5–7 days. Exconjugants resistant to erythromycin were iso-lated, re-streaked on SM plates containing erythromycin and nalidixicacid, and incubated at 37°C for three rounds of sporulation. Coloniesstably resistant to erythromycin were grown at 42°C for 5–7 days onSM plates containing erythromycin to facilitate the chromosomal inte-gration of pHOE0.6. Single colonies were picked for determination ofantibiotics production.

To test the stability, orfE mutant was inoculated on SM platenon-selectively for three rounds of sporulation, then inoculated on SMplates with or without erythromycin.

To confirm the integration of the ermE gene into the orfE locus,genomic DNA was isolated from exconjugants, and PCR was carried

out by using primers a and s. PCR product from both ends wassubjected to sequencing analysis, and the result was compared with theavailable sequence data of orfE and ermE gene sequence.

Complementation of orfE gene in the gene disruption mutant. A1.5-kb XbaI fragment containing intact orfE gene was obtained fromgenomic DNA of the wild-type strain of S. tenebrarius H6 by PCR withPrimers 3 and 4:

Primer 3: 5� CATATCTAGATGCACCGGAGGACTG 3�;Primer 4: 5� ACGTTCTAGACGGTGTACGCGAAGG 3�.This fragment was inserted into the XbaI site of pUC18, and the

ermE gene was subcloned as a KpnI fragment into the KpnI site of thesame plasmid, generating the plasmid pUCEE. Then, the 3.2-kb PstI-EcoRI fragment containing orfE-ermE was subcloned into the BamHIsite of pHZ132, resulting in construction of final plasmid pHZ132EE.

PHZ132EE was introduced into S. lividans TK24 by protoplasttransformation. The erythromycin-resistant transformants of S. lividansTK24 (pHZ132EE) were grown in SGGP medium at 28°C for 2 days,and orfE gene disruption mutants were incubated in 40 mL of fermen-tation medium at 37°C for 2 days, separately, then 5 mL of themycelium culture of S. lividans TK24 (pHZ132EE) was transferred into40 mL of fermentation culture broth of orfE gene disruption mutants ina 250-mL flask, and fermentation was continued at 37°C for another 5days. Fermentation broth was harvested by centrifugation and analyzedby TLC and bio-autography.

Identification and analysis of antibiotics. S. tenebrarius H6 or theorfE gene disruption mutants were inoculated onto minicylinders con-taining fermentation medium agar and were incubated at 37°C for 5–7days; then the agar was placed on a silica GF254 TLC glass plate(Merck) for about 20 min to allow the fermentation products to per-meate into the TLC plate. The TLC plate was developed with a solventsystem of 1-propanol:methanol:ammonia solution (25%) � 2.5:2:2.Then the TLC plate was placed, sample side down, on agar mediumseeded with Bacillus subtilis for 40 min to allow the antibiotics to beabsorbed by agar. The TLC plate was removed, and the agar mediumwas incubated overnight at 37°C; antibiotics produced in wild-type andexconjugates of S. tenebrarius H6 were analyzed by bio-autography incomparison with tobramycin and apramycin standard samples. Toconfirm the antibiotics produced in the orfE gene disruption mutants,colonies resistant to erythromycin were incubated in seed culturemedium at 37°C for 2 days, 5 mL of seed culture was transferred into50 mL of fermentation medium in a 250-mL flask, and the final culturewas incubated at 37°C at 220 rpm for 5 days. Fermentation broth washarvested by centrifugation and analyzed by TLC and bio-autography.

Nucleotide sequence accession number. The nucleotide sequences oforfE, orfG1, orfG2, and orfM genes have been deposited into GenBankunder accession numbers of AF306787 and AY131228.

