Review

How Macrolide Antibiotics Work

Nora Vázquez-Laslop1,* and Alexander S. Mankin1,*

HighlightsRibosome-targeting macrolide antibio-tics were thought to simply plug thenascent peptide exit tunnel and inter-rupt the synthesis of any protein. How-ever, structural, biochemical, andgenome-wide studies have revealedthat macrolides are highly selectivemodulators of protein synthesis.

Macrolide molecules together withspecific nascent peptides in the ribo-somal tunnel allosterically affect thefunctional properties of the catalyticcenter of the ribosome.

The macrolide-bound ribosome isunable to polymerize specific aminoacid sequences in the nascent protein.

Programmed translation arrest thatcontrols the expression of macrolideresistance genes exploits the con-text-specific action of macrolides.

The principles of the interplay betweenmacrolides and nascent peptides thatmodulate the functions of theribosome may apply to translationalcontrol exerted by other smallmolecules that interact with theribosome.

1Center for Biomolecular Sciences,University of Illinois at Chicago,Chicago, IL 60607, USA

*Correspondence:nvazquez@uic.edu (N. Vázquez-Laslop)and shura@uic.edu (A.S. Mankin).

In memory of Prof. Charles Yanofsky (1925–2018) whose work has been aninspiration.

Macrolide antibiotics inhibit protein synthesis by targeting the bacterialribosome. They bind at the nascent peptide exit tunnel and partially occlude it.Thus, macrolides have been viewed as ‘tunnel plugs’ that stop the synthesis ofevery protein. More recent evidence, however, demonstrates that macrolidesselectively inhibit the translation of a subset of cellular proteins, and that theiraction crucially depends on the nascent protein sequence and on the antibioticstructure. Therefore, macrolides emerge as modulators of translation rather thanas global inhibitors of protein synthesis. The context-specific action of macro-lides is the basis for regulating the expressionof resistancegenes.Understandingthe details of the mechanism of macrolide action may inform rational design ofnew drugs and unveil important principles of translation regulation.

Understanding the Mechanisms of Antibiotic Action Is Necessary for theDevelopment of Better Drugs and New Tools for Fundamental ResearchAntibiotics, the drugs that help to cure infectious diseases caused by bacterial pathogens, havesaved countless lives. Unfortunately, the excessive use of antibacterials in the clinic, veterinarymedicine, and farming has led to the development of resistance. Searching for new drugs willbe necessary to combat the spread of pathogens resistant to the available antibiotics. It isequally crucial to understand the mechanistic basis of action of currently used antibioticsbecause this could lead to rational, innovative strategies for designing more efficient treat-ments. In addition, knowing how antibiotics work may contribute to their use as tools forunraveling the basic mechanisms of translation.

The ribosome, which is responsible for the synthesis of all cellular proteins, is one of the bestantibiotic targets. Many antibacterials inhibit cell growth by interfering with ribosome functions[1,2]. Among them are the macrolides, which have been used medically for more than sixdecades. However, we are only starting to understand the true mode of action of theseantibiotics. Recent advances have revealed that, instead of being simple inhibitors of proteinsynthesis, ribosome-targeting macrolides are modulators of translation. By deciphering howmacrolides exploit the vulnerabilities of the protein synthesis apparatus we may find new waysto develop better drugs and uncover fundamental aspects of the ribosomal response toenvironmental cues.

The Classic Model of Macrolide Action Needs RevisionMacrolide antibiotics (Box 1) inhibit protein synthesis by targeting the nascent peptide exittunnel (NPET; see Glossary) of the bacterial ribosome (Box 2). The NPET, which is approxi-mately 100 Å in length and 10–20 Å wide, is a passageway through which the synthesizedprotein leaves the ribosome. Traditionally, it has been thought that macrolides stop translationsimply by clogging the NPET, thereby blocking the passage of all the newly made polypeptidesonce they grow to the size of 3–10 amino acids [3–7]. To some extent this view has been

668 Trends in Biochemical Sciences, September 2018, Vol. 43, No. 9 https://doi.org/10.1016/j.tibs.2018.06.011

© 2018 Elsevier Ltd. All rights reserved.

GlossaryCryo-electron microscopy (cryo-EM): a technique that allows thestructures of biomolecules to bestudied by capturing them atcryogenic temperatures.Erythromycin-resistancemethyltransferases (Erms):enzymes that mono- or dimethylatenucleotide A2058 of 23S ribosomalRNA (E. coli numbering), precludingbinding of macrolides to the targetsite. Their activity in pathogenicbacterial strains constitutes one ofthe main resistance mechanismsagainst the macrolides and two otherfamilies of NPET-binding antibiotics.Leader ORF: a short open readingframe (ORF) located upstream of aninducible resistance gene; theexpression of the resistance gene isoften controlled by programmedtranslation arrest within this ORF.Macrolide arrest motifs (MAMs):amino acid sequences that themacrolide-bound ribosome is unableto efficiently polymerize.Nascent peptide exit tunnel(NPET): a void channel spanning thebody of the large ribosomal subunitthrough which the proteinpolymerized in the PTC is threadedto then leave the ribosome.Peptidyl transferase center (PTC):located in the large ribosomalsubunit, the active site of the PTCcatalyzes the formation of peptidebonds between the C-terminal aminoacid of the nascent peptide and theincoming amino acid.Ribo-seq: a technique, also knownas ‘ribosome profiling’, that allowsvisualization of the distribution oftranslating ribosomes along mRNAsin the living cell.

supported by structural studies showing that a macrolide molecule bound in the NPETsignificantly narrows the tunnel (Figure 1A–C). The ‘plug-in-the-bottle’ model was alsocompatible with in vitro experiments showing that translation of some artificial mRNAs inthe presence of erythromycin (ERY) resulted in the accumulation of peptidyl-tRNAs carryingshort peptides, indicative of interruption of translation in its early rounds [7,8]. Peptidyl-tRNAaccumulation was also observed in macrolide-treated cells [9].

