IDENTIFICATION AND CHARACTERIZATION OF NEW …
160
1 IDENTIFICATION AND CHARACTERIZATION OF NEW COMPONENTS OF THE SALICYLIC ACID SIGNALING PATHWAY IN ARABIDOPSIS By YEZHANG DING A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2014
Transcript of IDENTIFICATION AND CHARACTERIZATION OF NEW …
1
IDENTIFICATION AND CHARACTERIZATION OF NEW COMPONENTS OF THE
SALICYLIC ACID SIGNALING PATHWAY IN ARABIDOPSIS
By
YEZHANG DING
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
2014
2
© 2014 Yezhang Ding
3
To my wife, Dongyan Chen, and my daughter, Rebecca Ding, for their unconditional love and support
4
ACKNOWLEDGMENTS
First, I would like to express my deepest gratitude to my advisor, Dr. Zhonglin
Mou, for his inspiration, guidance, patience, and support during the past four and a half
years. He is always available for questions and discussions. His logic, precision, and
insight greatly influenced me. I would also like to thank the members of my committee:
Drs. William Gurley, Joseph Larkin III, Byung-Ho Kang, and Jeffrey Rollins for their
advice, attention, and time. I want to thank Mrs. Xudong Zhang for her help with my
experiments during these years.
I would like to thank all the former and current members of Dr. Zhonglin Mou’s
lab for creating a friendly and pleasant environment: Drs. Yongsheng Wang, Chuanfu
An, Chenggang Wang, Minqi Zhou, and Christopher Defraia. I am very grateful to Dr.
Yongsheng Wang for his valuable help. Special thanks go to Danjela Shaholli, Calli
Breil, and Deepak Sathyanarayan for their help during the mutant screen. I thank my
colleagues in the Department of Microbiology and Cell Science for technical help, use of
equipment, and helpful discussions. I appreciate Dr. Sixue Chen for letting me use the
HPLC equipment. I want to thank all my friends accompanying me in Gainesville.
The love and support of my family have been instrumental towards my success
in graduate school. My father, brother, and sister have given me their everlasting
support. Although my mother has passed, I still feel her presence and dedicate my work
to her. Most importantly, I thank my wife, Dongyan Chen, for helping me through all the
good and bad times. Her love, support and constant patience have taught me so much.
I would like to thank my three-year-old daughter, Rebecca Ding, for her understanding.
She always says “My daddy is in the lab” when she sees other children playing with
their fathers, and never bothers me when I am working. I owe her too much.
5
TABLE OF CONTENTS page
ACKNOWLEDGMENTS .................................................................................................. 4
LIST OF TABLES ............................................................................................................ 8
LIST OF FIGURES .......................................................................................................... 9
ABSTRACT ................................................................................................................... 11
CHAPTER
1 LITERATURE REVIEW .......................................................................................... 13
Plant Immune System ............................................................................................. 13 The Arabidopsis thaliana/Pseudomonas syringae Pathosystem ...................... 14 Pathogenesis Mechanisms of P. syringae ........................................................ 14
Plant Disease Resistance Mechanisms............................................................ 16 PAMP-triggered Immunity ................................................................................ 17
Effector-triggered Immunity .............................................................................. 18 Hypersensitive Response ................................................................................. 19
Systemic Acquired Resistance ......................................................................... 20 Salicylic Acid and Its Function in Plant Immunity .................................................... 25
SA Acts as an Important Signal Molecule in Plant Defense Responses .......... 25
SA Biosynthesis in Plants ................................................................................. 26
SA Metabolism ................................................................................................. 29
Regulation of SA Accumulation ........................................................................ 32 The NPR1 Protein ................................................................................................... 37
Proteosome-mediated NPR1 Protein Degradation ........................................... 39 SA Receptors ................................................................................................... 40 NPR1-interacting Proteins ................................................................................ 43
The Role of ABA in Plant Immunity ......................................................................... 44 Biosynthesis and Catabolism of ABA in Plants ................................................. 45 ABA Signal Transduction.................................................................................. 46 The Negative Role of ABA in Plant Defense .................................................... 46 The Positive Role of ABA in Plant Defense ...................................................... 48
Antagonistic Interactions between SA and ABA ............................................... 49
Goals and Objectives of This Study ........................................................................ 51
2 A FORWARD GENETIC SCREEN FOR MUTANTS WITH ALTERED SA LEVELS DURING PATHOGEN INFECTION IN ARABIDOPSIS ............................ 52
Background Information .......................................................................................... 52 Results .................................................................................................................... 54
Genetic Screen for SA Accumulation Mutants .................................................. 54 Confirmation of the SA Accumulation Mutants Using HPLC............................. 55
6
Pathogen Resistance Test for the SA Accumulation Mutants .......................... 55
Allelism Test ..................................................................................................... 56 Discussion .............................................................................................................. 56
Materials and Methods............................................................................................ 58 Plant Materials and Growth Conditions ............................................................ 58 Bacterial Strains and Pathogen Infection.......................................................... 58 Measurement of SA Using the Biosensor-based Method ................................. 59 Measurement of SA with the HPLC Method ..................................................... 59
3 ABA IS A KEY REGULATOR OF PLANT IMMUNITY ............................................ 64
Results .................................................................................................................... 64 Isolation and Characterization of hsn2 npr1-3 .................................................. 64 HSN2 Encodes ABA3 ....................................................................................... 65
Disruption of ABA Signaling Confers NPR1-Dependent Resistance ................ 67 SA is Essential for aba3-Mediated Resistance to Psm ES4326 ....................... 68
High ABA Compromises Defense Responses in Arabidopsis .......................... 69
ABA Has a Positive Function in Full Induction of Defense Reponses .............. 70
Discussion .............................................................................................................. 71 Materials and Methods............................................................................................ 74
Plant Materials and Growth Conditions ............................................................ 74
Map-based Cloning .......................................................................................... 74 SA Measurement .............................................................................................. 75
ABA Treatment ................................................................................................. 75 ABA Measurement ........................................................................................... 75 Bacterial Strains and Pathogen Infection.......................................................... 76
RNA Extraction and Real-Time PCR ................................................................ 76 Statistics ........................................................................................................... 77
Accession Numbers ......................................................................................... 78
4 ABA AND SA COOPERATE TO REGULATE THE HOMEOSTASIS OF THE TRANSCRIPTION COACTIVATOR NPR1 IN PLANT IMMUNITY ......................... 89
Background Information .......................................................................................... 89 Results .................................................................................................................... 91
ABA Negatively Regulates NPR1 Protein Accumulation .................................. 91 ABA Triggers NPR1 Degradation via the 26S Proteasome Pathway ............... 93 SA Decelerates ABA-Promoted NPR1 Degradation ......................................... 95 ABA-Induced NPR1 Degradation Dampens Defense Responses after
Pathogen Infection Subsides ......................................................................... 97 SA Suppresses ABA Signaling Possibly through Phosphorylation of NPR1 .. 100
Discussion ............................................................................................................ 101 Materials and Methods.......................................................................................... 106
Plant Materials and Growth Conditions .......................................................... 106
Pathogen Infection ......................................................................................... 107 Chemical Treatment ....................................................................................... 107
SA and ABA Measurement ............................................................................. 108
7
Protein Analysis .............................................................................................. 108
RNA Extraction and Real-Time PCR .............................................................. 109 Seed Germination and Seedling Establishment Assays ................................. 109
Statistics ......................................................................................................... 109 Accession Numbers ....................................................................................... 109
5 SUMMARY AND CONCLUSIONS ........................................................................ 132
APPENDIX: TABLES .................................................................................................. 136
REFERENCES ............................................................................................................ 138
BIOGRAPHICAL SKETCH .......................................................................................... 160
8
LIST OF TABLES
Table page 2-1 Mutants identified in this screen ......................................................................... 63
A-1 Primers used for fine mapping. ......................................................................... 136
A-2 Primers used for mutant genotyping. ................................................................ 136
A-3 Primers used for qPCR in this study. ................................................................ 137
A-4 Primers for identification of the splicing site change in aba3-21. ...................... 137
A-5 Primers for identification of homozygousT-DNA insertion lines. ....................... 137
9
LIST OF FIGURES
Figure page 2-1 Free SA levels of SA mutants.. ........................................................................... 61
2-2 Pathogen growth in the SA mutants. .................................................................. 62
3-1 Isolation of the hsn2 npr1-3 mutant. ................................................................... 79
3-2 Defense phenotypes of the hsn2 npr1-3 mutant. ................................................ 80
3-3 Map-based cloning of hsn2. ............................................................................... 81
3-4 Disruption of ABA signaling confers NPR1-dependent defense responses. ....... 84
3-5 SA is required for ABA-deficiency-mediated disease resistance. ....................... 85
3-6 High ABA suppresses defense responses in Arabidopsis. ................................. 86
3-7 ABA signaling is required for the full Induction of NPR1 target genes. ............... 87
4-1 Real-time PCR analysis of RAB18 (A) and NPR1 (B) expression in wild-type plants treated by ABA. ...................................................................................... 110
4-2 ABA promotes NPR1 degradation in Arabidopsis. ............................................ 111
4-3 NPR1 protein levels in wild type (WT) and aba3 plants. ................................... 113
4-4 ABA promotes NPR1 degradation via the 26S proteasome pathway. .............. 114
4-5 ABA promoted-NPR1 degradation requires a CUL3-based E3 ligase. ............. 115
4-6 ABA promotes degradation of NPR1 monomer in the nucleus. ........................ 116
4-7 ABA and SA affect nuclear localization of NPR1. ............................................. 117
4-8 ABA negatively affects NPR1 protein accumulation in the presence of SA. ..... 118
4-9 Endogenous ABA promotes NPR1 degradation in the presence of SA. ........... 119
4-10 SA decelerates ABA-promoted NPR1 degradation. ......................................... 120
4-11 Phosphorylation decelerates ABA-triggered NPR1 turnover. ........................... 121
4-12 Quantification of ABA and SA levels in systemic tissues of wild type and aba3-21 plants during Psm ES4326 infection. .................................................. 122
10
4-13 NPR1 protein accumulation and PR1 gene expression in systemic tissues of wild type and aba3-21 plants during Psm ES4326 infection.. ........................... 123
4-14 SA and ABA regulates NPR1 protein accumulation and PR1 gene expression (mimic experiment). .......................................................................................... 124
4-15 Phosphorylation stabilizes NPR1 during SAR induction. .................................. 125
4-16 Perturbation of either SA or ABA signaling during pathogen induction affects SAR. ................................................................................................................. 126
4-17 Phosphorylated NPR1 negatively regulates ABA responses. ........................... 128
4-18 The effect of basal SA and ABA levels on the accumulation of the Myc-NPR1 protein. ............................................................................................................. 130
4-19 Working model for the regulation of SAR through NPR1 by different levels of SA and ABA...................................................................................................... 131
11
Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy
IDENTIFICATION AND CHARACTERIZATION OF NEW COMPONENTS OF THE
SALICYLIC ACID SIGNALING PATHWAY IN ARABIDOPSIS
By
Yezhang Ding
August 2014
Chair: Zhonglin Mou Major: Microbiology and Cell Science
Plants have evolved inducible immune systems to prevent pathogen infection.
Salicylic acid (SA) is an important plant defense signal molecule produced after
pathogen infection to induce systemic acquired resistance (SAR), which confers
immunity to a broad-spectrum of pathogens. However, where and how SA is
synthesized in plant cells still remains elusive. Identification of new components
involved in pathogen-induced SA accumulation would help understand the SA biology.
In this study, a total of 35,000 M2 plants in the npr1-3 mutant background were
individually tested for pathogen-induced SA accumulation using a biosensor-based SA
quantification method. Among the mutants identified, 17 accumulated lower levels of SA
than npr1-3 (lsn) and two produced higher levels of SA than npr1-3 (hsn) during
pathogen infection. Complementation tests indicated that seven of the lsn mutants are
new alleles of eds5/sid1, two are eds16/sid2 alleles, and one is allelic to pad4. The
remaining are likely new lsn and hsn mutants.
Through map-based cloning, HSN2 was shown to encode ABA3.
Characterization of aba3 npr1 double mutants revealed that abscisic acid (ABA) is a
12
negative regulator of SA biosynthesis. Plants with elevated levels of ABA exhibit
compromised defense responses, whereas disruption of ABA signaling constitutively
activates basal resistance. Interestingly, disruption of ABA signaling also compromises
further induction of defense responses. Thus, ABA appears to play both positive and
negative functions in plant immunity. This study further showed that ABA regulates plant
immunity by controlling the stability of NPR1 protein. In un-induced cells, basal ABA and
SA antagonistically determine the basal level of NPR1. Upon SAR induction, pathogen-
induced SA attenuates NPR1 degradation, leading to NPR1 accumulation, whereas
ABA-mediated NPR1 degradation may promote defense gene transcription. When SA
concentrations decrease, ABA drives NPR1 disappearance, which in turn shuts off
defense gene transcription. Shifting either ABA or SA signaling perturbs the biphasic
changes of NPR1 concentrations, consequently altering the dynamic pattern of defense
gene transcription. Our data demonstrate that SA and ABA cooperate to regulate SAR
by controlling the homeostasis of the key SAR regulator NPR1.
13
CHAPTER 1 LITERATURE REVIEW
Plant Immune System
Although science has significantly improved human life, there are still more than
800 million people in the world lacking access to sufficient food. Plants supply most of
the food. However, more than 10% of food production is lost due to plant disease, which
is one of the major limiting factors for plant-based food production (Richard and Peter,
2005). In addition, disease also results in lower food quality. As a result, farmers rely on
all kinds of chemicals that could negatively influence both the economics of farming and
the global environment. Moreover, pathogens could rapidly develop resistance to these
chemicals. Therefore, one of the eco-friendly ways to fight crop diseases is to employ
the plant’s natural defense mechanisms.
Plants are sessile organisms under constant attack from microbes, such as
bacteria, fungi, oomycetes, and viruses (Agrios, 1997). Most microbes fail to infect
plants to cause disease since their entry is prevented by preformed and constitutive
defenses such as the waxy cuticle on the surface, the cell wall, the plasma membrane,
and a wide variety of chemical barriers. However, pathogens have developed different
strategies to gain entry by destroying these preformed and constitutive defenses.
Generally, plant pathogens can be classified into biotrophs, necrotrophs and
hemibiotrophs based on their nutrient acquisition strategies (Glazebrook, 2005).
Biotrophic pathogens persist and multiply in living plant host tissues, while necrotrophic
pathogens derive nutrients by killing host cells using toxic molecules and lytic enzymes.
Hemibiotrophs behave both as biotrophs and necrotrophs depending on the stage of
their life cycles and living conditions (Glazebrook, 2005).
14
The Arabidopsis thaliana/Pseudomonas syringae Pathosystem
This pathosystem has emerged as a model for the study of plant/bacterial
pathogen interactions (Katagiri et al., 2002). P. syringae, a hemibiotrophic bacterial
pathogen, causes economically important diseases in a wide variety of crops. It infects
mainly aerial portions of plants within a few millimeters of the initial infection sites and
does not spread to other parts of the plant. In nature, P. syringae strains generally go
through two phases: an initial epiphytic phase upon arrival on the plant surface and an
endophytic phase in the apoplastic space after entering the plant through natural
openings and/or wounds. As a hemibiotroph, P. syringae behaves as a biotroph in the
early stage of infection but as a necrotroph at the late stage of infection (Glazebrook,
2005). Infected leaves show water-soaked patches, which eventually become necrotic.
Due to economic importance and amenability to genetic manipulation, P. syringae has
been extensively studied. More importantly, many strains of P. syringae pv. tomato (Pst)
and the closely related pathogen P. syringae pv. maculicola (Psm) can infect the model
plant A. thaliana, and certain strains exhibit race-cultivar specificity on this host. Thus,
the A. thaliana/P. syringae pathosystem has become a model system contributing to the
understanding of the mechanisms underlying plant recognition of pathogens, signal
transduction pathways controlling plant defense responses, host susceptibility, and
pathogen virulence and avirulence determinants.
Pathogenesis Mechanisms of P. syringae
The exact arsenal of P. syringae virulence factors has not been fully understood,
but two systems have been known to play important roles in P. syringae pathogenicity:
the type III secretion system (T3SS) and the toxin coronatine (Preston, 2000). The
T3SS, encoded by hrp (hypersensitive response and pathogenicity) and hrc (hrp
15
conserved) genes, is a needle-like structure across the bacterial envelope and is a
crucial virulence factor in P. syringae and many other gram-negative bacterial
pathogens of plants and animals (Galan and Collmer, 1999). This system delivers a
battery of bacterial avirulence and virulence proteins (type III effectors, T3Es) into the
host cells (Preston, 2000). Pathogens with an impaired T3SS fail to colonize susceptible
plants since these pathogens can induce faster and stronger defense responses in
plants than the wild-type P. syringae strains (Tsuda et al., 2007). Increasing evidence
shows that T3Es contribute to pathogenesis mainly through targeting the plant immune
system, including sabotaging signaling components of defense pathways, interfering
with immunity-related gene transcripts, disrupting immunity-associated vesicle
trafficking, and so on (Xin and He, 2013). For example, HopZ1a, a T3E from P.syringae
has been shown to be able to suppress pathogen-induced expression of pathogenesis
related (PR) genes and the development of systemic acquired resistance (SAR)
induced either by the virulent pathogen Pst DC3000 or the avirulent pathogen Pst
DC3000/avrRpt2 (Macho et al., 2010). EDS1 (enhanced disease susceptibility 1), a key
regulatory component of basal and induced resistance, is also targeted by bacterial
effectors, such as AvrRps4 and HopA1 from Pst DC3000, which disrupt the interaction
between EDS1 and resistance (R) proteins through binding to EDS1, consequently
preventing the activation of defense responses (Bhattacharjee et al., 2011; Heidrich et
al., 2011).
In addition to T3Es, some P. syringae strains (for example, Pst DC3000 and Psm
ES4326) also produce the toxin coronatine, which plays an important role in
pathogenicity (Bender et al., 1999). Coronatine-deficient bacterial mutants cause
16
weaker disease symptoms compared to wild-type bacteria (Mittal and Davis, 1995).
However, unlike bacterial mutants with an impaired T3SS, coronatine-deficient bacterial
mutants still can multiply in susceptible Arabidopsis plants (Mittal and Davis, 1995).
Structurally and functionally similar to the jasmonate-isoleucine (JA-Ile), coronatine acts
as a molecular mimic of methyl JA (MeJA). Previous studies have shown that
coronatine is required for P. syringae to enter into the plant apoplast through stomata by
counteracting ABA-induced stomatal defense (Melotto et al., 2006). Very recently, it has
been shown that coronatine contributes to pathogen’s virulence through activating a
signaling cascade that represses SA accumulation (Zheng et al., 2012).
Plant Disease Resistance Mechanisms
Under constant attack from various microbes, plants have developed
multilayered and cooperative defense mechanisms to protect themselves (Jones and
Dangl, 2006). This highly complicated defense system, similar to the animal innate
immunity, can recognize nonself molecules or signals from their own injured cells
resulting in the activation of an effective immune response (Jones and Dangl, 2006).
Unlike mammals, plants lack a circulatory system and specialized mobile cells to carry
out immune functions. However, plant cells undergo reprogramming to prioritize
defense over their normal cellular functions when attacked by a pathogen. It has been
proposed that plants are capable of establishing responses using a two-layered innate
immune system (Jones and Dangl, 2006). The first layer recognizes and responds to
molecules common to many classes of microbes, including non-pathogens. The second
responds to pathogen virulence factors, either directly or through their effects on host
cellular targets.
17
PAMP-triggered Immunity
On the external surface of the plant cell, conserved microbial elicitors called
pathogen-associated molecular patterns (PAMPs) or microorganism-associated
molecular patterns (MAMPs) can be recognized by pattern recognition receptors
(PRRs) (Boller and Felix, 2009). PAMPs or MAMPs, such as flagellin, elongation factor
Tu (EF-Tu), chitin, glycoproteins, and lipopolysaccharides, are typically essential
structures that are conserved throughout whole classes of pathogens. Plants also
respond to damage-associated molecular patterns (DAMPs), which are endogenous
molecules released by pathogen invasion. Recognition of these molecular patterns by
PRRs leads to PAMP-triggered immunity (PTI), including reactive oxygen species
(ROS) production, callose deposition, generation of secondary messengers, and
defense gene expression (Ausubel, 2005; Jones and Dangl, 2006).
The plant PRR family includes plasma membrane-localized receptor-like kinases
(RLKs) or receptor-like proteins (RLPs) with modular functional domains. In
Arabidopsis, there are approximately 610 predicted RLKs and 56 predicted RLPs, but
only a few have been functionally characterized (Altenbach and Robatzek, 2007). To
date, ten plant PRRs have been identified with known PAMP or MAMP ligands, seven
of which are from the model plant A. thaliana (Robatzek and Wirthmüller, 2013).
Flg22:FLS2 and EF-Tu:EFR are two of the best exemplified PAMP/PRR recognitions.
FLS2 can directly interact with flg22, a 22-amino-acid synthesized peptide derived from
the N-terminus of flagellin (Gómez-Gómez and Boller, 2000; Chinchilla et al., 2006).
Likewise, EFR can recognize elf18, an eighteen amino acid peptide from the N-terminus
of the EF-Tu, to initiate defense responses (Kunze et al., 2004).
18
Effector-triggered Immunity
To achieve successful colonization, adapted pathogens can deliver effector
molecules directly into the plant cells to suppress PTI, resulting in effector-triggered
susceptibility (ETS) (Jones and Dangl, 2006). Among bacterial secretory systems, the
T3SS appears to be the most important for effector delivery. Some T3Es have been
shown to suppress primary defense responses of plants (Alfano and Collmer, 2004).
For example, P. syringae T3Es, such as AvrPto, AvrPtoB, HopF2 and HopAI1, can
suppress PTI mediated by FLS2 through directly targeting different components of the
Flg22:FLS2 signaling cascade (Zhang et al., 2007; Rosebrock et al., 2007; Xiang et al.,
2008; Göhre et al., 2008; Wang et al., 2010a).
Through co-evolution with pathogens, plants have developed R proteins to detect
the presence of certain pathogen effector molecules. Most of the characterized plant R
proteins belong to the nucleotide-binding leucine-rich-repeat class (NB-LRR), which can
be separated into two categories according to whether the N terminus contains a toll-
interleukin-1 receptor (TIR) domain or a coiled-coil (CC) domain (Collier and Moffett,
2009; Lukasik and Takken, 2009; Knepper and Day, 2010). Both types of NB-LRRs act
as intracellular immune sentinels. Recognition of bacterial effectors by R proteins can
activate effector-triggered immunity (ETI) or R gene-mediated resistance, which is an
accelerated and amplified PTI response often accompanied by hypersensitive response
(HR)-mediated cell death at the infection site (Dangl and Jones, 2001; Jones and Dangl,
2006). The recognized effector is termed an avirulence (Avr) protein. Unlike PTI, which
is a general response to a number of conserved PAMPs, ETI is specific for particular
pathogen strains.
19
The recognition of pathogen Avr proteins by plant R proteins can be direct or
indirect (Jones and Dangl, 2006). In the gene-for-gene model, each plant R gene
matches with a pathogen effector-coding gene (van der Biezen and Jones, 1998). But
this model could not explain the broad immune capacity of plants with a limited number
of R proteins to deal with the virtually unlimited number of pathogen effectors.
Therefore, the guard model was put forward, which states that pathogen effectors can
be indirectly recognized by R proteins through monitoring the perturbations of host
cellular targets (Dangl and Jones, 2001; Jones and Dangl, 2006). An example of R
protein-guarded cellular target is the A. thaliana protein RIN4 (RPM1 interacting
protein4), which is not only targeted by three pathogen effectors from P. syringae
(AvrRpm1, AvrB and AvrRpt2), but also monitored by two plant R proteins (RPM1 and
RPS2) (Mackey et al., 2002; Kim et al., 2005).
Hypersensitive Response
The specific recognition of pathogen Avr proteins by R proteins in plants often
leads to the HR, a form of programmed cell death (PCD). Typically, HR does not extend
beyond the site of attempted infection. It may limit pathogen growth in some
interactions, but this is not always the case. HR is characterized by rapid death of cells
with cytoplasmic shrinkage, chromatin condensation, mitochondrial swelling,
vacuolization and chloroplast disruption (Coll et al., 2010). It has been shown that HR is
not required for ETI since cell death is abolished but R protein-mediated pathogen
resistance is not affected in some mutant plants (such as dnd1) as well as in transgenic
plant cell lines (Coll et al., 2010; Yu et al., 1998). However, HR may be adaptive for the
generation of long range signals, mediated by ROS and SA, which further induce SAR
against secondary infections (Durrant and Dong, 2004).
20
Plant (hemi)biotrophic pathogens feed on living cells. They have evolved
mechanisms to evade host detection and death of the invaded plant cells using specific
effectors. Several effectors from Pst DC3000 have been shown to be capable of
suppressing HR in tobacco and Arabidopsis (Jamir et al., 2004; Guo et al., 2009). In
contrast, some necrotrophs use the plant HR machinery as a strategy to promote
virulence. PCD results in a loss of host cell membrane integrity, which causes a flood of
previously unobtainable nutrients into the apoplast where most fungi reside (Hammond-
Kosack and Rudd, 2008).
In Arabidopsis, lesion mimic mutants (LMM) exhibits HR-like phenotypes. These
mutants may have roles in dissecting PCD and defense pathways in plants (Moeder
and Yoshioka, 2008). In the majority of these mutants, SA signaling and defense gene
expression are constitutively activated, suggesting that the lesions formed mimic the HR
(Lorrain et al., 2003). However, draw conclusions should be drawn carefully since some
LMM mutants could result from mutations affecting plant cell physiology that might be
unrelated to plant immune responses.
Systemic Acquired Resistance
Upon recognition of a pathogen, plants often develop HR at the infection site,
resulting in an enhanced resistance to further pathogen attacks in uninfected tissues.
This spread of enhanced resistance throughout the plant is referred to as SAR and has
been shown to be effective in many plant species (Durrant and Dong, 2004). SAR is
long lasting and effective against a broad spectrum of pathogens, including bacteria,
viruses, fungi and oomycetes (Ryals et al., 1996; Sticher et al., 1997). The PR genes
have been regarded as useful molecular markers for the onset of SAR, although their
functions remain unclear (Durrant and Dong, 2004).
21
How does local infection lead to SAR? Early grafting experiments demonstrated
that a singal(s) generated at the primary infection site could be rapidly translocated to
the uninfected parts to induce SAR (Jenns and Kuc, 1979; Dean and Kuc, 1986). The
identity of the systemic signal(s) has been a controversial subject for many years.
SA and MeSA. The phytohormone SA was for many years thought to serve as a
mobile signal for SAR. SA increases in both local and systemic tissues which correlate
with the expression of PR genes during SAR induction. Exogenous application of SA or
the SA analogues 2, 6-dichloroisonicotinic acid (INA) and benzothiadiazole S-methyl
ester (BTH) could induce the expression of PR genes and disease resistance (Durrant
and Dong, 2004). The Arabidopsis ics1 (isochorishmate synthase 1) mutant, which is
deficient in SA synthesis, lacks SAR (Wildermuth et al., 2001). In addition, transgenic
plants carrying the bacterial nahG gene (encoding a bacterial SA hydroxylase that
converts SA to inactive catechol) fail to accumulate SA, fail to express PR genes, and
fail to develop SAR (Gaffney et al., 1993; Delaney et al., 1994; Lawton et al., 1995).
However, a number of experiments showed that SA is not the mobile signal for
SAR. Development of SAR could not be blocked even when infected leaves were
detached before the accumulation of SA in the petioles (Rasmussen et al., 1991).
Grafting experiments in tobacco demonstrated that nahG-transgenic tobacco rootstocks
were capable of producing a SAR signal (Vernooij et al., 1994). Conversely, SAR was
not activated in nahG-transgenic scions grafted on wild-type rootstocks, thus suggesting
that SA is required to activate systemic defenses, but it is not the long-distance signal in
SAR (Vernooij et al., 1994).
22
Recently, methyl salicylate (MeSA), which is synthesized from SA, has been
suggested to be a mobile signal for SAR (Park et al., 2007; Dempsey and Klessig,
2012). MeSA accumulates during SAR and can induce defense via its conversion to SA
by MeSA esterase, such as SABP2 in tobacco (Seskar et al., 1998; Kumar and Klessig,
2003). Moreover, plants with impaired MeSA synthesis or MeSA cleavage are defective
in SAR development (reviewed by Dempsey and Klessig, 2012). It is volatile, so it may
function as an airborne signal to activate disease resistance and induce expression of
PR genes in neighbouring plants and/or in the distal parts of the infected plant
(Dempsey and Klessig, 2012).
However, there has been some controversy regarding the role of MeSA in SAR.
Arabidopsis bsmt1 (benzoic acid/salicylic acid carboxyl methytransferase 1) mutant
plants were shown to be able to initiate SAR, suggesting that MeSA is not required for
SAR (Attaran et al., 2009). During pathogen infection, the induction of MeSA was shown
to be dependent on the JA pathway, which antagonizes SA-mediated defense pathway
(Attaran et al., 2009). Thus, MeSA does not appear to be a mobile signal for SAR.
Jasmonic acid. Previously, JA had been proposed as the systemic signal for
SAR (Truman et al., 2007). The compelling evidence for this came from the facts that
JA accumulates to a high level in petiole exudates from leaves infected with SAR-
inducing bacteria, and that exogenous application of JA can induce SAR. However,
studies on mutants defective in either JA response or JA biosynthesis resulted in
controversial results (reviewed by Dempsey and Klessig, 2012). Furthermore, JA did not
co-purify from petiole exudates with the SAR-inducing ability (Chaturvedi et al., 2008).
Therefore, JA does not seem to be the critical mobile signal for SAR.
23
Lipid-based molecules. Previous studies also suggested that a lipid-based
molecule might serve as the mobile signal for SAR. DIR1 (defective in induced
resistance 1) encodes a protein with sequence similarity to lipid transfer proteins. dir1
mutant plants show wild-type local response to pathogens while they are not capable of
developing SAR (Maldonado et al., 2002). In addition, the phloem sap from dir1 mutant
plants was not able to induce SAR on wild-type plants, suggesting that dir1 mutant
plants are defective in the production of an essential mobile signal from the local
infected leaf. Two other lipase-like proteins, PAD4 (phytoalexin deficient 4) and EDS1,
have also been shown to be required for SAR (Truman et al., 2007). Taken together,
these results support that lipid signaling contributes to SAR.
Azelaic acid, glycerol-3-phosphate and dihydroabetinal. Recent studies also
showed that azelaic acid (AzA), glycerol-3-phosphate (G3P), and dihydroabetinal (DA)
serve as SAR inducers dependent on DIR1 and SA (Jung et al., 2009; Chanda et al.,
2011; Chaturvedi et al., 2012). Jung et al. reported that AzA, a C9 dicarboxylic acid,
accumulates in petiole exudates after pathogen infection. It can move to the distal
tissues to induce SAR following a local application (Jung et al., 2009). However, SA
levels do not change in AzA-treated plants, indicating that AzA can prime the plants with
pathogen responsive SA biosynthesis. The azi1 (azelaic acid insensitive 1) mutant
plants exhibit impaired SAR but have normal local response to infection. In addition, the
function of AzA as a SAR inducer requires DIR1 and SA. Thus, it was proposed that
AzA might be involved in the regulation of a mobile SAR signal (Jung et al., 2009; Fu
and Dong, 2013). Recently, it has also been reported that G3P, together with DIR1, can
induce even stronger SAR than does it alone (Chanda et al., 2011). Infiltration of DIR1
24
protein could not induce SAR in the gly1gli1 double mutant plants, which are defective
in G3P synthesis and have impaired SAR. Thus, G3P and DIR1 are interdependent for
SAR induction. Like AzA, G3P does not induce SA accumulation. Thus, G3P appears to
be a necessary but not a sufficient mobile signal for SAR. Unlike AzA and G3P, DA
does not increase after pathogen infection. It can move to the systemic tissues to
induce SAR when applied locally (Chaturvedi et al., 2012; Fu and Dong, 2013).
Furthermore, DA-induced SAR depends on NPR1 (nonexpressor of pathogenesis-
related proteins 1), DIR1, and FMO1 (flavin-dependent monooxygenase 1). Thus, it was
suggested that DA might activate SAR through inducing SA accumulation (Kachroo and
Robin, 2013).