Results and Discussion

Detection of dTDP-glucose-4, 6-dehydratase genefrom S. tenerarius H6. Evidences were presented thatthe 6-deoxyhexose (6DOH) biosynthetic pathway iswidespread in a vast array of secondary metabolitesincluding aminoglycoside antibiotic producers, anddTDP-glucose-4,6-dehydratase gene showed the highestdegree of conservation to its counterparts [15]. We pro-posed that the 6-deoxyhexose (6DOH) biosynthetic path-way is also present in the aminoglycoside antibioticsbiosynthetic pathway in S. tenebrarius H6, and chose the

Y. Du et al.: Gene Cluster in Producer of S. tenebrarius H6 101

dTDP-glucose-4,6-dehydratase gene as the startingpoint. After alignment of 14 highly homologous dTDP-glucose-4,6-dehydratases, two motifs that showed high-est conservations were chosen to design primers for theamplification of the homologous DNA in S. tenebrariusH6 (Fig. 2).

As expected, a 0.6-kb DNA fragment was obtainedby PCR; this fragment was purified and cloned intopUC18. DNA sequencing and BLASTX analysis showedthat the deduced protein obtained from one translationframe has �60% identity to dTDP-glucose-4,6-dehy-dratases in different bacterial species.

Fig. 2. The dTDP-glucose-4,6-dehydratase amino acid alignment analysis. Amino acid alignment analysis was made using DNAstar 5.0 Megalignsoftware. dTDP-glucose-4,6-dehydratase sequence from 14 Streptomyces are highly homologous. The two regions that were chosen to design primer1 (P1) and primer 2 (P2) for the amplification of the homologous DNA from S. tenebrarius H6 genome are indicated. The dTDP-glucose-4,6-dehydratase was deduced from the orfE sequence cloned from S. tenebrarius H6.

102 CURRENT MICROBIOLOGY Vol. 49 (2004)

Thirty positive cosmid clones from the genomiclibrary of S. tenebrarius H6 were identified by colonyhybridization by using the PCR product as a probe.Cosmid DNAs isolated from these colonies were ana-lyzed by restriction mapping and Southern hybridization.Comparison of the BamHI digestion patterns of the 30cosmids revealed that a 7.0-kb BamHI fragment wasmain band hybridized to the labeled 0.6-kb PCR frag-ment by Southern analysis. All cosmids contained theoverlapping DNA, encompassing in total approximately50 kb of S. tenebrarius H6 genomic DNA. Ordering ofthe cosmids was achieved by comparing BamHI diges-tions of the cosmids (Fig. 3).

Sequencing analysis of the 7.0-kb region. The 7.0-kbBamHI fragment containing the positive hybridizationregion was sequenced. Within this fragment, five openreading frames (ORFs) with the characteristics of Strep-tomyces genes (overall G�C content, 71.5%,97.0–98.0% high G/C bias, in the third codon position)were identified. An ORF, which was designated as orfE,encodes a protein that shows similarity to dTDP-glucose-4,6-dehygratase (StrE) of S. griseus. Upstream of orfEwas orfL that shows sequence homology to StrL of S.glaucescens [2, 12]. Because of the possible secondarystructure in its part (about 100–200 bp), we could notobtain the complete sequence data at this moment; inTable 1 orfL appears to be an incomplete ORF.

Three other ORFs transcripted in the opposite direc-tion to orfE gene, designated as orfG1, orfG2, and orfM.orfG1 and orfG2 encode proteins that share sequencingsimilarities to glycosyltransferase domain containingprotein of Clostridium acetobutylicum [10] and orfMencodes a protein showing similarity to a mannosyltrans-ferase B of Xanthomonas axonopodis pv. citri str. 306[14]. The arrangement of ORFs is depicted schematicallyin Fig. 4. Proposed functions of ORFs in the sequencedregion of S. tenebrarius H6 were summarized in Table 1.

The involvement of orfE in antibiotics biosynthesis inS. tenebrarius H6. The possible role of orfE in amino-glycoside antibiotics biosynthesis in S. tenebrarius H6was studied by gene disruption.

The gene disruption strategy was described aboveand is illustrated in Fig. 5A. The orfE gene was inacti-vated by insertion of the erythromycin resistance gene(ermE) into the SalI site of orfE. The E. coli–Streptomy-ces shuttle vector pHZ132 was used for conjugation,containing a temperature-sensitive replicon that func-tions only at temperatures below 34°C [1].

