Supporting Information

Protein expression and purification

Full-length and truncated HpHtrA genes (without signal peptide) were PCR-amplified using

H. pylori 26695 genomic DNA as a template. The amplified gene fragment was subcloned into

pET47b (+) (Novagen) vector for an N-terminal His6-tag fusion protein expression. All of the

point mutations were introduced using a QuikChange site-directed mutagenesis kit (Stratagene).

All of the constructs were verified by DNA sequence analysis. The plasmids were transformed

into BL21 (DE3) for protein expression. The cells were cultured in 1 L Luria-Bertani (LB) broth

supplemented with 50 mg/L kanamycin at 37 °C until DO600 reached 0.6, isopropyl β-D-1-

thiogalactopyranoside (IPTG) was added to a final concentration of 0.3 mM to induce protein

expression. The bacteria were further cultured at 25 °C overnight and harvested by

centrifugation at 4,000 g for 15 min. The cell pellets were resuspended in pre-chilled nickel-

nitrilotriacetic acid (Ni-NTA) buffer A (20 mM Tris-HCl, 250 mM NaCl, 10 mM imidazole,

1 mM β-mercaptoethanol and 1 mM phenylmethylsulfonyl fluoride (PMSF), pH 8.0). The cells

pellets were lysed by sonication and the supernatant was obtained by centrifugation at 20,000

g for 20 min at 4 °C. The supernatant was filtered by 0.45 μM filters and loaded onto a Ni-NTA

affinity column (Qiagen) pre-equilibrated with Ni-NTA buffer A. The expressed protein was

eluted with Ni-NTA buffer B (20 mM Tris-HCl, 250 mM NaCl, 250 mM imidazole, 1 mM β-

mercaptoethanol and 1 mM PMSF, pH 8.0). The eluted fractions were dialyzed against Ni-NTA

buffer A without imidazole and treated with the PreScission protease overnight (molar ratio of

protease to target protein is 1:150) at 4 °C to remove the N-terminal His-tag. The digested

protein was pooled and loaded onto a Superdex 200 increase 10/300 GL gel-filtration column

(GE Healthcare) pre-equilibrated with Tris-HCl buffer (20 mM Tris-HCl, 250 mM NaCl, 1 mM

DTT, pH 7.5). The final eluted protein was concentrated to approximately 5 mg/mL, flash

frozen in liquid N2 and stored at −80 °C. All the primers used in PCR amplification and

mutagenesis are listed in Table 1.

Protein crystallization and structure determination

Approximately 2 μL full-length (FL) HpHtrA protein with concentration of 5 mg/mL were

mixed with 2 μL reservoir solution consisting of 2.1 M DL-Malic Acid, 0.1 M HEPE pH 7.0.

Crystals were obtained by sitting drop diffusion within 3 days at 20 °C. For HpHtrA-∆PDZ2,

crystals were obtained similarly by sitting drop diffusion at 20 °C by mixing 2 μL protein

samples (15 mg/mL) with 2 μL reservoir solution containing 20% PEG 1500, 0.1 M HEPES

and 0.2 M proline pH 7.5. Crystals were obtained within 2 days. Protein crystals were

transferred into a cryoprotective solution containing the reservoir solution supplemented with

10% glycerol (v/v) and flash frozen in liquid nitrogen. Diffraction data of WT-HpHtrA and

HpHtrA-∆PDZ2 were collected at Shanghai Synchrotron Radiation Facility (SSRF, Shanghai,

China) using beamline 17B (BL17B), 17U1 (BL17U1) and 19U1 (BL19U1). Raw data images

were processed with HKL2000. The structures were solved by molecular replacement with

PHENIX program and the EcDegP structure (PDB code 1KY9) was used as a searching model.

Subsequent model building and refinement were carried out in COOT and PHENIX.

Crystallographic data statistics are summarized in Table 2. The secondary structure of HpHtrA-

∆PDZ2 was analyzed by ESPRIPT (1). The interface areas of HtrA family proteins were

analyzed using PDBePISA server with default parameters.

Cellular location analysis of HpHtrA.

H. pylori 26695 were grown in Brucella Broth medium and collected by centrifugation at

4,000 g for 15 min when OD reached 0.8. The medium was removed and the cell pellets were

washed three times with 20 mM HEPES buffer, pH 7.5. The pellets were resuspended in the

same buffer and lysed using a Branson Sonicator for 5 min (20% amplitude). Intact cells were

removed by centrifugation (500 g, 5 min at 4 °C) and the supernatant was retained. Total

membranes were then collected by centrifugation (45,000 g, 60 min at 4 °C). The separation of

inner and outer membranes was carried out according to the method described by Peter Doig

and Trevor J. Trust with minor modifications. Membranes were washed three times with 20

mM HEPES buffer, pH 7.5 and resuspended in the same buffer supplemented with 1% (w/v)

sodium N-lauroylsarcosine. The mixture was incubated at 4°C for 60 min followed by

centrifugation (45,000 g, 60 min, 4 °C). The obtained supernatant contains inner membrane

proteins. The remained pellet was washed three times and centrifuged again to remove the

excess detergent. Subsequently, 20 mM HEPES buffer supplemented with 1% SDS (w/v), pH

7.5 was added into the pellet and incubated for 60 min at 4 °C to solubilize the outer membrane

fraction. The supernatant containing outer membrane was obtained by centrifugation. All the

collected fractions were analyzed by Western blotting using HpHtrA-specific antibody.