Pipecolic acid. ery recently pipecolic acid ip was shown to be critical for
S and local resistance to bacterial pathogens varov et al. . ip
accumulates in petiole exudates of leaves inoculated with the SAR-inducing pathogen
Psm, while its accumulation is severely impaired in the distal noninoculated leaves of
several SAR deficient mutants, such as fmo1, ics1, npr1, and pad4. Exogenous
application of Pip can induce disease resistance of wild-type plants and restore SAR in
the pipecolate-deficient ald1 mutant varov et al. . hus it was proposed that
ip acts as an important regulator in priming plant defense responses and serves as a
S inducer varov et al. .
In addition, other factors are involved in modulating SAR, such as the plant
cuticle as well as light (Xia et al., 2009; Griebel and Zeier, 2008). Increasing evidence
suggests that many diverse signals are involved in regulating SAR. However, SA
signaling is required for SAR.
25
Salicylic Acid and Its Function in Plant Immunity
Salicylic acid (2-hydroxyl benzoic acid, SA) is one of an extremely diverse group
of phenolic compounds produced by many prokaryotic and eukaryotic organisms
including plants. The name of SA and its derivatives was derived from the Salix helix
(willow) tree. In 1897, Bayer Company produced the world’s first synthetic drug, aspirin
(acetylsalicylic acid) as an anti-inflammatory agent, which mimics the action of the
ancient medicine from the willow tree (Weissman, 1991). However, the functions of SA
in plants were initially recognized in 1970s when application of aspirin was shown to be
effective against a plant virus (White, 1979). Since then, SA has also been shown to
have other regulatory roles in plants, including seed germination, stomatal closure,
senescence, thermogenesis, growth and development, and responses to abiotic
stresses (Raskin, 1992a, 1992b; Vlot et al., 2009).
SA Acts as an Important Signal Molecule in Plant Defense Responses
Since the first suggestion that SA functions as a signal for plant disease
resistance (White, 1979; Antoniw and White, 1980), the role of SA in plant immunity has
been extensively studied. It has been shown that exogenous application of SA or its
analogs can induce PR gene expression and enhance resistance in many plant species,
and elevated levels of endogenous SA correlate with the induction of local and/or
systemic defense responses (Raskin, 1992; Klessig and Malamy, 1994; Vlot et al.,
2009). Moreover, SA deficient mutants or nahG transgenic plants exhibit increased
susceptibility to virulent and avirulent pathogens, and resistance can be restored in SA
deficient mutants by treatment with SA or its analogs (Gaffney et al., 1993; Delaney et
al., 1994; Mauch et al., 2001; Dewdney et al., 2000). In addition to local responses,
SAR development and systemic PR gene expression are suppressed in SA-deficient
26
plants (Gaffney et al., 1993; Delaney et al., 1994; Vernooij et al., 1994; Nawrath and
Métraux., 1999). Therefore, SA is widely accepted as a key player in multiple layers of
plant disease resistance, including PTI, ETI, and SAR.
SA Biosynthesis in Plants
Since SA plays critical roles in plant immunity and a diverse range of
physiological processes, elucidating how it is synthesized has been a central pursuit in
SA biology. Research has revealed that plants mainly utilize two distinct enzymatic
pathways to synthesize SA, the phenylalanine ammonia-lyase (PAL) pathway and the
isochorismate (IC) pathway. Both pathways require the primary metabolite chorismate,
which is derived from the shikimate pathway. However, neither pathway has been fully
defined so far.
The phenylalanine ammonia lyase (PAL) pathway. Earlier studies using
isotope feeding suggested that SA is synthesized from phenylalanine via trans-cinnamic
acid (t-CA), which is then converted to SA via two possible routes: (i) Decarboxylation of
the side chain of t-CA to form benzoic acid (BA) followed by hydroxylation at the C-2
position; (ii) Hydroxylation of t-CA to generate o-coumaric acid which is then
carboxylated to form SA (Klämbt, 1962; El-Basyouni et al., 1964; Chadha and Brown,
1974). However, SA mainly comes from phenylalanine through benzoic acid (BA) in
some plant species, such as tobacco, cucumber, rice, and potato (reviewed by
Dempsey et al., 2011). 14C-label SA can be detected in phloem after 14C-labeled BA is
injected into cucumber plants (Mölders et al., 1996). During the process of converting
benzoic acid to SA, the hydroxylation step is catalyzed by benzoic acid-2-hydroxylase
(BA2H). The activity of a partial purified tobacco BA2H was reported in 1995, but there
27
has been no further research progress on this enzyme (Leon et al., 1995). Up to date,
other enzymes involved in these two routes from t-CA to SA have not been fully defined.
Production of t-CA from phenylalanine is catalyzed by phenylalanine ammonia
lyase (PAL), which is the first enzyme of the phenylpropanoid pathway (Raes et al.,
2003; Rohde et al., 2004). A role for PAL in SA biosynthesis has been widely accepted
since plants increase PAL gene expression and SA levels during pathogen infection,
and reduce SA accumulation when PAL activity is lost (Pellegrini et al., 1994; Mauch-
Mani and Slusarenko, 1996; Dempsey et al., 1999). In Arabidopsis, there are four PAL
genes (PAL1-4). Quadruple mutant (pal1 pal2 pal3 pal4) exhibits a ~ 75% and a ~ 50%
reduction in the basal and pathogen-induced SA levels, respectively (Huang et al.,
2010). In addition, plants treated with the PAL inhibitor 2-aminoindane-2-phosphonic
acid (AIP) also accumulate reduced pathogen-induced SA levels (Mauch-Mani and Slu-
sarenko, 1996). Consistent with SA reduction, both quadruple mutant plants and plants
treated with PAL inhibitor display enhanced susceptibility to pathogens (Mauch-Mani
and Slu-sarenko, 1996).
The isochorismate pathway. Some bacteria also synthesize SA from
chorismate. The reactions are catalyzed by isochorismate synthase (ICS) and
isochorismate pyruvate lyase (IPL) or by a bifunctional enzyme SA synthase (SAS)
(Verberne et al., 1999; Pelludat et al., 2003). ICS and SAS have very similar structures
and contain conserved active sites (Harrison et al., 2006; Kerbarh et al., 2006;
Kolappan et al., 2007). Since plants can synthesize chorismate in the plastid (Poulsen
and Verpoorte, 1991) and many plastid-localized biochemical pathways share
similarities with prokaryotes, plants may synthesize SA through the isochorismate
28
pathway. Indeed, overexpression of the bacterial ICS and IPL targeted to chloroplasts
increases endogenous SA levels in plants (Serino et al., 1995). The first plant ICS
isolated from Catharanthus roseus has a high level of homology to bacterial ICS
isozymes (van Tegelen et al., 1999). The most convincing evidence supporting the
existence of the isochorismate pathway in plants was generated by characterization of
Arabidopsis mutants. Wildermuth et al. (2001) identified two Arabidopsis ICS genes,
ICS1 and ICS2, which share high identities at the amino acid level with the ICS of C.
roseus. They found that expression of ICS1, but not ICS2, can be induced by pathogens
and the induction is correlated with SA accumulation and PR1 expression. Moreover,
they showed that the sid2/eds16 mutant plants, which lack the functional ICS1 gene,
accumulate only 5-10% of the SA levels detected in wild-type plants during pathogen
infection (Wildermuth et al., 2001). ICS1 can also be induced by a variety of other
stresses, including ultraviolet (UV) light, ozone, and a series of chemicals (review by
Dempsey et al., 2011). ICS1 possesses a putative plastid-transit sequence and a
cleavage site, indicating that ICS1 functions in chloroplasts utilizing chorismate to
synthesize SA (Wildermuth et al., 2001). All these results confirm the presence of a
similar bacterial SA biosynthesis pathway in plants. However, biochemical studies
showed that ICS1 is a unifunctional enzyme since recombinant ICS1 converts
chorismate to isochorismate, not to SA (Strawn et al., 2007). Up to now, no plant genes
encoding IPL have been identified.
ICS homologs have been identified in other plant species. Some plants, such as
rice, crabgrass, barley and soybean, constitutively accumulate high levels of SA
29
(approximately 1 mg/g fresh mass). However, not all plants synthesize SA at detectable
levels (Raskin et al., 1990).
As mentioned above, the Arabidopsis genome contains two isochorismate
synthase genes, ICS1 and ICS2. Disruption of ICS1 results in ~93% reduction in basal
SA levels and ~92% in pathogen-induced SA levels (Garcion et al., 2008), suggesting
that ICS1 plays a major role in SA biosynthesis. In ics2 mutant plants, both basal and
UV-induced SA levels are similar to those in wild-type plants. However, ICS2 was
shown to be a functional and chloroplast-localized ICS (Gracion et al., 2008). Double
mutant ics1 ics2 plants accumulate even lower levels of SA than do ics1 plants,
indicating that ICS2 is responsible for only a marginal level of SA synthesis and an ICS-
independent SA biosynthesis pathway is also present in plants (Gracion et al., 2008).
Several lines of evidence suggest that the residual SA is synthesized by the PAL
pathway. Based on the basal and induced SA levels in the quadruple pal mutant plants
(pal1 pal2 pal3 pal4) (a ~ 75% and a ~ 50% reduction in the basal and pathogen-
induced SA levels, respectively) and the ics1 mutant plants (a ~ 93% and a ~ 92%
reduction in the basal level and pathogen-induced SA levels, respectively), it has been
concluded that the isochorismate pathway is the predominant route for synthesis of both
basal and induced SA in Arabidopsis (Mauch-Mani and Slu-sarenko, 1996; Garcion et
al., 2008).
SA Metabolism
Once SA is synthesized inside plant cells, it may be modified through
glucosylation, methylation, and amino acid conjugation. Most modifications are
regulatory processes for SA accumulation, function and/or mobility.
30
SA-glucosylation. SA can be glucosylated to form SA sugar conjugates SA 2-O-
β-D-glucoside (SAG) or SA glucose ester (SGE). Among them, SAG is the main form in
most plants (Dean and Mills, 2004). During TMV infection on tobacco leaves, SAG
increases in parallel with the accumulation of free SA, suggesting that the majority of SA
is likely glucosylated when an excess of SA is present inside plant cells (Enyedi et al.,
1992; Malamy et al., 1992). In plants, SA glucosylation is performed by a pathogen-
inducible UDPglucosyltransferase (UGT) (also known as SA
glucosyltransferase(SAGT)) (Vlot et al., 2009; Loake and Grant, 2007). Cytosolic SAG
is then transported to the vacuole as a readily available hydrolysable source of SA
(Loake and Grant, 2007). It was reported that in tobacco plants SAG is converted back
to free S by the activity of S β-glucosidase (SAGase) possibly occurring in the
extracellular spaces (Henning et al., 1993; Seo et al., 1995). However, whether SAG is
excreted from the vacuole to the apoplast for hydrolysis remains obscure. Arabidopsis
contains two SAGT genes, SAGT1 and SAGT2. SAGT1 only converts SA to SA 2-O-
beta-D-glucose (SAG), while SAGT2 forms both SAG and SGE (Dean and Delaney,
2008). Consistent with total SA accumulation during abiotic and biotic stresses, both
SAGT1 and SAGT2 expression are induced by these stresses (Dempsey et al., 2011).
SA methylation. SA can also be methylated to form MeSA, a volatile ester,
which is rarely present in plants. SA methylation can be significantly induced during
pathogen infection (Seskar et al., 1998). The synthesis of MeSA is catalyzed by SA
carboxyl methytransferase (SAMT), which uses the S-adenosyl-1-methionine as a
methyl donor and carboxylic acid containing substrates (Loake and Grant, 2007).
SAMTs have been identified in several plant species (Negre et al., 2002). Transgenic
31
Arabidopsis overexpressing OsBSMT1 or AtBSMT produces higher levels of MeSA and
fails to accumulate SA and SAG, resulting in increased susceptibility to pathogens (Koo
et al., 2007; Liu et al., 2010). Interestingly, MeSA was also shown to function as an
airborne signal for plant-to-plant communication (Koo et al., 2007). In tobacco,
Arabidopsis, and potato, MeSA was suggested to be able to travel through the phloem
to distal leaves where it can be converted by the activity of methyl esterase to SA, which
further triggers SAR (Park et al., 2007). Recently, the tobacco SA binding protein 2
(SABP2) was found to have MeSA esterase activity. SABP2-silenced tobacco plants
exhibit compromised SAR (Kumar and Klessig, 2003; Forouhar et al., 2005). Thus, it
has been proposed that MeSA functions as a mobile molecule to induce defense
responses in systemic tissues and/or nearby plants (Dempsey and Klessig, 2012).
SA amino acid conjugation. SA is also known to conjugate with certain amino
acids. Acyl-adenylate/thioester-forming enzyme (GH3.5) is able to conjugate amino
acids to SA and indole-3-acetic acid (Park et al., 2007). Interestingly, overexpression of
GH3.5 increases SA accumulation and disease resistance (Park et al., 2007). Another
research reported that overexpression of GH3.5 results in compromised ETI though
elevated SA accumulation (Zhang et al., 2007). However, GH3.5 is thought to be a
positive regulator of the SA-mediated signaling pathway since its loss-of-function mutant
plants show partially compromised SAR (Park et al., 2007). Another enzyme, GH3.12,
was recently shown to conjugate amino acids to 4-substitute benzoates but not to SA
(Okrent et al., 2009). Arabidopsis GH3.12 loss-of-function mutant plants
(pbs3/gdg1/win3) accumulate lower levels of SA and exhibit compromised pathogen
resistance (Jagadeeswaran et al., 2007; Lee et al., 2007; Nobuta et al., 2007).
32
Compromised defense phenotypes of these mutants can be rescued by exogenous
application of SA or its derivative BTH. Therefore, it has been suggested that SA amino
acid conjugates may act as bioactive inducers in plant defense responses.
Regulation of SA Accumulation
Genetic studies have uncovered a complex regulatory network that affects SA
accumulation. This includes upstream SA signaling components (such as R proteins,
EDS1, EDS5, PAD4, NDR1, and so on), downstream SA signaling components (such
as NPR1), transcription factors, metabolic enzymes (as discussed above), and positive
and negative feedback loops.
Plant R proteins are believed to function upstream of SA. Most of the
characterized plant R proteins belong to the NB-LRR class, which can be separated into
two categories, TIR-type R proteins and CC-type R proteins (Collier and Moffett, 2009;
Lukasik and Takken, 2009; Knepper and Day, 2010). Constitutively activated R proteins
result in SA accumulation and disease resistance. For example, a point mutation in the
R protein SNC1 creates an autoactivated receptor, which results in constitutively
elevated SA levels, PR gene expression, and disease resistance (Zhang et al., 2003).
Genetic studies have shown that defense signals from TIR-type R proteins (TIR-
NB-LRR) are mediated by EDS1, while CC-type R proteins (CC-NB-LRR) signal
through NDR1 (non-specific disease resistance1) (Aarts et al., 1998). EDS1, a lipase-
like protein, interacts with two other proteins, PAD4 and SAG101 (senescence
associated gene101), to regulate both basal immunity and ETI (Falk et al., 1999; Volt et
al., 2009). eds1 and pad4 mutants are defective in pathogen-induced SA accumulation,
suggesting that both EDS1 and PAD4 regulate SA accumulation during pathogen
infection and function upstream of SA (Feys et al., 2001). Exogenous application of SA
33
can rescue defense gene induction in the eds1 and pad4 mutants and up-regulate
expression of EDS1 and PAD4 in wild-type plants, indicating that both genes are
positively feedback regulated by SA (Falk et al., 1999; Feys et al., 2001; Zhou et al.,
1998).
Signaling downstream from CC-type R proteins is generally regulated by NDR1,
which is a glycophosphatidyl-inositol-anchored plasma membrane protein (Coppinger et
al., 2004). It has been shown that ndr1 mutant plants are defective in PTI, ETI, and SAR
due to their reduced ability to accumulate SA upon pathogen infection (Aarts et al.,
1998; Shapiro and Zhang, 2001). Research also showed that BTH is able to rescue the
SAR-deficient phenotype of ndr1 mutant plants, suggesting that NDR1 acts upstream of
SA (Shapiro and Zhang, 2001; Vlot et al., 2009).
EDS5 (enhanced disease susceptibility 5) encodes a protein with homology to
transporters of the MATE (multidrug and toxic compound extrusion) family (Nawrath et
al., 2002). Mutations in this gene result in reduced levels of free and conjugated SA
after pathogen infection or ozone treatment and compromised plant defense responses
(Rogers and Ausubel, 1997; Volko et al., 1998; and Nawrath and Métraux, 1999). Also,
exogenously supplied SA or SA analogs can induce similar levels of PR1 expression in
eds5 and wild-type plants (Volko et al., 1998; Nawrath and Métraux, 1999), indicating
that EDS5 functions upstream of SA to regulate SA accumulation. Additionally, SA
treatment can induce EDS5 expression, suggesting that EDS5 is feedforward regulated
by SA. EDS5 is located in the chloroplast envelope and might regulate SA levels
through transporting SA from the chloroplast to the cytoplasm (Serrano et al., 2013). It
has been proposed that the lack of SA synthesis in eds5 mutant plants might result from
34
a possible feedback inhibition of SA biosynthesis in the chloroplast (Serrano et al.,
2013).
In addition to components upstream of SA accumulation, the downstream
component, NPR1 (nonexpressor of PR genes 1), also known as NIM1 (noninducible
immunity 1) or SAI1 (SA insensitive 1), also regulates SA levels. NPR1 has been
shown to be an important regulator of defense responses downstream of SA (Cao et al.,
1994; Delaney et al., 1995). It was first identified through genetic screen for mutants
that fail to express PR genes after SAR induction (Cao et al., 1994). Mutations in NPR1
cause compromised basal resistance, defective SAR, and insensitivity to inducers
activating SA signaling (Dong, 2004). In addition, npr1 mutant plants accumulate higher
levels of SA than wild-type plants during pathogen infection, suggesting that NPR1 is a
feedback inhibitor of SA accumulation. Consistent with this result, NPR1 was also
shown to act upstream of SA to suppress the expression of ICS1, thus inhibiting SA
biosynthesis (Zhang et al., 2010). Nuclear localization of NPR1 was reported to be
required for suppression of ICS1 expression (Wildermuth et al., 2001; Zhang et al.,
2010). In the absence of SA or pathogen challenges, the NPR1 protein is present as an
oligomer in the cytosol. Upon induction, the NPR1 oligomer is reduced to form a
monomer, which is then imported into the nucleus (Mou et al., 2003). Since NPR1 lacks
a canonical DNA-binding domain, it is thought to regulate defense gene expression
through interaction with other transcription factors (Zhang et al., 1999; Després et al.,
2000; Kinkema et al., 2000; Fan and Dong, 2002; Després et al., 2003; Johnson et al.,
2003). However, the mechanism through which NPR1 suppresses SA accumulation has
not been fully elucidated.
35
Previous studies also showed that several transcription factors (TFs) are involved
in the regulation of SA accumulation. The transcription factors EIN3 (ethylene
insensitive 3) and EIL1 (EIN3-like 1) are positive regulators of ethylene-dependent
responses. Recently, the ein3-1 eil1-1 double mutant plants were shown to
constitutively accumulate elevated levels of free and total SA, resulting in constitutively
activated defense responses (Chen et al., 2009). In addition, overexpression of EIN3
enhances disease susceptibility to bacterial pathogens. Therefore, EIN3 and EIL1 are
thought to be negative regulators of SA-mediated defense responses. Moreover, EIN3
was shown to bind to the ICS1 promoter and inhibit the expression of ICS1 gene to
reduce SA synthesis (Chen et al., 2009).
Two other transcription factors, CBP60g (Calmodulin-Binding Protein 60-like g)
and SARD1 (SAR-Deficient 1), were recently shown to be positive transcriptional
activators of ICS1. Double cbp60g sard1 mutants accumulate very low levels of SA in
response to avirulent or virulent pathogens, and are defective in PTI, ETI, and SAR
(Zhang et al., 2010; Wang et al., 2011). Overexpression of SARD1 results in high levels
of constitutive free and total SA and enhanced disease resistance (Zhang et al., 2010).
Moreover, CBP60g and SARD1 were found to be able to bind to the ICS1 promoter to
facilitate the transcription of this gene. Taken together, CBP60g and SARD1 are
positive regulators of SA accumulation and plant defenses.
WRKY transcription factors have been shown to be involved in plant defense
responses (Eulgem and Somssich, 2007). This family of proteins can bind to the W-box,
which is overrepresented in the promoter regions of some SAR-related genes, including
ICS1 (Maleck et al. 2000). WRKY28 was recently shown to be able to bind two W-box
36
core motifs in the ICS1 promoter (van Verk et al., 2011). Overexpression of WRKY28 in
Arabidopsis protoplasts activates expression of pICS1::GUS while mutations of these
two W-boxes result in reduced expression of the reporter gene. Thus, WRKY28 may
positively regulate SA accumulation through directly controlling ICS1 expression.
Additionally, WRKY54 and WRKY70 were shown to be suppressors of SA biosynthesis,
since wrky54 wrky70 double mutant plants accumulate much higher levels of SA than
wild-type plants. Due to the observations that npr1 mutant plants also accumulate
higher levels of SA and WRKY54 and WRKY70 are target genes of NPR1, NPR1 is
thought to negatively regulate SA biosynthesis through these two WRKY TFs (Wang et
al., 2006).
Metabolic enzymes also impact SA accumulation in plants. In addition to those
enzymes involved in SA modification, some other enzymes also regulate SA
accumulation. For example, EPS1 (enhanced pseudomonas susceptibility 1), which is a
member of the BAHD acyltransferase superfamily, was shown to have a critical role in
pathogen-induced SA accumulation (Zheng et al., 2009). The BAHD family of
acyltransferases functions in catalyzing the transfer of an acyl moiety from acyl-
activated coenzyme A (CoA) to O or N atoms in various secondary metabolites
D’ uria 6 . It has been suggested that E S might regulate pathogen-induced SA
accumulation through formation of an ester conjugate from intermediates synthesized
from the ICS and PAL pathways. Alternatively, EPS1 may promote SA biosynthesis by
catalyzing synthesis of an unknown regulatory molecule for SA biosynthesis (Chen et
al., 2009). However, the exact role of EPS1 in regulating SA accumulation needs to be
further investigated.
37
Recently, PAP5 (purple acid phosphatase 5) was shown to regulate SA
accumulation and plant defense (Ravichandran et al., 2013). PAP5 encodes a member
of purple acid phosphatases which function in regulation of Pi uptake and other
biological functions, such as peroxidation, ascorbate recycling, and regulation of cell
wall carbohydrate biosynthesis (Ravichandran et al., 2013). In pap5 plants, expression
of defense related genes including ICS1 and PR1 is much lower than in wild-type plants
after pathogen infection. In addition, application of BTH can restore PR1 expression in
pap5 mutant plants. Therefore, it was proposed that PAP5 acts upstream of SA
accumulation to regulate the expression of other defense responsive genes
(Ravichandran et al., 2013).
Biochemical studies showed that SA can be converted to 2, 3- and 2, 5-
dihydroxybenzoic acid (2,3-DHBA and 2,5-DHBA) in diverse plant species (Ibrahim and
Towers, 1956). Recently, SA 3-hydroxylase (S3H) responsible for the conversion of SA
to 2,3-DHB which is a precursor of the S ’s major storage form 3-DHBA sugar
conjugates, has been shown to play a pivotal role in SA catabolism and homeostasis
(Zhang et al., 2013). The s3h knockout mutants accumulate very high levels of SA and
its sugar conjugates and fail to produce 2, 3-DHBA sugar conjugates. In addition,
overexpression of S3H results in high levels of 2, 3-DHBA sugar conjugates and
extremely low levels of SA and its sugar conjugates (Zhang et al., 2013). Therefore,
plants may regulate SA levels by converting it to 2, 3-DHBA to prevent SA over-
accumulation in plant cells.
The NPR1 Protein
In the last two decades, several genetic analyses identified the key SAR
component NPR1/NIM1/SAI1 (Cao et al., 1994; Delaneyet al., 1995; Glazebrook et al.,
38
1996; Shah et al., 1997). Plants lacking functional NPR1 are defective in SA and
pathogen-induced PR gene expression, susceptible to a wide range of pathogens, and
show impaired SAR (Cao et al., 1994; Delaneyet al., 1995; Glazebrook et al., 1996;
Shah et al., 1997). In contrast, overexpression of NPR1 in Arabidopsis increases
disease resistance, which is associated with a faster or stronger response of the
transgenic plants to pathogen attack and SAR induction (Cao et al. 1998). Homologs of
the Arabidopsis NPR1 (AtNPR1) have now been identified in many plant species, such
as tobacco, tomato, mustard, sugar beet, rice, apple, banana, cotton, and grapevine
(Durrant and Dong, 2004; Meur et al., 2006; Malnoy et al., 2007, Endah et al., 2008;
Zhang et al., 2008, Le Henanff et al., 2009). Overexpression of AtNPR1 or its homologs
also confers disease resistance to various pathogens (Lin et al., 2004; Chern et al.,
2005; Makandar et al., 2006; Malnoy et al., 2007; Potlakayala et al., 2007, Zhang et al.,
2010). Therefore, NPR1 functions as a key positive regulator of plant immunity
downstream of SA.
NPR1 is expressed throughout the plant at low levels. Its expression seems to be
regulated by WRKY transcription factors. In the promoter region of NPR1, there are
several W-boxes, which are known as the WRKY binding sites. Mutations of these
WRKY binding sites abolish NPR1 expression, resulting in loss of both SA-induced PR
gene expression and disease resistance (Yu et al., 2001). Thus, WRKY transcription
factors appear to function upstream of NPR1. However, the identity of the WRKY
transcription factors that are directly involved in regulating the NPR1 gene needs to be
further investigated. In addition, levels of NPR1 transcripts only increase two- to three-
fold after pathogen infection or SA treatment, suggesting that NPR1 is likely regulated at
39
the protein level (Ryals et al., 1997; Cao et al., 1997; Dong, 2004). Moreover, the NPR1
overexpressing lines do not constitutively express PR genes, indicating that the NPR1
protein must be activated to be functional (Durrant and Dong, 2004).
Proteosome-mediated NPR1 Protein Degradation
NPR1 encodes a protein containing four ankyrin repeats and a BTB (Broad-
Complex, Tramtrack and Bric a brac) domain, both of which are involved in protein-
protein interactions (Cao et al., 1997; Ryals et al., 1997). Also, NPR1 shares structural
homology with IКB transcription cofactor, which regulates the mammalian innate
immune responses (Ryals et al., 1997). The NPR1 protein resides both in the cytosol
and in the nucleus (Kinkema et al., 2000). In the absence of SA or pathogen challenges,
an NPR1 oligomer forms through intermolecular disulfide bonds in the cytosol (Mou et
al., 2003). Upon SAR induction by chemical treatments or bacterial pathogens, the
reductive redox potential in the cytosol triggers NPR1 oligomer to monomer transition
through reduction of disulfide bonds. Then monomeric NPR1 protein carrying an intact
nuclear localization sequence is translocated into the nucleus, where it acts as a
cofactor for transcription factors, such as TGAs, to induce PR genes (Kinkema et al.,
2000; Mou et al., 2003). In support of this, two NPR1 mutant variants, npr1C82A and
npr1C216A, which are constitutively localized in the nucleus, are capable of activating
PR1 gene expression in the absence of an SAR inducer (Mou et al., 2003).
The cysteine residue 156 has been shown to be important for NPR1 oligomer
formation through S-nitrosylation by S-nitrosoglutathione. Upon SAR induction,
cytoplasmic thioredoxins, TRX-h3 and TRX-h5, catalyze the reduction of cysteine-156,
disrupting intermolecular disulfide bonds and promoting NPR1 monomerization and
nuclear localization (Tada et al., 2008). At the biological level, formation of the oligomer
40
in the cytoplasm not only prevents spurious activation of SAR but also maintains NPR1
protein homeostasis during SAR.
The BTB domain is a general structure of adaptor proteins for the Cullin 3 E3
ligase. Unexpectedly, NPR1 does not directly interact with CUL3. However,
experimental evidence showed that NPR1 can be polyubiquitinylated by the Cullin 3 E3
ligase and degraded by the 26S proteasome possibly mediated by other BTB domain-
containing adaptor proteins (Spoel et al., 2009; Zhang et al., 2006). This event can
attenuate basal defense gene expression to prevent untimely activation of SAR, thereby
avoiding the fitness cost in the absence of infection. Interestingly, SAR activation
promotes phosphorylation of NPR1, resulting in NPR1 degradation by the 26S
proteasome. In addition, phosphorylation-mediated NPR1 turnover is necessary for the
activation of SAR (Spoel et al., 2009). Thus, it has been proposed that proteasome-
mediated NPR1 degradation plays dual functions in plant immunity (Spoel et al., 2009).
SA Receptors
It is well known that SA plays a prominent role in plant immunity. However, the
identity of the SA receptor remained elusive until recently. Previously, several SA-
binding proteins were identified biochemically, such as a catalase, an ascorbate
peroxidase, a carbonic anhydrase and a methyl salicylate esterase (Vlot et al., 2009).
There is little genetic support for their function as potential SA receptors. Thus,
identification of SA receptors in plants became central to understanding its function in
plant immunity
NPR3 and NPR4. Recently, NPR1 paralogs, NPR3 and NPR4, have been shown
to be able to mediate NPR1 degradation through the 26S proteasome in a SA
concentration dependent manner and act as SA receptors (Fu et al., 2012). Like NPR1,
41
NPR3 and NPR4 contain a BTB protein-protein interaction domain, making them
potential adaptor proteins for mediating NPR1 degradation. Biochemical evidence
showed that both NPR3 and NPR4 can interact with CUL3 ubiquitin ligase and NPR1
and act as CUL3 adaptors for NPR1 degradation. SA disrupts the interaction between
NPR1 and NPR4, making NPR1 less susceptible to degradation, while SA facilitates the
interaction between NPR1 and NPR3, promoting NPR1 degradation. More importantly,
NPR3 and NPR4 were shown to be able to bind SA with different binding affinities, while
NPR1 had very lower SA-binding activity (Fu et al., 2012). In addition to biochemical
evidence, several lines of genetic evidence also support the regulation of NPR1 protein
by NPR3 and NPR4. The npr3 npr4 double mutant exhibits enhanced disease
resistance and this enhanced basal resistance is NPR1-dependent. Also, the npr3npr4
double mutant lacks further SAR induction due to the increased accumulation of NPR1
protein. Moreover, this double mutant is defective in mounting the HR and ETI (Fu et al.,
2012). This is consistent with the previous result that NPR1 is an inhibitor of ETI-
triggered cell death (Rate and Greenberg, 2001). Therefore, the authors proposed the
following model: in the absence of SAR induction, NPR1 is constantly degraded by 26S
proteasome mediated by NPR4 to prevent untimely activation of defense; upon
pathogen challenge, locally high SA levels allow NPR3-mediated NPR1 degradation,
resulting in the onset of HR and ETI; in the neighboring cells, intermediate SA levels do
not allow NPR3-NPR1 interaction, but can disrupt NPR4-NPR1 interaction, leading to
the accumulation of NPR1 in the adjacent cells to induce SAR (Fu et al., 2012).
Therefore, the interplay between NPR1, NPR3/4, and SA finely regulates NPR1 protein
homeostasis and helps initiate different types of defense responses. However, it is still
42
not clear whether 3 and/or 4 are required for S ’s ability to induce nuclear
translocation of NPR1 and/or to promote NPR1 phosphorylation, and how SA influences
the ability of NPR3 and NPR4 to interact with NPR1. Crystal structure analyses of NPR3
and NPR4 would be the next crucial step to further address the question of how SA is
sensed by these receptors.
NPR1. Another study showed that NPR1 binds SA directly and acts as a bona
fide SA receptor (Wu et al., 2012). Using a method of equilibrium dialysis, it was shown
that SA can bind to the C-terminal transactivation (TA) domain of NPR1 through two
cysteine residues Cys521 and Cys529 and the transition metal copper. Mutation of both
cysteines to serines or metal chelation abolished SA binding activity of NPR1. In the
absence of SA, the TA domain of NPR1 is inhibited by the N-terminal autoinhibitory
BTB/POZ domain and therefore is unable to activate defense. Upon SA binding, NPR1
undergoes a conformational change, resulting in the release of the C-terminal TA
domain from the N-terminal autoinhibitory BTB/POZ domain. The authors also indicated
that the transition of NPR1 oligomer to monomer might not be through the reductive
redox potential, but rather through direct interaction between SA and Cys521/529 of
NPR1 (Mou et al., 2003; Wu et al., 2012). However, Cys521 and Cys529 of NPR1 are
not conserved across plant species. This raises the question of how SA is perceived in
other plant species. Also, It will be interesting to determine the biological significance of
NPR1 functioning as an SA receptor during different types of plant defense responses,
such as ETI and SAR.