However, in the past several years the simplistic view of macrolides acting as mere plugs of theNPET has been significantly transformed. New data have shown that these antibiotics allowpassage of some nascent peptides through the NPET and can interfere with synthesis of aprotein in a context-specific manner. We highlight here the recent findings that have formed thebasis for our current understanding of how macrolides can selectively inhibit protein synthesisand act as modulators of translation.

Macrolides Do Not Stop Global Translation but Inhibit the Synthesis of aSubset of ProteinsOne striking observation that could not be easily explained by the traditional model of macrolideaction was that protein synthesis is not completely inhibited even in cells exposed to very highconcentrations of macrolides – exceeding by many-fold the minimal inhibitory concentration (MIC)that prevents cell growth. For example, in Escherichia coli cells treated with 100-fold MIC of ERY,5–7% of total protein continues to be synthesized, whereas �25% of translation persists in cellsexposed to equivalent concentrations of telithromycin (TEL) [10], or as high as 40% with pikromycin(PKM) [11]. Remarkably, instead of equally curtailing the synthesis of all proteins, macrolides virtuallyabolish the production of several specific polypeptides, whereas some others continue to betranslated at levels comparable to those in untreated cells (Figure 1E) [10,11]. These findings werein line with earlier observations that the extent of macrolide inhibition varied dramatically for differentreporter proteins used in in vitro experiments [4,12].

A key feature of macrolide action emerged from these results: instead of being global inhibitorsof translation, macrolides selectively interfere with the production of a subset of proteins.

What Distinguishes Macrolide-Sensitive from Macrolide-Resistant Proteins?It has been known that specific short peptides synthesized by the ribosome are able tocotranslationally eject a macrolide molecule from its binding site in the NPET [13–16]. Byanalogy, if the N-terminal sequence of a cellular protein can dislodge the antibiotic from theribosome, the evicted antibiotic would not be able to rebind until translation of the protein iscomplete because the NPET of the elongating ribosome is occupied by a growing polypeptide[4,17]. The key postulate of this drug-eviction model is that resistant proteins are synthesized bythe drug-free ribosome.

While the eviction model is attractive and may contribute to the selective escape of somepolypeptides, biochemical evidence strongly argues that the synthesis of many, possibly most,cellular proteins resistant to macrolides occurs on ribosomes that retain the antibioticmolecules [10]. Although ostensibly controversial, this possibility is compatible with the knownX-ray structures of the macrolide-bound ribosome, showing that the aperture of the drug-obstructed NPET is in fact wide enough to allow unfolded nascent proteins to be threadedthrough [6,18]. The more recent structures of the ERY-bound translating ribosome carrying anascent peptide clearly demonstrate that a protein chain can be fairly comfortably accommo-dated in the NPET together with the antibiotic [19–21] (Figure 1D). These findings have validated

Trends in Biochemical Sciences, September 2018, Vol. 43, No. 9 669

Box 1. Macrolides: Chemical Structure and Brief History

A macrolactone ring, which can range in size from 12 to 16 atoms, forms the core of the ribosome-binding macrolide antibiotics. Most of the clinically relevantmacrolides contain a 14 (e.g., ERY and clarithromycin) or 15 atom (AZI) core (Figure I). The side chains appended to the macrolactone define many importantbiological and clinical properties of macrolides. Specific sugar residues are usually linked at the C3 and C5 positions of the ring. For example, ERY contains C3cladinose and C5 desosamine. In clinical (e.g., TEL) and natural (e.g., PKM) ketolides (Figure I), the C3 sugar is substituted by a keto group (hence the name of theclass). The most active semisynthetic ketolides also carry an extended alkyl-aryl side chain whose presence is important for activity and whose attachment site differsamong different drugs [79–81].

Macrolides are among the oldest and most clinically successful ribosome-targeting antibiotics. The prototype macrolide, erythromycin A (Figure I), was discoveredmore than 65 years ago and has been used clinically since the 1950s [82]. Macrolides of the second generation (e.g., clarithromycin, roxithromycin, and AZI), thatwere developed in the 1980s, exhibit improved pharmacological properties [83]. Subsequent spread of resistance spurred the advancement of a newer generation ofmacrolides, called the ketolides, such as TEL (Figure I) or solithromycin, that showed enhanced activity against some of the resistant strains. Although side effectsassociated with their toxicity have so far precluded the broad clinical use of ketolides, their high antibacterial potency keeps them in the crosshairs of ongoing drugdiscovery efforts [84–86]. A recent breakthrough in the combinatorial chemical synthesis of macrolides raises new hopes of finding a diverse array of even morepotent derivatives [87].

Erythromycin (ERY)

O

OO

O

O

HOOH

OH

O

OHO

N

OH

O

1 2 34

6

87

9

11

12

10

14

13 5

Cladinose

Desosamine

Macrolactone

Pikromycin (PKM)Telithromycin (TEL)

O

O O

O

O

HO

O

O O

O

O

O

OHO

NON

O

N

N

NAlkyl-aryl side chain

OHO

N

OHO

N

O

OO

O

HOOH

OH

O

OHO

N

OH

O

N

Azithromycin (AZI)

Figure I. Structures of Clinically Relevant and Natural Macrolides.

a seemingly heretic proposal, expressed by Weisblum more than two decades ago, that somenascent peptides could potentially slip through the macrolide-obstructed exit tunnel [22].