Figure S1. SDS-PAGE analysis of the wild-type and mutants of HtrA. WT-HpHtrA: wild-type HpHtrA. HpHtrA-∆N: N-terminal 19 residues truncated mutant. HpHtrA-∆PDZ2: PDZ2 domain truncated mutant. HpHtrA-∆PDZ1-2: both PDZ domains truncated mutant. HpHtrA-K326A: Lys326 to Ala326 mutant. HpHtrA-K328A: Lys32 to Ala32 mutant.

Figure S2. Crystal structures of the protease and PDZ1 domains of HtrA proteins. The

monomeric structures of full-length HpHtrA (cyan), HpHtrA-∆PDZ2 (marine), inactive

EcDegP (orange, PDB code 1KY9) and active EcDegP (gray, PDB code 3CS0) are

superimposed. The protease and PDZ1 domains are shown in cartoon.

Figure 3. Structure of the N-terminal domain swapping of HpHtrA. Chain A, B and C of

HpHtrA trimer are colored in green, cyan and magenta, respectively. The N-termini of trimeric

HpHtrA are shown in sticks. The 2Fo-Fc electron density of the N-termini contoured at 1.0 σ

is shown as mesh.

Figure S4. Analysis of the interfaces among HpHtrA N-termini. The hydrogen bond

networks of HpHtrA N-termini are shown. A, B and C indicate the different chains of HpHtrA

trimer; [N] and [O] represent the nitrogen and oxygen atoms of backbone respectively; [NH2]

represents the nitrogen atoms of sidechain.

Figure S5. Size-exclusion chromatography of full-length WT-HpHtrA and N-terminus

truncated mutants. HpHtrA-rN: HpHtrA with N-terminus truncated (residue 18-35 deletion);

HpHtrA-rL1: HpHtrA with N-terminal loop1 truncated (residue 21-29 deletion); HpHtrA-

rN13aa: HpHtrA with N-terminal 13 amino acids truncated (residue 18-30 deletion). The WT-

HpHtrA and HpHtrA-rN elution curves are reused from Figure 2A. They are used to compare

with two N-terminus truncation mutants, HpHtrA-rL1 and HpHtrA-rN13aa.

Figure S6. The interactions of Arg31 in HpHtrA N-terminus domain-swapping. Three

HpHtrA monomers are shown in different colors. Residues involved in the interactions are

shown in sticks. Hydrogen bonds and salt bridges are shown in yellow and gray dashed lines,

respectively. A and B represent the detail interactions among different monomers.

Figure S7. The assembly of proteolytic HpHtrA oligomer. (A) Size exclusion analysis of

HpHtrA oligomer formation in the presence of different molar ratios of β-casein substrate. (B)

The percentages of dodecameric WT-HpHtrA, primary and secondary digested products of β-

casein in the reaction mixture in the course of time. The percentage of each components is

calculated based on the size exclusion chromatography eluted peak areas.

Figure S8. HpHtrA and EC1-EC2 complex docking model. (A)The HpHtrA trimer and EC1-

EC2 monomer are shown in surface structure. The PDZ1 and EC1-EC2 involved in interactions

are shown in cartoon. Three HpHtrA monomers are shown in gray, green and cyan, respectively

and EC1-EC2 is shown in yellow. The lysine residues Lys326 and Lys328 of HpHtrA at the

interfaces are shown in magenta spheres. (B) The interface between HpHtrA PDZ1 domain and

EC1-EC2. The peptide binding groove of HpHtrA PDZ1 domain is colored in orange.

Figure S9. Substrates cleavage assay of wild-type HpHtrA and mutants. The cleavage

activities are calculated based on the residual substrates. The activity of WT-HpHtrA is set as

1. The activities of mutants are normalized to that of WT-HpHtrA. The cleavage time for casein

and E-cadherin are 4h and 15h, respectively.