The seemingly conflicting results discussed above could be attributed to the
differing experimental approaches used for detecting the direct binding of SA to NPR1
43
(Fu et al., 2012; Wu et al., 2012). However, it is possible that both NPR1 and
NPR3/NPR4 act as SA receptors, similar to the multireceptor sensing of ABA (Cutler et
al., 2010). Increasing evidence also indicates the existence of SA-dependent, NPR1-
independent defense responses, suggesting that there are additional mechanisms of
SA perception. In addition to its role in plant immunity, SA also functions as an
important regulator in other biological processes, such as plant growth, development,
germination, and responses to abiotic stresses (Volt et al., 2009). It would be interesting
to explore whether these SA receptors are also involved in these processes.
NPR1-interacting Proteins
Since NPR1 lacks an obvious DNA-binding domain and contains protein-protein
interaction domains, identification of NPR1-interacting proteins are important for
exploring how NPR1 functions in plant immunity. Three small structurally similar
proteins (named NIMIN1, NIMIN2, and NIMIN3) were identified in a yeast two-hybrid
screen. NIMIN1 and NIMIN2 were shown to interact with the C terminus of NPR1, while
NIMIN3 interacts with the N terminus (Weigel et al., 2001). However, the biological
activity of NIMINs is undefined. Protein-protein interaction assays also revealed that
NPR1 interacts with several members of the TGA family of basic leucine zipper
transcription factors, including TGA2, TGA3, TGA5, TGA6, and TGA7 (Zhang et al.,
1999; Després et al., 2000; Johnson et al., 2003). TGA1 and TGA4 were later shown to
be able to interact with NPR1 in vivo in the presence of SA (Després et al., 2003).
These results indicate that TGA factors may be responsible for NPR1-mediated PR
gene expression. Indeed, TGA factors are capable of binding to the activation
sequence-1 (as-1) of the PR1 promoter in vivo in an SA- and NPR1-dependent manner
(Johnson et al., 2003). In Arabidopsis, there are ten TGA genes. Mutational analysis of
44
TGA genes indicated that they have functional redundancy in SA signaling (Zhang et
al., 2003). Single knockout mutants of TGA2 and TGA3 do not show an obvious
defense phenotype (Durrant and Dong 2004). However, the tga2 tga5 tga6 triple
knockout mutant is impaired in SA-induced PR gene expression and SAR, suggesting
that TGA2, TGA5, and TGA6 play redundant functions in the induction of SAR.
Interestingly, the tga2 tga5 tga6 triple mutant has normal local resistance, indicating that
other TGA factors may function in basal resistance (Zhang et al., 2003).
The Role of ABA in Plant Immunity
Plants, as sessile organisms, face various types of environmental stresses
including biotic and abiotic stresses. Defense against biotic threats is largely mediated
by SA- and JA/ethylene (ET) signaling pathways, while abiotic stress responses are
mainly controlled by the phytohormone abscisic acid (ABA) (Kunkel and Brooks, 2002).
In addition, ABA also regulates developmental processes, such as seed development,
dormancy, and desiccation (Wasilewska et al., 2008). Recent studies also revealed a
novel role of ABA in plant immunity, which is dependent on the lifestyle of pathogen and
on the time scale of infection (Asselbergh et al., 2008; Yasuda et al., 2008; Ton et al.,
2009; Cao et al., 2011; Grant and Jones, 2009). Interactions among ABA, JA, and SA
signaling appear to coordinate to determine combined adaptive responses when plants
are exposed to both biotic and abiotic stresses simultaneously (Asselbergh et al., 2008;
Yasuda et al., 2008; Ton et al., 2009; Cao et al., 2011; Kim, 2012). In addition,
increasing evidence suggests that ABA may be an essential component in integrating
and fine-tuning biotic and abiotic stress-response signaling networks.
45
Biosynthesis and Catabolism of ABA in Plants
The biosynthesis of ABA has been identified in all known plants as well as
different types of fungi, such as B. cinerea (Grant and Jones, 2009; Kim, 2012). In
plants B is synthesized from β-carotene in the plastid and the last several steps that
convert xanthoxin to ABA occur in the cytosol (Seo and Koshiba, 2002). During abiotic
stresses, such as salinity and drought, plant cells synthesize more ABA which enables
plants to survive. It has also been demonstrated that ABA concentration changes during
pathogen infection in many plants (Whenham et al., 1986; Fan et al., 2009; Choi and
Hwang, 2011). For example, tobacco plants infected with TMV show increased ABA
levels (Whenham et al., 1986). Similarly, Arabidopsis plants challenged with P. syringae
accumulate higher levels of ABA (de Torres-Zabala et al., 2007; Fan et al., 2009).
Interestingly, expression of the bacterial type III effector AvrPtoB in Arabidopsis
elevates foliar ABA levels (deTorres-Zabala et al., 2007). Moreover, genome wide
expression analyses revealed that there is a high similarity (42%) between the
expression of genes induced by ABA and bacterial type III effectors in Arabidopsis (de
Torres-Zabala et al., 2007). These results indicate that pathogens might have evolved
abilities to hijack the host ABA signaling pathway to suppress plant defense.
Currently, there is no direct evidence as to whether pathogen-infected cells
themselves synthesize ABA and/or ABA is transported to the infected cells (Robert-
Seilaniantz et al., 2011). ABA mobility through ABA transporters represents another
potential regulatory level (Kuromori et al., 2010). ABA can be converted into an inactive
form by B 8’-hydroxylases, which in Arabidopsis are encoded by the CYP707A gene
family (CYP707A1– 4) (Zhou et al., 2004). This process has an important role in
regulating ABA levels during abiotic stresses (Zhou et al., 2004; Saito et al., 2004).
46
However, it might be a potential host target for pathogen virulence. ABA can also be
conjugated to form the inactive ABA-glucosyl ester (ABA-GE), which is a storage form
or transport form of ABA (Lim et al., 2005).
ABA Signal Transduction
Recent discoveries revealed that PYR (pyrabactin resistant), PYLs (PYR-like) or
RCARs (regulatory component of ABA receptor) form a family of cytosolic ABA
receptors (PYR1 and PYL1-PYL12). The ABA signaling pathway starts with ABA
binding to these receptors followed by a conformational change that stabilizes the
complex with one of the clade A protein phosphatase 2Cs (PP2Cs; negative regulators
of ABA signaling), resulting in inactivation of the PP2C and activation of SNF1-related
kinases (SnRKs), which are required for activating transcriptional factors, ion channels,
and other mediators involved in ABA responses (reviewed by Cutler et al., 2010).
The Negative Role of ABA in Plant Defense
Treatment with ABA promotes disease susceptibility to many pathogens, such as
P. syringae and Fusarium oxysporum in Arabidopsis (Fan et al., 2009; Torres-Zabala et
al., 2007; Mohr and Cahill, 2003; Anderson et al., 2004), Magnaporthe grisea in rice
(Koga et al., 2004), and B. cinerea and Erwinia chrysanthemi in tomato (Audenaert et
al., 2002; Asselbergh et al., 2008). In line with the effect of exogenous ABA, plants with
higher levels of endogenous ABA show compromised plant defense (Fan et al., 2009;
Torres-Zabala et al., 2007). It has also been shown that ABA deficient mutants exhibit
higher levels of disease resistance than wild type. For example, the Arabidopsis ABA
biosynthetic mutants aba1, aba2, aba3, and aao3 show enhanced resistance to both
biotrophic and necrotrophic pathogens (Mang et al., 2012; Fan et al., 2009; Torres-
Zabala et al., 2007; Adie et al., 2007; Sanchez-Vallet et al., 2012). In tomato, the ABA
47
deficient mutant sitiens exhibits enhanced resistance against B. cinerea (Adie et al.,
2007). Similarly, the Arabidopsis ABA signal mutants, ABA insensitive 1-1 (abi1-1), ABA
insensitive 2-1 (abi2-1) and the quadruple pyr/pyl mutant (pyr1 pyl1 pyl2 pyl4) are more
resistant whereas the ABA hypersensitive plants (abi1-1 sup5 and abi1-1 sup7) are
more susceptible (de Torres-Zabala et al., 2007; Sanchez-Vallet et al., 2012).
Therefore, ABA levels and ABA sensitivity negatively correlate with plant resistance to
biotrophic and necrotrophic pathogens, suggesting that ABA has a negative role in plant
immunity.
Increasing evidence suggests that ABA acts as a negative regulator of disease
resistance by interfering with defense signaling at multiple levels. It was reported that
ABA has a negative impact on phenylalanine ammonia lyase (PAL) activities, which are
important for formation of antimicrobial secondary metabolites, such as phytoalexins,
and accumulation of the key plant defense hormone SA (Audenaert et al., 2002). In
addition to negatively regulating phenylpropanoid biosynthesis, ABA appears to induce
the biosynthesis of JA, which is known to play an antagonistic role against SA-mediated
signaling (Adie et al., 2007). Moreover, ABA was shown to have a negative role in
regulating ROS accumulation, which is well known for its importance in plant defense
(Asselbergh et al., 2008). Recently, it was also reported that ABA influences plant
immunity by directly regulating R protein activity. ABA and exposure of plants to high
temperature inhibit the nuclear accumulation of the R proteins SNC1 (suppressor of
npr1-1, constitutive 1) and RPS4 (resistant to P. syringae 4), resulting in compromised
resistance to P.syringae (Mang et al., 2012).
48
The Positive Role of ABA in Plant Defense
Although most studies support a negative role for ABA in plant defense, ABA has
also been shown to impose positive effects on plant defense (Asselbergh et al., 2008;
Ton et al., 2009). De Vleesschauwer et al. (2010) reported that exogenous ABA
reduces spreading of the virulent necrotroph Cochliobolus miyabeanus in rice through
suppression of C. miyabeanus-triggered activation of ethylene signaling (De
Vleesschauwer et al., 2010). Similarly, exogenous application of ABA promotes
resistance against the necrotrophic fungal pathogens Alternaria brassicicola and
Plectosphaerella cucumerina in Arabidopsis (Ton and Mauch-Mani, 2004). The positive
role of ABA in plant immunity is also supported by the evidence that the ABA defective
mutants (aba2-12, aao3-2 and abi4-1) are more susceptible to Pythium irregulare and
A. brassicicola (Adie et al., 2007). Moreover, Adie et al. (2007) showed that ABA is
required for JA accumulation and JA responsive gene expression after P. irregulare
infection, suggesting that ABA promotes disease resistance against these necrotrophic
pathogens by contributing to JA biosynthesis and signaling. Additionally, it was reported
that MYB96-mediated ABA signaling confers plant resistance against the bacterial
pathogen Pst DC3000 by inducing SA biosynthesis (Seo and Park, 2010).
ABA signaling also has a positive function in stomatal immunity. Melotto et al.
reported that ABA-induced stomatal closure is a defensive strategy of plants to prevent
microbial invasion through open stomata (Melotto et al., 2006). During pathogen
infection, ABA-induced stomatal closure requires SA, indicating that ABA and SA have
synergistic functions in stomatal immunity. Moreover, it was demonstrated that
coronatine, a virulence factor produced by several P. syringae strains, counteracts
PAMP-induced stomatal closure, which is mediated by ABA signaling. Another positive
49
effect of ABA on pathogen defense is its ability to stimulate the deposition of callose,
which reinforces the cell wall to prevent pathogen invasion (Ton and Mauch-Mani,
2004).
In addition, ABA has been shown to be a key hormone in Arabidopsis response
to R. solanacearum infection (Hu et al., 2008). Pretreatment of Arabidopsis with an
avirulent strain of R. solanacearum increases plant resistance to the virulent isolates of
this bacterium, and this resistance correlates well with the enhanced expression of
ABA-related genes, which might create a hostile environment for secondary infection
(Feng et al., 2012).
Antagonistic Interactions between SA and ABA
Recently, Yasuda et al. (2008) reported that there is an antagonistic interaction
between SA and ABA signaling in Arabidopsis. ABA pre-treatment can suppress both
BIT (1, 2-benzisothiazol-3(2H)-one1, 1-dioxide) and BTH induced PR genes and
resistance against virulent Pst DC3000. In addition, ABA can suppress BIT-induced SA
accumulation in wild-type plants and BTH-induced PR1 expression in SA deficient
mutant sid2-1 and eds5-1, indicating that ABA inhibits SA signaling both upstream and
downstream of SA biosynthesis. Likewise, pretreatment of NaCl suppresses BIT-
induced SA synthesis and BIT/BTH-induced defense responses against Pst DC3000.
Moreover, over-expression of B 8’-hydroxylase CYP707A3 suppresses the effect of
NaCl pretreatment on BIT- or BTH-induced PR gene expression, SA accumulation and
disease resistance (Yasuda et al., 2008). Therefore, ABA appears to have an
antagonistic effect on the SA signaling pathway. However, effects of whole-plant
chemical treatments on pathogen growth and/or defense gene expression are not
appropriate ways to measure biological SAR (Kachroo and Robin, 2013). Also, whether
50
localized application of ABA inhibits the onset of SAR in response to primary pathogen
infection has yet to be further investigated.
The antagonistic effects of SA and ABA have also been demonstrated in the
lesion mimic mutants, cpr22 and ssi4, which constitutively accumulate high levels of SA
(Mosher et al., 2010). After moving these mutants from high humidity to low humidity,
both SA and ABA levels increased. However, SA accumulation is capable of
suppressing ABA signaling in these mutants. In addition, both mutants display partial
ABA insensitive phenotypes with respect to germination, water loss, and stomatal
opening, which are attributable to elevated SA levels in these mutants (Mosher et al.,
2010). Therefore, it was proposed that SA has a role in antagonizing the ABA signaling
pathway.
Conversely, Torres-Zabala et al. demonstrated a role for pathogen-induced ABA
in suppressing plant defenses mediated by SA (Torres-Zabala et al., 2009). They
examined the dynamics, inter-relationship and impact of three key phytohormones, SA,
ABA and JA during pathogen infection in Arabidopsis. It was shown that changes of
endogenous hormone levels can profoundly influence the outcome of a plant–pathogen
interaction, and pathogen-induced ABA suppresses plant basal defense by down-
regulating SA biosynthesis and SA-mediated signaling (Torres-Zabala et al., 2009).
Thus, hormone ratios appear to play a crucial role in plant immunity, and subtle
changes may result in the perturbation of plant defense responses. However, the exact
molecular mechanism through which ABA-SA antagonism balances the downstream
defense responses remains unclear. Dissecting key factors involved in the cross-talk
51
between these two hormone signaling pathways would shed more light on how biotic
and abiotic stresses influence the combined adaptive plant defense responses.
Goals and Objectives of This Study
SA is an essential signal molecule in plant defense against numerous biotrophic
and hemi-biotrophic pathogens (Dong, 2004). However, where and how SA is
synthesized in plant cells remains unclear. The goals of this study are to identify new
components involved in SA biosynthesis and/or SA-mediated signaling and to
characterize the underlying regulatory mechanisms. The objectives are to (1) perform a
forward genetic screen for mutants with altered pathogen-induced SA accumulation in
Arabidopsis; (2) characterize the newly identified mutants; and (3) clone one or more
genes and characterize the underlying regulatory mechanism(s).
52
CHAPTER 2 A FORWARD GENETIC SCREEN FOR MUTANTS WITH ALTERED SA LEVELS
DURING PATHOGEN INFECTION IN ARABIDOPSIS
Background Information
Plants have evolved innate immune systems against pathogens. SA is an
important plant defense signal produced after pathogen infection to induce SAR, which
confers immunity towards a broad-spectrum of pathogens (Dong, 2004). Mutants that
have impaired SA biosynthesis during infection show compromised plant defense.
Conversely, exogenous application of SA or its analogues induces PR gene expression
and disease resistance (Dong, 2004). Therefore, understanding the mechanisms
underlying SA accumulation is critical in the study of plant immunity. However, it is still
unclear where and how SA is synthesized in plant cells. Identification of new
components involved in pathogen-induced SA accumulation would help understand how
SA is synthesized and how SA mediates disease resistance in plants.
Previously, a forward genetic screen was performed in Arabidopsis for mutants
with altered levels of total SA after infection with P. syringae pv tomato DC3000 carrying
the avirulence gene avrRpm1. Two mutants, sid1 and sid2, were identified, which did
not accumulate SA during the infection (Nawrath and Métraux, 1999). sid1 and sid2
were shown to be allelic to eds5 and eds16, respectively, which were identified in
another genetic screen for enhanced disease susceptibility (Nawrath and Métraux,
1999; Rogerset al., 1997). SID1/EDS5 was later shown to encode a chloroplast MATE
(multidrug and toxin extrusion) transporter (Nawrath et al., 2002). SID2/EDS16 encodes
an SA biosynthetic enzyme ICS1 (isochorismate synthase 1) (Wildermuth et al., 2001).
In this screen, an HPLC-based method was used to quantify the SA levels in pathogen-
infected leaf tissues from about 4,500 individual M2 plants. Obviously, the screen did
53
not reach saturation. Therefore, in order to identify more valuable genetic components
involved in SA biosynthesis or signaling, the population for a mutant screen needs to be
enlarged.
The HPLC-based method used for the mutant screen is not practical since it is
extremely costly and time-consuming. Recently, an SA biosensor, named Acinetobacter
sp. ADPWH_lux, was developed (Huang et al., 2005). This bacterial strain is derived
from Acinetobacter sp. ADP1 and contains a chromosomal integration of a salicylate-
inducible lux-CDABE operon, which encodes a luciferase (LuxA and LuxB) and the
enzymes that produce its substrate (LuxC, LuxD and LuxE). In the presence of SA,
MeSA and acetylsalicylic acid, the operon is activated, resulting in emission of 490-nm
light (Huang et al., 2005). Measurement of SA from TMV-infected tobacco leaves with
the biosensor and GC/MS yielded similar results, demonstrating that this strain is
suitable for quantification of SA in crude plant extracts (Huang et al., 2006). DeFraia et
al. developed an improved methodology for Acinetobacter sp. ADPWH_lux-based SA
quantification for both free SA and SAG in crude plant extracts (DeFraia et al., 2008).
Based on this, Marek et al. (2010) reported a further simplified protocol for the
estimation of free SA levels in crude plant extracts in a high-throughput format (Marek et
al., 2010). The efficacy and effectiveness of the newly developed SA biosensor-based
method were confirmed by HPLC and verified in a small-scale mutant screen.
To better understand SA biology, we performed a large-scale forward genetic
screen for mutants with altered SA accumulation after pathogen infection. We expected
that mutants with significantly altered SA levels during pathogen infection will help study
how SA is synthesized in plant cells and/or uncover important regulators of plant
54
immunity. In this study, we identified seven new mutants that accumulate lower levels of
SA and two new mutants that produce higher levels of SA than the parental line npr1-3
after pathogen infection. The seven likely new lsn mutants (lower SA than npr1-3) are
more susceptible, while both hsn (higher SA than npr1-3) mutants are more resistant
than npr1-3.
Results
Genetic Screen for SA Accumulation Mutants
The npr1 mutant was used as the starting material for the mutant screen, since
this mutant accumulates significantly higher levels of SA than wild type during pathogen
infection (Figure 2-1 A and B; Cao et al., 1997; Shah et al., 1997; Ryals et al., 1997).
One leaf on each M2 plant of an EMS (ethyl methanesulfonate)-mutagenized population
was syringe-infiltrated with a virulent bacterial strain Psm ES4326 suspension
(OD600=0.001). After 24 hr, a disc from each infiltrated leaf was collected using a hole
punch and the SA levels in the leaf disc were determined using the SA biosensor-based
method (Marek et al., 2010). Plants that accumulated significantly higher or lower levels
of SA than npr1-3 were kept as putative SA accumulation mutants. About 350 such
mutants were identified from a total of 35,000 M2 plants in this genetic screen.
To confirm the putative SA accumulation mutants, eight plants of each mutant
were tested for Psm ES4326-induced SA accumulation using the SA biosensor-based
method (Marek et al., 2010). Nineteen mutants, 17 lsn mutants and two hsn mutants,
were confirmed (Figure 2-1A, Table 2-1). As the parental npr1-3 mutant carries a fuhl-2
allele, which lacks sinapoyl malate in the leaf epidermis and appears red, rather than
blue, under UV light (Chapple et al., 1992), contamination from other mutants in the lab
was excluded by checking the mutant plants under UV illumination. Furthermore, the
55
presence of the npr1-3 mutation in the identified mutants was confirmed with a derived
cleaved amplification polymorphism sequence (dCAPS) marker (Table A-2).
Confirmation of the SA Accumulation Mutants Using HPLC
To further confirm these SA mutants, we measured free SA levels after pathogen
infection in the mutants using HPLC. As shown in Figure 2-1B, compared with the
parental npr-3 mutant, all 17 lsn mutants accumulated extremely low levels of free SA,
whereas the two hsn mutants produced higher levels of free SA after Psm ES4326
infection. Therefore, the 19 mutants we identified may contain mutations modifying SA
accumulation in the npr1-3 genetic background during pathogen infection.
Pathogen Resistance Test for the SA Accumulation Mutants
SA has been shown to play an important role in plant defense (Dong, 2004).
Most mutants with altered SA levels have changed defense phenotypes. To investigate
whether the 19 putative mutants we isolated also have altered disease resistance, we
inoculated 4-week-old plants with the bacterial pathogen Psm ES4326 (OD600=0.0001).
Interestingly, all lsn mutants developed enhanced disease symptoms (data not shown)
and supported more bacterial growth (2- to 7-fold) in comparison with the parent npr1-3
(Figure 2-2). This is consistent with the conclusion that mutants with impaired SA
accumulation have compromised defense capacity (Dempsey et al., 1999).
In contrast to the lsn mutants, the hsn mutants supported less bacterial growth
than npr1-3, although the bacteria still grew to a slightly higher titer in hsn mutants than
in wild-type plants (Figures 2-2). This result indicates that the increased levels of SA in
the hsn mutants activate NPR1-independent disease resistance.
56
Allelism Test
Analysis of the F1 plants from crosses between the 19 SA accumulation mutants
and their parent npr1-3 indicated that the lsn and hsn mutations are recessive. Several
recessive mutants including sid1/eds5, sid2/eds16, pad4, eds1, eps1, and pbs3 have
been shown to accumulate less SA than the wild type upon pathogen infection. The lsn
mutants are unlikely alleles of eds1, eps1, and pbs3, since no difference in pathogen-
induced free SA accumulation was detected between eps1 or pbs3 and the wild type
using the SA biosensor (data not shown), and two EDS1 isoforms are present in the
Arabidopsis ecotype Col-0 (Feys et al., 2005). We therefore tested for allelism of the lsn
mutants to sid1/eds5, sid2/eds16, and pad4. lsn mutants that almost do not accumulate
SA after pathogen infection were crossed with eds5-1 npr1-3 or sid2-1 npr1-3 to test
whether they are new alleles of sid1/eds5 or sid2/eds16. Those accumulating SA after
infection but with levels significantly lower than those in the wild type were crossed with
pad4-1 npr1-3 to test whether they are allelic to pad4. SA levels in all F1 plants were
measured using the SA biosensor and compared with those in their parents. The results
of these allelism tests revealed that seven lsn mutants are alleles of eds5/sid1, two are
eds16/sid2 alleles, and one is allelic to pad4. The remaining seven lsn mutants and the
two hsn mutants are likely new SA accumulation mutants isolated in this genetic screen
(Table 2-1).
Discussion
In this study, we performed a forward genetic screen for Arabidopsis mutants
with altered SA levels during pathogen infection using the newly developed SA
biosensor method (Marek et al., 2010). Compared to the commonly used high
performance liquid chromatography (HPLC) and gas chromatography/mass
57
spectroscopy (GC/MS) methods, the SA biosensor method is much faster and less
expensive (Malamy and Klessig, 1992; Verberne et al., 2002; Marek et al., 2010). On
the other hand, unlike HPLC and GC/MS, the SA biosensor is intended to estimate SA
levels in leaf crude extracts, not to accurately determine the SA concentration (Marek et
al., 2010). Using this method, we were able to screen a large population (35,000) of M2
plants in a short period of time. About 350 putative SA accumulation mutants were
identified in the primary screen, among which 19 were confirmed using both the SA
biosensor and HPLC methods (Figure 2-1A and 2-1B).
Among the 19 SA accumulation mutants, 17 are lsn mutants, producing much
lower SA levels than npr1-3 after pathogen infection, and two are hsn mutants,
accumulating higher SA levels than npr1-3. Based on allelism tests, 10 out of the 17 lsn
mutants are new alleles of previously identified genes involved in SA biosynthesis or SA
signaling, and the remaining seven lsn mutants are most likely new SA biosynthesis or
signaling mutants. Although this is a large-scale genetic screen, we only identified one
allele of pad4, two alleles of sid2, and two hsn mutants, indicating that the genetic
screen may not have been saturated.
The eds5-1 npr1-3, sid2-1 npr1-3, and pad4-1 npr1-3 double mutants accumulate
much less SA and are more susceptible to Psm ES4326 than the corresponding single
mutants (Figure 2-1 and 2-2). The seven new lsn mutants exhibit similar SA and
defense phenotypes as these double mutants, suggesting that the LSN genes may
encode SA signaling components or SA biosynthetic enzymes. The two hsn mutants
accumulate higher free SA levels than npr1-3 and are less susceptible to the virulent
pathogen Psm ES4326, suggesting that increased SA accumulation may activate
58
NPR1-independent defense responses in the hsn mutants. It is expected that the HSN
genes may encode important components suppressing pathogen-induced SA
accumulation. Cloning and characterization of the LSN and HSN genes will certainly
shed new light on the mechanisms underlying pathogen-induced SA accumulation
and/or SA-mediated defense signaling.
Materials and Methods
Plant Materials and Growth Conditions
The wild type used was the Arabidopsis thaliana (L.) Heynh. Columbia (Col-0)
ecotype, and the mutant alleles used were npr1-3 (Glazebrook et al., 1996), eds5-1
(Nawrath et al., 2002), sid2-1 (Nawrath and Metraux, 1999; Wildermuth et al., 2001),
pad4-1 (Glazebrook et al., 1996), eps1-1 (Zheng et al., 2009), and pbs3-1 (Nobuta et
al., 2007). The double mutants were created by crossing npr1-3 with eds5-1, sid2-1 or
pad4-1. EMS mutagenesis was carried out as described previously (Weigel and
Glazebrook, 2002). Briefly, ~1 gram of npr1-3 seeds were treated in 25 mL of 0.2% (v/v)
EMS (Sigma) in a 50-mL Falcon tube and incubated on a rocking platform for 15 hr.
After washing with water eight times, the seeds were suspended in 0.1% agarose and
sown on soil (Metromix 200) with a pasteur pipette. The M1 plants were allowed to self-
fertilize to produce M2 seeds, which were collected in 96 independent pools. The M2
seeds were vernalized at 4 °C for 3 days before placement in a growth environment (16
hr light/8 hr dark photoperiods at 22 °C). After two weeks, seedlings were transplanted
into 96-plot trays and grown for an additional two weeks.
Bacterial Strains and Pathogen Infection
The virulent bacterial leaf pathogen Psm ES4326 was grown overnight in liquid
King’s B medium. Bacterial cells were collected by centrifugation and diluted in 10 mM
59
MgCl2. Inoculation of plants with Psm ES4326 was performed by pressure infiltration
with a 1 ml needleless syringe (Clarke et al., 1998). For SA measurement with the
biosensor-based method, one leaf on each plant was infiltrated with a Psm ES4326
suspension (OD600 = 0.001). The susceptibility phenotype was tested using a low titer
(OD600 =0.0001) of Psm ES4326. In planta growth of Psm ES4326 was assayed three
days after infection as previously described (Clarke et al., 1998).
Measurement of SA Using the Biosensor-based Method
For mutant screening, free SA levels were measured using the SA biosensor as
described by Marek et al. (2010). Briefly, 24 hr after Psm ES4326 infection, a leaf disc
was collected from the infected leaf of each plant using a hole punch and placed in 200
L of LB in a corresponding well of a 96-well PCR plate. The plate was then boiled at
95°C for 30 min and cooled down to room temperature in a thermocycler (Marek et al.,
2010). An overnight culture of Acinetobacter sp. ADPWH_lux was diluted with LB (1:10)
and incubated at 37°C for ~2 hr until the OD600 reached 0.4. Using a multipipette, 50 L
of this bacterial culture was added to each well in a 96-well black cell culture plate, and
then 50 L of the boiled leaf extract was added to each well and mixed by pipette
action. The plate was incubated at 37°C for 1 hr without shaking before luminescence
was read using a eritas ™ Microplate Luminometer romega Corporation Sunnyvale
CA).
Measurement of SA with the HPLC Method
Two leaves of each plant were infiltrated with a Psm ES4326 suspension
(OD600=0.001) 24 hr before leaf tissue collection. Leaf tissues (0.1 g) were ground twice
in liquid nitrogen and extracted with 1 mL of 90% HPLC-grade methanol. After
60
centrifugation at 14,000 g for 10 min, the supernatant was transferred to a 1.5 mL
microcentrifuge tube. The pellet was re-extracted with 0.5 mL of 100% methanol and
the supernatant was transferred to the same tube. The total supernatant was equally
split into two microcentrifuge tubes [one for free SA and another for glucose conjugated
SA (salicylic acid 2-O-β-D-glucoside or SAG)], which were dried in a speed vacuum to
final volume of ~50 L. The residue was resuspended in 250 L hydrolysis buffer (0.1 M
sodium acetate buffer pH 5.5 . For S G samples were added with units of β-
glucosidase and incubated at 37°C for 1.5 hr. An equal volume of 10% trichloroacetic
acid (TCA) was then added to both the free SA and SAG tubes. After centrifugation at
14,000 g for 10 min, the supernatant was transferred to a new tube. SA was then
extracted into an organic phase containing a 1:1 mixture of ethyl acetate and
cyclopentane. The organic solvent was dried in a speed vacuum and SA was dissolved
in 0.25 mL 0.2 M sodium acetate buffer (pH 5.5). Pure SA samples were included in the
same procedure to account for recovery rate. SA levels were quantified on an HPLC
system with excitation at 301 nm and emission at 412 nm (Verberne et al., 2002). Each
data point was derived from three independently collected samples.
61
Figure 2-1. Free SA levels in SA accumulation mutants. A) Luminescence from Psm ES4326-infected Col-0, npr1-3, pad4-1 npr1-3, eds5-69 npr1-3, sid2-1 npr1-3, and 19 putative mutants measured by the SA biosensor-based method. B) Free SA levels in Psm ES4326-infected Col-0, npr1-3, pad4-1 npr1-3, eds5-69 npr1-3, sid2-1 npr1-3, and 19 putative mutants detected by the HPLC-based method. Values are the mean of eight samples (A), three samples read in triplicate (B) with standard deviation (SD). Experiments were repeated with similar results.
62
Figure 2-2. Pathogen growth in the SA mutants. Leaves of 4-week-old plants were inoculated with Psm ES4326 (OD600= 0.0001). The in planta bacterial titers were determined 3 days postinoculation. Cfu, colony-forming units. Data represent the mean of eight independent samples with SD. This experiment was repeated with similar results.
63
Table 2-1. Mutants identified in this screen
Gene lleles
EDS5 SID2 PAD4 Putative lsn Putative hsn
82-200, 85-11, 91-2, 91-27, 91-89, 93-19, 93-181 91-14, 91-56 91-99 43-28, 54-25, 82-18, 91-133, 93-5, 93-6, 93-80 92-26, 90-82
64
CHAPTER 3 ABA IS A KEY REGULATOR OF PLANT IMMUNITY
Results
Isolation and Characterization of hsn2 npr1-3
In Arabidopsis, NPR1 is a positive regulator of plant immunity downstream of SA
(Dong, 2004). Mutations in NPR1 result in compromised defense responses and SA
hyper-accumulation during pathogen infection (Dong, 2004), indicating that NPR1 is a
feedback inhibitor of SA accumulation (Wildermuth et al., 2001; Zhang et al., 2010). In
our forward genetic screen for SA accumulation mutants in the npr1-3 background, a
mutant designated hsn2 npr1-3 was found to accumulate higher SA levels than the
parental line npr1-3 during infection (Figure 3-1A, 3-1B, and 3-1C). To assess whether
the hsn2 npr1-3 mutant has enhanced pathogen resistance, we performed pathogen
infection assays with the compatible bacterial pathogen Psm ES4326. As shown in
Figure 3-2A and 3-2B, hsn2 npr1-3 supported less bacterial growth than did npr1-3,
although the bacteria still grew to a slightly higher titer in hsn2 npr1-3 than in the wild
type, suggesting that the hsn2 mutation confers NPR1-independent disease resistance.
However, hsn2 npr1-3 plants did not show enhanced disease resistance compared to
npr1-3 when challenged with a high bacterial inoculum (OD600=0.001) (Figure 3-2C).