If the macrolide molecule does not stop the growing protein from advancing through the NPET,then why do macrolides prevent the translation of so many proteins? The answer to thisquestion came from ribosome profiling (ribo-seq) experiments that provided the key

Box 2. The Target of Macrolide Antibiotics Is the Bacterial Ribosome

The ribosome is composed of two subunits, small and large (30S and 50S, respectively, in bacteria) (Figure I). The small subunit is in charge of decoding the geneticinformation encoded in mRNAs while the large subunit is responsible for polymerizing amino acids into proteins. The ribosome contains three tRNA binding sites: thegrowing protein chain is attached to the tRNA located in the P (peptidyl) site, while the incoming amino acid is delivered to the ribosome by aminoacyl-tRNA that bindsin the A (aminoacyl) site. On its way out of the ribosome, the deacylated tRNA resides in the E (exit) site (not shown in Figure I). Addition of individual amino acids to thegrowing protein is catalyzed in the PTC of the large ribosomal subunit. Formation of a new peptide bond occurs as the result of nucleophilic attack of the A-site aminoacid onto the carbonyl carbon atom of the ester bond linking the nascent peptide to the P-site tRNA (Figure I). The efficiency of peptide bond formation depends onthe nature of the donor and acceptor substrates participating in the reaction [88,89]. The elongating protein is threaded through the NPET on its way out to thecytoplasm (Figure I). Instead of being a passive passageway, the NPET is a functionally important compartment that is capable of sensing the structure of the growingprotein and modulating ribosome function in response not only to the peptide sequence but also to cues from the environment [18,90,91]. It is here in the NPET wheremacrolides bind, at a short distance from the PTC [6,78,92–94].

670 Trends in Biochemical Sciences, September 2018, Vol. 43, No. 9

PPA

50S50S

30S30S

NPETNPETPTCPTC

50S50S30S30SNPETNPET

PTCPTC

mRNAmRNAmRNAmRNAP

A

O

HOHO O

O

O

O

O

:

PA

Nascentpep de

NHNH2

N

N

N

N

NHRN+1RN H2N

HOHO

N

N

NHNH2

N

N

PTCPTC

30S50S

30S 50S

Figure I. Bacterial Ribosome Structure and the Peptidyl Transferase Reaction.

breakthrough in our understanding of the mechanism that underlies the protein specificity ofmacrolides. Ribo-seq technology shows the distribution of ribosomes along translated mRNAs:peaks of ribosome density build up at the codons where translation slows down, whereas thecodons that are traversed faster have fewer ribosomes associated with them [23] (Figure 2A).

Trends in Biochemical Sciences, September 2018, Vol. 43, No. 9 671

TELERYNo drug PKM

NascentNascentpep depep de

ERYERY

P

A

50S50S30S30S

NPETNPET

PTCPTC

ERYERY

NPETNPET

(A)

(E)

P A

A2058A2058A2059A2059

C2610C2610

L4L4

L22L22

U2609U2609

A752A752

(B) (C)

MacrolactoneMacrolactone

CladinoseCladinoseDesosamineDesosamine

(D)

Alkyl-arylAlkyl-arylside chainside chain

Figure 1. Macrolides Narrow the Nascent Peptide Exit Tunnel (NPET) but Allow the Synthesis of Some Proteins. (A) The macrolide binding site in thebacterial ribosome. A cross-cut of the ribosome showing the A (aminoacyl) and P (peptidyl)-site tRNAs (orange and blue, respectively) and a segment of mRNA(magenta). Erythromycin (ERY; green) and all the other macrolides bind in the NPET at a short distance from the peptidyl transferase center (PTC). (B) The macrolidebinding site is composed primarily of rRNA. The macrolactone ring of different macrolides (for comparison, the structures of ERY, green, and TEL, blue, have beensuperimposed) lies flat against the NPET wall, and the C3 and C5 sugars protrude towards the PTC but do not reach its active site. C5 desosamine interacts with thesplayed-out A2058 and A2059 rRNA residues in the NPET. C2610 nucleotide contacts C3 cladinose (present in ERY, but lacking in telithromycin, TEL). The alkyl-arylside chain of ketolides, such as TEL, usually extends away from the PTC: in E. coli, it interacts with the A752–U2609 base pair, but its placement may differ in otherbacteria [74,75,78]. The loops of proteins L4 and L22, which form a constriction in the NPET, may directly interact with the side chains of some macrolides [76]. (C) Viewinto the NPET from the PTC showing that the macrolide (ERY) narrows the aperture of the tunnel. (D) The remaining opening of the NPET is nevertheless wide enough fora nascent peptide to be threaded through. (E) Specific proteins are synthesized in macrolide-treated cells. Gel electrophoresis analysis of radiolabeled proteinstranslated in E. coli cells in the absence of antibiotics (No drug), in the presence of high concentrations of ERY, semi-synthetic ketolide TEL, or the natural ketolidepikromycin (PKM).

By comparing the distribution of ribosomes on mRNAs in untreated and drug-exposed cells, itis possible to determine not only whether the antibiotic abolishes translation of a gene but alsoat which specific mRNA codon(s) the translation is arrested.

672 Trends in Biochemical Sciences, September 2018, Vol. 43, No. 9

argS

No drug

ERY

TEL

rpmC

Arg Val LysArg Glu Lys

hns

No drug

ERY

TEL

TEL ERY

Arg-Met-Arg

Pro-Asp-Lys

Arg-Tyr-Arg

Arg-Leu-Arg

Arg-Lys-Arg

Lys-Asp-Lys

Arg-Asp-Arg

Arg-Glu-Arg

Arg-Ile-Arg

Arg-Phe-Arg

Ile-Arg-Pro

Arg-Pro-Arg

Arg-Lys-Pro

Lys-Asp-Lys

Arg-Tyr-Arg

Lys-Ile-Pro

Val-Asp-Lys

Lys-Pro-Arg

Ile-Lys-Pro

Pro-Asp-Lys

+ X +X Asp LysX + Pro

Macrolides inducesite-specific arrest

Not all proteins areinhibited by macrolides

Macrolide arrest mo fs(MAMs)

(A) (B) (C)

(D)

Figure 2. Macrolides Arrest the Ribosome at Specific mRNA Codons. (A) Treatment of E. coli cells with high concentrations of erythromycin (ERY) ortelithromycin (TEL) leads to dramatic redistribution of ribosomes along mRNAs was arrested at a few distinct sites throughout their length (illustrated by ribosomedensities along the mRNA of the representative gene argS). The discrete peaks of ribosome density at specific codons of argS in ERY- or TEL-treated cells reflectcontext-specific translation arrest [24,25]. (B) Some open reading frames (ORFs) are completely translated in macrolide-treated cells. Ribosome density along themRNA of the representative gene hns in cells treated with TEL reveals that HN-S is one protein that is fully translated in the presence of this antibiotic (Figure 1D). (C) Aribosome with bound macrolide struggles to polymerize specific sequences, the macrolide arrest motifs (MAMs). The table lists the 10 most prevalent MAMs enriched insites of translation arrest in TEL- and ERY-treated cells [25]. The consensus sequences of the common MAMs are listed underneath the table (X indicates any aminoacid, + indicates Arg or Lys). (D) Translation arrest at a MAM can be influenced by a more extended context, likely involving other segments of the nascent protein chain.The example shown illustrates how TEL-bound ribosomes could easily translate through the usually problematic Arg-Glu-Lys sequence (a MAM of the +X+ type) withinthe early codons of rpmC, but became arrested at the second +X+ MAM (Arg-Val-Lys) located towards the end of the ORF.

