Human Genetics Basics

Kate Garber

Director of Education

Department of Human Genetics

kgarber@genetics.emory.edu

Syndrome named after an old guy

Gene name, which is some meaningless abbreviation

Pathway Genetic test

Medical Genetics

Variable Human TraitsQualitative Traits:Discrete traits

Receding hairlineBushy eyebrowsGray hair

Quantitative Traits:Measurable traits

IQBlood pressureHeight

Genes versus Environment Genes versus Environment

environmentalenvironmentalgeneticgenetic

RareSimple genetics

High recurrence risk

CommonComplex geneticsLow recurrence risk

Sickle cell disease

Scurvy;Infectious diseases;Gunshot wound

HypertensionHeart disease

DiabetesAsthma

Behavioral disorders

Why might someone want to seek genetic services?

Get information about their family history and any genetic risk factors

The diagnosis of a genetic disorder by physical examination and/or genetic laboratory testing

How/why a disorder occurred (in most cases) The chance for the disorder to reoccur in the family The chance for other family members to have the

disorder or pass it on The management and treatment of the disorder Support groups for the disorder Connections to other families who have a child with a

similar/same disorder

Types of genetic testing1. Diagnostic testing - establish or confirm a diagnosis

2. Carrier testing - screen adults to determine if they are carriers of mutations so that their risk of having a child with a genetic defect can be calculated

3. Prenatal testing - determine if a fetus is affected with a genetic disorder (also includes PGD testing).

4. Presymptomatic testing - determine if a currently asymptomatic individual will become affected with a genetic disease in the future.

5. Population screening - screening of the entire population for a genetic disorder so that these individuals can be identified and treated before the onset of symptoms

Chromosome Variation Karyotype 23 pairs autosomes, 2 sex

chromosomes Each chromosome has a

characteristic banding pattern

What is the most common genetic variation you see in karyotypes from a normal population?

46, XX versus 46, XY

Variation in Chromosome Number

Trisomies 13, 18, and 21 are the only non-mosaic trisomies for an entire autosome that are compatible with postnatal survival

Monosomy X is the only monosomy that is viable Trisomy 13 Trisomy 18

Turnpenny & Ellard, 2007

Variation in chromosome structure

Translocations Inversions Duplications Deletions

Chromosome abnormalitiesmicroscopically visible changes in the number or structure of chromosomes occur in:

Approximately 1% of all live births

23% of congenital anomalies with MR 13% of congenital heart defects60% of spontaneous first trimester abortions

Examples: 1. Down syndrome - caused by an additional copy of chromosome 21 2. Unbalanced translocations - partial monosomy for one region of the genome and partial trisomy for another region of the genome 3. 22q11.2 deletion –interstitial deletion of 3Mb removing several genes

When to order cytogenetic testing(i.e. standard of care)

Multiple congenital anomalies

Mental retardation of unknown origin or associated with minor or major malformations

Multiple unexplained spontaneous abortions

Ambiguous genitalia

Prenatal testingAbnormal prenatal screen

Ultrasound abnormalities

Fluorescence In Situ Hybridization (FISH)

Metaphase cell Denaturedtarget DNAds ssDNA

GATT

Denaturedprobe DNA

FISH probes

A shows a normal chromosome 15

B shows a deletion at the end of the other chromosome 15

Unique sequence probes - single copy probes (1 kb feasible). Useful for microdeletions/dups, specific telomeres.

Copy Number Polymorphism

Large chunks of DNA (1000s-1 Mb) that are present in a variable number of copies in different people

Can affect the number of copies of a gene that are present in a person

Even if they don’t contain a complete gene, they can affect the level of gene expression

Comparative Genome Hybridization

Fragments of sample and reference DNA labeled with different fluorescent dyes

Labeled DNAs are denatured and incubated with metaphase chromosomes or on DNA arrays

The DNAs compete for binding to the target DNA

Resulting relative fluorescence is measured

If there’s an equal sequence between sample and reference,you get a yellow signal. If not you get red or green.