Moreover, blocking the SA pathway, as seen in nahG hsn2 npr1-3 or sid2-1 hsn2 npr1-3
triple mutants restored the basal susceptibility (Figure 3-2D and E). Together, these
results indicate that the hsn2 mutation regulates SA-dependent disease resistance in
the npr1-3 mutant background.
hsn2 npr1-3 plants exhibit dark green and dwarf phenotypes (Figure 3-1D).
When backcrossed to npr1-3, wild-type-like morphology was observed in all F1 progeny
65
(data not shown), suggesting that the hsn2 mutation is recessive. To determine the co-
segregation of the higher SA accumulation during pathogen infection and hsn2
morphology, SA levels of individual F2 plants from the cross between hsn2 npr1-3 and
npr1-3 were examined using the SA biosensor-based method (Mark et al., 2010).
Progeny (approximately 70 plants) with hsn2-like morphology accumulated a higher
level of free SA during pathogen infection, indicating that higher SA level during
pathogen infection and hsn2 morphology co-segregate and are caused by the same
mutation or two closely-linked mutations.
HSN2 Encodes ABA3
To map the hsn2 mutation, hsn2 npr1-3 (in the Col-0 ecotype) was crossed with
the polymorphic ecotype Landsberg erecta (Ler) to generate a F2 segregating
population. Crude mapping using 48 plants with an hsn2-like morphology placed the
hsn2 mutation on the north arm of chromosome 1 between markers F21M12 and
CIW12. Further fine mapping using 1586 F2 mutant plants located the hsn2 mutation
between markers M1 and M5, an interval of approximately 149 kb (Figure 3-3A). This
region contains 41 genes. We checked all the genes for known functions and found that
mutations in the ABA3 gene (At1g16540) cause similar morphology as observed in
hsn2 npr1-3. Therefore, the coding region of ABA3 was amplified from hsn2 npr1-3 and
sequenced. A single G to A mutation in the ABA3 gene was detected in the splicing site
between the third intron and the fourth exon. A cleaved amplified polymorphic sequence
(CAPS) was developed to genetically distinguish the hsn2 mutant from the wild type
(Figure 3-3B). To confirm that the hsn2 mutation affects mRNA splicing of ABA3, RT-
PCR analysis was carried out using a pair of primers spanning the mutation site (Table
A-3). As expected, multiple bands were amplified from the hsn2 npr1-3 cDNA, whereas
66
only one was detected from the wild type cDNA (Figure 3-3C), supporting that hsn2
mutation causes missplicing of the ABA3 gene.
To further confirm that the mutation in ABA3 actually causes the hsn2 phenotype,
a double mutant between another ABA3 allele, aba3-1, and nrp1-3 was generated. We
analyzed free SA levels during pathogen infection using the SA biosensor-based
method (Marek et al., 2010), and found that the aba3-1 npr1-3 double mutant also
accumulated higher levels of free SA, which was similar to that observed in hsn2 npr1-3
(Figure 3-3D). Then, we performed disease resistance test. As shown in Figure 3-3E,
the aba3-1 npr1-3 double mutant showed less bacterial growth than the npr1-3 mutant.
We also made a cross between hsn2 npr1-3 and aba3-1 npr1-3, and found that all F1
plants had higher free SA levels during pathogen infection, enhanced disease
resistance, and dark green phenotypes (Figure 3-3D, E, and F). ABA3 encodes the
cytosolic enzyme molybdenum cofactor sulfurase (Moco-S), which plays a pivotal role in
ABA biosynthesis (Xiong et al., 2001). To further confirm that the hsn2 mutation results
in a nonfunctional ABA3, we analyzed the ABA level in hsn2. As the aba3-1 mutant
(Léon-Kloosterziel et al., 1996), hsn2 exhibited a lower basal level of ABA than the wild
type (Figure 3-3G). We further verified that the dark green phenotype of hsn2 npr1-3 is
due to ABA deficiency by exogenously applying ABA to the mutant plants. After 6 days,
spraying 10 M ABA rescued the growth defects in the hsn2 npr1-3 mutant plants
(Figure 3-3H). Spraying ABA also restored disease susceptibility (Figure 3-3I),
indicating that ABA deficiency is responsible for the enhanced disease resistance in the
hsn2 npr1-3 double mutant. Taken together, these data demonstrate that HSN2 is
ABA3. Therefore, hsn2 was renamed aba3-21.
67
Disruption of ABA Signaling Confers NPR1-Dependent Resistance
Previously, it was shown that defects in ABA3 confer disease resistance against
the virulent pathogen Pst DC3000 (Melotto et al., 2006; Fan et al., 2009). To examine
whether the new ABA3 mutant allele, aba3-21, also has enhanced disease resistance,
we inoculated aba3 single mutants, aba3 npr1 double mutants, npr1, and wild type with
the virulent bacterial pathogen Psm ES4326 (OD600=0.001) and monitored the pathogen
growth two and half days later. As shown in Figure 3-4A, Psm ES4326 grew
significantly less in both aba3 single mutants than in the wild type, whereas there were
no significant differences among the wild type, npr1 mutant, and the two aba3 npr1
double mutants, indicating that defects in ABA3 confer NPR1-depedent disease
resistance when challenged with a high bacterial inoculum (OD600=0.001). To determine
whether basal PR gene expression was altered in the aba3 single mutants, four- to five-
week-old soil-grown plants were assayed for PR1 gene expression by real-time qPCR.
As shown in Figure 3-5B, both aba3 single mutants displayed significantly elevated
basal PR1 gene expression, whereas PR1 expression in the aba3 npr1 double mutants
was comparable to that in the wild type. Together, these data indicate that mutations in
ABA3 confer NPR1-depedent disease resistance and PR1 gene expression.
We next investigated whether other mutations in ABA biosynthesis or signaling
also confer NPR1-depedent defense responses. In Arabidopsis, ABA1 encodes a
zeaxanthin epoxidase, which catalyses the epoxidation of zeaxanthin to antheraxanthin
and violaxanthin in the ABA biosynthesis pathway, and mutations in this gene cause
ABA deficiency (Léon-Kloosterziel et al., 1996; Barrero et al., 2005). ABI1 (ABA
insensitive 1) encodes a member of the 2C class of protein phosphatases (PP2C), and
the dominant mutant abi1-1 significantly blocks ABA responsiveness (Leung et al.,
68
1994). We constructed double mutants between aba1-5 and npr1-3 and between abi1-1
and npr1-L through genetic crosses. Similar to aba3, both aba1 and abi1 mutants
conferred NPR1-depedent disease resistance and PR1 gene expression (Figure 5A and
5B). Moreover, the ABA receptor sextuple mutant pyr1 pyl1 pyl2 pyl4 pyl5 pyl8 (112458)
showed enhanced disease resistance and basal PR1 gene expression compared with
the wild type Col-0 (Figrue 5A and 5B). Collectively, these data strongly support a
negative function for ABA in the regulation of Arabidopsis basal resistance against the
bacterial pathogen Psm ES4326, and demonstrate that disruption of ABA signaling
activates NPR1-depedent defense responses.
SA is Essential for aba3-Mediated Resistance to Psm ES4326
To examine whether the resistance phenotype of aba3-21 depends on SA, we
introduced the nahG transgene, which encodes a SA-degrading enzyme (Vernooij et al.,
1994), into the aba3-21 mutant. As shown in Figure 3-5A, basal resistance was
abolished in aba3-21 nahG plants similarly as in nahG plants at 3 days post-inoculation.
We also generated a sid2-1 aba3-21 double mutant, which showed the combined
developmental phenotypes of their parents (data not shown). Susceptibility of the
double mutant to Psm ES4326 was evaluated with a low bacterial inoculum
(OD600=0.0001). Bacterial growth was significantly higher in the aba3-21 sid2-1 double
mutant than in the aba3-21 single mutant (Figure 3-5B), indicating that SA is required
for the enhanced resistance observed in aba3-21. Notably, the double mutant was not
as susceptible as the sid2-1 single mutant (Figure 3-5B), indicating that ABA deficiency
may also confer sid2-independent disease resistance. Overall, these results suggest
that SA is essential for ABA deficiency-conferred disease resistance (Figure 3-5A and
3-5B).
69
High ABA Compromises Defense Responses in Arabidopsis
Since disruption of ABA signaling results in enhanced defense responses, we
postulated that enhancing ABA signaling might compromise defense responses. To test
this, we infiltrated wild-type plants with mock (0.1% ethanol) or 80 M ABA (in 0.1%
ethanol). After 12 h, the treated leaves were inoculated with Psm ES4326
(OD600=0.0001). As shown in Figure 3-6A, the growth of Psm ES4326 in the ABA-
treated plants was significantly higher than in the mock-treated plants. Interestingly, the
growth of Psm ES4326 in the ABA-treated plants was comparable to that observed in
the npr1 mutant plants. The expression of PR1 was also analyzed. The ABA-treated
plants showed significantly decreased PR1 gene expression, similar to that observed in
the npr1 mutant plants (Figure 3-6B). These results indicate that ABA treatment has the
similar effect on defense responses as the npr1 mutation.
We next examined the effect of elevated levels of endogenous ABA on plant
defense responses. In agreement with the previous report (Fan et al., 2009), cds2D,
which constitutively accumulates high levels of endogenous ABA, exhibited enhanced
susceptibility to Psm ES4326 (Figure 3-6C), a phenotype reminiscent of the npr1 mutant
(Cao et al., 1994; Delaneyet al., 1995; Glazebrook et al., 1996; Shah et al., 1997),
indicating that elevated levels of endogenous ABA have the similar effect on disease
resistance as the npr1 mutation. Together with the result that disruption of ABA
signaling confers NPR1-depedent defense responses, these data suggest that ABA
controls plant immunity likely by regulating NPR1 either at the mRNA level or at the
protein level.
70
ABA Has a Positive Function in Full Induction of Defense Reponses
Previously, it was shown that ABA is an important regulator of defense gene
expression during the infection of the damping-off oomycete pathogen P. irregular (Adie
et al., 2007). To examine whether ABA is also required for the induction of defense
genes during the infection of a bacterial pathogen, we analyzed the expression of PR1,
WRKY18, WRKY38, and WRKY62 in aba3-21 and wild-type Col-0 plants during the
infection of Psm ES4326. The background expression level of PR1 was higher in aba3-
21 than in the wild type, whereas after Psm ES4326 infection, PR1 was induced to a
higher level in the wild type than in aba3-21 mutant (Figure 3-7A). Compared with the
wild type, aba3-21 also showed decreased induction of two WRKY genes, WRKY18
and WRKY 38 during Psm ES4326 infection, but there was no significant difference in
the induction of WRKY62 between aba3-21 and the wild type. Similarly, the induction of
PR1, WRKY18, and WRKY38 during Psm ES4326 infection was also partially
compromised in the ABA receptor sextuple mutant 112458, as shown in Figure 3-7A.
Consistently, SA-induced expression of PR1, WRKY38, and WRKY62 was significantly
decreased in aba3-21 and 112458 compared with that in the wild type (Figures 3-7B).
To further demonstrate that ABA is required for the induction of defense genes,
we pretreated the aba3-21 mutant plants with 10 M ABA (in 0.01% ethanol) or mock
(0.01% ethanol) 2 hr before inoculation of Psm ES4326. As shown in Figure 3-7C,
plants pretreated with ABA showed significantly increased induction of defense genes,
including PR1, WRKY18, WRKY38, and WRKY62, during Psm ES4326 infection.
Therefore, ABA is required for full induction of plant defense genes during the infection
of Psm ES4326.
71
Since disruption of ABA signaling compromises the induction of defense genes,
we hypothesized that ABA signaling may play a crucial role in SAR induction. To test
this hypothesis, we examined biological induction of SAR in aba mutants. Three lower
leaves on each plant were syringe-infiltrated with either 10 mM MgCl2 or Psm ES4326.
After 2 days, we challenge-inoculated the upper, untreated systemic leaves with Psm
ES4326. As control, pre-inoculation of wild-type plants with Psm ES4326 protected the
plants against the secondary infection (Figure 3-7D). By contrast, ABA biosynthetic
mutant aba3-21 and ABA receptor sextuple mutant 112458 failed to further induce
resistance (Figure 3-7D), indicating that ABA signaling is required for the induction of
SAR. These results demonstrate that ABA functions as a positive regulator in the
induction of plant defense responses. Together with the negative effect of ABA on plant
defense responses, our data clearly support that the phytohormone ABA plays both
positive and negative functions in regulating plant innate immunity.
Discussion
It is well documented that SA acts as an important signal molecule in plant
defense responses (Vlot et al., 2009; Dempsey et al., 2011). To date, it is still unclear
how SA is synthesized and regulated inside plant cells. To identify new components
regulating SA levels, we performed a forward genetic screen in Arabidopsis for mutants
with altered levels of SA during pathogen infection. We identified the phytohormone
ABA as a negative regulator of SA accumulation during Psm ES4326 infection.
Previously, ABA had been shown to have multiple and diverse functions in plants,
including the regulation of developmental processes, abiotic and biotic stress responses
(Fujita et al., 2005; Wasilewska et al., 2008). During plant-pathogen interactions, both
positive and negative functions have been described for ABA (Mauch-Mani and Mauch,
72
2005; Ton et al., 2009). In this study, we showed that ABA plays both positive and
negative regulatory functions in plant defense responses against a virulent bacterial
pathogen Psm ES4326.
Mutations in ABA3 conferred enhanced basal resistance in an NPR1-dependent
and –independent manner (Figure 3-2B and Figure3-4A), whereas the enhanced
resistance was largely dependent on the SID2-mediated SA biosynthesis (Figure 3-2D
and 3-2E). However, when challenged with a higher bacterial inoculum, plants with
impaired ABA signaling mainly exhibited NPR1-dependent disease resistance (Figure 3-
3C). By contrast, application of ABA at physiologically relevant concentrations promoted
disease susceptibility of wild type plants to Psm ES4326 and suppressed SAR induction
(Yasuda et al., 2008). In addition, treatment of the aba3-21 npr1-3 double mutant plants
with exogenous ABA (10 M) for several days restored the basal susceptibility to a level
similar to that observed in the npr1 mutant plants (Figure 3-3H). Taken together, the
data presented here are consistent with the negative regulatory role of ABA in plant
immunity (Audenaert et al., 2002; Anderson et al., 2004; de Torres-Zabala et al., 2007;
Asselbergh et al., 2008; Yasuda et al. ; Fan et al. 9; L’Haridon et al. ;
Mang et al., 2012; Sanchez-Vallet et al., 2012).
It has been reported that the application of exogenous ABA could suppress SAR
by inhibiting signal transduction both upstream and downstream of SA (Yasuda et al.,
2008). In this study, we found that the aba3 npr1 double mutant plants accumulated
higher SA levels than the npr1 single mutant after infection (Figure 3-1A, 3-1B, and 3-
1C), indicating that ABA is a negative regulator of SA biosynthesis during pathogen
infection. However, SA levels were not higher in the aba3 single mutant relative to the
73
wild type after infection (Fan et al., 2009; data not shown), indicating that the functional
NPR1 in aba3 likely suppresses SA hyper-accumulation during pathogen infection. This
is consistent with previous studies that NPR1 is a feedback inhibitor of SA accumulation
(Wildermuth et al., 2001; Zhang et al., 2010). Thus, our data support that ABA acts as a
negative regulator of SA biosynthesis during pathogen infection.
NPR1 is a key regulator of SAR signaling downstream of SA. It is possible that
ABA regulates plant immunity by controlling NPR1 either at the gene expression level or
at the protein level. The compromised defense phenotype in ABA-treated plants or
mutant plants with constitutively high ABA levels was reminiscent of the npr1 mutant
(Figure 3-6A, 3-6B, and 3-6C), indicating that ABA compromises plant defense possibly
through inactivating NPR1 either at the mRNA level or at the protein level. Moreover,
disruption of ABA signaling activated NPR1-depedent disease resistance (Figure 3-4).
However, whether ABA impacts plant defense responses by regulating NPR1 needs to
be further investigated.
ABA has been shown also to play a positive regulatory role in plant immunity
(reviewed by Ton et al., 2009). We showed here that the aba3-21 mutant and the
sextuple pyr/pyl mutant (112458) were impaired in defense gene induction (Figure 3-7A
and 3-7B). In addition, exogenous application of a low concentration of ABA increased
the induction of defense genes during pathogen infection in aba3 (Figure 3-7C).
Consistently, compromised defense gene induction caused by disruption of ABA
signaling led to impaired biological SAR induction in these mutants (Figure 3-7D). Our
data clearly demonstrate that ABA signaling is essential for the induction of plant
defense responses.
74
Previous studies also reported that ABA has a multifaceted role in disease
resistance depending on the layer of defense involved and/or the specific plant-
pathogen interactions analyzed (Ton et al., 2009; Cao et al.,2011). In addition to ABA
biosynthesis, we demonstrated here that ABA signaling also plays diverse roles even
during infection of the same pathogen Psm ES4326. First, we showed that ABA is a
negative regulator of SA accumulation during infection. Second, we found that ABA
signaling plays a negative role in basal resistance against Psm ES4326. Thirdly, ABA
signaling is essential for the full induction of defense genes. Finally, we showed that
ABA signaling plays a positive function in biological induction of SAR. Taken together,
our data strongly support that ABA signaling plays both positive and negative regulatory
functions in plant defense against Psm ES4326 infection.
Materials and Methods
Plant Materials and Growth Conditions
Arabidopsis thaliana Columbia (Col-0), Landsberg erecta and different mutants
were used: sid2-1 (Wildermuth et al., 2001), aba1-5 (Léon-Kloosterziel et al., 1996),
aba3-1 (Léon-Kloosterziel et al., 1996), npr1-3 (Glazebrook et al., 1996), abi1-1
(Kornneet et al., 1984), pyr1 pyl1 pyl2 pyl4 pyl5 pyl8 (112458) (Gonzalez-Guzman et al.,
2012), cds2D (Fan et al., 2009), npr1-L (GT_5_89558). The nahG transgenic line was
obtained from Xinnian Dong. Plant growth conditions were used in this study as
previously described in Chapter 2.
Map-based Cloning
The hsn2 npr1-3 double mutant in the Columbia ecotype (Col-0) was crossed to
the wild-type Landsberg erecta, and F2 progenies were scored for dark green
phenotype. Rough mapping was first performed on 48 mutant plants to place hsn2 on
75
the north arm of chromosome 1 between markers F21M12 and CIW12. Further markers
were identified using The Arabidopsis Information Resource website
(http://arabidopsis.org/servlets/Search?action=new_search&type=marker), and a total of
1586 mutant plants were used for fine mapping. Markers generated in this study are
listed in Table A-1. The hsn2 mutation was confirmed with derived CAPS markers
(Table A-2) in the original mutant plant and in 150 independent F2 mutant plants from
the mapping populations.
SA Measurement
SA measurement was performed as described in Chapter 2.
ABA Treatment
ABA [(±)-isomer; Acros Organics], was solubilized in ethanol. The ABA solution
(diluted in water) was syringe-infiltrated into 4-5 week-old Arabidopsis leaves using a 1-
mL needleless syringe. Control plants (mock) were treated identically with a solution of
0.1% ethanol. For determination of PR gene expression, infiltrated leaves were
collected for RNA extraction 24 hr after treatment. For the disease susceptibility test,
infiltrated leaves were inoculated with a bacterial pathogen suspension 12 hr after ABA
treatment or at the same time as ABA treatment.
ABA Measurement
ABA measurement was performed as previously reported with slight
modifications (Cheng et al., 2013). Briefly, 0.1 g tissues were ground twice in liquid
nitrogen and extracted for 24 hr at 4°C on a rotary shaker with 1 mL of 80% acetone
with 0.2% (v/v) acetic acid. A total of 500 L of the supernatant was dried under vacuum
and then resuspended in 1 mL of 50% ethanol (v/v) containing 0.1 M NH4H2PO4 by
vortexing. ABA was further cleaned-up using Sep-Pak C18 cartridges (Waters). After
76
washing with 2 mL of 20% methanol containing 2% acetic acid, ABA was eluted with 4
mL of 60% methanol containing 2% acetic acid. 1mL was vaccum dried, resuspended in
250 L Tris-buffered saline (TBS) buffer, and quantified using the Phytodetek ABA
ELISA kit (Agdia) following the manufacturer’s instructions. ABA was extracted from
three independent samples and the data shown represent the mean ABA content of
three replicates.
Bacterial Strains and Pathogen Infection
The virulent bacterial pathogen Psm ES4326 was grown at 28°C overnight in
liquid King’s B medium. Bacterial cells were collected by centrifugation and diluted in
mM MgCl2. Challenge inoculation was performed by pressure-infiltration with a 1-mL
needless syringe as described previously (Clarke et al., 1998). For SA measurement,
two leaves on each four-week-old plant were infiltrated with Psm ES4326 bacterial
suspension (OD600 = 0.001). For the disease susceptibility test, OD600 =0.0001 Psm
ES4326 was used for inoculation, and in planta bacterial growth was assayed three
days after infection. For the disease resistance test, OD600 =0.001 Psm ES4326 was
inoculated and in planta growth of Psm ES4326 was determined two and half days or
three days after inoculation. For SAR evaluation, three lower leaves were inoculated
with Psm ES4326 (OD600 = 0.002) (+SAR) or 10 mM MgCl2 (Mock, -SAR) two days
before secondary infection of one upper leaf with the Psm ES4326 (OD600 = 0.001). The
in planta bacterial titers were assayed 3 days after secondary challenge inoculation.
RNA Extraction and Real-Time PCR
RNA extraction was carried out as described previously (Cao et al., 1997). In
brief, 0.1 g tissue was ground to a fine powder in liquid nitrogen and extracted with
warm water-saturated phenol and RAPD buffer. The aqueous phase obtained was re-
77
extracted with 24:1 chloroform-isoamyl alcohol, and RNA was precipitated with ethanol
by incubating at -80°C for 1 hr. RNA was centrifuged for 15 min at 14000 rpm and
washed once with 75% ethanol, dried at room temperature for 15 min, and dissolved in
40 L nuclease free water.
For reverse transcription (RT), ~10 g of total RNA was treated with DNase I
(Ambion) at 37°C for 30 min for digestion of contaminating DNA. After inactivation of the
DNase, ~2 g of total RNA was used as a template for first-strand cDNA synthesis
using the M-MLV Reverse Transcriptase first-strand synthesis system (Promega). The
resulting cDNA products were diluted 20-fold with autoclaved ddH2o, and 2.5 L used
for quantitative PCR. Quantitative PCR was performed in an Mx3005P qPCR system
(Stratagene). All PCR reactions were performed with a 12.5 L reaction volume using
the SYBR Green protocol under the following conditions: denaturation program (95°C
for 10 min), amplification and quantification program repeated for 40 cycles (95°C for 30
sec, 55°C for 1 min, 72°C for 1 min), and melting curve program (95°C for 1 min, 55°C
for 30 sec, and 95°C for 30 sec).
Statistics
One-way analysis of variance (ANOVA) was used to determine statistical
significance among genotypes or treatments at P<0.05. In addition, two-way analysis of
variance was used to examine the effects of genotypes, treatments, and the interaction
of these two factors on disease resistance. Post-hoc comparison was performed using
Fisher’s least significant difference LSD test at a < . 5 and represented by different
letters. Alternatively, statistical analyses were performed using Student’s t test for
78
comparison of two data sets. A * indicates a statistically significant difference at the level of
at least 95% confidence.
Accession Numbers
The locus numbers for the genes discussed in this study are as follows: ABA1
(At5g67030), ABA2 (At1g52340), ABA3 (At1g16540), ABI1 (At4g26080), NPR1
(AT1G64280), UBQ5 (At3g62250), PR1 (At2g14610), WRKY18 (At4g31800), WRKY38
(At5g22570), WRKY62 (At5g01900).
79
Figure 3-1. Isolation of the hsn2 npr1-3 mutant. A) Luminescence from Psm ES4326-infected Col-0, npr1-3, and hsn2 npr1-3 plants detected by the SA biosensor-based method. Four- to five-week-old soil-grown plants were inoculated with Psm ES4326 (OD600 =0.001). The infected leaves were collected 24 hr post inoculation (hpi) for SA measurement. Data represent the mean of eight independent samples with SD. B) and C) Free B) and total (C) SA levels in Psm ES4326-infected WT, npr1-3, and hsn2 npr1-3 plants detected by the HPLC-based method. Plants were treated as in (A). Data represent the mean of three independent samples with SD. FW, fresh weight; SAG, SA-2-O-β-D-glucoside. D) Morphology of hsn2 npr1-3. Plants were grown under long day conditions at 22°C. Photos were taken 22 days after germination. Different letters above the bars in (A), (B), and (C) indicate significant differences (P < 0.05, tested by one-way ANOVA). All experiments were repeated with similar results.
80
Figure 3-2. Defense phenotypes of the hsn2 npr1-3 mutant. A) Visual phenotype of Psm ES4326-infected Col-0, npr1-3, and hsn2 npr1-3 leaves. Four- to five-week-old soil-grown plants were inoculated with Psm ES4326 (OD600 = 0.0001). Photos were taken 3 days after inoculation. B) Growth of Psm ES4326 in Col-0, npr1-3, and hsn2 npr1-3 plants. Four- to five-week-old soil-grown plants were inoculated with Psm ES4326 (OD600 = 0.0001). The in planta bacterial titers were determined immediately and at 3 dpi. Data represent the mean of eight independent samples with SD. C) Growth of Psm ES4326 in Col-0, npr1-3, and hsn2 npr1-3 plants. Four- to five-week-old soil-grown plants were inoculated with Psm ES4326 (OD600 = 0.001). The in planta bacterial titers were determined two and half days post inoculation. Data represent the mean of eight independent samples with SD. D) Growth of Psm ES4326 in wild-type Col-0, npr1-3, hsn2 npr1-3, hsn2 npr1-3 nahG, and nahG plants. Four- to five-week-old soil-grown plants were inoculated with Psm ES4326 (OD600 = 0.0001). The in planta bacterial titers were determined 3 dpi. Data represent the mean of eight independent samples with SD. E) Growth of Psm ES4326 in wild-type Col-0, npr1-3, sid2-1, hsn2 npr1-3, and hsn2 sid2-1 npr1-3 plants. Four- to five-week-old soil-grown plants were inoculated with Psm ES4326 (OD600 = 0.0001). The in planta bacterial titers were determined 3 dpi. Data represent the mean of eight independent samples with SD. Different letters above the bars in (B), (C), (D), and (E) indicate significant differences (P < 0.05, tested by one-way ANOVA). All the experiments were repeated with similar results. cfu, colony-forming units.
81
Figure 3-3. Map-based cloning of hsn2. A) A schematic diagram of the map-based cloning process. A total of 48 F2 progeny homozygous for hsn2 were used to determine the approximate position of the hsn2 mutation using bulked segregant analysis. hsn2 was linked to the markers F21M12 and CIW12 on the north arm of chromosome 1. Out of a total mapping population of 1586 mutant plants, two were heterozygous at M1, and four were heterozygous at M5. The heterozygotes found by these two markers were mutually exclusive. No heterozygotes were found at M2, M3, and M4. Novel markers used in this process are listed in Table A-1. cM, centimorgan; Rec., recombination. B) DNA polymorphism between hsn2 and wild type Col-0. A new CAPS marker was generated based on the hsn2 mutation (Table A-2). The PCR products amplified from hsn2 npr1-3 and Col-0 genomic DNA were digested with Mse I and separated on an agarose gel. C) The hsn2 mutation causes alternative splicing of the ABA3 gene. A pair of primers (Table A-4) spanning the mutated splicing site were used. One band was amplified from wild type Col-0 cDNA, whereas multiple fragments were amplified from hsn2 npr1-3 cDNA. D) Free Psm ES4326-induced SA levels. Luminescence from Psm ES4326-infected Col-0, npr1-3, hsn2 npr1-3, F1, and aba3-1npr1-3 detected by the SA biosensor-based method. Values are the mean of eight independent samples with SD. E) Growth of Psm ES4326 in Col-0, npr1-3, hsn2 npr1-3, F1, and aba3-1npr1-3 plants. The plants were infiltrated with a bacterial suspension of OD600 = 0.0001. The in planta bacterial titers were determined 3 dpi. Data represent means with standard deviation (SD) of eight independent samples. F) The plants were grown on soil for 25 days before the photos were taken. G) Quantification of ABA levels in aba3-1, hsn2 and Col-0. Leaf samples were collected from four- to five-week-old soil-grown plants for ABA measurement. Data are means with SD (n = 3) from three biological repeats. FW, fresh weight. H) Growth of Psm ES4326 in npr1-3, water-treated hsn2 npr1-3, and
ABA-treated (10 M) hsn2 npr1-3 plants. The plants were infiltrated with a bacterial suspension of OD600 = 0.0001. The in planta bacterial titers were determined 3 dpi. Data represent means with standard deviation (SD) of eight independent samples. I) The phenotypes of hsn2 npr1-3 were rescued by spraying with ABA. Shown are npr1-3, water-treated hsn2 npr1-3, and ABA-
treated (10 M) hsn2 npr1-3 plants. All experiments were repeated with similar results. Different letters above the bars in (D), (E), (G), and (I) indicate statistically significant differences (p<0.05, tested by one-way ANOVA). Cfu, colony-forming units.
A
82
Figure 3-3. Continued
B C
D E
F
83
Figure 3-3. Continued
+ABA
G
I
H
+ABA
84
Figure 3-4. Disruption of ABA signaling confers NPR1-dependent defense responses. A) Growth of Psm ES4326 in Col-0, npr1-3, aba3-1, aba3-21, aba1-5, aba3-1 npr1-3, aba3-21 npr1-3, aba1-5 npr1-3, 112458, Ler 2-2, npr1-L, abi1-1, and abi1-1 npr1-L plants. The plants were infiltrated with a bacterial suspension of OD600 = 0.001. The in planta bacterial titers were determined 3 dpi. Data represent the mean of eight independent samples with SD. Cfu, colony-forming units. B) Total RNA was extracted from similar-size untreated Col-0, npr1-3, aba3-1, aba3-21, aba1-5, aba3-1 npr1-3, aba3-21 npr1-3, aba1-5 npr1-3, 112458, Ler 2-2, npr1-L, abi1-1, and abi1-1 npr1-L plants. The expression of PR1 was analyzed by qPCR and normalized against constitutively expressed UBQ5. Data represent the mean of three independent samples with SD. Different letters above the bars in (A) indicate significant differences (P<0.05, tested by one-way ANOVA), and an asterisk * in B indicates significant difference < . 5 student’s t test). All experiments were repeated three times with similar results.
A
B
85
Figure 3-5. SA is required for ABA-deficiency-mediated disease resistance. A) Growth
of Psm ES4326 in Col-0, aba3-21, nahG, and aba3-21 nahG plants. The plants were infiltrated with a bacterial suspension of OD600 = 0.0001. The in planta bacterial titers were determined 3 dpi. Data represent the mean of eight independent samples with SD. B) Growth of Psm ES4326 in Col-0, sid2-1, aba3-21, and aba3-21 sid2-1plants. The plants were infiltrated with a bacterial suspension of OD600 = 0.0001. The in planta bacterial titers were determined 3 dpi. Data represent the mean of eight independent samples with SD. Different letters above the bars in (A) and (B) indicate significant differences (P<0.05, tested by one-way ANOVA). The experiment was repeated with similar results. Cfu, colony-forming units.
A B
86
Figure 3-6. High ABA suppresses defense responses in Arabidopsis. A) Growth of Psm ES4326 in wild-type plants treated with or without ABA, and npr1-3 mutant plants. Four-week-old soil-grown plants were infiltrated with ABA solution (80
M in 0.1% ethanol) or water (0.1% ethanol). After 12 hr, the infiltrated leaves were inoculated with the bacterial pathogen Psm ES4326 (OD600 =0.0001). Eight leaves were collected 3 days post-inoculation to examine the growth of the pathogen. Data represent the mean of eight independent samples with SD. B) Expression of PR1 gene in wild-type plants treated with or without ABA, and npr1-3 mutant plants. Two leaves of four-week-old soil-grown
plants were infiltrated with ABA solution (80 M in 0.1% ethanol) or water (0.1% ethanol). Total RNA was extracted from leaf tissues collected 24 hr later and subjected to qPCR analysis. PR1 transcript levels were normalized to the expression of UBQ5 in the same samples. Data represent the mean of three independent samples with SD. C) Growth of Psm ES4326 in Col-0, npr1-3, cds2D, and cds2D npr1-3 double mutant plants. The plants were infiltrated with a bacterial suspension of OD600 = 0.0001. The in planta bacterial titers were determined 3 dpi. Data represent the mean of eight independent samples with SD. Different letters above the bars in (A), (B), and (C) indicate statistically significant differences (p<0.05, tested by one-way ANOVA). The experiment was repeated three times with similar results. Cfu, colony-forming units.