Trends in Biochemical Sciences, September 2018, Vol. 43, No. 9 673

Ribo-seq analysis showed that translation of nearly 80% of the genes in macrolide-treated cellsproceeds beyond the early codons [24,25], demonstrating that early interruption of proteinelongation could be a contributing factor, but is clearly not the main mode of macrolide action.The most remarkable finding, however, was that translation of many mRNAs was arrested at afew distinct sites throughout their length (Figure 2A,B). Analysis of the sites of the mostpronounced drug-induced translational arrest showed that they are defined by specificsequence signatures [24,25], which we will refer to as macrolide arrest motifs (MAMs)(Figure 2C). The macrolide-bound ribosome stalls when it needs to polymerize the amino acidsequence of a MAM. Because the stalled ribosome peaks could be found anywhere within theopen reading frames (ORFs), drug-arrested ribosomes often carry nascent polypeptides thatspan the entire length of the NPET. This result corroborated the structural and biochemicalevidence that the growing protein can coexist with the macrolide molecule in the NPET of thetranslating ribosome (Figure 1D).

If a protein lacks MAMs, translation of its gene remains essentially impervious to the macrolidepresence [10,11] (Figure 1E) and high ribosome density is observed along the entire length ofthe ORF [24,25] (Figure 2B).

Ribo-seq data pointed to another important aspect of macrolide action. Although all ribosome-targeting macrolides bind to the same site in the NPET (Figure 1B), the specificity of actioncrucially depends on their chemical structure. As a result, the sites of translation arrests and thespectra of the affected proteins vary in cells treated with different macrolides. The Lys/Arg-X-Lys/Arg motif accounts for nearly 80% of the strongest ketolide arrest sites, but cladinose-containing ERY or azithromycin (AZI) inhibit translation not only at this motif but at a wider arrayof MAMs (Figure 2C). The broader the variety of MAMs, the higher the chance that a protein willcontain at least one of them. For this reason, ERY and AZI preclude the synthesis of moreproteins (Figure 1C), whereas ketolides emerge as more selective inhibitors of translation thatallow more proteins to be synthesized. By rationally modifying the structural features of thedrugs, it is hypothetically possible not only to control the affinity or kinetics of drug–ribosomeinteractions [26] but also to modulate the spectrum of proteins whose translation is inhibited bythe antibiotic.

Implications of the Dynamics of Antibiotic–Ribosome Interactions for theMechanism of Macrolide ActionThe understanding that the nascent chain can coexist in the NPET with the macrolide molecule(Figure 2A,D) changes our perception of the dynamics of drug–ribosome interactions. Becausethe entrance into the NPET from the peptidyl transferase center (PTC) (Box 2) side is toonarrow, it has been suggested that macrolides access their binding site by diffusing through thetunnel from its exit [27]. When the NPET is vacant, the bound inhibitor can freely exchange withthe unbound drug and exist in dynamic equilibrium with the antibiotic in the cell cytoplasm.However, when the ribosome is engaged in translation, the nascent protein, advancing throughthe NPET, will eventually trap the macrolide molecule, making its departure impossible. Theefficiency of antibiotic trapping is determined by the rates of the nascent peptide advancementthrough the NPET, drug dissociation, and peptidyl-tRNA drop-off [28]; all these kinetic param-eters may depend on the nature of the synthesized protein. Once the N-terminus of the growingprotein chain has bypassed the macrolide molecule, it should hinder antibiotic dissociation bynarrowing the NPET constriction formed by the loops of ribosomal proteins L4 and L22(Figure 1B). Only upon release of the completed protein will the drug regain its ability to beexchanged with the cytoplasm. The duration of the antibiotic trapping could be significantlyextended when translation is arrested at a MAM, possibly accounting, at least in part, for the

674 Trends in Biochemical Sciences, September 2018, Vol. 43, No. 9

prolonged post-antibiotic effects of some macrolides [29,30]. Although ribo-seq data andsingle-molecule fluorescence studies show that translation arrest at a MAM is transient[24,25,31], we know very little about the kinetics of macrolide-induced ribosome stalling.

The dynamics of the drug–ribosome interaction may have important practical implications.Depending on their structure, macrolides can significantly vary in their ability to simply stop cellsfrom growing (and thus act as bacteriostatic drugs) or actively kill bacteria, preventing theirregrowth upon removal of the antibiotic (thereby acting as bactericidal agents) [32]. Recentstudies have shown that the kinetics of binding and dissociation from the ribosome rather thanmere affinity is the crucial parameter that distinguishes between bacteriostatic and bactericidalmacrolides [26]. Drugs that lack an extended alky-aryl side chain, such as that seen in thestructure of TEL (Box 1), rapidly vacate the ribosome and exhibit primarily bacteriostatic action,whereas antibiotics that carry such an appendage exhibit much slower dissociation kineticsthat correlate with their bactericidal activity [26]. Therefore, taking into account not only theaffinity of macrolides for the ribosome, but also the dynamics of their interaction with the target,should guide future efforts for improving drug-treatment regimens.