Transformation of S. tenebrarius H6 was carried outby conjugation between E. coli ET12567 (pUZ8002/pHOE0.6) and S. tenebrarius H6. The conjugation wasfirst carried out on SM medium at 37°C. Potential ex-conjugants then were picked and inoculated in selectedmedium containing nalidixic acid and erythromycin, fol-lowed by incubation at 42°C. At this temperature, theplasmid pHOE0.6 could not replicate autonomously, andonly the strains in which pHOE0.6 has integrated into thechromosome of the wild-type strain by means of homol-ogous recombination could grow. About 100 coloniesgrown at 42°C on the SM agar containing erythromycinwere separately inoculated to minicylinder filled withfermentation agar and checked for antibiotics productiv-ity by TLC and bio-autography.

Five strains, B7-1–B7-5, in which the production oftobramycin and kanamycin B were abolished were cho-sen as potential orfE disruption mutants for genetic char-acterization. The targeted gene disruption of orfE wasdemonstrated by PCR. Primer s was designed referring tothe sequence upstream to 0.6-kb SalI fragment of orfE inthe chromosome of S. tenebrarius H6 and Primer a to thesequence of ermE in the plasmid pHOE0.6. A 2.0-kbDNA fragment was obtained in all PCR reactions withgenomic DNA of B7-1–B7-5 as templates, where noPCR product was observed with genomic DNA fromwild-type S. tenebrarius H6 (Fig. 5B) in the same con-ditions. The 2.0-kb PCR product was purified and se-quenced in both directions. As expected, the sequencedata of the PCR product was identical to the region thatis amplified by Primer s and Primer a (Fig. 5A), indicat-ing that targeted disruption of orfE occurred in all fivestrains tested.

Absence of free-form plasmids in orfE disruptionmutants was presented by plasmid isolation from B7-1 toB7-5 and re-transformation into E. coli DH-5�, indicat-ing the disrupted copy of orfE has been integrated intochromosomes. All five mutants were proven geneticallystable after three generations were transferred on SMmedium without any selections (data not shown).

To confirm the deficiency of antibiotics productionin orfE mutants we also performed a fermentation inliquid medium with B7-1–B7-5; the fermentation brothswere analyzed by TLC bio-autography. A representativemutant of B7-2 was chosen to show the result in Fig. 6.The wild-type strain of S. tenebrarius H6 produced to-

Fig. 3. Overlapped cosmids covering 7.0-kb BamHI fragment hybrid-ized with the 0.6-kb PCR product in S. tenebrarius H6.

Y. Du et al.: Gene Cluster in Producer of S. tenebrarius H6 103

bramycin (carbamoylated), kanamycin B (carbamoy-lated), and apramycin as compared with tobramycin andapramycin standard samples. But only a very low level ofkanamycin B is produced in wild-type S. tenebrarius H6.The bio-autography clearly showed that orfE disruptionmutants did not produce tobramycin and kanamycin B,but still produced apramycin.

In order to clarify the orfE gene function and ruleout the possible inhibitory effect of the insertion of theentire suicide plasmid on the production of tobramycinand kanamycin in disruption mutants, we carried outrestoration of the orfE gene expression in disruptionmutants. To avoid the difficulty of finding availableselected marker other than ermE for S. tenebrarius H6,we carried out restoration of orfE in disruption mutant bycomplementation of hetero-expressed orfE gene in S.lividans TK24. Plasmid pHZ132EE containing intactorfE and ermE genes was constructed and transformedinto S. lividans TK24 protoplasts. The whole-cultureco-fermentation of both strains, i.e., orfE gene disruptionmutant and S. lividans TK24 (pHZ132EE) transformant,was performed as described in Materials and Methods.The results, as shown in Fig. 6, clearly indicated thatproduction of tobramycin in disruption mutant was re-stored by complementation of the orfE from S. lividanstransformants. It is believed that the expressed OrfE in S.lividans TK24 (pHZ132EE) could complement the genedeficiency in disruption mutant to complete the entiretobramycin biosynthetic pathway.