87
Figure 3-7. ABA signaling is required for the full Induction of NPR1 target genes. A) Psm ES4326-induced expression of PR1, WRKY18, WRKY38, and WRKY62 in Col-0, aba3-21, and pyr1 pyl1 pyl2 pyl4 pyl5 pyl8 (112458) plants. Four- to five-week-old soil-grown plants were inoculated with Psm ES4326 (OD600 = 0.001). Total RNA was extracted from the inoculated leaves collected at the indicated time points and analyzed for the expression of indicated genes using qPCR. Expression was normalized against constitutively expressed UBQ5. Data represent the mean of three independent samples with SD. The comparison was made separately among Col-0, aba3-21, and 112458 for each time point. B) SA-induced expression of PR1, WRKY18, WRKY38, and WRKY62 in Col-0, aba3-21, and 112458 plants. Four- to five-week-old soil-grown plants were treated with soil drenches plus foliar sprays of 0.5 mM of SA solution or water. After 24 hr, leaf tissues were collected and subjected to total RNA extraction and qPCR analysis. Data represent the mean of three independent samples with SD. The comparison was made separately among Col-0, aba3-21, and 112458 for each time point. C) Psm ES4326-induced expression of PR1, WRKY18, WRKY38, and WRKY62 in aba3-21 treated
with or without 10M ABA. Five-week-old aba3-21 plants were pretreated with
10 M ABA (in 0.01% ethanol) or mock (0.01% ethanol) two hr before inoculation of Psm ES4326. Total RNA was extracted from the inoculated leaves collected 24 hr later and analyzed for the expression of indicated genes using qPCR. Expression was normalized against constitutively expressed UBQ5. Data represent the mean of three independent samples with SD. D) Induction of SAR against Psm ES4326 in Col-0, 112458, and aba3-21 plants. Three lower leaves on each plant were inoculated with Psm ES4326 (OD600 = 0.002) (+SAR) or 10 mM of MgCl2 (-SAR). After 2 d, one upper uninfected/untreated leaf was challenge-inoculated with Psm ES4326 (OD600 = 0.001). The in planta bacterial titers were determined 3 d after challenge inoculation. Data represent the mean of eight independent samples with SD. Cfu, colony-forming units. Asterisks indicate statistically significant differences compared with uninduced WT plants (Tukey–Kramer ANOVA test; a = 0.05, n = 8). Different letters above the bars in (A), (B), and (C) indicate statistically significant differences (p<0.05, tested by one-way ANOVA). All experiments were repeated three times with similar results.
A
88
Figure 3-7. Continued
B
C
D
89
CHAPTER 4 ABA AND SA COOPERATE TO REGULATE THE HOMEOSTASIS OF THE
TRANSCRIPTION COACTIVATOR NPR1 IN PLANT IMMUNITY
Background Information
Plants, as sessile organisms, often encounter environmental stresses, including
biotic and abiotic stresses, during their life cycle. In addition to constitutive physical and
chemical strategies, plants have developed an effective inducible defense system
against a variety of stresses (Glazebrook, 2005; Jones and Dangl, 2006; Santner and
Estelle, 2009). Plant hormones have been shown to play central roles in modulating
diverse plant defense responses. Defense against biotic threats is largely contributed by
SA- and JA/ET-mediated signaling pathways, while abiotic stress responses are mainly
controlled by ABA (Kunkel and Brooks, 2002).
SA is a positive regulator of defense responses against biotrophic and
hemibiotrophic pathogens (Dong, 2004). In the last two decades, another key player of
plant immunity, NPR1, has been shown to function downstream of SA (Fu and Dong,
2013). The NPR1 gene is constitutively expressed throughout the plant, and the levels
of NPR1 transcript only increase two- to three-fold after pathogen infection or SA
treatment, suggesting that NPR1 is mainly regulated at the protein level (Ryals et al.,
1997; Cao et al., 1997; Dong, 2004). Moreover, the NPR1 overexpressing lines do not
constitutively express PR genes, indicating that NPR1 protein must be activated to be
functional (Durrant and Dong, 2004). In the absence of induction, NPR1 oligomer forms
through intermolecular disulfide bonds in the cytosol (Mou et al., 2003). Upon induction,
these disulfide bonds are reduced, triggering movement of NPR1 monomer into the
nucleus, where it acts as a coactivator for transcription factors, such as TGAs, to induce
PR genes (Kinkema et al., 2000; Mou et al., 2003). Cysteine residue 156 has been
90
shown to be important for NPR1 oligomer formation through S-nitrosylation by S-
nitrosoglutathione (Tada et al., 2008). Recent studies revealed that NPR1 could be
polyubiquitinylated by the Cullin 3 E3 ligase and consequently degraded by the 26S
proteasome (Spoel et al., 2009; Fu et al., 2012). SAR activation can promote
phosphorylation of NPR1, resulting in its degradation (Spoel et al., 2009). Thus, it has
been proposed that proteasome-mediated NPR1 degradation plays dual functions in
plant immunity (Spoel et al., 2009). Fu et al. (2012) reported that NPR3 and NPR4
mediate NPR1 degradation in a SA concentration dependent manner and serve as SA
receptors. SA disrupts the interaction between NPR1 and NPR4, rendering NPR1 less
susceptible to degradation, whereas SA facilitates the interaction between NPR1 and
NPR3, promoting NPR1 degradation (Fu et al., 2012).
While ABA is well known for its role in mediating tolerance to abiotic stresses,
recent studies also revealed that ABA has a crucial role in regulating responses to biotic
stresses (Ton et al., 2009; Cao et al., 2011). It has been reported that ABA negatively
regulates plant disease resistance against (hemi)biotrophic pathogens by antagonizing
the SA signaling pathway (Yasuda et al., 2008; Fan et al., 2009; Cao et al., 2011; Xu et
al., 2013). Nevertheless, how ABA regulates plant disease resistance is not yet fully
understood.
In this study, we investigated the underlying mechanism of the effect of ABA on
plant immunity. Our findings revealed a novel mechanism that integrates SA signaling
and ABA signaling to coordinate biotic and abiotic stresses.
91
Results
ABA Negatively Regulates NPR1 Protein Accumulation
Based on genetic analysis, we reasoned that ABA might regulate plant disease
resistance through NPR1 either at the transcriptional level or at the posttranscriptional
level or both. To examine the effect of ABA on NPR1 gene expression, a meta-analysis
of public microarray data was performed using Genevestigator (Zimmermann et al.,
2004). We found that NPR1 mRNA levels are not significantly affected by ABA
treatments in adult plants (data not shown). To further investigate whether ABA
regulates NPR1 gene expression, we performed a real-time PCR analysis. Treatment
with ABA induced the ABA-responsive gene RAB18 in a dose dependent manner
(Figure 4-1A), whereas ABA did not have a substantial effect on the expression of
NPR1 (Figure 4-1B). On the basis of this result, we postulated that the effect of ABA on
NPR1 might be post-transcriptional. To test this possibility, we treated plants expressing
Myc-NPR1 driven by its endogenous promoter with ABA (Zhang et al., 2012). Strikingly,
ABA treatment led to a significant decrease in Myc-NPR1 protein levels (Figure 4-2A).
To confirm that ABA is capable of reducing the abundance of NPR1 protein, we
used the previously characterized 35S::NPR1-GFP (in npr1-1) transgenic plants
(Kinkema et al., 2000). After ABA treatment, we observed a decrease in NPR1-GFP
protein levels (Figure 4-2B), though to a lesser extent than in Myc-NPR1 levels (Figure
4-2A). The effect of ABA on NPR1-GFP protein was probably post-transcriptional
because ABA did not reduce transcript levels of NPR1-GFP (Figure 4-2C). To verify that
high levels of ABA reduce the abundance of NPR1 protein, we crossed NPR1::Myc-
NPR1 and 35S::NPR1-GFP into the cds2D mutant, which constitutively accumulates
elevated levels of ABA (Fan et al., 2009). As shown in Figure 4-2D, Myc-NPR1 and
92
NPR1-GFP in the cds2D mutant were significantly decreased. Since plants with high
levels of ABA exhibit compromised defense responses (Figure 4-2E; de Torres-Zabala
et al., 2007; Yasuda et al., 2008; Fan et al., 2009), these findings suggest that ABA may
negatively regulate plant defense responses by modulating the abundance of NPR1.
ABA might interfere with the production or stability of the NPR1 protein, leading
to its concentration decrease. To investigate this, 4-week-old NPR1::Myc-NPR1 plants
were treated with the protein synthesis inhibitor cycloheximide (CHX) followed by
treatment with or without 80 M ABA. As shown in Figure 4-2F, the amount of NPR1
protein was reduced after CHX treatment, and decreased more rapidly in the presence
of both CHX and ABA, indicating that ABA likely impacts NPR1 protein stability rather
than NPR1 protein production.
To confirm that ABA modulates NPR1 protein stability, we examined the
accumulation of NPR1 in the aba3-21 mutant. We introduced the NPR1::Myc-NPR1 and
35S::NPR1-GFP transgenes into the aba3-21 mutant background through genetic
crosses. As shown in Figure 4-3A, NPR1 protein levels were significantly higher in the
aba3-21 mutant than in the wild type. The increased accumulation of NPR1 protein in
aba3 may explain why the aba3 mutant plants show elevated levels of the NPR1 target
gene PR1 and basal resistance (Figure 3-4; de Torres-Zabala et al., 2007; Fan et al.,
2009; Sanchez-Vallet et al., 2012). Notably, the defense phenotype in the aba mutant is
reminiscent of both cul3a cul3b and npr3 npr4 double mutants (Spoel et al., 2009; Fu et
al., 2012), further corroborating that ABA negatively regulates NPR1 protein
accumulation.
93
ABA Triggers NPR1 Monomer Degradation via the 26S Proteasome Pathway
Since NPR1 protein turnover is mediated by the 26S proteasome during SAR
(Spoel et al., 2009), we next investigated whether ABA-promoted degradation of NPR1
specifically requires proteasome activity. The NPR1::Myc-NPR1 transgenic plants were
treated with the 26S proteasome inhibitor MG115 before addition of ABA. As reported
previously (Spoel et al., 2009), inhibition of proteasome activity markedly increased the
accumulation of Myc-NPR1 protein (Figure 4-4A). ABA-induced degradation of Myc-
NPR1 was clearly attenuated by MG115 (Figure 4-4A), suggesting that ABA-triggered
NPR1 degradation is dependent on the 26S proteasome pathway.
To further confirm that ABA-promoted NPR1 turnover depends on the 26S
proteasome activity, we treated the 35S::NPR1-GFP transgenic plants with ABA in the
presence of MG115. As observed previously (Mou et al., 2003; Spoel et al., 2009),
MG115 treatment substantially enhanced the abundance of NPR1-GFP in the nucleus
(Figure 4-4B). Plants treated with both MG115 and ABA still showed detectable GFP
fluorescence in the nuclei, albeit at a level lower than that observed in the MG115-
treated plants (Figure 4-4B). Consistently, western blot analysis showed that treatment
with the proteasome inhibitor MG115 significantly enhanced NPR1-GFP protein
accumulation and blocked the ABA-induced degradation (Figure 4-4C). Taken together,
these results indicate that ABA promotes proteasomal degradation of NPR1 protein.
Previous studies have shown that NPR1 can be polyubiquitinylated by a Cullin 3
E3 ligase, leading to its proteasomal degradation (Spoel et al., 2009; Fu et al., 2012).
Therefore, we examined if Cullin 3 E3 ligase is required for ABA-promoted NPR1
degradation. Four-week-old wild-type and cul3a cul3b plants carrying 35S::NPR1-GFP
construct were treated with ABA. As shown in Figure 4-5A, ABA treatment led to a
94
significant decrease of NPR1-GFP protein in the wild type, whereas ABA-induced
NPR1-GFP degradation was partially blocked in the cul3a cul3b mutant plants. This
could be due to incomplete knockout of Cullin 3 E3 ligase or existence of other E3
ligase-mediated NPR1 turnover in the presence of ABA. Next, we tested whether Cullin
3 E3 ligase is required for ABA-promoted NPR1 degradation in SA-induced plants. As
shown in Figure 4-5B, ABA reduced NPR1 accumulation even in the presence of SA,
whereas NPR1 protein levels remained unchanged in the cul3a cul3b mutant,
suggesting that Cullin 3 E3 ligase is required for ABA-induced NPR1 degradation in the
presence of SA. To demonstrate further that ABA-induced NPR1 degradation requires
the CUL3 E3 ligase, we tested whether ABA promotes the interaction between them. A
co-immunoprecipitation assay was performed using transgenic plants expressing Myc-
NPR1 in the wild type and aba3-21 mutant plants. We found that the amount of the
endogenous CUL3 protein pulled down by Myc-NPR1 was markedly less in the aba3-21
mutant than in the wild type (Figure 4-5C), suggesting that the Myc-NPR1 interaction
with CUL3 requires ABA. Taken together, these data indicate that ABA-promoted NPR1
proteolysis requires the CUL3 E3 ligase.
NPR1 monomer has been shown to be degraded in the nucleus (Spoel et al.,
2009). To investigate whether ABA-induced NPR1 degradation also occurs in the
nucleus, we examined the in vivo stability of NPR1-GFP and the nuclear localization
sequence mutant npr1-nls-GFP by treating plants with ABA. After ABA treatment, the
amount of NPR1-GFP decreased, whereas the levels of npr1-nls-GFP remained almost
unchanged (Figure 4-6A), indicating that ABA-induced NPR1 degradation may occur in
the nucleus. We then investigated if NPR1 oligomers and monomers are equally
95
sensitive to ABA-promoted proteasomal degradation by testing the in vivo stability of
NPR1C156A-GFP and NPR1-GFP in the presence of ABA. Upon ABA treatment,
NPR1C156A-GFP protein decreased much faster than the NPR1-GFP protein (Figure
4-6B). In agreement with the observed rapid degradation rate of NPR1C156A-GFP
protein, treatment with ABA resulted in more susceptibility of 35S::NPR1C156A-GFP
plants to Psm ES4326 (Figure 4-6C). Taken together, these results indicate that ABA-
promoted NPR1 proteolysis may occur in the nucleus and NPR1 monomer is more
sensitive to ABA-promoted degradation.
SA Decelerates ABA-Promoted NPR1 Degradation
SA has been shown to be able to trigger NPR1 oligomer to monomer transition
and monomeric NPR1 is then translocated into the nucleus, where NPR1 acts as a
transcriptional co-activator to induce PR genes (Kinkema et al., 2000; Mou et al., 2003;
Spoel et al., 2009). To examine whether ABA has an effect on the SA-induced NPR1
nuclear translocation, we pretreated the 35S::NPR1-GFP transgenic plants with ABA 12
hr before addition of SA. As reported previously, SA treatment led to accumulation of
NPR1-GFP monomer in the nucleus (Figure 4-7A and C). Strikingly, SA-induced
monomer was completely absent in the presence of ABA, as shown in Figure 4-7D.
Accordingly, western blot analysis demonstrated that SA treatment did not rescue
NPR1-GFP from degradation triggered by ABA (Figure 4-8A). Similar results were
obtained for Myc-NPR1 protein (Figure 4-8B). Consequently, SA-induced expression of
NPR1-dependent defense gene PR1 was strongly suppressed in the ABA pretreated
plants (Figure 4-8C), which is consistent with a previous report that ABA treatment
suppresses BIT- and BTH-induced PR1 expression (Yasuda et al., 2008). Next, we
examined whether a high endogenous ABA level is also able to reduce NPR1 protein
96
accumulation in the presence of SA. As shown in Figure 4-9A and 4-9B, SA treatment
was not able to rescue NPR1-GFP protein and Myc-NPR1 protein in the cds2D mutant
plants. Collectively, these data demonstrate that ABA promotes the degradation of
NPR1 protein even in the presence of SA, which provides an explanation for the
compromised SAR in plants with high levels of ABA (Figure 4-8D; Yasuda et al., 2008;
Fan et al., 2009).
Accumulating evidence supports an antagonistic relationship between SA and
ABA in plant defense responses (Flors et al., 2008; Yasuda et al., 2008; de Torres-
Zabala et al., 2009). This prompted us to investigate whether SA pretreatment can
counteract the effect of ABA on the stability of NPR1 protein. We pretreated the
35S::NPR1-GFP transgenic plants with SA 24 hr before addition of ABA. Interestingly,
ABA treatment barely inhibited SA-induced nuclear translocation of NPR1-GFP (Figure
4-7F), and resulted in a slight decrease in total NPR1 protein (Figure 4-10A). However,
compared with pretreatment with ABA, SA pretreatment appeared to be able to
counteract the effect of ABA on the abundance of NPR1 protein (Figure 4-7D and 4-7F,
Figure 4-8B, Figure 4-10A). Moreover, when SA and ABA were applied at the same
time, SA seemed to be less effective in protecting NPR1 protein than pretreatment
(Figure 4-10C and 4-10D). Taken together, these data suggest that SA is able to
decelerate ABA-induced NPR1 degradation.
Previously, SA was shown to be able to promote NPR1 phosphorylation (Spoel
et al., 2009). Taking advantage of the previously generated 35S::npr1S11/15D-GFP (in
npr1-2) transgenic plants (Spoel et al., 2009), we tested whether SA decelerates ABA-
induced NPR1 degradation through promoting its phosphorylation. We first examined
97
the in vivo stability of NPR1-GFP and npr1S11/15D-GFP in the presence of ABA, and
found that npr1S11/15D-GFP exhibited a decreased degradation rate compared to
NPR1-GFP (Figure 4-11A), indicating that phosphorylated NPR1 is more stable in the
presence of ABA. Based on this, we hypothesized that 35S::npr1S11/15D-GFP plants
may be insensitive to ABA-induced disease susceptibility. To test this hypothesis, we
pretreated 35S::NPR1-GFP and 35S::npr1S11/15D-GFP plants with ABA or Mock. After
12 hr, the treated leaves were inoculated with Psm ES4326. The growth of the bacterial
pathogen in the leaves was determined 3 days post-inoculation. As shown in Figure 4-
11B, the growth of Psm ES4326 was significantly higher in the ABA-treated 35S::NPR1-
GFP plants than in the mock-treated 35S::NPR1-GFP plants, whereas there was no
significant difference between ABA-treated and mock-treated 35S::npr1S11/15D-GFP
plants. However, in two of five experiments, we did not detect the significantly negative
effect of ABA on NPR1-GFP protein accumulation and disease resistance, indicating
that NPR1-GFP protein can be modified or the effect of ABA on NPR1-GFP protein can
be modulated by unidentified environmental conditions. Overall, these data indicate that
SA decelerates ABA-promoted NPR1 degradation likely through promoting NPR1
phosphorylation.
ABA-Induced NPR1 Degradation Dampens Defense Responses after Pathogen Infection Subsides
Interplay between SA and ABA has been indicated to be crucial for plant immune
responses, including SAR (Yasuda et al., 2008; de Torres-Zabala et al., 2009; Fan et
al., 2009; Choi and Hwang, 2011). To examine the effect of endogenous SA and ABA
on SAR, we analyzed both SA and ABA levels in systemic tissues of wild-type Col-0
and aba3-21 mutant plants infected with the virulent bacterial pathogen Psm ES4326.
98
As shown in Figure 4-12A and 4-12B, the SA level peaked at 24 hpi in wild-type
systemic leaves and then decreased to basal levels by the end of the experiment,
whereas the ABA level reached the highest level at 48 hr, and then decreased. In
contrast, although the dynamic pattern of systemic SA accumulation in aba3 was similar
to that in the wild type, ABA remained unchanged (Figure 4-12A and 4-12B). Together
with the finding that the aba3-21 mutant is defective in SAR induction, these results
support that endogenous ABA and SA cooperate to regulate SAR.
Since NPR1 is regulated by both SA and ABA, we hypothesized that SA and
ABA may cooperate to control SAR through NPR1. To test this, we first examined the
accumulation kinetics of the Myc-NPR1 protein in systemic tissues of wild-type and
aba3-21 plants during the time course of SAR development. As shown in the western
blot in Figure 4-13A, the Myc-NPR1 protein showed a significant increase at 36 hr after
infection, and then decreased to basal levels. In contrast, the dynamic changes of Myc-
NPR1 protein levels in aba3-21 were significantly diminished (Figure 4-13A). We also
analyzed the transcription profiles of the SAR marker gene PR1 in the systemic tissues.
Consistent with the notion that PR1 is one of the NPR1 target genes, the expression
pattern of PR1 coincided well with that of the Myc-NPR1 protein (Figure 4-13B). To
eliminate the effect of transcriptional regulation on NPR1 protein level, we also
examined the 35S::NPR1-GFP transgenic plants, which constitutively express the
transgene independent of SA (Spoel et al., 2009). As shown in Figure 4-15, NPR1-GFP
protein concentration exhibited a similar dynamic pattern as the Myc-NPR1 protein
during biological induction of SAR. Together with the accumulation kinetics of SA and
ABA during SAR induction (Figure 4-12A and 4-12B), these data suggest that both SA
99
and ABA appears to be required for the accumulation and/or activation of NPR1,
whereas the inactivation of SAR may be attributed to the reduction and/or deactivation
of NPR1 due not only to the decreased SA concentrations but also to the elevated
levels of ABA.
To further demonstrate the role of ABA and SA in the inactivation of SAR, we
performed an experiment to mimic the dynamic changes of SA and ABA during
pathogen infection. Since SA accumulation precedes ABA accumulation during
biological induction of SAR, we first activated plant defense responses by treating the
NPR1::Myc-NPR1 transgenic plants with SA. After 24 hr, SA was removed. At the same
time, plants were treated with ABA or a mock solution. As shown in Figure 4-14A and 4-
14B, NPR1 protein and its target gene PR1 in the mock-treated NPR1::Myc-NPR1
plants decreased after removing SA, indicating that SA has an important role in
maintaining NPR1 protein level and activating SAR. However, treatment with ABA
resulted in a rapid reduction of NPR1 protein, leading to a quick decrease of PR1 gene
expression, suggesting that ABA has a crucial role in inactivating SAR. Moreover, NPR1
protein and its target gene PR1 in aba3-21 mutant plants showed a relatively slow
decrease rate after removing SA (Figure 4-14A and 4-14B), further supporting that ABA
is involved in inactivation of SAR. Taken together, these data support that the
inactivation of SAR is attributed to the reduction of NPR1 protein not only due to the
decreased SA levels but also due to the elevated ABA levels when pathogen infection
subsides.
To dissect the individual role of ABA signaling and SA signaling in maintaining
SAR, we tested the effect of shifting either SA or ABA signaling on the accumulation
100
kinetics of NPR1 protein. We first infected the NPR1::Myc-NPR1 transgenic plants with
the bacterial pathogen Psm ES4326. After 24 hr, systemic tissues of infected plants
were then treated with SA or DFPM, which is an inhibitor of ABA signaling (Kim et al.,
2011). As shown in Figure 4-16A, 4-16B, and 4-16C, either enhancement of SA
signaling or inhibition of ABA signaling was capable of stabilizing NPR1 protein,
consequently maintaining PR1 gene expression at high levels. Since SA accumulation
precedes ABA accumulation during biological induction of SAR (Figure 4-12), we next
examined the effect of pre-activation of ABA signaling on SAR. As shown in Figure 4-
16D, pre-activation of ABA signaling blocked the accumulation of NPR1 protein (Figure
4-16D), leading to a significant suppression of PR1 gene expression (Figure 4-16E).
Taken together, these data support that ABA and SA cooperate to regulate SAR by
controlling the homeostasis of NPR1.
SA Suppresses ABA Signaling possibly through Phosphorylation of NPR1
In many biological processes of plants, such as responses to abiotic and biotic
stresses, the proteasome either degrades activators to suppress gene expression or
degrades repressors to activate transcription (Smalle and Vierstra, 2004). Previously,
Yasuda et al. (2008) reported that NPR1 might be involved in the suppressive effect of
SAR signaling on ABA signaling. Therefore, the observation of ABA-promoted
proteasome-mediated degradation of NPR1 led us to investigate whether NPR1 is a
suppressor of ABA signaling. Since ABA promotes seed dormancy and inhibits seed
germination (Wasilewska et al., 2008), we hypothesized that NPR1 may be involved in
regulating these processes. In our ABA response assays, the wild type and three npr1
mutant alleles, npr1-1, npr1-2, and npr1-3, were equally sensitive to the inhibitory effect
of ABA during seed germination (Figure 4-17A). We reasoned that the presence of ABA
101
likely promotes NPR1 degradation, making the wild type resembling npr1 mutants. If
this were true, we expected that overexpression of the npr1S11/15D-GFP protein, which
is less sensitive to ABA-promoted degradation, would reduce the sensitivity to ABA.
Indeed, 35S::npr1S11/15D-GFP seedling was less sensitive to the inhibitory effect of
ABA than the 35S::NPR1-GFP seedling during postgerminative growth (Figure 4-17B
and 4-17C). Consistent with this, the expression of ABA responsive genes, including
RAB18, RD22, COR15A, RD29A, and RD29B, was significantly decreased in
35S::npr1S11/15D-GFP seedlings compared with that in 35S::NPR1-GFP seedlings
after ABA treatment (Figure 4-17). Together with the fact that SA promotes NPR1
phosphorylation, these results indicate that SA suppresses ABA signaling likely by
promoting NPR1 phosphorylation.
Discussion
Proteasome-mediated protein degradation has been directly or indirectly
implicated in the action of plant hormones, including auxin, gibberellins, ABA, JA, SA,
and ethylene (Hellmann and Estelle, 2002; Smalle and Vierstra, 2004; Dreher and
Callis, 2007; Stone and Callis, 2007; Spoel et al., 2009). Hormone signaling often leads
to a secondary modification of transcriptional activators or repressors, resulting in either
their degradation or stabilization. In this study, we showed that ABA negatively affects
the stability of NPR1 to regulate plant immunity, and that NPR1 takes part in the
suppressive effect of SA signaling on ABA-mediated signaling, providing an important
mechanism that integrates SA signaling and ABA signaling to coordinate biotic and
abiotic stresses.
Several reports have shown that exogenous application of ABA increases plant
susceptibility to pathogen infections that activate SA-mediated defense signaling. Mohr
102
and Cahill (2003) reported that ABA treatment increased the susceptibility of
Arabidopsis plants to the biotrophic oomycete pathogen Peronospora parasitica and the
avirulent bacterial pathogen Pst 1065 but not to the virulent pathogen Pst DC3000.
However, other studies showed that the activation of ABA signaling actually could
enhance the bacterial virulence of Pst DC3000 by either ABA treatment or the bacterial
T3E or abiotic stress (de Torres-Zabala et al., 2007; Fan et al., 2009). In our study,
exogenous application of ABA was able to promote the susceptibility of Arabidopsis
plants to Psm ES4326 in a dose-dependent manner (Figure 4-2E). This is consistent
with a previous report that the ABA level is directly correlated with the growth of virulent
bacterial pathogens in Arabidopsis (de Torres-Zabala et al., 2009).
ABA has been shown to suppress inducible defense responses by inhibiting the
pathway both upstream and downstream of SA (Yasuda et al., 2008; de Torres-Zabala
et al., 2009). In the last chapter, we showed that endogenous ABA is able to suppress
the accumulation of SA during pathogen infection. Here, we successfully demonstrate
that ABA regulates plant immunity through affecting the stability of NPR1 protein, which
is a key regulator of plant immunity downstream of SA. We used both genetic and
biochemical approaches to show that ABA promotes the proteasome-mediated
degradation of NPR1 protein, which plays both positive and negative functions in
regulating plant immune responses.
NPR1 contains a BTB domain, which is the general structure of an adaptor
protein for the Cullin 3 E3 ligase. Spoel et al. (2009) demonstrated that NPR1
associates with CUL3 and is degraded by the 26S proteasome possibly mediated by
other BTB domain-containing adaptor proteins. Very recently, NPR1 paralogs, NPR3
103
and NPR4, have been shown to be these adaptor proteins mediating NPR1 degradation
and act as SA receptors (Fu et al., 2012). NPR1 stability is enhanced in both cul3a
cul3b and npr3 npr4 double mutant plants, which exhibit enhanced disease resistance
(Spoel et al., 2009; Fu et al., 2012). In our study, we found that aba mutants also
accumulate high level of NPR1 protein and show elevated defense response (Figure 4-
3), a phenotype reminiscent of both cul3a cul3b and npr3 npr4 double mutants, further
supporting that ABA has a role in affecting NPR1 protein stability.
To our surprise, disruption of ABA signaling compromises the induction of
several NPR1 target genes activated by either SA or the bacterial pathogen Psm
ES4326. In aba3 mutant, addition of ABA decreased the accumulation of NPR1 protein
and restored the activation of NPR1 target genes by the bacterial pathogen Psm
ES4326, indicating that NPR1 turnover is required for stimulating transcription of these
NPR1 target genes. This result is consistent with a previous report that proteasome-
mediated degradation of NPR1 plays an important function in activating defense gene
expression during plant immune responses (Spoel et al., 2009).
In this study, we measured the dynamic accumulation of both endogenous SA
and ABA levels in systemic tissues of the wild type and aba3 during the progression of
Psm ES4326 infection in Arabidopsis plants (Figure 4-12). We found that the dynamic
pattern of PR1 gene expression correlates well with that of NPR1 protein, which is
controlled by both endogenous SA and ABA during infection (Figure 4-13). Shifting the
pattern of either SA or ABA signaling during infection affects the stability of NPR1
protein, resulting in the perturbation of the transcription profile of PR1 gene (Figure 4-
16). Collectively, our data support that the induction of SAR results from the elevation of
104
both SA and ABA levels, and that the inactivation of SAR may be attributed to the
disappearance of the key SAR regulator NPR1, which is caused not only by the
decrease of cellular SA concentrations but also by the elevation of ABA levels.
Accumulating evidence supports an antagonistic relationship between SA and
ABA in plant defense responses (Flors et al., 2008; Yasuda et al., 2008; de Torres-
Zabala et al., 2009). In this study, our data demonstrated that SA and ABA have an
antagonistic effect on the stability of NPR1, which is a master regulator of plant immune
responses (Dong, 2004). ABA pretreatment leads to the degradation of NPR1 (Figure 4-
8), whereas SA pretreatment can counteract the effect of ABA on NPR1 protein stability
(Figure 4-10), indicating that SA can protect NPR1 protein from degradation triggered
by ABA. Previously, SA was shown to be able to promote phosphorylation of NPR1
(Spoel et al., 2009). In this study, we found that SA-triggered phosphorylation of Ser11
and Ser15 in the phosphodegron motif of NPR1 can suppress the effect of ABA on the
stability of NPR1 (Figure 4-11), suggesting that SA protects NPR1 protein from the
proteasome-mediated degradation promoted by ABA likely through phosphorylation.
This was further supported by the result that in the presence of SA, ABA-triggered
NPR1 protein degradation is completely abolished in plants with impaired Cullin 3 E3
ligase (Figure 4-5), which preferentially targets phosphorylated NPR1 for degradation
(Spoel et al., 2009).
SA signaling transduction in rice has been shown to be partially different from
that in Arabidopsis (reviewed by De Vleesschauwer et al., 2013). Healthy rice leaves
have high basal levels of SA with no significant local or systemic changes upon
pathogen attack, whereas Arabidopsis plants have low basal levels of SA with an
105
induction of two orders of magnitude after pathogen infection. Most SA in rice is present
as the free acid form (Silverman et al., 1995), which is active in promoting NPR1
phosphorylation and activity (Spoel et al., 2009). Moreover, the SA pathway in rice
branches into OsWRKY45-dependent and OsNPR1-dependent sub-pathways (Shimono
et al., 2007). Furthermore, overexpression of OsNPR1 in rice confers high levels of
resistance associated with constitutive accumulation of PR genes (Chern et al., 2005).
By contrast, the Arabidopsis NPR1 overexpressing lines do not constitutively express
PR genes (Durrant and Dong, 2004). In addition, unlike AtNPR1, OsNPR1 is barely
regulated by the ubiquitin-proteasome system (Spoel et al., 2009; Matsushita et al.,
2013). Together, these reflect different regulatory mechanisms associated with SA
signaling transduction between rice and Arabidopsis. Evidence has shown that ABA
also has the immune-suppressive effect in rice possibly through inhibiting expression of
several defense genes, including OsWRKY45 and OsNPR1 (Jiang et al., 2010; Xu et
al., 2013). In this study, we showed that in Arabidopsis, ABA promotes NPR1
proteolysis rather than affects NPR1 gene expression (Figure 4-3; 4-1). In addition,
overexpression of OsNPR1 in rice largely abolishes the negative impact of ABA on rice
disease resistance (Jiang et al., 2010; Xu et al., 2013), whereas overexpression of
AtNPR1 in Arabidopsis barely attenuates the immune-suppressive effect of ABA (Figure
4-6C and 4-2E). The difference in ABA-immunosuppressive effect between rice and
Arabidopsis could be explained by the high levels of free SA in rice, which possibly
protect NPR1 protein by triggering NPR1 phosphorylation from ABA-triggered
proteasomal degradation (Figure 4-11).