Macrolides as Modulators of Peptide Bond FormationOne of the most unexpected aspects of macrolide action is that the MAM is not juxtaposed withthe macrolide molecule in the NPET at the moment of translation arrest. Instead, the ribosomestalls when the MAM residues are positioned at the PTC – and thus are too distant to establishextensive direct contacts with the antibiotic molecule (Figure 3). This means that the MAMsequence presents a problem not because it is simply stuck in the drug-obstructed NPET butbecause the macrolide-bound ribosome is unable to polymerize it. Protein synthesis stopsbecause macrolides prevent the ribosome from catalyzing peptide bond formation (Box 2)between the MAM residues [21,33–35], as has been also shown previously for specificcombinations of artificial donor and acceptor substrates [36–38] (Figure 3A–C). Therefore,instead of being simple tunnel plugs, macrolide antibiotics emerge as context-specific inhibitorsof peptide bond formation.

We are only starting to understand why polymerizing particular sequence motifs is difficult forthe macrolide-bound ribosome. Biochemical experiments have shown that the positive chargeof the key amino acids of the Lys/Arg-X-Lys/Arg motif accounts for its problematic nature;hence, this MAM is referred to as the +X+ motif [35]. Consistently, macrolides do not usuallydisrupt polymerization of the sequence Asp/Glu-X-Asp/Glu, where the charges of the mainresidues of the motif are reversed [35]. However, not only the charge but also the length of theArg and Lys side chains, the longest among the 20 canonical amino acids, is important fortranslation arrest. In fact, replacing the Lys residue of the Arg-X-Lys sequence with amino-alanine, which carries a positively charged but relatively short side chain, lessens the ability ofthe macrolides to inhibit peptide bond formation [35].

In the absence of a high-resolution structure of the translation complex stalled at the +X+ MAM,we can only speculate as to why polymerizing this sequence is difficult for the macrolide-boundribosome (Figure 3A). However, cryo-electron microscopy (cryo-EM) has provided impor-tant insights into macrolide-dependent ribosome stalling at some other MAMs (Figure 3B–D).Most of these studies have been carried out using regulatory ORFs of macrolide resistancegenes that contain strategically placed MAMs directing programmed ribosome stalling (seesection below). Analysis of the ERY-bound ribosome stalled at the MAMs encoded in theermBL and ermCL ORFs showed that the nascent peptide, whose placement in the NPET isconstrained by the antibiotic, could be actively involved in the stalling mechanism [19–21]. The

Trends in Biochemical Sciences, September 2018, Vol. 43, No. 9 675

I

VI

FR

VD K

++

Ile Phe Val IleIle Phe Val Ile(ErmCL)(ErmCL)

X Asp LysX Asp Lys(ErmBL)(ErmBL)

+ X X +

ERYERY

ErmBLErmBLErmCLErmCL

(B) (C)(A) (D)

Figure 3. Macrolides Are Selective Modulators of the Peptidyl Transferase Center (PTC). The interplay between the macrolide molecule (green star) and anascent peptide containing a macrolide arrest motif (MAM) alters the properties of the PTC and inhibits peptide bond formation. In (A–C) the residues crucial for stallingare colored, and in (B,C) are indicated with the single-letter code. (A) Stalling at the +X+ MAM may occur because the macrolide orients the lengthy, positively chargedside chain of the penultimate amino acid of the nascent peptide toward the PTC A (aminoacyl) site, preventing accommodation of the similarly long and positivelycharged acceptor amino acid. (B) The macrolide imposes an unfavorable orientation on the C-terminal Asp residue of the ErmBL peptide that contains the X-Asp-LysMAM [19,21]. The placement of the acceptor Lys in the A site is also suboptimal. The orientation of several key PTC nucleotides is altered in the stalled ribosome. Themobility of the nascent peptide in the nascent peptide exit tunnel (NPET) is restricted owing to the presence of the antibiotic and specific interactions of the Arg residue ofthe nascent chain with rRNA of the tunnel wall. (C) Interactions between the ErmCL nascent chain and NPET nucleotides and the antibiotic misplace the C-terminalresidue of the peptide in the PTC [20]. The adverse conformation of the PTC nucleotides prevents accommodation of the A site amino acid [20,72]. (D). The differentialplacement of ErmBL and ErmCL nascent peptides in the NPET of the erythromycin (ERY)-stalled ribosome shows that the peptide trajectory depends on the amino acidsequence.

idiosyncratic trajectory of ErmBL translation causes the misplacement and reorientation of itsC-terminal residue in the PTC, and this is expected to impede the catalysis of peptide bondformation [19] (Figure 3B). Similarly, the C-terminal residue of ErmCL also appears to bedisplaced in the PTC of the macrolide-bound ribosome [20] (Figure 3B). Because the trajectoryof the nascent chain in the drug-obstructed NPET is dictated by the amino acid sequence of thepeptide (Figure 3D) [19–21], not only the MAM (which is mostly confined to the PTC) but alsomore distant segments of the growing protein are likely to modulate the efficiency of stalling.This conclusion resonates well with the results of ribo-seq studies showing that not everypotential MAM causes translation arrest [24,25] (Figure 2D).

The analysis of the macrolide-stalled ribosomal complexes consistently showed rearrangementof nucleotides in the PTC active site (e.g., U2585), whose conformations in the drug-arrestedribosome are likely incompatible with the efficient catalysis of peptide bond formation [19–21](Figure 3B,C). Importantly, even binding of a macrolide molecule to the vacant ribosome canalready allosterically induce changes in the structure of the PTC [39]. Thus, the ribosome is likelyable to integrate the signals generated by the nascent peptide and the antibiotic stallingcofactor [40,41]. Although illuminating, the available cryo-EM reconstructions still lack animportant control: the structure of a macrolide-bound ribosome with a nascent chain lackinga MAM. In the absence of such a reference, it is impossible to conclude which of the manyidiosyncrasies observed in the stalled ribosome complex are directly pertinent to drug-inducedtranslation arrest.

676 Trends in Biochemical Sciences, September 2018, Vol. 43, No. 9

However, overall, the understanding that macrolides are context-specific ribosome modulatorsleads to a concise model for the mechanism of action of these drugs, where the fate of theprotein to be synthesized by the macrolide-bound ribosome is defined by its amino acidsequence (Figure 4, Key Figure).