The abolishment of tobramycin and kanamycin B

production in orfE disruption mutants evidently showedthat the orfE gene product was implicated in the biosyn-thesis of tobramycin and kanamycin B. But the disrup-tion of orfE has no apparent effect on apramycin pro-duction. The gene products of orfE and the upstream orfLare similar to strE and strL products in S. griseus; theyboth belong to the NDP-hexose–oxidoreductases. How-ever, the gene similar to the strD, which encodes thedTDP-D-glucose synthase and usually occurred with thestrE in the 6-deoxyhexose (6DOH) pathways, was absentin the linked region of orfE. In aminoglycosides typically6DOH components are almost exclusively joined withthe synthesis of cyclitol pathway as in the biosynthesis ofstreptomycins, spectinomycins, kasugamycins, etc.However, it has been mentioned that in the course of thehighly flexible 6DOH pathways, several types of furthermodifications are possible, such as deoxygenations,transaminations, various forms of isomerization, andepimerization. Other types of modifications, such as C-,N-, O-, and S-methylations, or transfer reactions formore complex side groups, are also common in the6DOH pathways [11]. The transamination reaction onthe purosamine moieties of tobramycin is possibly re-lated to the 6DOH pathway. The gene prmE encodingdTDP-glucose 4,6-dehydratase from paromomycin, pro-ducer of Streptomyces rimosus ATCC14827, was alsoreported (GenBank Accession number AF144042). Froma biochemical pathway point of view, kanamycins/tobra-mycin and apramycin all belong to 2-deoxystreptamine(2-DOS)-containing aminoglycosides. Most of 2-DOS-containing aminoglycosides represent a relatively homo-geneous biosynthetic group, since they share the com-mon pseudodisaccharidic intermediate paromamine. Butthe apramycin is a non-paromamine aminoglycoside.

The three downstream genes, orfG1, orfG2, andorfM, encode three proteins that share distant similaritieswith the glycosyltransferase family of Clostridium ace-

Table 1. Proposed functions of ORFs in the sequenced region of S. tenebrarius H6

Gene Amino acid Sequence similarityIdentity/similarity

(%) Proposed function

orfG1 345 glycosyltransferase domain containing protein[Clostridium acetobutylicum]

33/55 glycosyltransferase

orfG2 459 diverged glycosyltransferase domaincontaining protein [Clostridiumacetobutylicum]

37/60 putative sugar transferase

orfM 350 mannosyltransferase B [Xanthomonasaxonopodis pv. citri str. 306].

32/44 mannosyltransferase

*orfL 273 StrL [Streptomyces glaucescens] 49/56 dTDP-glucose-4-dehydrorhamnose reductase

orfE 367 StrE [Streptomyces griseus] 65/71 dTDP-glucose-4,6-dehydratase

* incomplete ORF

Fig. 4. Restriction map and organization of the ORFs in the sequencedregion of S. tenebrarius H6.

104 CURRENT MICROBIOLOGY Vol. 49 (2004)

Fig. 5. (A) Construction of the plasmids pHOE0.6 used in conjugation and the result of insertion inactivation of orfE via single crossover. Theprimers s, a used for PCR confirming the orfE gene disruption were marked. (B) Agarose gel electrophoresis of the PCR products with S. tenebrariusH6 and orfE gene disruptants chromosomal DNA as templates. 1, 8,-HindIII; 2, S. tenebrarius H6; 3–7, orfE gene disruptants.

Y. Du et al.: Gene Cluster in Producer of S. tenebrarius H6 105

tobutylicum and Pseudomonas putida KT2440. Weaksimilarities were also found with other known glycosyl-transferases in S. coelicolor A3(2) for OrfG1 (34% iden-tity and 56% similarity) and in S. avermitilis for OrfG2and OrfM (26–29% identity and 42% similarity, respec-tively). Their actual function in the biosynthesis of to-bramycin/kanamycin needs to be clarified.