Figure S10. Sequence alignment of HtrA family proteins. The conserved motif between

HpHtrA and DegSs were labeled in red boxes, while the identity or similar residues were

highlighted by blue circles. The signal peptides have been removed from the sequences. The

abbreviated species names and their GenBank accession numbers are as follows: CpDegPL:

Chlamydia pneumoniae DegPL (Q9Z6T0), SsHtrA: Synechocystis sp. HtrA (P73354),

DrHtrA1A: Danio rerio HtrA1A (Q6GMI0), XtHtrA: Xenopus tropicalis HtrA (A4IHA1),

MsDegPL: Marinomonas sp. DegPL (A6VUA4), HcDegPL: Hahella chejuensis DegPL

(Q2SL36), PfDegPL (fulva): Pseudomonas fulva DegPL (F6AA62), PfDegPL (fluorescens):

Pseudomonas fluorescens DegPL (Q4KGQ4), BhDegPL: Bartonella henselae DegPL (P54925),

EcDegP: Escherichia coli DegP (P0C0V0), StDegP: Salmonella typhimurium DegP (P26982),

BaDegP (Baizongia pistaciae): Buchnera aphidicola subsp. Baizongia pistaciae DegP

(Q89AP5), BaDegP (Acyrthosiphon pisum): Buchnera aphidicola subsp. Acyrthosiphon pisum

DegP (P57322), EcDegQ: Escherichia coli DegQ (P39099), HpHtrA: Helicobacter pylori HtrA

(G2J5T2), CjHtrA: Campylobacter jejuni HtrA (A7H2F1), EcDegS: Escherichia coli DegS

(P0AEE3), StDegS: Salmonella typhimurium DegS (D0ZY51), HiDegS: Haemophilus

influenzae DegS (P44947), LhHtrA: Lactobacillus helveticus HtrA (Q9Z4H7), LlHtrA:

Lactococcus lactis HtrA (A2RNT9), BsHtrA: Bacillus subtilis HtrA (P39668).

Figure S11. Full size of western blot of cellular location of HpHtrA and HpTatC. Ctrl: purified HpHtrA protein, Bac.: bacterial pellet, Med.: extracellular medium, Tot.: total protein after bacterial lysis, Sol.: soluble protein after bacterial lysis, Wash: wash of pellet after cell lysis, Inner: inner membrane protein, Outer: outer membrane protein. HpTatC: twin-arginine translocation protein C, an inner membrane protein of H. pylori. HpTatC is identified in the total lysate and inner membrane fractions.

Table 1. The primers used for PCR amplification and mutagenesis Name Forward Primer Reverse Primer

WT-HpHtrA 5-AAGGATCCGGGCAATA

TCCAAATCCAGAGCATG-3

5-CTTGTACTCGAGTCAT

TTCACCAAAATGATCC-3 HpHtrA- △

PDZ1-2

5-AAGGATCCGGGCAATA

TCCAAATCCAGAGCATG-3

5- CCGAGACTCGAGTCAGGT

TTTGATGAGTTGGGTTAC -3

HpHtrA- △

PDZ2

5-AAGGATCCGGGCAATAT

CCAAATCCAGAGCATG-3

5- CCGAGACTCGAGTCATTTC

CTTTCAGCTAGAGTG -3

HpHtrA-△N 5-CTTGTAGGATCCGTCTA

AAGACGATACGATCTATTC-3

5-CTTGTACTCGAGTCAT

TTCACCAAAATGATCC-3

HpHtrA-

K326A

5- CCGAAGTCAATGGGAAAG

CGGTTAAAAACACGAATG -3

5- CATTCGTGTTTTTAACCGCTT

TCCCATTGACTTCGG -3

HpHtrA-

K328A

5-AAGTCAATGGGAAAAAGGT

TGCAAACACGAATGAGTTAAG-3

5-CTTAACTCATTCGTGTTTG

CAACCTTTTTCCCATTGACTT-3

Table 2. X-ray crystallography: data collection and refinement statistics

Full-length HpHtrA HpHtrA-△PDZ2

Data collection

Wavelength 0.97 0.97

Space group R 3 2:H P 21 21 21

Resolution range 44.49 - 3.7 (3.832 - 3.7) a 42.76 - 3.086 (3.196 - 3.086) a

Cell dimensions

a, b, c (Å) 128.88 128.88 184.54

90 90 120

89.91 91.5 120.32

90 90 90 α, β, γ (°) 90 90 120 90 90 90

Unique reflections 6505 18846

Redundancy 1.8 (1.7) a 7.0 (7.4) a

Completeness (%) 1.00 (0.99) a 0.99 (1.0) a

Mean I/sigma(I) 31.0 (6.2) a 13.9 (2.9) a

R-merge 0.174 (0.488) a 0.083 (0.615) a

CC1/2 0.989 (0.944) a 0.998 (0.899) a

Refinement

R-work 0.3314 (0.287) a 0.257 (0.3085) a

R-free 0.3411 (0.295) a 0.299 (0.3566) a

Number of non-hydrogen atoms 1853 5193

Macromolecules/ ligands 1853/0 5188/5

RMS(bonds) 0.012 0.002

RMS(angles) 1.943 0.54

Ramachandran favored (%) 76.1 88.9

Ramachandran allowed (%) 15.4 8.9

Average B-factor 49 83

a Statistics for the highest-resolution shell are shown in parentheses.

Reference 1. Robert, X., and Gouet, P. (2014) Deciphering key features in protein structures with the new

ENDscript server. Nucleic Acids Res. 42, W320-324