The Context-Specificity of Macrolide Action Controls Inducible ResistanceOne of the most important mechanisms of resistance to macrolide antibiotics is modification ofa 23S rRNA adenine residue (A2058 in E. coli) in the macrolide binding site (Figure 1B) [42,43].Methylation of this nucleotide, catalyzed by erythromycin-resistance methyltransferases(Erms), precludes antibiotic binding. However, the resistance conferred by A2058 methylationcomes at a cost: it affects the translation of some proteins, skews the cellular proteome, andresults in reduced cell fitness [44].

An elegant mechanism, based on programmed translation arrest, reduces the fitness cost ofresistance by allowing activation of the corresponding genes only when cells are under

Key Figure

A General Model of Macrolide Action on Protein Synthesis

I

II

III

Sensi veprotein

Resistantprotein

Resistantprotein

MAM MAM

??

Figure 4. Translation of any protein can be initiated by the macrolide (green star)-bound ribosome, and the N-termini of the majority of polypeptides can be threadedthrough the drug-obstructed nascent peptide exit tunnel (NPET). The subsequent fate of the protein being synthesized depends on its sequence and the structure of thebound antibiotic. (I) Translation of sensitive proteins is interrupted because the drug-bound ribosome is unable to efficiently catalyze peptide bond formation duringsynthesis of the macrolide arrest motif (MAM) sequence. The structure of the macrolide molecule bound in the NPET dictates the spectrum of the MAM sequences, andtherefore defines which proteins will be inhibited. If translation is arrested close to the start of the open reading frame (ORF), when the nascent peptide is short(<10 amino acids), the peptidyl-tRNA likely dissociates from the ribosome (an effect known as peptidyl-tRNA drop-off) [7,8,77]. (II) If the protein sequence lacks MAMs,its translation will proceed unimpeded and the full-size protein will be produced in the cell exposed to the antibiotic. (III) Hypothetically, some proteins might be able todislodge the antibiotic from the ribosome at the early stages of translation; in this case the drug-free ribosome completes the synthesis of such protein. Antibiotic evictionhas been observed with some artificial short peptides [13–16], but has not yet been demonstrated for cellular polypeptides; however, this scenario remains a possibilityfor at least some of the bacterial proteins.

Trends in Biochemical Sciences, September 2018, Vol. 43, No. 9 677

antibiotic threat [45,46]. In the absence of the antibiotic, inducible macrolide resistance genesare translationally or transcriptionally repressed due to unfavorable mRNA folding (Figure 5A)[47,48]. The presence of the macrolide directs programmed ribosome stalling at a specificcodon of the short upstream ORF (leader ORF), and stalling at this site triggers mRNA refoldingand activation of the expression of the resistance gene [42] (Figure 5A). The sequence of theleader ORFs and the spectra of the inducing macrolide antibiotics vary between differentresistance genes [42,49–51].

Although the general operation of the induction mechanism was elucidated several decadesago (reviewed in [42,51]), key questions remained unanswered. Why is translation arrested atone specific codon of the leader ORF? How could the macrolide-bound ribosome even reachthe site of productive translation arrest? Why are different Erm resistance genes induced bydifferent antibiotics? The now-understood context-specificity of macrolide action providesanswers to these questions because the leader ORFs encode peptides with strategicallyplaced MAMs. The locations of MAMs within the leader peptide sequences have beenevolutionarily optimized to arrest translation specifically at the codons where the stalledribosome can induce the ‘ON’ conformation of the mRNA (Figure 5B). The leader ORFs ofmany macrolide resistance genes encode the +X+ motif [39,50,52]. Leader ORFs of otherresistance genes may carry different MAMs identified by ribo-seq experiments [20,53](Figure 2B). The nature of the MAM in the leader ORF-encoded peptide defines the spectrumof macrolides that can act as inducers of resistance [40,49,54]. It is hypothetically possible toengineer macrolides that, while being able to inhibit synthesis of some proteins, would notinduce ribosome stalling at MAMs of regulatory genes, thereby avoiding activation ofresistance.

Macrolides Can Induce Miscoding and Ribosomal FrameshiftingIn addition to the ability of macrolides to stall the ribosome within specific sequence contexts, aless-appreciated property of these drugs is their capacity to induce translation errors [55].Although the nature of these effects is unclear, it is conceivable that inhibition of PTC functions(peptide bond formation or peptide release) resulting in an altered kinetics of translation couldincrease the chance of faulty events such as accommodation in the A site of a near-cognateaminoacyl-tRNA.

Macrolides can also stimulate ribosomal frameshifting. Interestingly, this activity accounts for anunconventional scenario of induction of resistance [56]. Cladinose-containing macrolides (e.g.,ERY) activate expression of the ermC resistance gene via programmed translation arrest at theIle-9 codon of the 19-codon ermCL leader ORF [33,45,46] (Figure 5A). Ketolides (e.g., TEL) donot direct stalling at ermCL MAM [33,40,57] but are nevertheless capable of inducing ermC,albeit with a lower efficiency compared to ERY [58]. This unconventional induction mechanismexploits the ability of the ribosome with bound TEL to reach the end of the ermCL leader ORF,where it slips to the (�1) frame (Figure 5C). Continuous translation through the ermCL–ermCintergenic region results in activation of the resistance gene [56]. Two aspects of macrolideaction, the drug-specificity of the ribosomal response to MAMs and the ability of macrolides toprovoke translation errors, make this unexpected induction scheme possible.

The overall contribution of macrolide-induced miscoding to the antibacterial action of theseantibiotics remains to be elucidated.

678 Trends in Biochemical Sciences, September 2018, Vol. 43, No. 9

Leader ORF

Resistance gene

'Off'

Leader ORF

Resistance gene

Transla onarrest

'On'

AUGAUGUUGGUAUUCCAAAUGCGUAAUCUAGAUAAAACAUCUACUGUUUUGAAACAGACUAAAAACAGUGAUUACGCAGAUAAAUAAUAAM KDNRQFL VMV T S IT L K TQ *DAYDSNK KermBL

AUGAUGACACACUCAAUGAGACUUCGUUUCCCAAUUACUUUGAACCAGUAAUAAM IPRLMST FRH T L QN *ermDL

(A)

(B)

(C)

ermCL ermC

Frameshi ing

AUGGGCAUUUUUAGUAUUUUUGUAAUCAGCACAGUUCAUUAUCAACCAAACAAAAAAUAAM TSVFSFG III V H QY P N KK *

TEL

Figure 5.