Indications for array CGH Patients with normal chromosome analysis and:

Unexplained developmental delay or mental retardation Dysmorphic features or congenital anomalies Autism spectrum disorders, seizures, or a clinical

presentation suggestive of a chromosomal syndrome Patients with a previously identified chromosome

abnormality: To size deletions or duplications and identify genes involved For apparently balanced rearrangements and an abnormal

clinical phenotype, oligo array analysis can be used to test for cryptic deletions/duplications at the breakpoints

Changes to DNA sequence

~ 1 change every 1,000 bases = 99.9% identical from person to person

CTCGAGGGGCCTAGACATTGCCCTCCAGAGAGAGCACCCAACACCCTCCAGGCTTGACCGGCCAGGGTGTCCCCTTCCTACCTTGGAGAGAGCAGCCCCAGGGCATCCTGCAGGGGGTGCTGGGACACCAGCTGGCCTTCAAGGTCTCTGCCTCCCTCCAGCCACCCCACTACACGCTGCTGGGATCCTGGATCTCAGCTCCCTGGCCGACAACACTGGCAAACTCCTACTCATCCACGAAGGCCCTCCTGGGCATGGTGGTCCTTCCCAGCCTGGCAGTCTGTTCCTCACACACCTTGTTAGTGCCCAGCCCCTGAGGTTGCAGCTGGGGGTGTCTCTGAAGGGCTGTGAGCCCCCAGGAAGCCCTGGGGAAGTGCCTGCCTTGCCTCCCCCCGGCCCTGCCAGCGCCTGGCTCTGCCCTCCTACCTGGGCTCCCCCCATCCAGCCTCCCTCCCTACACACTCCTCTCAAGGAGGCACCCATGTCCTCTCCAGCTGCCGGGCCTCAGAGCACTGTGGCGTCCTGGGGCAGCCACCGCATGTCCTGCTGTGGCATGGCTCAGGGTGGAAAGGGCGGAAGGGAGGGGTCCTGCAGATAGCTGGTGCCCACTACCAAACCCGCTCGGGGCAGGAGAGCCAAAGGCTGGGTGTGTGCAGAGCGGCCCCGAGAGGTTCCGAGGCTGAGGCCAGGGTGGGACATAGGGATGCGAGGGGCCGGGGCACAGGATACTCCAACCTGCCTGCCCCCATGGTCTCATCCTCCTGCTTCTGGGACCTCCTGATCCTGCCCCTGGTGCTAAGAGGCAGGTAAGGGGCTGCAGGCAGCAGGGCTCGGAGCCCATGCCCCCTCACCATGGGTCAGGCTGGACCTCCAGGTGCCTGTTCTGGGGAGCTGGGAGGGCCGGAGGGGTGTACCCCAGGGGCTCAGCCCAGATGACACTATGGGGGTGATGGTGTCATGGGACCTGGCCAGGAGAGGGGAGATGGGCTCCCAGAAGAGGAGTGGGGGCTGAGAGGGTGCCTGGGGGGCCAGGACGGAGCTGGGCCAGTGCACAGCTTCCCACACCTGCCCACCCCCAGAGTCCTGCCGCCACCCCCAGATCACACGGAAGATGAGGTCCGAGTGGCCTGCTGAGGACTTGCTGCTTGTCCCCAGGTCCCCAGGTCATGCCCTCCTTCTGCCACCCTGGGGAGCTGAGGGCCTCAGCTGGGGCTGCTGTCCTAAGGCAGGGTGGGAACTAGGCAGCCAGCAGGGAGGGGACCCCTCCCTCACTCCCACTCTCCCACCCCCACCACCTTGGCCCATCCATGGCGGCATCTTGGGCCATCCGGGACTGGGGACAGGGGTCCTGGGGACAGGGGTCCGGGGACAGGGTCCTGGGGACAGGGGTGTGGGGACAGGGGTCTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTCTGGGGACAGGGGTGTGGGGACAGGGGTCCGGGGACAGGGGTGTG

What is the effect of a DNA change?

½½

chocolatechocolate

White LilyWhite Lily

DNA change can lead to different results

DeleteriousDeleteriousNo change ???