Although this work has demonstrated that orfE geneand its linked genes are involved in the tobramycin/kana-mycin B biosynthesis, evidences are still required to addresswhether a complete separate gene cluster encodes for apra-mycin biosynthesis. A 12-kb fragment that contains anapramycin-resistant gene (aprR) linked with three genesencoding trehalose, maltose phosphorylase, and a UDP-glucose-4-epimerase were identified by shot-gun cloningfrom S. tenebrarius H6. Disruption of aprR resulted ingenerating an apramycin non-producer, but still producedtobramycin and kanamycin B, indicating that this genecluster may be responsible for apramycin production(Huangzhang Xia, unpublished). Most of genes, includingthe best characterized streptomycin production genes, in theaminoglycoside gene clusters cannot yet be assigned spe-cific functions or associated with particular biosyntheticsteps. This situation occurred mainly because of scarceinformation about the enzymology and the intermediatesblocked in single steps of their biosynthetic pathway. Fur-ther gene-specific induction of mutation and their subse-quent biochemical characterization will facilitate the eluci-dation of the mechanism of the divergent biosyntheticpathway of tobramycin/kanamycins with apramycin.

It is difficult and expensive to separate the apramy-cin from tobramycin and kanamycin B in fermentationbroth (unpublished technological report). These orfEgene disruption mutants of S. tenebrarius H6 failed toproduce tobramycin, and kanamycin B may be useful toapply for industrial production of apramycin.

ACKNOWLEDGMENTS

This work was supported by the National Science Foundation of China(No.39700003). We are grateful to Dr. Rongfeng Li (Dept. of Chem-istry, The Johns Hopkins University, Baltimore, MD, USA) for criticalreview and strong correction of the English writing.

Literature Cited1. Bao K, Hu Z, Zhou X, Zhou Q, Deng Z (1995) A E. coli/

Streptomyces shuttle cosmid vector used in conjugation. Chin SciBull 40:1440

2. Beyer S, Distler J, Piepersberg W (1996) The str gene cluster forthe biosynthesis of 5�-hydroxystreptomycin in Streptomycesglaucescens GLA.0 (ETH 22794): new operons and evidence forpathway-specific regulation by StrR. Mol Gen Genet 250:775–784

3. Bibb MJ, Janssen GR, Ward JM (1985) Cloning and analysis of thepromoter region of the erythromycin resistance gene (ermE) ofStreptomyces erythraeus. Gene 38:215–226

4. Dairi J, Ohta T, Hasgimoto E, Hasegawa M (1992) Self cloning inMicromonospora olivasterospora of fms genes for fortimicinA(astromicin) biosynthesis. Mol Gen Genet 232:262–270

5. Distler J, Mansouri K, Mayer G, Stockmann M, Piepersberg W(1992) Related articles, links, Streptomycin biosynthesis and itsregulation in Streptomycetes. Gene 115:105

6. Furumai T, Takeda K, Kinumaki A, Ito Y, Okuda T (1979) Relatedarticles, links, biosynthesis of butirosins. II. Biosynthetic pathwayof butirosins elucidated from cosynthesis and feeding experiments.J Antibiot (Tokyo) 32:891

7. Han Y, Mu L, Li J, Chen X (1986) Studies on aminoglycosideantibiotic 83-1050 B.I. Cultural characteristics of antibiotic 83-1050 B producing strain and its in-vitro antimicrobial activities.Chin J Antibiot 11:183–189

8. Kieser T, Bibb MJ, Buttner MJ, Charter KF, Hopwood DA (2000)Practical Streptomyces genetics. Norwich: John Innes Foundation

9. Kudo F, Tamegai H, Fujiwara T, Tagami U, Hirayama K, Kaki-numa K (1999) Molecular cloning of the gene for the key carbo-cycle-forming enzyme in the biosynthesis of 2-deoxystreptamine-containing aminocyclitol antibiotics and its comparison withdehydroquinate synthase. J Antibiot 52:559–571

10. Nolling J, Breton G, Omelchenko MV, Makarova KS, Zeng Q,Gibson R, Lee HM, Dubois J, Qiu D, Hitti J, Wolf YI, Tatusov RL,Sabathe F, Doucette-Stamm L, Soucaille P, Daly MJ, Bennett GN,Koonin EV, Smith DR (2001) Genome sequence and comparativeanalysis of the solvent-producing bacterium Clostridium acetobu-tylicum. J Bacteriol 183:4823–4838