(Figure legend continued on the bottom of the next page.)

Inducible Resistance Exploits the Context-Specific Action of Macrolides. (A) In an inducible macrolide-resistance operon, the resistance gene ispreceded by a regulatory leader open reading frame (ORF). In the absence of antibiotic, the leader ORF is translated while the resistance gene is not expressed because

Trends in Biochemical Sciences, September 2018, Vol. 43, No. 9 679

The Mechanism of Macrolide Action Reflects the Ability of the Ribosome toFunction as a Small-Molecule SensorRibosome stalling at specific MAMs in response to different macrolides is only one manifesta-tion of a more general phenomenon: modulation of translation by small molecules. Importantly,the capacity of the ribosome to recognize and respond to specific small molecules is uniquelymodulated by the properties of the nascent protein. This ribosomal feature is vividly illustratedby mutations of the ErmBL peptide: by changing a single amino acid in the X-Asp-Lys MAM ofErmBL, it is possible to direct ribosome stalling, and hence activation of expression of thedownstream gene, in response to the presence of only cladinose-containing macrolides, onlyketolides, or of both types of drugs [59] (Figure 6A).

The ribosomal property to act as a small-molecule sensor is not limited to detecting onlyantibiotics: other molecules, which generally do not inhibit protein synthesis, can be recognizedin a similar fashion. For example, expression of the tna operon in several bacterial species isbased on recognition by the ribosome of elevated concentrations of L-tryptophan in the cell.Tryptophan sensing is aided by the TnaC nascent peptide and results in programmedtranslation arrest of the tnaC gene [60,61]. Although many details of tryptophan-inducedstalling remain unclear, the regulatory tryptophan molecule likely binds at (or close to) the siteof macrolide binding in the NPET [62,63] (Figure 6B), a crevice that has been proposed to serveas a binding pocket for different hydrophobic molecules [64]. Conceivably, specific amino acidsequences of nascent protein chains could facilitate binding and recognition of differenteffectors in this site. Furthermore, other binding sites in the NPET could be exploited bydifferent small molecules that are known to cooperate with nascent peptides in inducingprogrammed translation arrest (reviewed in [65]).

Regulating translation via the interplay between small molecules and nascent peptides mayextend beyond the bacterial ribosome. Although no antibiotics binding in the NPET of theeukaryotic cytoplasmic ribosome are currently known [66], a recent report of an inhibitor ofprotein PCSK9 involved in cholesterol homeostasis may represent the first such example[67,68]. The ribosome-targeting small molecule PF-06446846 selectively inhibits the trans-lation of only a handful of proteins in human cells, including PCSK9. Similarly to macro-lides, PF-06446846 binds in the NPET and cooperates with the nascent protein chain ininducing site-specific translation arrest [68,69]. Future studies will likely reveal many moreexamples of gene control mechanisms involving nascent peptide-assisted small-moleculesensing.

the ‘OFF’ conformation of the intergenic region of the mRNA precludes access to its translation initiation site. When macrolide is present, translation of the leader ORF isarrested at a specific codon within a macrolide arrest motif (MAM; red rectangle). The stalled ribosome rearranges the mRNA structure into the ‘ON’ conformation,releasing the initiation site of the resistance gene and activating its expression. The MAM location is optimal for the paused ribosome to activate isomerization of themRNA structure. In a similar scenario, ribosome stalling at the leader ORF can activate attenuated transcription of some of the resistance genes. (B) Programmedribosome arrest relies on the MAMs (dotted rectangle) encoded in the leader ORFs. The Val-Asp-Lys (the X-Asp-Lys MAM) is embedded in the ermBL gene, while theArg-Lys-Arg (the +X+ MAM), is found in ermDL. The codon where the ribosome stalls in the presence of antibiotic is indicated by an arrowhead. The amino acidsessential for programmed translation arrest are shown in red. (C) Macrolide-induced miscoding accounts for unorthodox induction of resistance. The ribosome withbound telithromycin (TEL, blue star) ignores the stall site within the ermCL ORF, where erythromycin (ERY) would arrest translation at the Ile-9 codon (red arrowhead) ofthe Ile-Phe-Val-Ile MAM (dotted rectangle). Therefore, the TEL-bound ribosome traverses the entire ermCL ORF and reaches its last two Lys codons with the sequenceAAA AAA (red), where TEL stimulates (�1) ribosomal frameshifting. Upon frameshifting, the 0-frame stop codon of the ermCL ORF is skipped and the ribosomecontinues translation through the intergenic region, dynamically unfolding the mRNA structure and releasing the translation initiation site of the resistance gene.

680 Trends in Biochemical Sciences, September 2018, Vol. 43, No. 9

Leader ORF lacZ

DAUGUUGGUAUUCCAAAUGCGUAAUGUAGAUAAA...M NRMQFVL V K ...

EAUGUUGGUAUUCCAAAUGCGUAAUGUAGAGAAA...M NRMQFVL V K ...

YAUGUUGGUAUUCCAAAUGCGUAAUGUAUACAAA...M NRMQFVL V K ...

VAUGUUGGUAUUCCAAAUGCGUAAUGUAGUGAAA...M NRMQFVL V K ...