Neutral variationNeutral variation mutationmutationpolymorphismspolymorphisms

height, weightresponse to certain drugs, hair, skin, eye color

Inborn errors of metabolism, cystic fibrosis, sickle cell anemia, cancer

Mutation can occur in different places across a gene

1 2 3 4 51 2 3 4 5X

promoterpromoterX X X

Clinicians often don’t use pedigrees

“Although there are several obstacles, ... a common underestimation by clinicians of the value of the family history, …”

2% 8%

33%

57%

Blue – 57% - no significant family hxRed – 33% - one chronic conditionYellow – 8% - twoPink – 2% - three or more

(3) Scheuner, et al. Am J Med Genet 1997, 71:315-324.

Pedigree vs. Questionnaire

Focus on individuals by asking about each person in family

Trigger patient memory Easier to see patterns Use to explain patterns Demonstrates biological relationships “Amount of genetic information shared” Reveals social relationships

Family history can provide the basis for:

Making a diagnosis Determining who is at risk and level of risk Assessing needs for education and

psychosocial support

Rules

Squares for males Circles for females Relationship line (horizontal) – connects

partners – double slash equals separation Line of descent (vertical) Sib-ship line (horizontal)

Information to collect

Initials or first name – particularly affected Ages or dates (year) of birth Decades for adult onset concerns okay Unaffected just as important as affected If affected, note age of onset Deceased – slash – age and cause – include

lost pregnancies

d. 58 Colon CA

More information to collect Physical and mental health of each individual Birth defects, developmental delay, mental

retardation, inherited disorders, chronic conditions?

Build key – shading, patterns, etc. Watch abbreviations – add to key as you go Date pedigree, Where and who collected Who reported information - Historian

What to look for:

Mental retardation/

developmental delay Birth Defects Obvious genetic

conditions Infertility/miscarriage

Early age of onset Multiple affecteds Individuals who are

affected multiple times Particular constellations

of features Pattern of inheritance

35 33 30

6263

Dx 48d. 50

Dx 4258

60

28

90

61Type 2 diabetes

Dx. 45

82 82

Breast cancer

35 33 30

6263

Dx 75d. 77

5860

28

90 82 Dx 7680

Breast cancer

Dx 68d. 75 MI

35 33 30

d. 40MI

63

d. 35Car accident

5860

28

90 d. 86Prostate ca

Dx 54d. 78

Breast cancer

70

Dx 5151

Autosomal DominantAutosomal Dominant• Responsible gene on autosome

• Only 1 copy of mutation needed - normal allele not sufficient to compensate for mutant allele

• Heterozygotes and homozygotes are both affected

• appears in every generation

• each affected person has an affected parent (exceptions!)

• each child of an affected parent has 50% risk to inherit trait.

• unaffected family members don’t transmit phenotype to children (exceptions again).

• males and females equally likely to transmit the trait, to children of either sex.

• male-to-male transmission

• new mutations relatively common

Characteristics of Autosomal Dominant DisordersCharacteristics of Autosomal Dominant Disorders

Autosomal RecessiveAutosomal Recessive• Responsible gene on autosome

• Both alleles of the gene must be defective.

• Frequently due to loss of function (gene is inactivated)

• Heterozygotes are unaffected carriers

aa

Aa Aa

Medium chain acyl CoA dehydrogenase (MCAD)

• If disorder appears >1 family member, typically found within a sibship, not across generations.

• The recurrence risk for each sib of the proband is 25%.

• More common with consanguinity, especially for rare diseases.

• Males and females are equally likely to be affected.

• New mutation is almost never a consideration.

Characteristics of Autosomal Recessive Disorders

Sex-LinkedSex-Linked• Responsible gene on X chromosome (also called “X-linked”)

• Usually for females, both copies of the X chromosome must be affected

• Males, hemizygous for the X chromosome, much more likely to be affected

X-linked mental retardation

Genetics and Prenatal Care

Diagnostic Tests Chorionic Villus

Sampling (CVS) Amniocentesis Testing for single gene

defects

Screens Combined first trimester

screen Triple screen/Quad

screen

Genetics and Prenatal Care

Diagnostic Tests Chorionic Villus

Sampling (CVS) Amniocentesis

Screens Combined first trimester

screen Triple screen/Quad

screen

Is 35 a “magic” age cut-off for screening versus testing?Is 35 a “magic” age cut-off for screening versus testing?