106
On the basis of our findings, we present a working model for the regulation of
SAR through NPR1 in response to different levels of SA and ABA (Figure 4-19). In un-
induced cells, basal ABA is required to trigger the proteasome-mediated degradation of
NPR1 to prevent spurious activation of resistance, and basal SA is also required to
stabilize and activate NPR1 to maintain the basal resistance. This is crucial because
plants deficient in both SA and ABA biosynthesis are compromised in basal defense
even though these plants accumulate higher levels of steady-state NPR1 protein
(Figure 3-5; Figure 4-18). During the induction of SAR, SA accumulation in systemic
cells increases and activates NPR1 to induce the expression of defense genes. When
pathogen infection subsides, the inactivation of SAR is attributed to the destabilization
and/or deactivation of NPR1 not only due to the decreased SA concentrations but also
due to the elevated ABA levels. In natural environments, plants are facing diverse levels
of stresses including abiotic stresses and biotic pathogen attacks. Our findings provide
a mechanism by which biotic and abiotic stresses influence the combined adaptive plant
defense responses. This knowledge will aid in devising strategies for developing new
crop varieties with both improved disease resistance and abiotic stress tolerance.
Materials and Methods
Plant Materials and Growth Conditions
Arabidopsis thaliana Columbia (Col-0) and different mutants were used: cds2D
(Fan et al., 2009), aba3-21 (this study), eds5-1 (Nawrath et al., 2002), and npr1-3
(Glazebrook et al., 1996). NPR1::Myc-NPR1 transgene (Zhang et al., 2012) was
introduced into cds2D npr1-3, aba3-21 npr1-3, and eds5-1 npr1-3 background, and
35S::NPR1-GFP transgene was introduced into the cds2D npr1-1 and aba3-21 npr1-1
background through genetic crosses. Homozygous plants were chosen by genotyping.
107
35S::NPR1-GFP (in npr1-1), 35S::npr1-nls-GFP (in npr1-1), 35S::npr1C156A-GFP (in
npr1-1), 35S::NPR1-GFP in cul3a cul3b, 35S::NPR1-GFP ( in npr1-2), and
35S::npr1S11/15D-GFP (in npr1-2) were kindly provided by X. Dong (Spoel et al.,
2009). The plant growth condition was used as previously described in Chapter 2.
Pathogen Infection
The virulent bacterial pathogen Psm ES4326 was grown at 28°C overnight in
liquid King’s B medium. Bacterial cells were collected by centrifugation and diluted in
mM MgCl2. Challenge inoculation was performed by pressure-infiltration with a 1-mL
needless syringe as described previously (Clarke et al., 1998). For SA, ABA, NPR1
protein, and mRNA analysis in systemic tissue, half leaves were infiltrated with Psm
ES4326 (OD600=0.002) before the other halves were collected and frozen in liquid
nitrogen until analysis. For ABA-induced disease susceptibility test, OD600 =0.0001 Psm
ES4326 was used for inoculation, and in planta bacterial growth was assayed two and a
half or three days after infection.
Chemical Treatment
SA, MG115 (Sigma), and cycloheximide (Sigma) treatments were performed as
previously described (Spoel et al., 2009). ABA treatment was done as described in
Chapter 3. Alternatively, two-week-old MS-grown seedlings were submerged in ½ MS
liquid medium containing 10 M ABA and/or 1 mM SA.
50 M DFPM (ChemBridge, San Diego) was syringe-infiltrated into 4-5 week-old
Arabidopsis leaves using a 1-mL needleless syringe. Control plants were treated
identically with a solution of 0.1% DMSO (mock).
108
SA and ABA Measurement
SA and ABA measurement was done as described in Chapter 2 and Chapter 3,
respectively.
Protein Analysis
Protein extraction was performed as described by Mou et al. (2003). Briefly, leaf
tissue was homogenized in protein extraction buffer (50 mM Tris-HCl, pH 7.5, 150 mM
NaCl, 10 mM MgCl2, 5 mM EDTA, 10% Glycerol, and protease inhibitors: 50 g/mL
TPCK, 50 g/mL TLCK, and 0.6 mM PMSF). The extract was then centrifuged at 14,000
rpm for 5 min at 4°C.
For immunoprecipitation, protein extracts were centrifuged twice and precleared
with protein G agarose beads for 30 min. 1 l Anti-GFP antibody (Santa Cruz) was
added to the extracts and incubated at 4°C for 1 hr. The antibody bound protein was
precipitated by adding protein G agarose beads to the extracts, followed by incubation
at 4°C with gentle rocking for another 1 hr. The beads were then washed 3 times with
the extraction buffer. The proteins were eluted by heating the beads in the SDS loading
buffer containing 100 mM dithiothreitol (DTT) at 95 °C for 10 min.
For Western blot analysis, SDS sample buffer was added to the protein extracts
from a 2 × stock solution containing 100 mM DTT. Protein samples were heated at
70 °C for 10 min, separated on 8% SDS-PAGE gels, and then transferred to
nitrocellulose membrane. The Myc-NPR1, NPR1-GFP, and CUL3 proteins were
detected by western blotting using an anti-Myc antibody (Santa Cruz), an anti-GFP
antibody (Santa Cruz), and an anti-CUL3 antibody (Enzo), respectively.
109
RNA Extraction and Real-Time PCR
RNA extraction and real-time PCR were carried out as described in Chapter 3.
Seed Germination and Seedling Establishment Assays
After surface sterilization of the seeds harvested at the same time, around 100
seeds of each genotype were sowed on ½ MS plates supplemented with different ABA
concentration. Then stratification was conducted in the dark at 4°C for 3 days. Seedling
establishment was scored as the percentage of seeds that developed green expanded
cotyledons at indicated times.
Statistics
One-way analysis of variance (ANOVA) was used to determine statistical
significance among genotypes or treatments at P<0.05. In addition, two-way analysis of
variance was used to examine the effects of genotypes, treatments, and the interaction
of these two factors on disease resistance. Post-hoc comparison was performed using
Fisher’s least significant difference LSD test at a < . 5. Alternatively, statistical
analyses were performed using Student’s t test for comparison of two data sets. A *
indicates a statistically significant difference at the level of at least 95% confidence.
Accession Numbers
The locus numbers for the genes discussed in this chapter are as follows: ABA1
(At5g67030), ABA3 (At1g16540), NPR1 (AT1G64280), UBQ5 (At3g62250), PR1
(At2g14610), RAB18 (At5g66400), RD22 (At5G25610), COR15A (At2g42540), RD29A
(At5g52310), RD29B (At5g52300).
110
Figure 4-1. Real-time PCR analysis of RAB18 (A) and NPR1 (B) expression in wild-type plants treated by ABA. Four-week-old soil-grown plants were treated with 0,
40, or 80 M ABA by pressure-infiltration with a 1-mL needleless syringe. After 24 hr, inoculated leaves were collected and total RNA was extracted for analyzing the expression of indicated genes using real-time PCR. Expression was normalized against constitutively expressed UBQ5. Error bars represent SD (n = 3). Different letters above the bars indicate statistically significant differences (p<0.05, tested by one-way ANOVA).
A B
111
Figure 4-2. ABA promotes NPR1 degradation in Arabidopsis. A) Four-week-old NPR1::Myc-NPR1 (in npr1-3) plants were treated with various concentrations of ABA by pressure-infiltration with a 1-mL needleless syringe. After 24 hr, total protein was analyzed by reducing SDS-PAGE and western blotting using an anti-Myc antibody (top panel). Detection of a non-specific band confirmed equal loading (bottom panel). B) Four-week-old 35S::NPR1-GFP (in npr1-1)
plants were treated with 80 M ABA (in 0.1% ethanol) or mock (0.1% ethanol) by pressure-infiltration with a 1-mL needleless syringe. After 24 hr, total protein was analyzed by reducing SDS-PAGE and western blotting using an anti-GFP antibody (top panel). Detection of a non-specific band confirmed equal loading (bottom panel). C) Expression level of NPR1 in 35S::NPR1-GFP plants treated with or without ABA. Four-week-old plants were treated as in (B). After 24hr, inoculated leaves were collected and total RNA was extracted for analyzing the expression of NPR1 using real-time PCR. Expression was normalized against constitutively expressed UBQ5. Error bars represent SD (n = 3). Different letters above the bars indicate statistically significant differences (p<0.05, tested by one-way ANOVA). D) NPR1 protein levels in WT and cds2D plants. Total protein was analyzed by reducing SDS-PAGE and immunoblotting using an anti-Myc antibody or an anti-GFP antibody (top panel). Non-specific band confirmed equal loading (bottom panel). E) Growth of Psm ES4326 in wild-type plants treated with various concentrations of ABA. Four-week-old wild-type plants were infiltrated with various concentrations of ABA with a 1-mL needleless syringe. After 12 hr, the infiltrated leaves were inoculated with the bacterial pathogen Psm ES4326 (OD600 = 0.0001). Eight leaves were collected 3 days post-inoculation to examine the growth of the pathogen. Data are the mean of eight samples with SD. Different letters above the bars indicate significant differences (P < 0.05, tested by one-way ANOVA). F) Four-week-old NPR1::Myc-NPR1 (in
npr1-3) plants were treated with 100 M cycloheximide (CHX) followed by
treatment with or without 80 M ABA for indicated amounts of time. The levels of Myc-NPR1 at each time point were determined by immunoblot with an anti-Myc antibody (top panel). Detection of a non-specific band confirmed equal loading (bottom panel). All experiments were repeated with similar results.
A B
112
Figure 4-2. Continued
C D
E F
113
Figure 4-3. NPR1 protein levels in wild type (WT) and aba3 plants. A) Total protein was analyzed by reducing SDS-PAGE and immunoblotting using an anti-Myc antibody or an anti-GFP antibody (top panel). Non-specific band confirmed equal loading (bottom panel). B) Expression levels of NPR1. Total RNA was extracted from similar size untreated Col-0, npr1-3, and aba3-21 plants. The expression of NPR1 was analyzed by qPCR and normalized against constitutively expressed UBQ5. Error bars represent SD (n = 3). Different letters above the bars indicate statistically significant differences (p<0.05, tested by one-way ANOVA). All experiments were repeated with similar results.
A B
114
Figure 4-4. ABA promotes NPR1 degradation via the 26S proteasome pathway. A) Four-week-old NPR1::Myc-NPR1 (in npr1-3) plants were treated with (+) or
without (-) 80 M ABA and 40 M MG115 for 24 hr. Total protein was analyzed by reducing SDS-PAGE and western blotting using an anti-Myc antibody (top panel). Detection of a non-specific band confirmed equal loading (bottom panel). B) Four-week-old 35S::NPR1-GFP (in npr1-1) plants were treated as in (A). Leaf tissue was examined by fluorescence microscopy. C) 35S::NPR1-GFP (in npr1-1) plants were treated as in (A). Total protein was analyzed by reducing SDS-PAGE and western blotting using an anti-GFP antibody (top panel). Detection of a non-specific band confirmed equal loading (bottom panel). All experiments were repeated with similar results.
A B
C
115
Figure 4-5. ABA promoted-NPR1 degradation requires a CUL3-based E3 ligase. A) Wild-type (WT) and cul3a cul3b plants in the presence of the 35S::NPR1-GFP
transgene were treated with (+) or without (-) 80 M ABA for 24 hr. Total protein was analyzed by reducing SDS-PAGE and western blotting using an anti-GFP antibody (top panel). Detection of a non-specific band confirmed equal loading (bottom panel). B) Wild-type (WT) and cul3a cul3b plants in the presence of the 35S::NPR1-GFP transgene were treated with (+) or without (-
) 80 M ABA in the presence of SA for 24 hr. Total protein was analyzed by reducing SDS-PAGE and western blotting using an anti-GFP antibody (top panel). Detection of a non-specific band confirmed equal loading (bottom panel). C) Co-immunoprecipitation of Myc-NPR1 and CUL3 in WT and aba3 plants.
A B
C
116
Figure 4-6. ABA promotes degradation of NPR1 monomer in the nucleus. A) 35S::NPR1-GFP (in npr1-1) and 35S::npr1-nls-GFP (in npr1-1) plants were treated various concentrations of ABA for 24 hr. Total protein was analyzed by reducing SDS-PAGE and western blotting using an anti-GFP antibody (top panel). Detection of a non-specific band confirmed equal loading (bottom panel). B) 35S::NPR1-GFP (in npr1-1) and 35S::npr1C156A-GFP (in npr1-1) plants were treated various concentrations of ABA for 24 hr. Total protein was analyzed by reducing SDS-PAGE and western blotting using an anti-GFP antibody (top panel). Detection of a non-specific band confirmed equal loading (bottom panel). C) Growth of Psm ES4326 in 35S::NPR1-GFP and 35S::npr1C156A-GFP plants. Four-week-old plants were inoculated with the bacterial pathogen Psm ES4326 (OD600 = 0.0001) supplemented with or
without 80 M ABA. Eight leaves were collected 3 days post-inoculation to examine the growth of the pathogen. Data are the mean of eight samples with SD. Asterisks indicate statistically significant differences (Regular two-way ANOVA test; a = 0.05, n = 8). All experiments were repeated with similar results.
A
B
C
117
Figure 4-7. ABA and SA affect nuclear localization of NPR1. A) Nuclear localization of NPR1 in four-week-old 35S::NPR1-GFP (in npr1-1) plants treated with mock. B) Nuclear localization of NPR1 in four-week-old 35S::NPR1-GFP (in npr1-1)
plants treated with 80 M ABA for 24 hr. C) SA-induced nuclear localization of NPR1 in four-week-old 35S::NPR1-GFP (in npr1-1) plants treated with 1 mM SA for 24 hr. D) Nuclear localization of NPR1 in four-week-old 35S::NPR1-
GFP (in npr1-1) plants pretreated with 80 M ABA 12 hr before addition of SA. Leaf tissue was examined using fluorescence microscopy 24 hr after SA treatment. E) Nuclear localization of NPR1 in four-week-old 35S::NPR1-GFP
(in npr1-1) plants treated with 1mM SA and 80 M ABA for 24 hr. F) Nuclear localization of NPR1 in four-week-old 35S::NPR1-GFP (in npr1-1) plants
pretreated with 1 mM SA 24 hr before addition of 80 M ABA. Leaf tissue was examined using fluorescence microscopy 24 hr after ABA treatment.
B
A
C
E
D
F
118
Figure 4-8. ABA negatively affects NPR1 protein accumulation in the presence of SA. A) Four-week-old 35S::NPR1-GFP (in npr1-1) plants were treated with mock
(0.1% ethanol) or 80 M ABA (in 0.1% ethanol) 12 hr prior to treatment with 1mM SA. Leaves were collected 24 hr after SA treatment. Total protein was analyzed by reducing SDS-PAGE and western blotting using an anti-GFP antibody (top panel). Detection of a non-specific band confirmed equal loading (bottom panel). B) Four-week-old NPR1::Myc-NPR1 (in npr1-3) plants were treated as in (A). Total protein was analyzed by reducing SDS-PAGE and western blotting using an anti-Myc antibody (top panel). Detection of a non-specific band confirmed equal loading (bottom panel). C) Four-week-old NPR1::Myc-NPR1 (in npr1-3) plants were treated as in (A). Leaves were collected and total RNA was extracted for analyzing the expression of PR1 using real-time PCR. Expression was normalized against constitutively expressed UBQ5. Error bars represent SD (n = 3). D) Growth of Psm ES4326 in Arabidopsis leaf tissues. Four-week-old NPR1::Myc-NPR1 plants were
pretreated with mock (0.1% ethanol) or 80 M ABA (in 0.1% ethanol). After 12 hr, plants were treated with 1 mM SA by soil drenching and inoculated with Psm ES4326 (OD600=0.0001). Eight leaves were collected 3 days post-inoculation to examine the growth of the pathogen. Data are the means of eight samples with SD. Different letters above the bars indicate statistically significant differences (p<0.05, tested by one-way ANOVA). All experiments were repeated with similar results.
A B
D C
119
Figure 4-9. Endogenous ABA promotes NPR1 degradation in the presence of SA. A) Wild-type (WT) and cds2D plants in the presence of the 35S::NPR1-GFP transgene were treated with (+) or without (-) 1 mM SA for 24 hr. Total protein was analyzed by reducing SDS-PAGE and western blotting using an anti-GFP antibody (top panel). Detection of a non-specific band confirmed equal loading (bottom panel). B) Wild-type (WT) and cds2D plants in the presence of the NPR1::Myc-NPR1 transgene were treated as in (A). Total protein was analyzed by reducing SDS-PAGE and western blotting using an anti-Myc antibody (top panel). Detection of a non-specific band confirmed equal loading (bottom panel).
A B
120
Figure 4-10. SA decelerates ABA-promoted NPR1 degradation. A) Four-week-old NPR1::Myc-NPR1 (in npr1-3) plants were treated with mock or 1 mM SA 24
hr prior to treatment with 80 M ABA. Leaves were collected 24 h after ABA treatment. Total protein was analyzed by reducing SDS-PAGE and western blotting using an anti-Myc antibody (top panel). Detection of a non-specific band confirmed equal loading (bottom panel). B) Four-week-old NPR1::Myc-NPR1 (in npr1-3) plants were treated as in (A). Treated leaves were collected and total RNA was extracted for analyzing the expression of PR1 using real-time PCR. Expression was normalized against constitutively expressed UBQ5. Error bars represent SD (n = 3). C) Four-week-old NPR1::Myc-NPR1
(in npr1-3) plants were treated with a combination of 1 mM SA and 80 M ABA for 24 hr. Total protein was extracted from treated leaves and analyzed by reducing SDS-PAGE and western blotting using an anti-Myc antibody (top panel). Detection of a non-specific band confirmed equal loading (bottom panel). D) Four-week-old NPR1::Myc-NPR1 (in npr1-3) plants were treated as in (C). Treated leaves were collected and total RNA was extracted for analyzing the expression of PR1 using real-time PCR. Expression was normalized against constitutively expressed UBQ5. Error bars represent SD (n = 3). All experiments were repeated with similar results.
A B
C D
121
Figure 4-11. Phosphorylation decelerates ABA-triggered NPR1 turnover. A) 35S::NPR1-GFP and 35S::npr1S11/15D-GFP plants were treated with mock (0.1%
ethanol) or 80 M ABA (in 0.1% ethanol) for 24 hr. Total protein was analyzed by reducing SDS-PAGE and western blotting using an anti-GFP antibody (top panel). Detection of a non-specific band confirmed equal loading (bottom panel). B) Growth of Psm ES4326 in Arabidopsis leaf tissues. Four-week-old 35S::NPR1-GFP and 35S::npr1S11/15D-GFP plants were pretreated with
mock (0.1% ethanol) or 80 M ABA (in 0.1% ethanol). After 12 hr, treated plants were inoculated with Psm ES4326 (OD600=0.0001). Eight leaves were collected 3 days post-inoculation to examine the growth of the pathogen. Data are the means of eight samples with SD. Different letters above the bars indicate statistically significant differences < . 5 Student’s t test). All experiments were repeated with similar results.
A B
122
Figure 4-12. Quantification of ABA and SA levels in systemic tissues of wild type and aba3-21 plants during Psm ES4326 infection. The leaf-halves of wild type and aba3-21 plants were inoculated with the virulent pathogen Psm ES4326 (OD600=0.002). At the indicated time points, the uninoculated leaf haves were collected for measurement of free SA (A) and ABA (B). Data represent the mean of three biological replicates with SD. FW, fresh weight.
A B
123
Figure 4-13. NPR1 protein accumulation and PR1 gene expression in systemic tissues of wild type and aba3-21 plants during Psm ES4326 infection. A) The leaf-halves of NPR1::Myc-NPR1 and NPR1::Myc-NPR1 aba3-21 plants were treated as in Figure 4-12. At the indicated time points, total protein was extracted from the uninoculated leaf halves and subjected to reducing SDS-PAGE and western blot using an anti-Myc antibody (top panel). Detection of a non-specific band confirmed equal loading (bottom panel). B) NPR1::Myc-NPR1 and NPR1::Myc-NPR1 aba3-21 plants were treated as in (A). Total RNA was extracted for analyzing the expression of PR1 using real-time PCR. Expression was normalized against constitutively expressed UBQ5. Error bars represent SD (n = 3). All experiments were repeated with similar results.
A
B
124
Figure 4-14. SA and ABA regulates NPR1 protein accumulation and PR1 gene expression (mimic experiment). A) NPR1::Myc-NPR1 in WT and aba3-21 plants were placed in 6-well plates containing 0.5 mM SA. After 24 hr, plants were transferred to new 6-well plants containing fresh water and treated with
mock (0.1% ethanol) or 80 M ABA (in 0.1% ethanol). Total protein was extracted at the indicated time points and analyzed by reducing SDS-PAGE and western blotting using an anti-Myc antibody (top panel). Detection of a non-specific band confirmed equal loading (bottom panel). B) Plants were treated as in (A). Total RNA was extracted and analyzed for the expression for PR1 using real time PCR. Numbers on the black bars represent fold induction values at 24 hr relative to 0 hr (white bars). Data represent the mean of three independent samples with SD. The experiment was repeated three times with similar results.
A
B
125
Figure 4-15. Phosphorylation stabilizes NPR1 during SAR induction. The leaf-haves of 35S::NPR1-GFP (in npr1-2) and 35S::npr1S11/15D-GFP (in npr1-2) plants inoculated with the virulent pathogen Psm ES4326 (OD600=0.002). At the indicated time points, total protein was extracted from the uninoculated leaf haves and analyzed by reducing SDS-PAGE and western blotting using an anti-GFP antibody (top panel). Detection of a non-specific band confirmed equal loading (bottom panel).
126
Figure 4-16. Perturbation of either SA or ABA signaling during pathogen induction affects SAR. A) The leaf-haves of NPR1::Myc-NPR1 plants were inoculated with the virulent pathogen Psm ES4326 (OD600=0.002). After 24 hr, plants were treated with water or 1 mM SA by soil drenching. Total protein was extracted at the indicated time points after pathogen inoculation and analyzed by reducing SDS-PAGE and western blotting using an anti-Myc antibody (top panel). Detection of a non-specific band confirmed equal loading (bottom panel). B) The leaf-haves of NPR1::Myc-NPR1 plants were inoculated with the virulent pathogen Psm ES4326 (OD600=0.002). After 24 hr, plants were
treated with mock (0.1% DMSO) or 50 M DFPM. Total protein was extracted at the indicated time points after pathogen inoculation and analyzed by reducing SDS-PAGE and western blotting using an anti-Myc antibody (top panel). Detection of a non-specific band confirmed equal loading (bottom panel). C) NPR1::Myc-NPR1 plants were treated as in (A) or in (B) , respectively. Total RNA was extracted for analyzing the expression of PR1 using real-time PCR. Expression was normalized against constitutively expressed UBQ5. Error bars represent SD (n = 3). D) The leaf-haves of NPR1::Myc-NPR1 plants were inoculated with Psm ES4326 (OD600=0.002),
and another leaf-haves were treated with mock (0.1% ethanol) or 80 M ABA (0.1% ethanol). Total protein was extracted from the treated leaf-haves at the indicated time points after ABA treatment and analyzed by reducing SDS-PAGE and western blotting using an anti-Myc antibody (top panel). Detection of a non-specific band confirmed equal loading (bottom panel). E) NPR1::Myc-NPR1 plants were treated as in (D). Total RNA was extracted for analyzing the expression of PR1 using real-time PCR. Expression was normalized against constitutively expressed UBQ5. Error bars represent SD (n = 3). All experiments were repeated with similar results.
A
B
127
Figure 4-16. Continued
C
D E
128
Figure 4-17. Phosphorylated NPR1 negatively regulates ABA responses. A) Seven-day-
old seedlings of the wild type (WT, Col-0), npr1-1, npr1-2, and npr1-3 mutants
were germinated and grown on ½ MS medium supplemented with 1 M ABA. B) Cotyledon-greening percentage of 35S::NPR1-GFP and 35S::npr1S11/15D-GFP grown on ½ MS medium supplemented with various concentrations of ABA was recorded at 10 days after the end of stratification. Data shown are means of three replicates with SD. About 100 seeds per genotype were measured in each replicate. Different letters above the bars indicate statistically significant differences (p<0.05, student's t test). C) Photographs showing the ABA sensitivity of 35S::NPR1-GFP and 35S::npr1S11/15D-GFP in early seedling growth. Seven-day-old seedlings 35S::NPR1-GFP and 35S::npr1S11/15D-GFP were germinated and grown on
½ MS medium supplemented with or without 1 M ABA, and photos were taken 7 days after stratification. C) to G) Real time PCR analysis of the ABA-responsive genes RAB18, RD22, COR15A, RD29A, and RD29B. 10-day-old
seedlings were treated with or without 10 M ABA for 3 hr. Total RNA was extracted for analyzing the expression of ABA-responsive genes using real-time PCR. Expression was normalized against constitutively expressed UBQ5. Error bars represent SD (n = 3). Different letters above the bars indicate statistically significant differences (p<0.05, tested by one-way ANOVA). All experiments were repeated with similar results.
B C
A
129
Figure 4-17. Continued
D E
F G
H
130
Figure 4-18. The effect of basal SA and ABA levels on the accumulation of the Myc-NPR1 protein. A) and B) Free (A) and total (B) SA levels in untreated Col-0, eds5, and aba31 eds5 (a3e5) plants detected by the HPLC-based method. Data represent the mean of three independent samples with SD. FW, fresh weight; SAG, SA-2-O-β-D-glucoside. Different letters above the bars indicate statistically significant differences (p<0.05, tested by one-way ANOVA). C) The Myc-NPR1 protein in untreated WT, eds5, aba3, and aba3 eds5 (a3e5) plants by western blotting. Myc-NPR1 was detected by western blotting using an anti-Myc antibody (Top panel). Detection of a non-specific band confirmed equal loading (bottom panel). All experiments were repeated with similar results.
A B
C
131
Figure 4-19. Working model for the regulation of SAR through NPR1 by different levels
of SA and ABA. In uninduced cells (left panel), a small amount of NPR1 monomers constitutively translocate into the nucleus where they are degraded by ABA-promoted proteasome-mediated pathway. This event prevents spurious activation of NPR1 target genes. During SAR activation (middle panel), the elevated levels of SA promote NPR1 phosphorylation, which protects NPR1 from ABA-triggered degradation. Thus, phosphorylated NPR1 accumulates and interacts with transcription factors (TF) to initiate defense gene transcription. At this stage, ABA-mediated NPR1 turnover plays a positive function possibly by either degrading unphosphorylated NPR1 to increase the ratio of transcriptionally active or clearing the “exhausted” from the target gene promoter to allow “fresh” 1 to reinitiate the transcription cycle. After pathogen infection subsides (right panel), decreased SA levels slow down the process of NPR1 phosphorylation, resulting in NPR1 more sensitive to ABA-triggered proteasomal degradation. Meanwhile, elevated ABA levels accelerate NPR1 turnover, leading to the reduction of NPR1 concentrations, which further inactivate SAR.
132
CHAPTER 5 SUMMARY AND CONCLUSIONS
Like animals, plants have evolved effective inducible defense systems. SA is an
important plant defense signal produced after pathogen infection to induce SAR, which
confers immunity towards a broad-spectrum of pathogens. However, where and how SA
is synthesized in plant cells remains unclear. Identification of new components involved
in pathogen-induced SA accumulation would help understand how SA mediates disease
resistance in plants. In this study, we performed a forward genetic screen for
Arabidopsis mutants with altered SA accumulation using a biosensor-based SA
quantification method. A total of 35,000 M2 plants in the npr1-3 mutant background
were individually tested. Among the mutants identified, 17 accumulate lower levels of
SA than npr1-3 (lsn) and two produce higher levels of SA than npr1-3 (hsn).
Complementation tests indicated that seven of the lsn mutants are new alleles of
eds5/sid1, two are eds16/sid2 alleles, and one is allelic to pad4. The remaining are
likely new lsn and hsn mutants. These mutants will likely help dissect the molecular
mechanisms underlying pathogen-induced SA accumulation in plants.
Through map-based cloning, HSN2 was shown to encode ABA3, which is
involved in ABA biosynthesis. Characterization of aba3 npr1 double mutants showed
that ABA is a negative regulator of SA biosynthesis. However, the aba3 single mutant
plants do not accumulate higher levels of SA than the wild-type plants after pathogen
infection, suggesting that the NPR1 protein in aba3 likely inhibits SA accumulation. In
addition, pathogen growth assays showed that mutations in ABA3 confer enhanced
basal resistance in both an NPR1-dependent and -independent manner, whereas the
enhanced resistance depends on SA. Interestingly, plants impaired in ABA signaling
133
mainly exhibit NPR1-dependent disease resistance when challenged with a higher
bacterial inoculum. By contrast, high levels of ABA contribute to compromised basal
resistance and impaired SAR, phenotypes reminiscent of the npr1 mutant. Thus, these
data suggest that ABA promotes pathogenesis likely by inactivating NPR1.
On the other hand, a positive regulatory function of ABA in plant immunity was
also observed. The aba3-21 mutant and the sextuple pyr/pyl mutant (112458) were
defective in the full induction of defense genes by Psm ES4326 or SA. In addition,
exogenous application of a low concentration of ABA in aba3 was able to increase the
induction of defense genes during pathogen infection. Moreover, compromised defense
gene induction caused by disruption of ABA signaling led to impaired biological SAR
induction in aba3 and 112458 mutants. Thus, ABA signaling appears to be required for
plant immunity. Taken together, our data support that ABA signaling plays both positive
and negative functions in plant defense.
The mechanism of how ABA regulates plant immune responses was further
investigated. This study demonstrated that ABA regulates plant immunity by controlling
the abundance of NPR1 protein, which is a key regulator of plant immunity downstream
of SA. Both genetic and biochemical approaches were employed to demonstrate that
ABA promotes proteasomal degradation of NPR1 in the nucleus, which plays both
positive and negative regulatory functions in plant innate immunity.
Accumulating evidence supports an antagonistic relationship between SA and
ABA in plant immunity (Flors et al., 2008; Yasuda et al., 2008; de Torres-Zabala et al.,
2009). In this study, our data demonstrate that SA and ABA have an antagonistic effect
on the stability of NPR1 protein. ABA pretreatment leads to the degradation of NPR1,
134
whereas SA pretreatment can counteract the effect of ABA on NPR1 protein stability. In
addition, phosphorylated NPR1 was found to be less sensitive to ABA treatment and
have a suppressive effect on the ABA signaling pathway. Together with the fact that SA
promotes NPR1 phosphorylation (Spoel et al., 2009), these results suggest that SA
antagonizes ABA signaling likely through promoting NPR1 phosphorylation. Thus,
NPR1 appears to be the regulatory node through which SA and ABA antagonize each
other.
In this study, the dynamic accumulation of both endogenous SA and ABA levels
in systemic tissues of the wild type and aba3 was measured during the progression of
Psm ES4326 infection. The dynamic pattern of PR1 gene expression correlates well
with that of the NPR1 protein, which appears to be controlled by both endogenous SA
and ABA during infection. Shifting either SA or ABA signaling during infection perturbs
the biphasic changes of NPR1 concentrations, consequently altering the transcription
profile of the PR1 gene, which is a molecular marker of SAR. Therefore, our data
suggest that SA and ABA cooperate to regulate SAR through controlling the key SAR
regulator NPR1.
On the basis of our findings, we provide a working model for the regulation of
SAR by SA and ABA through NPR1. In un-induced cells, basal ABA is required to
trigger the proteasome-mediated degradation of NPR1 to prevent spurious activation of
resistance, and basal SA is also required to stabilize/activate NPR1 to maintain the
basal resistance. Upon SAR induction, SA accumulation in systemic cells increases
NPR1 concentrations to induce the expression of defense genes, whereas at this stage
ABA-mediated degradation of NPR1 may be required for the full induction of these
135
defense genes. When pathogen infection subsides, the inactivation of SAR is attributed
to the reduction of NPR1 concentrations due to the decreased levels of SA and the
elevated levels of ABA. In the natural environments, plants are facing diverse stresses
including abiotic stresses and biotic pathogen attacks. Our findings suggest a
mechanism by which biotic and abiotic stresses influence the combined adaptive plant
defense responses.
136
APPENDIX TABLES
Table A-1 Primers used for fine mapping.