11. Piepersberg W (1997) Molecular Biology, Biochemistry, and Fer-mentation of Aminoglycoside Antibiotics. In: Strohl WR (ed)Biotechnology of antibiotics, 2nd ed. New York: Marcel Dekker,p. 81

12. Retzlaff L, Mayer G, Beyer S, Ahlert J, Verseck S, Distler J,Piepersberg W (1993) Streptomycin production in Streptomycetes:a progress report. In: Baltz RH, Hegeman GD, Skatrud PL (eds.)Industrial microorganisms. Basic and applied molecular genetics.Herndon, VA, USA: ASM Press, pp 183–194

Fig. 6. Result of TLC bio-autography of the fermentation products ofthe orfE gene disruptant strain and co-culturing of the orfE genedisruptant strains with orfE/TK24 transformants. 1–3: fermentationproducts of the co-culturing of orfE gene disruptant strains with orfE/TK24 transformants; 4: orfE gene disruptant strain; 5: wild type strain;6: tobramycin; 7: apramycin.

106 CURRENT MICROBIOLOGY Vol. 49 (2004)

13. Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: alaboratory manual, 2nd ed. Cold Spring Harbor, NY: Cold SpringHarbor Laboratory Press

14. da Silva AC, Ferro JA, Reinach FC, Farah CS, Furlan LR, QuaggioRB, Monteiro-Vitorello CB, Van Sluys MA, Almeida NF, AlvesLM, do Amaral AM, Bertolini MC, Camargo LE, Camarotte G,Cannavan F, Cardozo J, Chambergo F, Ciapina LP, Cicarelli RM,Coutinho LI, Cursino-Santos JR, El-Dorry H, Faria JB, FerreiraAJ, Ferreira RC, Ferro MI, Formighieri EF, Franco MC, GreggioCC, Gruber A, Katsuyama AM, Kishi LT, Leite RP, Lemos EG,Lemos MV, Locali EC, Machado MA, Madeira AM, Martinez-Rossi NM, Martins EC, Meidanis J, Menck CF, Miyaki CY, MoonDH, Moreira LM, Novo MT, Okura VK, Oliveira MC, OliveiraVR, Pereira HA, Rossi A, Sena JA, Silva C, de Souza RF, SpinolaLA, Takita MA, Tamura RE, Teixeira EC, Tezza RI, Trindade dosSantos M, Truffi D, Tsai SM, White FF, Setubal JC, Kitajima JP(2002) Comparison of the genomes of two Xanthomonas patho-gens with differing host specificities. Nature 417:459–463

15. Stockmann M, Piepersberg W (1992) Gene probes for the detec-tion of 6-deoxyhexose metabolism in secondary metabolite-pro-ducing Streptomycetes. FEMS Microbiol Lett 69:185

16. Thompson RQ, Presti EA (1967) Nebramycin, a new broad-spec-trum antibiotic complex. 3. Isolation and chemical-physical prop-erties. Antimicrob Agents Chemother 1967(7):332

17. Vara J, Lewandowska-Skarbek M, Wang Y, Donadio S, Hutchin-son CR (1989) Cloning of genes governing the deoxysugar portionof the erythromycin biosynthesis pathway in Saccharopolysporaerythraea. J Bacteriol 171:5872–5881

18. Yamauchi N, Kakinuma K (1995) Enzymatic carbocycle formationin microbial secondary metabolism. The mechanism of the 2-de-oxy-scyllo-inosose synthase reaction as a crucial step in the 2-de-oxystreptamine biosynthesis in Streptomyces fradias. J Org Chem60:5614–5619

19. Zhang HD, Wu X, Liu S (1987) Studies on the characters of ahigher tobramycin producer. Acta Microbiol Sin 27:357–361

Y. Du et al.: Gene Cluster in Producer of S. tenebrarius H6 107