From Thompson & Thompson Genetics in Medicine

For an autosomal recessive disorder, what is the family history likely to be?

Carrier TestingThe frequency of Tay-Sachs (prior to the onset of widespread carrier screening among Ashkenazim ) was about:

1/360,000 live births for non-Ashkenazi North Americans, and

1/3,600 for North American Ashkenazi Jews

Carrier frequencies are therefore about:

1/300 for most North Americans, and1/30 for North American Ashkenazi Jews

And within a certain population, particular mutations tend topredominate

Carrier Testing

African Americans: Sickle cell disease 1 in 10

Caucasians: Cystic fibrosis 1 in 25

Ashkenazi Jewish: Tay-Sachs Canavan Disease

1 in 40 Gaucher Disease

1 in 13 Familial Dysautonomia

1 in 30 Cystic fibrosis

1 in 25 Fanconi anemia

1 in 90 Niemann-Pick Disease

1 in 90 Bloom syndrome

1 in 100

What does a negative result tell you?

For an autosomal recessive disorder, what is the family history likely to be?

Newborn Screening

Newborn Screening: WHY ?

Detect an affected infant before before symptoms to prevent or reduce morbidity and mortality

Provide parents and family reproductive options for future pregnancies

Avoid diagnostic odyssey

http://genes-r-us.uthscsa.edu

www.acmg.net/resources Look under “reference materials”

Algorithm for MCADpositive newborn screen

MCAD ACT Sheet

Adults who might seek genetic services:

Those with reproductive problems Those with a known genetic disorder in the

family Those with symptoms of a genetic disorder Those with family history of cancer

Case Study

At the time of her annual physical, your patient, a 30-year old woman, asks about the “breast cancer gene”. She is Jewish and has been reading in the paper that Jewish women may be more likely to have this “gene”. She has two older sisters, aged 33 and 35, who are also worried about their risks.

Cancer risk assessmentSporadic cancerSporadic cancer Familial cancerFamilial cancer

Hereditary cancerHereditary cancer *Early onset cases*Individuals affected with multiple tumors*Particular patterns of tumors Breast and ovarian

Red Flags:

35 33 30

6263

Dx 48d. 50

Dx 4258

60

28

90

61Type 2 diabetes

Dx. 45

82 82

Breast cancer

Genetic testing for BRCA1/2

All testing in North America performed by a single lab, Myriad Exons and adjacent regions sequenced. Also look for large duplications

and deletions. Mutation-specific testing is also available. Possible results:

Mutation positive Mutation negative (known mutation in family) Variant of unknown significance (This happens ~10% of the time) No mutation found

Preferable procedure is to do test on an affected family member first

If our patient tests negative for a BRCA1/2 mutation, what are the possible explanations?

No BRCA1/2 mutation in the family Increased risk

She didn’t inherit the mutation in the family Population risk (1 in 8)

There is a mutation in our patient but we can’t detect it using our testing method. High risk

How can we avoid some of this confusion? Identify a familial mutation Try to test aunt first or test archived tissue sample from

grandmother, if available.

What if the test is positive?

Provide psychosocial support Review cancer risks and management

options Identify at-risk relatives Plan for follow-up

Cancer risks with BRCA mutations

www.myriad.com

Personal risk reduction following BRCA1/2 mutation detection

Increased surveillance Selective estrogen receptor modulators (tamoxifen) Prophylactic mastectomy Prophylactic oophorectomy (usually recommended)

Finch et al. (2006) JAMA 286:185-192

ASCO Guidelines for Hereditary Cancer Testing

Cancer predisposition testing should be offered only when… There is a personal or family history

suggesting a genetic susceptibility to cancer The test can be adequately interpreted The test result will aid in diagnosis or influence

medical management of the patient or family members

Why might somebody who has already had cancer want genetic testing?