Marker Forward primer 5’-3’ everse primer 5’-3’ Restriction
enzyme Col-0 (bp) Ler (bp)
At1g16500
(M1)
CTCGTCATCATCGTC
TCATC
GTCATCTTCAGGAGA
TTGGC Tsp509 I 272, 59 331
At1g16540
(M2)
TACTTGGAGGTGGAG
AAGC
CACTGACGACGGTTC
CATTC Mse I 532, 170
396, 170,
136
At1G16660
(M3)
ACCTTCGTCAAGGCT
CTATG
AAGCAGGCTGTAACT
GAGAG SfaN I 699 453, 246
At1G16860
(M4)
AGGAACTGCACAATC
AGGTC
AGTGACCTTCACGTG
TTGAC Hph I 628 310, 318
At1G16920
(M5)
CAGCTTCATGTTAAG
CTCCC
GGTACAGAGTGGAAG
ATGAC Nla III 337, 283 620
Table A-2. Primers used for mutant genotyping.
Marker Forward primer 5’-3’ everse primer 5’-3’ Restriction
enzyme
WT (bp) Mutant (bp)
aba3-21 GTGATATCAGTTCGGCC
ACC
CTGTAATCTTCAGG
AGATGC Mse I 164, 24 147, 24, 17
npr1-3
(dCAPS)
GGCCGACTATGTGTAGA
AATACTAGCG
TGAGACGGTCAGG
CTCGAGG HhaI 319, 27 346
eds5-1 CTTGGTCTAATCTGATT
CTTGATATGTTTGCCG
GAGACTTATTCAGC
TGCTTGCTTCTC HpaII 142 171
137
Table A-3. Primers used for qPCR in this study.
Gene Forward primer 5’-3’ everse primer 5’-3’
PR1 CTCATACACTCTGGTGGG ATTGCACGTGTTCGCAGC
NPR1 AGCATTCTCTCAAAGGCCGAC TGAGACGGTCAGGCTCGAGG
WRKY18 TTAGATGCTCGTTTGCACCG CCAAAGTCACTGTGCTTGAC
WRKY38 CGTCGTAGTAAATCGGATCC CCAGAAACCGAAGATGATCAG
WRKY62 GTATTTCCTCCAGAGGAAGC ACCACCAAGACGATCAATCC
RAB18 CCGTTAAGCTTCGAACAATCG CAACACACATCGCAGGACGTA
RD22 ATTGTGCGACGTCTTTGGAGT TGCGTTCTTCTTAGCCACCTC
COR15A GAGGCATTAGCAGATGGTGAGA ACATACGCCGCAGCTTTCT
RD29A GTTACTGATCCCACCAAAGAAGA GGAGACTCATCAGTCACTTCCA
RD29B GCAAGCAGAAGAACCAATCA CTTTGGATGCTCCCTTCTCA
UBQ5 TCTCCGTGGTGGTGCTAAG GAACCTTTCCAGATCCATCG
Table A-4. Primers for identification of the splicing site change in aba3-21.
Forward primer 5’-3’ everse primer 5’-3’
CTTGGATCATGCTGGTTCTAC CATCAACTTCACCAGATCTAG
Table A-5. Primers for identification of homozygousT-DNA insertion lines.
Forward primer 5’-3’ everse primer 5’-3’
SALK_072361 TTCTATTGGAAATGCATTGCC CCATGTCTGCATGTTTCTGTG
138
REFERENCES
Aarts, N., Metz, M., Holub, E., Staskawicz, B.J., Daniels, M.J., and Parker, J.E. (1998). Different requirements for EDS1 and NDR1 by disease resistance genes define at least two R gene-mediated signaling pathways in Arabidopsis. Proc. Natl. Acad. Sci. USA 95: 10306–10311.
Adie, B.A.T., Perez-Perez, J., Perez-Perez, M.M., Godoy, M., Sanchez-Serrano, J.J., Schemelz, E.A., and Solano, R. (2007). ABA is an essential signal for plant resistance to pathogens affecting JA biosynthesis and the activation of defences in Arabidopsis. Plant Cell 19: 1665–1681.
Agrios, G.N. (1997). Plant Pathol. 4th edition. San Diego: Academic Press.
Alfano, J.R., and Collmer, A. (2004). Type III secretion system effector proteins: Double agents in bacterial disease and plant defense. Annu. Rev. Phytopathol. 42: 385–414.
Altenbach, D., and Robatzek, S. (2007). Pattern recognition receptors: from the cell surface to intracellular dynamics. Mol. Plant Microbe Interact. 20: 1031–1039.
Anderson, J.P., Badruzsaufari, E., Schenk, P.M., Manners, J.M., Desmond, O.J., Ehlert, C., Maclean, D.J., Ebert, P.R., and Kazan, K. (2004). Antagonistic interaction between abscisic acid and jasmonate-ethylene signaling pathways modulates defense gene expression and disease resistance in Arabidopsis. Plant Cell 16: 3460–3479.
Antoniw, J.F., and White, R.F. (1980). The effects of aspirin and polyacrylic acid on soluble leaf proteins and resistance to virus infection in five cultivars of tobacco. J. of Phytopathol. 98: 331–341.
Asselbergh, B., De Vleesschauwer, D., and Höfte, M. (2008). Global switches and finetuning ABA modulates plant pathogen defense. Mol. Plant Microbe Interact. 21: 709–719.
Attaran, E., Zeier, T.E., Griebel, T., and Zeier, J. (2009). Methyl salicylate production and jasmonate signaling are not essential for systemic acquired resistance in Arabidopsis. Plant Cell 21: 954–971.
Audenaert, K., De Meyer, G.B., and Höfte, M. (2002). Abscisic acid determines basal susceptibility of tomato to Botrytis cinerea and suppresses salicylic acid-dependent signaling mechanisms. Plant Physiol. 128: 491–501.
Ausubel, F. (2005). Are innate immune signaling pathways in plants and animals conserved? Nat. Immunol. 6: 973–979.
139
Barrero, J.M., Piqueras, P., Gonzalez-Guzman, M., Serrano, R., Rodriguez, P.L., Ponce, M.R. and Micol, J.L. (2005). A mutational analysis of the ABA1 gene of Arabidopsis thaliana highlights the involvement of ABA in vegetative development. J. Exp. Bot. 56: 2071–2083.
Bender, C.L., Alarcon-Chaidez, F., and Gross, D.C. (1999). Pseudomonas syringae phytotoxins: mode of action, regulation, and biosynthesis by peptide and polyketide synthetases. Microbiol. Mol. Biol. Rev. 63: 266–292.
Bender, C.L., Stone, H.E., Sims, J.J., and Cooksey, D.A. (1987). Reduced pathogen fitness of Pseudomonas syringae pv. Tomato Tn5 mutants defective in coronatine production. Physiol. Mol. Plant Pathol. 30: 273–283.
Bhattacharjee, S., Halane, M.K., Kim, S.H., and Gassmann, W. (2011). Pathogen effectors target Arabidopsis EDS1 and alter its interactions with immune regulators. Science 334: 1405–1408.
Boller, T., and Felix, G. (2009). A renaissance of elicitors: perception of microbe-associated molecular patterns and danger signals by pattern-recognition receptors. Annu. Rev. Plant Biol. 60: 379–406.
Cao, F., Yoshioka, K., and Desveaux, D. (2011). The roles of ABA in plant-pathogen interactions. J. Plant Res. 124: 489-499.
Cao, H., Bowling, S.A., Gordon, A.S., and Dong, X. (1994). Characterization of an Arabidopsis mutant that is nonresponsive to inducers of systemic acquired resistance. Plant Cell 6: 1583–1592.
Cao, H., Glazebrook, J., Clark, J.D., Volko, S., and Dong, X. (1997). The Arabidopsis NPR1 gene that controls systemic acquired resistance encodes a novel protein containing ankyrin repeats. Cell 88: 57–63.
Cao, H., Li, X., and Dong, X. (1998). Generation of broad-spectrum disease resistance by overexpression of an essential regulatory gene in systemic acquired resistance. Proc. Natl. Acad. Sci. USA 95: 6531–6536.
Chadha, K.C., and Brown, S.A. (1974). Biosynthesis of phenolic acids in tomato plants infected with Agrobacterium tumefaciens. Can J. Bot. 52: 2041–2047.
Chanda, B., Xia, Y., Mandal, M.K., Yu, K., Sekine, K.T., Gao, Q.M., Selote, D., Hu, Y., Stromberg, A., Navarre, D., Kachroo, A., and Kachroo, P. (2011). Glycerol-3-phosphate is a critical mobile inducer of systemic immunity in plants. Nat. Genet. 43: 421–427.
Chapple, C.C., Vogt, T., Ellis, B.E., and Somerville, C.R. (1992). An Arabidopsis mutant defective in the general phenylpropanoid pathway. Plant Cell 4: 1413–1424.
140
Chaturvedi, R., Krothapalli, K., Makandar, R., Nandi, A., Sparks, A.A., Roth, M.R., Welti, R., and Shah, J. (2008). Plastid omega3-fatty acid desaturase-dependent accumulation of a systemic acquired resistance inducing activity in petiole exudates of Arabidopsis thaliana is independent of jasmonic acid. Plant J. 54: 106–117.
Chaturvedi, R., Venables, B., Petros, R.A., Nalam, V., Li, M., Wang, X., Takemoto, L.J., and Shah, J. (2012). An abietane diterpenoid is a potent activator of systemic acquired resistance. Plant J. 71: 161–172.
Chen, Z. (2010). Functional analysis of the Arabidopsis PAL gene family in plant growth, development, and response to environmental stress. Plant Physiol. 153: 1526–1538.
Chen, Z., Zheng, Z., Huang, J., Lai, Z., and Fan, B. (2009). Biosynthesis of salicylic acid in plants. Plant Signal Behav. 4: 493–496.
Cheng, M.C., Liao, P.M., Kuo, W.W., and Lin, T.P. (2013) The Arabidopsis ETHYLENE-RESPONSE-FACTOR1 regulates abiotic-stress-responsive gene expression by binding to different cis-acting elements in response to different stress signals. Plant Physiol. 162: 1566–1582
Chern, M., Fitzgerald, H.A., Canlas, P.E., Navarre, D.A., and Ronald, P.C. (2005). Overexpression of a rice NPR1 homolog leads to constitutive activation of defense response and hypersensitivity to light. Mol. Plant Microbe Interact. 18: 511–520.
Chinchilla, D., Bauer, Z., Regenass, M., Boller, T., and Felix, G. (2006). The Arabidopsis receptor kinase FLS2 binds flg22 and determines the specificity of flagellin perception. Plant Cell 18: 465–476.
Choi, D.S. and Hwang, B.K. (2011). Proteomics and functional analyses of pepper abscisic acid–responsive 1 (ABR1), which is involved in cell death and defense signaling. Plant Cell 23: 823–842.
Clarke, J.D., Liu, Y., Klessig, D.F., and Dong, X. (1998). Uncoupling PR gene expression from NPR1 and bacterial resistance: Characterization of the dominant Arabidopsis cpr6-1 mutant. Plant Cell 10: 557–569.
Coll, N.S., Vercammen, D., Smidler, A., Clover, C., Van Breusegem, F., Dangl, J., and Epple, P. (2010). Arabidopsis type I metacaspases control cell death. Science 330: 1393–1397.
Collier, S.M., and Moffett, P. (2009). NB-LRRs work a "bait and switch" on pathogens. Trends Plant Sci. 14: 521–529.
141
Coppinger, P., Repetti, P.P., Day, B., Dahlbeck, D., Mehlert, A., and Staskawicz, B.J. (2004). Overexpression of the plasma membrane-localized NDR1 protein results in enhanced bacterial disease resistance in Arabidopsis thaliana. Plant J. 40: 225–237.
Cunnac, S., Lindeberg, M., and Collmer, A. (2009). Pseudomonas syringae type III secretion system effectors: repertoires in search of functions. Curr. Opin. Microbiol. 12: 53–60
Cutler, S.R., Rodriguez, P.L., Finkelstein, R.R., and Abrams, S.R. (2010). Abscisic acid: Emergence of a core signaling network. Ann. Rev. Plant Biol. 61: 651–679.
Dangl, J.L., and Jones, J.D.G. (2001). Plant pathogens and integrated defence responses to infection. Nature 411: 826–833.
D'Auria, J.C. (2006). Acyltransferases in plants: a good time to be BAHD. Curr Opin Plant Biol. 9: 331–340.
de Torres Zabala, M., Bennett, M.H., Truman, W.H., and Grant, M.R. (2009). Antagonism between salicylic and abscisic acid reflects early host-pathogen conflict and moulds plant defence responses. Plant J. 59: 375–386.
de Torres-Zabala, M., Truman, W., Bennett, M.H., Lafforgue, G., Mansfield, J.W., Rodriguez Egea, P., Bögre, L., and Grant, M. (2007). Pseudomonas syringae pv. tomato hijacks the Arabidopsis abscisic acid signalling pathway to cause disease. EMBO J. 26: 1434–1443.
De Vleesschauwer, D., Gheysen, G., and Höfte, M. (2013). Hormone defense networking in rice: tales from a different world. Trends Plant Sci. 18: 555–565.
De Vleesschauwer, D., Yang, Y.N., Cruz, C.V., and Höfte, M. (2010). Abscisic acidinduced resistance against the brown spot pathogen Cochliobolus miyabeanus in rice involves MAP kinase-mediated repression of ethylene signaling. Plant Physiol. 152: 2036–2052.
Dean, J.V., and Delaney, S.P. (2008). Metabolism of salicylic acid in wild-type, ugt74f1 and ugt74f2 glucosyltransferase mutants of Arabidopsis thaliana. Physiol. Plant. 132: 417–425.
Dean, J.V., and Mills, J.D. (2004). Uptake of salicylic acid 2-O-β-D-glucose into soybean tonoplast vesicles by an ATP-binding cassette transporter-type mechanism. Physiol Plant. 120: 603–612.
Dean, R.A., and Kuc, J. (1986). Induced systemic protection in cucumbers: the source of the “signal”. hysiol. Mol. lant athol. 28: 227–233.
Defraia, C.T., Schmelz, E.A., and Mou, Z. (2008). A rapid biosensor-based method for quantification of free and glucose-conjugated salicylic acid. Plant Methods. 4: 28.
http://www.ncbi.nlm.nih.gov/pubmed?term=B%C3%B6gre%20L%5BAuthor%5D&cauthor=true&cauthor_uid=17304219
142
Delaney, T.P., Friedrich, L., and Ryals, J.A. (1995). Arabidopsis signal transduction mutant defective in chemically and biologically induced disease resistance. Proc. Nati. Acad. Sci. USA 92: 6602–6606.
Delaney, T.P., Uknes, S., Vernooij, B., Friedrich, L., Weymann, K., Negrotto, D., Gaffney, T., Gut-Rella, M., Kessmann, H., Ward, E., and Ryals, J. (1994). Central role of salicylic acid in plant disease resistance. Science 266: 1247-1250.
Dempsey, D.A., and Klessig, D.F. (2012). SOS-too many signals for systemic acquired resistance? Trends Plant Sci. 17: 538–545.
Dempsey, D.A., Shah, J. and Klessig, D.F. (1999). Salicylic acid and disease resistance in plants. Crit. Rev. Plant Sci. 18: 547–575.
Després, C., Chubak, C., Rochon, A., Clark, R., Bethune, T., Desveaux, D., and Fobert, P.R. (2003). The Arabidopsis NPR1 disease resistance protein is a novel cofactor that confers redox regulation of DNA binding activity to the basic domain/leucine zipper transcription factor TGA1. Plant Cell 15: 2181–2191.
Després, C., DeLong, C., Glaze, S., Liu, E., and Fobert, P.R. (2000). The Arabidopsis NPR1/NIM1 protein enhances the DNA binding activity of a subgroup of the TGA family of bZIP transcription factors. Plant Cell 12: 279–290.
Dewdney, J., Reuber, T.L., Wildermuth, M.C., Devoto, A., Cui, J., Stutius, L.M., Drummond, E.P., and Ausubel, F.M. (2000). Three unique mutants of Arabidopsis identify eds loci required for limiting growth of a biotrophic fungal pathogen. Plant J. 24: 205–218.
Dong, X. (2004). NPR1, all things considered. Curr. Opin. Plant Biol. 7: 547–752.
Dreher, K., and Callis, J. (2007). Ubiquitin, hormones and biotic stress in plants. Ann Bot. 99: 787–822.
Durrant, W.E., and Dong, X. (2004). Systemic acquired resistance. Annu. Rev. Phytopathol. 42: 185–209.
El-Basyouni, S.Z., Chen, D., Ibrahim, R.K., Neish, A.C., and Towers, G.H.N. (1964). The biosynthesis of hydroxybenzoic acids in higher plants. Phytochem. 3: 485–492.
Endah, R., Beyene, G., Kiggundu, A., Berg, N., Schluter, U., Kunert, K., and Chikwamba, R. (2008). Elicitor and Fusarium-induced expression of NPR1-like genes in banana. Plant Physiol. Biochem. 46: 1007–1014.
Enyedi, A.J., Yalpani, N., Silverman, P., and Raskin, I. (1992). Localization, conjugation, and function of salicylic acid in tobacco during the hypersensitive reaction to tobacco mosaic virus. Proc. Natl. Acad. Sci. USA 89: 2480–2484.
143
Eulgem, T., and Somssich, I.E. (2007). Networks of WRKY transcription factors in defense signaling. Curr. Opin. Plant Biol. 10: 366–371.
Falk, A., Feys, B.J., Frost, L.N., Jones, J.D., Daniels, M.J., and Parker, J.E. (1999). EDS1, an essential component of R gene-mediated disease resistance in Arabidopsis has homology to eukaryotic lipases. Proc. Natl. Acad. Sci. USA 96: 3292–3297.
Fan, J., Hill, L., Crooks, C., Doerner, P., and Lamb, C. (2009). Abscisic acid has a key role in modulating diverse plant-pathogen interactions. Plant Physiol. 150: 1750–1761.
Fan, W., and Dong, X. (2002). In vivo interaction between NPR1 and transcription factor TGA2 leads to salicylic acid-mediated gene activation in Arabidopsis. Plant Cell 14: 1377–1389.
Feng, D.X., Tasset, C., Hanemian, M., Barlet, X., Hu, J., Trémousaygue, D., Deslandes, L., and Marco, Y. (2012). Biological control of bacterial wilt in Arabidopsis thaliana involves abscissic acid signalling. New Phytol. 194:1035–1045.
Feys, B.J., Moisan, L.J., Newman, M.A., and Parker, J.E. (2001). Direct interaction between the Arabidopsis disease resistance signaling proteins, EDS1 and PAD4. EMBO J. 20: 5400–5411.
Feys, B.J., Wiermer, M., Bhat, R.A., Moisan, L.J., Medina-Escobar, N., Neu, C., Cabral, A., and Parker, J.E. (2005). Arabidopsis SENESCENCE-ASSOCIATED GENE101 stablizes and signals within an ENHANCED DISEASE SUSCEPTIBILITY1 complex in plant innate immunity. Plant Cell 17: 2601–2613.
Flors, V., Ton, J., Van Doorn, R., Jakab, G., García-Agustín, P., and Mauch-Mani, B. (2008). Interplay between JA, SA and ABA signalling during basal and induced resistance against Pseudomonas syringae and Alternaria brassicicola. Plant J. 54: 81–92.
Forouhar, F., Yang, Y., Kumar, D., Chen, Y., Fridman, E., Park, S.W., Chiang, Y., Acton, T.B., Montelione, G.T., Pichersky, E., Klessig, D.F., and Tong, L. (2005). Structural and biochemical studies identify tobacco SABP2 as a methyl salicylate esterase and implicate it in plant innate immunity. Proc. Natl. Acad. Sci. USA 102: 1773–1778.
Fu, Z.Q., and Dong, X. (2013). Systemic acquired resistance: turning local infection into global defense. Annu. Rev. Plant Biol. 64: 839–863.
Fu, Z.Q., Yan, S., Saleh, A., Wang, W., Ruble, J., Oka, N., Mohan, R., Spoel S.H., Tada, Y., Zheng, N., and Dong, X. (2012). NPR3 and NPR4 are receptors for the immune signal salicylic acid in plants. Nature 486: 228–232.
144
Fujita, M., Fujita, Y., Noutoshi, Y., Takahashi, F., Narusaka, Y., Yamaguchi-Shinozaki, K., and Shinozaki, K. (2006). Crosstalk between abiotic and biotic stress responses: a current view from the points of convergence in the stress signaling networks. Curr. Opin. Plant Biol. 9: 436–442.
Fujita, Y., Fujita, M., Satoh, R., Maruyama, K., Parvez, M.M., Seki, M., Hiratsu, K., Ohme-Takagi, M., Shinozaki, K., and Yamaguchi-Shinozaki, K. (2005). AREB1 is a transcription activator of novel ABRE-dependent ABA signaling that enhances drought stress tolerance in Arabidopsis. Plant Cell 17: 3470–3488.
Gaffney, T., Friedrich, L., Vernooij, B., Negrotto, D., Nye, G., Uknes, S., Ward, E., Kessman, H., and Ryals, J. (1993). Requirement of salicylic acid for the induction of systemic acquired resistance. Science 261: 754–756.
Galan, J.E., and Collmer, A. (1999). Type III secretion machines: bacterial devices for protein delivery into host cells. Science 284: 1322–1328.
Garcion, C., Lohmann, A., Lamodière, E., Catinot, J., Buchala, A., Doermann, P., and Métraux, J.P. (2008). Characterization and biological function of the ISOCHORISMATE SYNTHASE2 gene of Arabidopsis. Plant Physiol. 147: 1279–1287.
Glazebrook, J. (2005). Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens. Annu. Rev. of Phytopathol. 43: 205–227.
Glazebrook, J., Rogers, E.E., and Ausubel, F.M. (1996). Isolation of Arabidopsis mutants with enhanced disease susceptibility by direct screening. Genetics 143: 973–982.
Gohre, V., Spallek, T., Haweker, H., Mersmann, S., Mentzel, T., Boller, T., de Torres, M., Mansfield, J.W., and Robatzek, S. (2008). Plant pattern-recognition receptor FLS2 is directed for degradation by the bacterial ubiquitin ligase AvrPtoB. Curr. Biol. 18: 1824–1832.
Gómez-Gómez, L., and Boller, T. (2000). FLS2: an LRR receptor-like kinase involved in the perception of the bacterial elicitor flagellin in Arabidopsis. Mol. cell 5: 1003–1011.
Gonzalez-Guzman, M., Pizzio, G.A., Antoni, R., Vera-Sirera, F., Merilo, E., Bassel, G.W., Fernández, M.A., Holdsworth, M.J., Perez-Amador, M.A., Kollist, H., and Rodriguez, P.L. (2012). Arabidopsis PYR/PYL/RCAR receptors play a major role in quantitative regulation of stomatal aperture and transcriptional response to abscisic acid. Plant Cell 24: 2483–2496.
Grant, S.R., Fisher, E.J., Chang, J.H., Mole, B.M., and Dangl, J.L. (2006). Subterfuge and manipulation: type III effector proteins of phytopathogenic bacteria. Annu. Rev. Microbiol. 60: 425–449.
145
Grant, M.R., Jones, J.D. (2009). Hormone (dis)harmony moulds plant health and disease. Science 324: 750-752.
Griebel, T., and Zeier, J. (2008). Light regulation and daytime dependency of inducible plant defenses in Arabidopsis: phytochrome signaling controls systemic acquired resistance rather than local defense. Plant Physiol. 147: 790–801.
Guo, M., Tian, F., Wamboldt, Y., and Alfano, J.R. (2009). The majority of the type III effector inventory of Pseudomonas syringae pv. tomato DC3000 can suppress plant immunity. Mol. Plant Microbe Interact. 22: 1069–1080.
Hammond-Kosack, K.E., and Rudd, J.J. (2008). Plant resistance signalling hijacked by a necrotrophic fungal pathogen. Plant Signal Behav. 3: 993–995.
Harrison, A.J., Yu, M., Gårdenborg, T., Middleditch, M., Ramsay, R.J., Baker, E.N., and Lott, J.S. (2006). The structure of MbtI from Mycobacterium tuberculosis, the first enzyme in the biosynthesis of the siderophore mycobactin, reveals it to be a salicylate synthase. J. Bacteriol. 188: 6081–6091.
Heidel, A.J., Clarke J.D., Antonovics, J., and Dong, X. (2004). Fitness costs of mutations affecting the systemic acquired resistance pathway in Arabidopsis thaliana. Genetics 168: 2197–2206.
Heidrich, K., Wirthmueller, L., Tasset, C., Pouzet, C., Deslandes, L., and Parker, J.E. (2011). Arabidopsis EDS1 connects pathogen effector recognition to cell compartment specific immune responses. Science 334: 1401–1404.
Hellmann, H., and Estelle, M. (2002). Plant development: regulation by protein degradation. Science. 297: 793–797.
Hennig, J., Malamy, J., Grynkiewicz, G., Indulski, J., and Klessig, D. F. (1993). Interconversion of the salicylic acid signal and its glucoside in plants. Plant J. 4: 593–600.
Hu, J., Barlet, X., Deslandes, L., Hirsch, J., Feng, D.X., Somssich, I., and Marco, Y. (2008). Transcriptional responses of Arabidopsis thaliana during wilt disease caused by the soil-borne phytopathogenic bacterium, Ralstonia solanacearum. PLoS ONE 3: e2589.
Huang, J., Gu, M., Lai, Z., Fan, B., Shi, K., Zhou, Y.H., Yu, J.Q., and Chen, Z. (2010). Functional analysis of the Arabidopsis PAL gene family in plant growth, development, and response to environmental stress. Plant Physiol. 153: 1526–1538.
Huang, W.E., Huang, L., Preston, G.M., Martin, N., Carr, J.P., Li, Y.H., Singer, A.C., Whiteley, A.S., and Hui, W. (2006). Quantitative in situ assay of salicylic acid in tobacco leaves using a genetically modified biosensor strain of Acinetobacter sp. ADP1. Plant J. 46: 1073–1083.
146
Huang, W.E., Wang, H., Zheng, H., Huang, L., Singer, A.C., Thompson, I., and Whiteley, A.S. (2005). Chromosomally located gene fusions constructed in Acinetobacter sp. ADP1 for the detection of salicylate. Environ. Microbiol. 7: 1339–1348.
Ibrahim, R.K., and Towers, G. (1959). Nature 184: 1803.H.
Jagadeeswaran, G., Raina, S., Acharya, B.R., Maqbool, S.B., Mosher, S.L., Appel, H.M., Schultz, J.C., and Klessig, D.F. (2007). Arabidopsis GH3-LIKE DEFENSE GENE 1 is required for accumulation of salicylic acid, activation of defense responses and resistance to Pseudomonas syringae. Plant J. 51: 234–246.
Jamir, Y., Guo, M., Oh, H.S., Petnicki-Ocwieja, T., Chen, S., Tang, X., Dickman, M.B., Collmer, A., and Alfano, J.R. (2004). Identification of Pseudomonas syringae type III effectors that can suppress programmed cell death in plants and yeast. Plant J. 37: 554–565.
Jenns, A.E., and Kuc, J. (1979). Graft transmission of systemic resistance of cucumber to anthracnose induced by Colletotrichum lagenarium and tobacco necrosis virus. Phytopathol. 7: 753–756.
Jiang, C.J., Shimono, M., Sugano, S., Kojima, M., Yazawa, K., Yoshida, R., Inoue, H., Hayashi, N., Sakakibara, H., and Takatsuji, H. (2010) Abscisic acid interacts antagonistically with salicylic acid signaling pathway in rice-Magnaporthe grisea interaction. Mol. Plant Microbe Interact. 23: 791–798.
Johnson, C., Boden, E., and Arias, J. (2003). Salicylic acid and NPR1 induce the recruitment of trans-activating TGA factors to a defense gene promoter in Arabidopsis. Plant Cell 15: 1846–1858.
Jones, J.D.G., and Dangl, J.L. (2006). The plant immune system. Nature 444: 323–329.
Jung, H.W., Tschaplinski, T.J., Wang, L., Glazebrook, J., Greenberg, J.T. (2009). Priming in systemic plant immunity. Science 324: 89–91.
Kachroo, A., and Robin, G.P. (2013). Systemic signaling during plant defense. Curr. Opin. Plant Biol. 16: 527–533.
Katagiri, F., Thilmony, R., and He, S.Y. (2002). The Arabidopsis Book: The Arabidopsis thaliana-Pseudomonas syringae interaction.
Kerbarh, O., Chirgadze, D.Y., Blundell, T.L., and Abell, C. (2006). Crystal structures of Yersinia enterocolitica salicylate synthase and its complex with the reaction products salicylate and pyruvate. J. Mol. Biol. 357: 524–534.
147
Kim, H.S., and Delaney, T.P. (2002). Over-expression of TGA5, which encodes a bZIP transcription factor that interacts with NIM1/NPR1, confers SAR-independent resistance in Arabidopsis thaliana to Peronospora parasitica. Plant J. 32: 151–163.
Kim, M.G., da Cunha, .L, McFall, A.J., Belkhadir, Y., DebRoy, S., Dangl, J.L., and Mackey, D. (2005). Two Pseudomonas syringae type III effectors inhibit RIN4-regulated basal defense in Arabidopsis. Cell 121: 749–759.
Kim, T.H. (2012). Plant stress surveillance monitored by ABA and disease signaling interactions. Mol. Cells 33: 1–7.
Kinkema, M., Fan, W., and Dong, X. (2000). Nuclear localization of NPR1 is required for activation of PR gene expression. Plant Cell 12: 2339–2350.
Klämbt, H.D. (1962). Conversion in plants of benzoic acid to salicylic acid and its βd-glucoside. Nature 196: 491.
Klessig, D.F., and Malamy, J. (1994). The salicylic acid signal in plants. Plant Mol. Biol. 26: 1439–1458.
Klick, S., and Herrmann, K. (1988). Glucosides and glucose esters of hydroxybenzoic acids in plants. Phytochem. 27: 2127–2180.
Knepper, C., and Day, B. (2010). From perception to activation: the molecular-genetic and biochemical landscape of disease resistance signaling in plants. Arabidopsis Book. 8: e012.
Koga, H., Dohi, K., and Mori, M. (2004). Abscisic acid and low temperatures suppress the whole plant-specific resistance reaction of rice plants to the infection of Magnaporthe grisea. Physiol. Mol. Plant Pathol. 65: 3–9.
Kolappan, S., Zwahlen, J., Zhou, R., Truglio, J.J., Tonge, P.J., and Kisker, C. (2007). Lysine 190 is the catalytic base in MenF, the menaquinone-specific isochorismate synthase from Escherichia coli: Implications for an enzyme family. Biochem. 46: 946–953.
Koo, Y.J., Kim, M.A., Kim, E.H., Song, J.T., Jung, C., Moon, J.K., Kim, J.H., Seo, H.S., Song, S.I., Kim, J.K., Lee, J.S., Cheong, J.J., and Choi, Y.D. (2007). Overexpression of salicylic acid carboxyl methyltransferase reduces salicylic acid-mediated pathogen resistance in Arabidopsis thaliana. Plant Mol. Biol. 64: 1–15.
Kornneef, M., Reuling, G., and Karssen, C.M. (1984). The isolation and characterization of abscisic-acid insensitive mutants of Arabidopsis thaliana. Plant Physiol. 61: 377–383.
148
Kumar, D., and Klessig, D.F. (2003). High affinity salicylic acid-binding protein2 is required for plant innate immunity and has salicylic acid-stimulated lipase activity. Proc. Natl. Acad. Sci. USA 100: 16101–16106.
Kunze, G., Zipfel, C., Robatzek, S., Niehaus, K., Boller, T., and Felix, G. (2004). The N terminus of bacterial elongation factor Tu elicits innate immunity in Arabidopsis plants. Plant Cell 16: 3496–3507.
Kuromori, T., Miyaji, T., Yabuuchi, H., Shimizu, H., Sugimoto, E., Kamiya, A., Moriyama, Y., and Shinozaki, K. (2010). ABC transporter AtABCG25 is involved in abscisic acid transport and responses. Proc. Natl. Acad. Sci. USA 107: 2361–2366.
Lawton, K. A., Weymann, K., Friedrich, L., Vernooij, B., Uknes, S., and Ryals, J. (1995). Systemic acquired resistance in Arabidopsis requires salicylic acid but not ethylene. Mol. Plant Microbe Interact. 8: 863–870.
Le Henanff, G., Heitz, T., Mestre, P., Mutterer, J., Walter, B., and Chong, J. (2009). Characterization of Vitis vinifera NPR1 homologs involved in the regulation of pathogenesis-related gene expression. BMC Plant Biol. 9: 54.