They would be at increased risk of other additional primary tumors

Could influence patient management Could help family members

Genetic counseling/risk assessment

When a patient is not interested in or is not a good candidate for cancer genetic testing, genetic counseling and risk assessment are still valuable when there is: A suggestive pattern of cancers in the family or

individual High anxiety A mixture of cancers in the family (suggestive of a

cancer syndrome)

Mendelian versus complex traits

Mendelian traits Are determined by the independent action of a single major

gene Mutation in this gene is necessary and sufficient for

phenotype Have predictable inheritance patterns

Cystic fibrosis

Risk to each sib is 25% and we can do prenatal testing

Mendelian versus complex traits Complex traits

Exhibit familial clustering but not predictable inheritance patterns

Cleft palate

Recurrence risk is 3% (compared to population risk of 0.1%)

Benefits to determining genetic Benefits to determining genetic factors that influence a complex traitfactors that influence a complex trait

Provide a molecular definition of the trait

Improve understanding of disease etiology and mechanism

Can offer early risk assessment

Aids in discovery of new, targeted drugs

Can be utilized for disease prevention

How do we find genes for complex traits?

Search for the occurrence of specific genetic variation at a higher frequency among affected individuals compared to unaffected individuals

Strength of association is measured by an odds ratio

“we identified a variant in the CDKAL1 gene that was associated with T2D in individuals of European ancestry (odds ratio (OR) = 1.20)” Steintorsdottir et al. (2007)

In contrast to studies of Mendelian traits in which you look for mutations throughout a gene that that are inherited with a trait, association studies look for one specific allele that is overrepresented in the case population

An allele is the specific genetic variation in a gene

The sickle cell mutation is an allele of the beta globin gene

We reserve the term “mutation” for alleles that cause disease and are very rare

Association studiesAssociation studies

Association and allele frequency in populationsAssociation and allele frequency in populations

Allele 1

Allele 2

Allele 3

Allele 4

Control Population

Association with allele 1Association with allele 1

Affected Population

Note: the disease-associated allele is found in the control population!

Case Study

A 53-year old African American male has an annual check-up. He is 5’10” and 220 lbs. He reports feeling well. Family history indicates a history of diabetes in his mother that was diagnosed at age 45. She died at age 58 from complications of diabetes after 3 years on dialysis.

“An immediate practical consequence of the discovery, saidDecode’s chief executive, Kari Stefansson, would be todevelop a diagnostic test to identify people who carry thevariant gene. If people knew of their extra risk, they would havean incentive to stay thin and exercise, he said.”

~38% of people examined are heterozygous for the TCF7L2 risk allele

Relative risk if you are heterozygous for the TCF7L2 risk allele is ~1.4. 26% of people in the group without the risk allele had T2D 38% of people in the group heterozygous for the risk allele had T2D

General population risk for T2D is ~33%

TCF7L2 and Type 2 Diabetes

Grant et al. (2006) Nature Genetics 38: 320-323

Why is this study important?

There was no prior evidence that TCF7L2 was involved in diabetes. This gives us a new way to look at the process by which diabetes develops.

Could ultimately lead to new treatments We may find other genes that, in combination with

TCF7L2, help us fully understand genetic contributions to diabetes.

Evaluating Association Studies

Has the result been replicated in an independent population?

How predictive is the genetic variation of disease? How do environmental risk factors interact with this

genetic risk factor? Does the environmental risk have a much bigger role?

Would a genetic test for this variation give us more accurate risk assessment than one based on general family history and lifestyle factors?

Unique Aspects of Genetic Medicine

You’re really treating a family, not an individual

Testing individuals can reveal information about other family members

Testing can be predictive Especially as we move toward genomic tests,

we may find things we’re not looking for

Genetic Resources National Society of Genetic Counselors

http://www.nsgc.org/ Genetics Home Reference

http://ghr.nlm.nih.gov/ NIH website with consumer-oriented information on genetic variation and

genetic disease Gene Tests/Gene Reviews

http://www.geneclinics.org/ Current reviews of genetic disorders Labs that offer testing for each, if available Genetic clinics by geographic location

Emory Genetics http://www.genetics.emory.edu/egl/index.php