Lee, M.W., Lu, H., Jung, H.W., and Greenberg, J.T. (2007). A key role for the Arabidopsis WIN3 protein in disease resistance triggered by Pseudomonas syringae that secrete AvrRpt2. Mol. Plant Microbe Interact. 20: 1192–1200.
Leon, J., Lawton, M.A., and Raskin, I. (1995). Hydrogen peroxide stimulates salicylic acid biosynthesis in tobacco. Plant Physiol. 108: 1673–1678.
Léon-Kloosterziel, K.M., Gil, M.A., Ruijs, G.J., Jacobsen, S.E., Olszewski, N.E., Schwartz, S.H., Zeevaart, J.A., and Koornneef, M. (1996). Isolation and characterization of abscisic acid–deficient Arabidopsis mutants at two new loci. Plant J. 10: 655–661.
Leung, J., Bouvier-Durand, M., Morris, P.C., Guerrier, D., Chefdor, F., and Giraudat, J. (1994). Arabidopsis ABA response gene ABI1: Features of a calcium-modulated protein phosphatase. Science 264: 1448–1452.
L'Haridon, F., Besson-Bard, A., Binda, M., Serrano, M., Abou-Mansour, E., Balet, F., Schoonbeek, H.J., Hess, S., Mir, R., Léon, J., Lamotte, O., and Métraux, J.P. (2011). A permeable cuticle is associated with the release of reactive oxygen species and induction of innate immunity. PLoS Pathog. 7: e1002148.
Lim, E.K., Doucet, C.J., Hou, B., Jackson, R.G., Abrams, S.R., and Bowles, D.J. (2005). Resolution of (+)-abscisic acid using an Arabidopsis glycosyltransferase. Tetrahedron: Asymmetry 16: 143–147.
Lin, W.C., Lu, C.F., Wu, J.W., Cheng, M.L., Lin, Y.M., Yang, N.S., Black, L., Green, S.K., Wang, J.F., and Cheng, C.P. (2004). Transgenic tomato plants expressing
149
the Arabidopsis NPR1 gene display enhanced resistance to a spectrum of fungal and bacterial diseases. Transgenic Res. 13: 567–581.
Liu, P., Yang, Y., Pichersky, E., and Klessig, D.F. (2010). Altering expression of Benzoic acid/Salicylic acid carboxyl Methyltransferase 1 compromises systemic acquired resistance and PAMP-triggered immunity in Arabidopsis. Mol. Plant Microbe Interact. 23: 82–90.
Loake, G., and Grant, M. (2007). Salicylic acid in plant defence-the players and protagonists. Curr. Opin. Plant Biol. 10: 466–472.
Lorrain, S., Vailleau, F., Balagué, C., and Roby, D. (2003). Lesion mimic mutants: keys for deciphering cell death and defense pathways in plants? Trends Plant Sci. 8: 263–271.
Lukasik, E., and Takken, F.L. (2009). STANDing strong, resistance proteins instigators of plant defence. Curr. Opin. Plant Biol. 12: 427–436.
Macho, A.P., Guevara, C.M., Tornero, P., Ruiz-Albert, J., and Beuzón, C.R. (2010). The Pseudomonas syringae effector protein HopZ1a suppresses effector-triggered immunity. New Phytol. 187: 1018–1033.
Mackey, D., Holt, B.F., Wiig, A., and Dangl, J.L. (2002). RIN4 interacts with Pseudomonas syringae type III effector molecules and is required for RPM1-mediated resistance in Arabidopsis. Cell 108: 743–754.
Makandar, R., Essig, J.S., Schapaugh, M.A., Trick, H.N., and Shah, J. (2006). Genetically engineered resistance to Fusarium head blight in wheat by expression of Arabidopsis NPR1. Mol. Plant Microbe Interact. 19: 123–129.
Malamy, J., Hennig, J., and Klessig, D. F. (1992). Temperature-dependent induction of salicylic acid and its conjugates during the resistance response to tobacco mosaic virus infection. Plant Cell 4: 359–366.
Maldonado, A.M., Doerner, P., Dixon, R.A., Lamb, C.J., and Cameron, R.K. (2002). A putative lipid transfer protein involved in systemic resistance signalling in Arabidopsis. Nature 419: 399–403.
Maleck, K., Levine, A., Eulgem, T., Morgan, A., Schmid, J., Lawton, K.A., Dangl, J.L., and Dietrich, R.A. (2000). The transcriptome of Arabidopsis thaliana during systemic acquired resistance. Nat. Genet. 26: 403–410.
Malnoy, M., Jin, Q., Borejsza-Wysocka, E.E., He, S.Y., and Aldwinckle, H.S. (2007). Overexpression of the apple MpNPR1 gene confers increased disease resistance in Malus x domestica. Mol. Plant Microbe Interact. 20: 1568–1580.
Mang, H.G., Qian, W., Zhu, Y., Qian, J., Kang, H.G., Klessig, D., and Hua, J. (2012). Abscisic acid deficiency antagonizes high-temperature inhibition of disease
150
resistance through enhancing nuclear accumulation of Resistance proteins SNC1 and RPS4 in Arabidopsis. Plant Cell 24: 1–14.
Marek, G., Carver, R., Ding, Y., Sathyanarayan, D., Zhang, X., and Mou, Z. (2010). A high-throughput method for isolation of salicylic acid metabolic mutants. Plant Methods. 6: 21.
Matsushita, A., Inoue, H., Goto, S., Nakayama, A., Sugano, S., Hayashi, N., and Takatsuji, H. (2013) The nuclear ubiquitin proteasome degradation affects WRKY45 function in the rice defense program. Plant J. 73: 302–313.
Mauch, F., Mauch-Mani, B., Gaille, C., Kull, B., Haas, D., and Reimmann, C. (2001). Manipulation of salicylate content in Arabidopsis thaliana by the expression of an engineered bacterial salicylate synthase. Plant J. 25: 67–77.
Mauch-Mani, B., and Slusarenko, A.J. (1996). Production of salicylic acid precursors is a major function of phenylalanine ammonia lyase in the resistance of Arabidopsis to Peronospora parasitica. Plant Cell 8: 203–212.
Meighen, E.A. (1993). Bacterial bioluminescence: organization, regulation, and application of the lux genes. FASEB J. 7: 1016–1022.
Melotto, M., Underwood, W., Koczan, J., Nomura, K., and He, S.Y. (2006). Plant stomata function in innate immunity against bacterial invasion. Cell 126: 969–980.
Meur, G., Budatha, M., Gupta, A.D., Prakash, S., and Kirti, P.B. (2006). Differential induction of NPR1 during defense responses in Brassica juncea. Physiol. Mol. Plant Pathol. 68: 128–137.
Mittal, S., and Davis, K.R. (1995). Role of the phytotoxin coronatine in the infection of Arabidopsis thaliana by Pseudomonas syringae pv. tomato. Mol. Plant Microbe Interact. 8: 165-171.
Moeder, W., and Yoshioka, K. (2008). Lesion mimic mutants: A classical, yet still fundamental approach to study programmed cell death. Plant Signal Behav. 3: 764–767.
Mohr, P.C.D. (2003). Abscisic acid influences the susceptibility of Arabidopsis thaliana to Pseudomonas syringae pv. tomato and Peronospora parasitica. Funct. Plant Biol. 30: 461–469.
Mohr, P.G., and Cahill, D.M. (2003). Abscisic acid influences the susceptibility of Arabidopsis thaliana to Pseudomonas syringae pv. tomato and Peronospora parasitica. Func. Plant Bio. 30: 461–469.
Molders, W., Buchala, A., and Metraux, J.P. (1996). Transport of salicylic acid in tobacco necrosis virus-infected cucumber plants. Plant Physiol. 112: 787–792.
151
Mosher, S., Moeder, W., Nishimura, N., Jikumaru, Y., Joo, S.H., Urquhart, W., Klessig, D.F., Kim, S.K., Nambara, E., and Yoshioka, K. (2010). The lesion mimic mutant cpr22 shows alterations in abscisic acid signaling and abscisic acid insensitivity in a salicylic acid-dependent manner. Plant Physiol. 152: 1901–1913.
Mou, Z., Fan, W., and Dong, X. (2003). Inducers of plant systemic acquired resistance regulate NPR1 function through redox changes. Cell 113: 935–944.
(2012). Pipecolic acid, an endogenous mediator of defense amplification and priming, is a critical regulator of inducible plant immunity. Plant Cell 24: 5 3−5 4 .
Nawrath, C., and Métraux, J.P. (1999). Salicylic acid induction-deficient mutants of Arabidopsis express PR-2 and PR-5 and accumulate high levels of camalexin after pathogen inoculation. Plant Cell 11: 1393–1404.
Nawrath, C., Heck, S., Parinthawong, N., and Métraux, J.P. (2002). EDS5, an essential component of salicylic acid-dependent signaling for disease resistance in Arabidopsis, is a member of the MATE transporter family. Plant Cell 14: 275–286.
Negre, F., Kolosova, N., Knoll, J., Kish, C.M., and Dudareva, N. (2002). Novel S-adenosyl-L-methionine:salicylic acid carboxyl methyltransferase, an enzyme responsible for biosynthesis of methyl salicylate and methyl benzoate, is not involved in floral scent production in snapdragon flowers. Arch Biochem. Biophys. 406: 261–270.
Nobuta, K., Okrent, R.A., Stoutemyer, M., Rodibaugh, N., Kempema, L., Wildermuth, M.C., and Innes, R.W. (2007). The GH3 acyl adenylase family member PBS3 regulates salicylic acid-dependent defense responses in Arabidopsis. Plant Physiol. 144: 1144–1156.
Okrent, R.A., Brooks, M.D., and Wildermuth, M.C. (2009). Arabidopsis GH3.12 (PBS3) conjugates amino acids to 4-substituted benzoates and is inhibited by salicylate. J. Biol. Chem. 284: 9742–9754.
Park, J.E., Park, J.Y., Kim, Y.S., Staswick, P.E., Jeon, J., Yun, J., Kim, S.Y., Kim, J., Lee, Y.H., and Park, C.M. (2007). GH3-mediated auxin homeostasis links growth regulation with stress adaptation response in Arabidopsis. J. Biol. Chem. 282: 10036–10046.
Park, S.W., Kaimoyo, E., Kumar, D., Mosher, S., and Klessig, D.F. (2007). Methyl salicylate is a critical mobile signal for plant systemic acquired resistance. Science 318: 113–116.
Pellegrini, L., Rohfritsch, O., Fritig, B., and Legrand, M. (1994). Phenylalanine ammonia-lyase in tobacco. Molecular cloning and gene expression during the
152
hypersensitive reaction to Tobacco Mosaic Virus and the response to a fungal elicitor. Plant Physiol. 106: 877–886.
Pelludat, C., Brem, D., and Heesemann, J. (2003). Irp9, encoded by the high-pathogenicity island of Yersinia enterocolitica, is able to convert chorismate into salicylate, the precursor of the siderophore yersiniabactin. J. Bacteriol. 185: 5648–5653.
Potlakayala, S.D., DeLong, C., Sharpe, A., and Robert, P.R. (2007). Conservation of non-expressor of pathogenesis related genes 1 function between Arabidopsis thaliana and Brassica napus. Physiol. and Mol. Plant Pathol. 71: 174–183.
Poulsen, C., and Verpoorte, R. (1991). Roles of chorismate mutase, isochorismate synthase and anthranalate synthase in plants. Phytochem. 30: 377–386.
Preston, G. (2000). Pseudomonas syringae pv. tomato: the right pathogen, of the right plant, at the right time. Mol. Plant Pathol. 1: 263–275.
Raes, J., Rhode, A., Christensen, J.H., Van de Peer, Y., and Boerjan, W. (2003). Genome-wide characterization of the lignification toolbox in Arabidopsis. Plant Physiol. 133: 1051–1071.
Rai, V.K., Sharma, S.S., and Sharma, S. (1986). Reversal of ABA-induced stomatal closure by phenolic compounds. J. Exp. Bot. 37: 129–134.
Raskin, I. (1992a). Role of salicylic acid in plants. Annu. Rev. Plant Physiol. 43: 438–463.
Raskin, I. (1992b). Salicylate, a new plant hormone. Plant Physiol. 99: 799–803.
Rasmussen, J.B., Hammerschmidt, R., and Zook, M.N. (1991). Systemic induction of salicylic acid accumulation in cucumber after inoculation with Pseudomonas syringae pv. syringae. Plant Physiol. 97: 1342–1347.
Rate, D.N., and Greenberg, J.T. (2001). The Arabidopsis aberrant growth and death2 mutant shows resistance to Pseudomonas syringae and reveals a role for NPR1 in suppressing hypersensitive cell death. Plant J. 27: 203–211.
Ravichandran, S., Stone, S.L., Benkel, B., and Prithiviraj, B. (2013). Purple Acid Phosphatase5 is required for maintaining basal resistance against Pseudomonas syringae in Arabidopsis. BMC Plant Biol. 13: 107.
Richard, N.S., and Peter, R.S. (2005). Plant disease: a threat to global food security. Annu. Rev. Phytopathol. 43: 83–116.
Robatzek, S., and Wirthmüller, L. (2013). Mapping FLS2 function to structure: LRRs, kinase and its working bits. Protoplasma 250: 671–81.
153
Robert-Seilaniantz, A., Grant, M., and Jones, J.D. (2011). Hormone crosstalk in plant disease and defense: more than just jasmonate-salicylate antagonism. Annu. Rev. Phytopathol. 49: 317–343.
Rogers, E.E., and Ausubel, F.M. (1997). Arabidopsis enhanced disease susceptibility mutants exhibit enhanced susceptibility to several bacterial pathogens and alterations in PR-1 gene expression. Plant Cell 9: 305–316.
Rohde, A., Morreel, K., Ralph, J., Goeminne, G., Hostyn, V., De Rycke, R., Kushnir, S., Van Doorsselaere, J., Joseleau, J.P., Vuylsteke, M., Van Driessche, G., Van Beeumen, J., Messens, E., and Boerjan, W. (2004). Molecular phenotyping of the pal1 and pal2 mutants of Arabidopsis thaliana reveals far-reaching consequences on phenylpropanoid, amino acid, and carbohydrate metabolism. Plant Cell 16: 2749–2771.
Rosebrock, T.R., Zeng, L., Brady, J.J., Abramovitch, R.B., Xiao, F., and Martin, G.B. (2007). A bacterial E3 ubiquitin ligase targets a host protein kinase to disrupt plant immunity. Nature 448: 370–374.
Ryals, J., Weymann, K., Lawton, K., Friedrich, L., Ellis, D., Steiner, H.Y., Johnson, J., Delaney, T.P., Jesse, T., Vos, P., and Uknes, S. (1997). The Arabidopsis NIM1 protein shows homology to the mammalian transcription factor inhibitor IkB. Plant Cell 9: 425–439.
Ryals, J.A., Neuenschwander, U.H., Willits, M.G., Molina, A., Steiner, H.Y., and Hunt, M.D. (1996). Systemic acquired resistance. Plant Cell 8: 1809–1819.
Saito, S., Hirai, N., Matsumoto, C., Ohigashi, H., Ohta, D., Sakata, K., and Mizutani, M. (2004). Arabidopsis CYP707As encode (+)-abscisic acid 8’-hydroxylase, a key enzyme in the oxidative catabolism of abscisic acid. Plant Physiol. 134: 1439–1449.
Sanchez-Vallet, A., Lopez, G., Ramos, B., Delgado-Cerezo, M., Riviere, M.P., Llorente, F., Fernandez, P.V., Miedes, E., Estevez, J.M., Grant, M. and Molina, A. (2012). Disruption of abscisic acid signaling constitutively activates Arabidopsis resistance to the necrotrophic fungus Plectosphaerella cucumerina. Plant Physiol. 160: 2109–2124.
Santner, A., and Estelle, M. (2009). Recent advances and emerging trends in plant hormone signalling. Nature 459: 1071–1078.
Seo, M., and Koshiba, T. (2002). Complex regulation of ABA biosynthesis in plants. Trends Plant Sci. 7: 41–48.
Seo, P.J. and Park, C.M. (2010). MYB96-mediated abscisic acid signals induce pathogen resistance response by promoting salicylic acid biosynthesis in Arabidopsis. New Phytol. 186: 471–483.
154
Seo, S., Ichizawa, K., and Ohashi, Y. (1995). Induction of salicylic acid-β-glucosidase in tobacco leaves by exogenous salicylic acid. Plant Cell Physiol. 36: 447–453.
Serino, L., Reimmann, C., Baur, H., Beyeler, M., Visca, P., and Haas, D. (1995). Structural genes for salicylate biosynthesis from chorismate in Pseudomonas aeruginosa. Mol. Gen. Genet. 249: 217–228.
Serrano, M., Wang, B., Aryal, B., Garcion, C., Abou-Mansour, E., Heck, S., Geisler, M., Mauch, F., Nawrath, C., and Métraux, J.P. (2013). Export of salicylic acid from the chloroplast requires the multidrug and toxin extrusion-like transporter EDS5. Plant Physiol. 162: 1815–1821.
Seskar, M. Shulaev, V., and Raskin, I. (1998). Endogenous methyl salicylate in pathogen-inoculated tobacco plants. Plant Physiol. 116: 387–392.
Shah, J., Tsui, F., and Klessig, D.F. (1997). Characterization of a salicylic acid-insensitive mutant (sai1) of Arabidopsis thaliana, identified in a selective screen utilizing the SA-inducible expression of the tms2 gene. Mol. Plant Microbe Interact. 10: 69–78.
Shapiro, A.D., and Zhang, C. (2001). The role of NDR1 in avirulence gene-directed signaling and control of programmed cell death in Arabidopsis. Plant Physiol. 127: 1089–1101.
Shimono, M., Sugano, S., Nakayama, A., Jiang, C.J., Ono, K., Toki, S., and Takatsuji, H. (2007). Rice WRKY45 plays a crucial role in benzothiadiazole-inducible blast resistance. Plant Cell 19: 2064–2076.
Shulaev, V. Silverman, P., and Raskin, I. (1997). Airborne signalling by methyl salicylate in plant pathogen resistance. Nature 385: 718–721.
Silverman, P., Seskar, M., Kanter, D., Schweizer, P., Métraux, J.P., and Raskin, I. (1995) Salicylic acid in rice, biosynthesis, conjugation, and possible role. Plant Physiol. 108: 633–639.
Smalle, J., and Vierstra, R.D. (2004). The ubiquitin 26S proteasome proteolytic pathway. Annu. Rev. Plant Biol. 55: 555–590.
Spoel, S.H., Mou, Z., Tada, Y., Spivey, N.W., Genschik, P., and Dong, X. (2009). Proteasome-mediated turnover of the transcription coactivator NPR1 plays dual roles in regulating plant immunity. Cell 137: 860–872.
Sticher, L., Mauch Mani, B., and Métraux, J.P. (1997). Systemic acquired resistance. Annu. Rev. Phytopathol. 35: 235–270.
Stone, S.L., and Callis, J. (2007). Ubiquitin ligases mediate growth and development by promoting protein death. Curr. Opin. Plant Biol. 10: 624–632.
155
Strawn, M.A., Marr, S.K., Inoue, K., Inada, N., Zubieta, C., and Wildermuth, M.C. (2007). Arabidopsis isochorismate synthase functional in pathogen-induced salicylate biosynthesis exhibits properties consistent with a role in diverse stress responses. J. Biol. Chem. 282: 5919–5933.
Tada, Y., Spoel, S.H., Pajerowska-Mukhtar, K., Mou, Z., Song, J., Wang, C., Zuo, J., and Dong, X. (2008). Plant immunity requires conformational changes of NPR1 via S-nitrosylation and thioredoxins. Science 321: 952–956.
Ton, J., and Mauch-Mani, B. (2004 . β-Aminobutyric acid-induced resistance against necrotrophic pathogens is based on ABA-dependent priming for callose. Plant J. 38: 119–130.
Ton, J., Flors, V., and Mauch-Mani, B. (2009). The multifaceted role of ABA in disease resistance. Trends Plant Sci. 14: 310–317.
Truman, W., Bennett, M.H., Kubigsteltig, I., Turnbull, C., and Grant, M. (2007). Arabidopsis systemic immunity uses conserved defense signaling pathways and is mediated by jasmonates. Proc. Natl. Acad. Sci. USA 104: 1075–1080.
Tsuda, K., Sato, M., and Katagiri, F. (2007). Expression profile analysis of Arabidopsis defense responses elicited by the Pseudomonas syringae hrcC mutant. Plant and Cell Physiol. 48: S49–S49.
van der Biezen, E.A., and Jones, J.D.G. (1998). Plant disease resistance proteins and the gene-for-gene concept. Trends Biochem. Sci. 23: 454–456.
van Tegelen, L.J., Moreno, P.R., Croes, A.F., Verpoorte, R., Wullems, G.J. (1999). Purification and cDNA cloning of isochorismate synthase from elicited cell cultures of Catharanthus roseus. Plant Physiol. 119: 705–712.
Van Verk, M.C., Bol, J.F., and Linthorst, H.J. (2011). WRKY transcription factors involved in activation of SA biosynthesis genes. BMC Plant Biol. 11: 89.
Verberne, M.C., Brouwer, N., Delbianco, F., Linthorst, H.J., Bol, J.F., and Verpoorte, R. (2002). Method for the extraction of the volatile compound salicylic acid from tobacco leaf material. Phytochem. Anal. 13: 45–50.
Verberne, M.C., Budi Muljono, R.A., and Verpoorte, R. (1999). Salicylic acid biosynthesis. In: Biochemistry and Molecular Biology of Plant Hormones. 33: 295-314.
Vernooij, B., Friedrich, L., Morse, A., Reist, R., Kolditz-Jawhar, R., Ward, E., Uknes, S., Kessmann, H., and Ryals, J. (1994). Salicylic acid is not the translocated signal responsible for inducing systemic acquired resistance but is required in signal transduction. Plant Cell 6: 959–965.
156
Vlot, A.C., Dempsey, D.A. and Klessig, D.F. (2009) Salicylic acid, a multifaceted hormone to combat disease. Annu. Rev. Phytopathol. 47: 177–206.
Volko, S.M., Boller, T., and Ausubel, F.M. (1998). Isolation of new Arabidopsis mutants with enhanced disease susceptibility to Pseudomonas syringae by direct screening. Genetics 149: 537–548.
Wang, D., Amornsiripanitch, N., and Dong, X. (2006). A genomic approach to identify regulatory nodes in the transcriptional network of systemic acquired resistance in plants. PLoS Pathog. 2: e123.
Wang, L., Tsuda, K., Truman, W., Sato, M., Nguyen le, V., Katagiri, F., and Glazebrook, J. (2011). CBP60g and SARD1 play partially redundant critical roles in salicylic acid signaling. Plant J. 67: 1029–1041.
Wang, Y., Li, J., Hou, S., Wang, X., Li, Y., Ren, D., Chen, S., Tang, X., and Zhou, J.M. (2010). A Pseudomonas syringae ADP-ribosyltransferase inhibits Arabidopsis mitogen-activated protein kinase kinases. Plant Cell 22: 2033–2044.
Wasilewska, A., Vlad, F., Sirichandra, C., Redko, Y., Jammes, F., Valon, C., Frei dit Frey, N., and Leung, J. (2008). An update on abscisic acid signaling in plants and more...Mol. Plant 1: 198–217.
Weigel, D., and Glazebrook, J. (2002). Arabidopsis: A Laboratory Manual. (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press).
Weigel, R.R., B¨auscher, C., Pfitzner, A.J.P., and Pfitzner, U.M. (2001). NIMIN-1, NIMIN-2 and NIMIN-3, members of a novel family of proteins from Arabidopsis that interact with NPR1/NIM1, a key regulator of systemic acquired resistance in plants. Plant Mol. Biol. 46: 143–160.
Weissman, G. (1991). Aspirin. Scient. Amer. 264: 84-90.
Whenham, R.J., Fraser, R.S.S., Brown, L.P., and Payne, J.A. (1986). Tobacco Mosaic Virus-induced increase in abscisic acid concentration in tobacco leaves intracellular location in light and dark green areas, and relationship to symptom development. Planta 168: 592–598.
White, R.F. (1979). Acetylsalicylic acid (aspirin) induces resistance to tobacco mosaic virus in tobacco. Virology 99: 410–412.
Wildermuth, M.C., Dewdney, J., Wu, G., and Ausubel, F.M. (2001). Isochorismate synthase is required to synthesize salicylic acid for plant defence. Nature 414: 562–565.
Wu, Y., Zhang, D., Chu, J.Y., Boyle, P., Wang, Y., Brindle, I.D., De Luca, V., and Després, C. (2012). The Arabidopsis NPR1 protein is a receptor for the plant defense hormone salicylic acid. Cell Rep. 1: 639–647.
157
Xia, Y., Gao, Q.M., Yu, K., Lapchyk, L., Navarre, D., Hildebrand, D., Kachroo, A., and Kachroo, P. (2009). An intact cuticle in distal tissues is essential for the induction of systemic acquired resistance in plants. Cell Host Microbe 5: 151–165.
Xiang, T., Zong, N., Zou, Y., Wu, Y., Zhang, J., Xing, W., Li, Y., Tang, X., Zhu, L., Chai, J., and Zhou, J.M. (2008). Pseudomonas syringae effector AvrPto blocks innate immunity by targeting receptor kinases. Curr. Biol. 18: 74–80.
Xin, X.F., and He, S.Y. (2013). Pseudomonas syringae pv. tomato DC3000: A model pathogen for probing disease susceptibility and hormone signaling in plants. Annu. Rev. Phytopathol. 51: 473–498.
Xiong, L.M., Ishitani, M., Lee, H., and Zhu, J.K. (2001). The Arabidopsis LOS5/ABA3 locus encodes a molybdenum cofactor sulfurase and modulates cold stress- and osmotic stress-responsive gene expression. Plant Cell 13: 2063–2083.
Xu, J., Audenaert, K., Hofte, M., and De Vleesschauwer, D. (2013). Correction: Abscisic acid promotes susceptibility to the rice leaf blight pathogen Xanthomonas oryzae pv oryzae by suppressing salicylic acid-mediated defenses. PLoS ONE 8: 10.1371
Yasuda, M., Ishikawa, A., Jikumaru, Y., Seki, M., Umezawa, T., Asami, T., Maruyama-Nakashita, A., Kudo, T., Shinozaki, K., Yoshida, S., and Nakashita, H. (2008). Antagonistic interaction between systemic acquired resistance and the abscisic acid–mediated abiotic stress response in Arabidopsis. Plant Cell 20: 1678–1692.
Yu, D., Chen, C., and Chen, Z. (2001). Evidence for an important role of WRKY DNA binding proteins in the regulation of NPR1 gene expression. Plant Cell 13: 1527– 1540.
Yu, I.C., Parker, J., and Bent, A.F. (1998). Gene-for-gene disease resistance without the hypersensitive response in Arabidopsis dnd1 mutant. Proc. Natl. Acad. Sci. USA 95: 7819–7824.
Zhang, J., Shao, F., Li, Y., Cui, H., Chen, L., Li, H., Zou, Y., Long, C., Lan, L., Chai, J., Chen, S., Tang, X., and Zhou, J.M. (2007). A Pseudomonas syringae effector inactivates MAPKs to suppress PAMP-induced immunity in plants. Cell Host Microbe 1: 175–185.
Zhang, K., Halitschke, R., Yin, C., Liu, C.J., and Gan, S.S. (2013). Salicylic acid 3-hydroxylase regulates Arabidopsis leaf longevity by mediating salicylic acid catabolism. Proc. Natl. Acad. Sci. USA 110: 14807–14812.
h X c M I w W O G h m O b ć V T pl tt E W , and Mou, Z. (2010) Over-expression of the Arabidopsis NPR1 gene in citrus increases resistance to citrus canker. Eur. J Plant Pathol. 128: 91–100.
158
Zhang, X., Wang, C., Zhang, Y., Sun, Y., and Mou, Z. (2012). The Arabidopsis Mediator Complex Subunit16 positively regulates salicylate-mediated systemic acquired resistance and jasmonate/ethylene-induced defense pathways. Plant Cell 24: 4294–4309.
Zhang, Y., Cheng, Y.T., Qu, N., Zhao, Q., Bi, D., and Li, X. (2006). Negative regulation of defense responses in Arabidopsis by two NPR1 paralogs. Plant J. 48: 647–656.
Zhang, Y., Fan, W., Kinkema, M., Li, X., and Dong, X. (1999). Interaction of NPR1 with basic leucine zipper protein transcription factors that bind sequences required for salicylic acid induction of the PR-1 gene. Proc. Natl. Acad. Sci. USA 96: 6523–6528.
Zhang, Y., Goritschnig, S., Dong, X., and Li, X. (2003). A gain-of-function mutation in a plant disease resistance gene leads to constitutive activation of downstream signal transduction pathways in suppressor of npr1-1, constitutive 1. Plant Cell 15: 2636–2646.
Zhang, Y., Tessaro, M.J., Lassner, M., and Li, X. (2003). Knockout analysis of Arabidopsis transcription factors TGA2, TGA5, and TGA6 reveals their redundant and essential roles in systemic acquired resistance. Plant Cell 15: 2647–2753.
Zhang, Y., Wang, X., Cheng, C., Gao, Q., Liu, J., and Guo, X. (2008). Molecular cloning and characterization of GhNPR1, a gene implicated in pathogen responses from cotton (Gossypium hirsutum L.). Biosci. Rep. 28: 7–14.
Zhang, Y., Xu, S., Ding, P., Wang, D., Cheng, Y.T., He, J., Gao, M., Xu, F., Li, Y., Zhu, Z., Li, X., and Zhang, Y. (2010). Control of salicylic acid synthesis and systemic acquired resistance by two members of a plant-specific family of transcription factors. Proc. Natl. Acad. Sci. USA 107: 18220-18225.
Zhang, Z., Li, Q., Li, Z., Staswick, P.E., Wang, M., Zhu, Y., and He, Z. (2007). Dual regulation role of GH3.5 in salicylic acid and auxin signaling during Arabidopsis-Pseudomonas syringae interaction. Plant Physiol. 145: 450–464.
Zheng, X.Y., Spivey, N.W., Zeng, W., Liu, P.P., Fu, Z.Q., Klessig, D.F., He, S.Y. and Dong, X. (2012). Coronatine promotes Pseudomonas syringae virulence in plants by activating a signaling cascade that inhibits salicylic acid accumulation. Cell Host Microbe 11: 587–596.
Zheng, Z., Qualley, A., Fan, B., Dudareva, N., and Chen, Z. (2009). An important role of a BAHD acyl transferase-like protein in plant innate immunity. Plant J. 57: 1040-1053.
Zhou, J.M., Trifa, Y., Silva, H., Pontier, D., Lam, E., Shah, J., and Klessig, D.F. (2000). NPR1 differentially interacts with members of the TGA/OBF family of
159
transcription factors that bind an element of the PR-1 gene required for induction by salicylic acid. Mol. Plant Microbe Interact. 13: 191–202.
Zhou, N., Tootle, T.L., Tsui, F., Klessig, D.F., and Glazebrook, J. (1998). PAD4 functions upstream from salicylic acid to control defense responses in Arabidopsis. Plant Cell 10: 1021–1030.
Zhou, R., Cutler, A.J., Ambrose, S.J., Galka, M.M., Nelson, K.M., Squires, T.M., Loewen, M.K., Jadhav, A.S., Ross, A.R.S., Taylor, D.C., and Abrams, S.R. (2004). A new abscisic acid catabolic pathway. Plant Physiol. 134: 361–369.
Zimmermann, P., Hirsch-Hoffmann, M., Hennig, L., and Gruissem, W. (2004). GENEVESTIGATOR. Arabidopsis microarray database and analysis toolbox. Plant Physiol. 136: 2621–2632.
160
BIOGRAPHICAL SKETCH
Yezhang Ding was born in Huai’an Jiangsu China in 1979. He obtained his
bachelor’s degree at Nanjing Agricultural University in 2002. He continued his studies
for his master’s degree in the Plant Breeding program at the same university. He
conducted research on understanding the molecular mechanisms of cotton fiber
development in Dr. ianzhen Zhang’s lab and received his master’s degree in 2005.
Subsequently, he became a teacher at Nanjing Agricultural University and taught
“Common Genetics” and “Common Genetics Laboratory”. t the same time he worked
as a research assistant on cotton breeding and took charge of the field management in
ianzhen Zhang’s lab. He was married to Dongyan Chen in 2005. In 2009, he moved to
Texas Tech University and worked as a research assistant on oil crop breeding with Dr.
Dick Auld. In January, 2010, he joined the Ph.D program in the Department of
Microbiology and Cell Science at the University of Florida. He began working with Dr.
Zhonglin Mou and focused on the understanding of the SA signaling pathway in plant
innate immunity.