TEL ERY

(A) (B)

Figure 6. Nascent Peptides Turn the Ribosome into a Small-Molecule Sensor. (A) Single amino acid changes in the ErmBL nascent peptide alter theribosomal response to structurally different macrolides. The reporter cassette in which the resistance gene was replaced with lacZ mimics an inducible erm resistanceoperon (Figure 5). Reporter induction is visualized by the green color of the cell lawn in the vicinity of an antibiotic-containing disk placed on the agar plate. Both ketolide(telithromycin, TEL) and cladinose-containing erythromycin (ERY) arrest ermBL translation and activate the reporter when the 10th codon (red) of ermBL specifies Asp(wild type). Changing the 10th codon to Glu preserves the response to ERY but eliminates the response to TEL. Tyr-10 allows the ribosome to respond exclusively toketolides. Val-10 precludes the response to either TEL or ERY. (B) The TnaC nascent peptide allows sensing of tryptophan. Activation of the tna operon depends onribosome stalling on the tnaC leader open reading frame (ORF) [60,61]. Structural studies of the TnaC-stalled ribosome suggest that one of the two tryptophanmolecules binds at the A2058/A2059 crevice (left image) [63], the same site that is exploited by macrolide antibiotics for binding to the ribosome (right image) [78].Similarly to the coordinated action of macrolides and nascent peptide in inducing translation arrest, the TnaC peptide cooperates with tryptophan to disrupt peptidyltransferase center (PTC) function and stall the ribosome at the last sense codon of the tnaC ORF.

Concluding RemarksThe NPET, whose existence was proposed decades ago [70], was initially viewed as afunctionally inert crawlway. Research during the recent years has shown that the NPET is adynamic and functionally important compartment that endows the ribosome with the ability tosense the nature of the protein it synthesizes and to respond to environmental cues, includingthe presence of specific small molecules. We now recognize the NPET as a hub for nascentprotein-based translation regulation.

The closely examined stalling scenarios involving small molecules differ in several importantdetails. However, a common theme is starting to emerge: the presence of a small-moleculecofactor and a specific nascent peptide is sensed in the NPET [40,60,71–73]. The cofactorbound to the ribosome restricts the freedom of movement of the growing protein, forcing it toadopt a specific trajectory. The nascent protein, locked in a defined conformation, and thecofactor molecule both engage specific elements of the NPET, and the integrated signal is thenrelayed to the PTC. Under the influence of the stalling signal, the properties of the PTC arealtered in such way that formation of peptide bonds between specific donor and acceptorsubstrates becomes inefficient.

In this common scheme of events, macrolide antibiotics, rather than being simple, non-selective protein synthesis inhibitors, represent one example of context-specific translation

Trends in Biochemical Sciences, September 2018, Vol. 43, No. 9 681

Outstanding QuestionsWhat is the kinetics of the macrolide-induced translation arrest? For howlong does the ribosome stall? Doesthe kinetics of macrolide-induced stall-ing depend on the structure of thebound antibiotic?

How does the extended context of thegrowing peptide in the NPET influenceribosome stalling at a MAM?

Can the N-terminal sequences ofsome proteins displace macrolide anti-biotics from their binding site in theNPET?

What features of the N-terminalsequence of the growing polypeptide

arrest cofactors. The spectrum of known macrolides, emerging approaches for the synthesis ofnovel derivatives, and new technologies for studying their effects on translation make this classof protein synthesis modulators an ideal model for unraveling the fundamental mechanisms ofnascent peptide-based translation control.

AcknowledgmentsWe wish to thank Yury Polikanov and Nikolay Aleksashin for help in the preparation of some figures and the analysis of

NPET characteristics. We thank Elizabeth Woods for proofreading the manuscript. We are in debt to former and current

members of our laboratory for their enthusiasm and dedication to studying the mechanisms of antibiotic action and for the

energy they bring to these studies. Antibiotic research in our laboratory is supported by National Institutes of Health grants

R01 AI125518 and R35 GM127134.

Conflict of InterestResearch in our laboratory was previously supported by, among other sources, grants from pharmaceutical companies

working on the development of macrolide antibiotics.

References

are conducive to early translationarrest and peptidyl-tRNA drop-off?

Are there cellular factors that are ableto rescue the macrolide-stalled ribo-some with the nascent polypeptidethreaded through the NPET?

Do MAMs represent generally prob-lematic sequences for polymerizationby the ribosome even in the absence ofantibiotic?

How do structural differences betweenthe NPETs of ribosomes of differentbacterial species affect the mode ofmacrolide action and the spectrumof MAMs?

What is the effect of macrolides onmitochondrial translation? Does thecontext specificity remain the sameas that seen in bacterial ribosomes?

Is it possible to adapt macrolide mol-ecules for context- and protein-spe-cific inhibition of cytoplasmictranslation in the eukaryotic (mamma-lian) cells?

1. Wilson, D.N. (2014) Ribosome-targeting antibiotics and mecha-nisms of bacterial resistance. Nat. Rev. Microbiol. 12, 35–48

2. Lin, J. et al. (2018) Ribosome-targeting antibiotics: modes ofaction, mechanisms of resistance, and implications for drugdesign. Annu. Rev. Biochem. 87, 451–478

3. Contreras, A. and Vazquez, D. (1977) Cooperative and antago-nistic interactions of peptidyl-tRNA and antibiotics with bacterialribosomes. Eur. J. Biochem. 74, 539–547

4. Odom, O.W. et al. (1991) The synthesis of polyphenylalanine onribosomes to which erythromycin is bound. Eur. J. Biochem. 198,713–722

5. Arevalo, M.A. et al. (1988) Protein components of the erythromy-cin binding site in bacterial ribosomes. J. Biol. Chem. 263, 58–63

6. Schlunzen, F. et al. (2001) Structural basis for the interaction ofantibiotics with the peptidyl transferase centre in eubacteria.Nature 413, 814–821

7. Tenson, T. et al. (2003) The mechanism of action of macrolides,lincosamides and streptogramin B reveals the nascent peptideexit path in the ribosome. J. Mol. Biol. 330, 1005–1014

8. Otaka, T. and Kaji, A. (1975) Release of (oligo) peptidyl-tRNA fromribosomes by erythromycin A. Proc. Natl. Acad. Sci. U. S. A. 72,2649–2652

9. Menninger, J.R. and Otto, D.P. (1982) Erythromycin, carbomycin,and spiramycin inhibit protein synthesis by stimulating thedissociation of peptidyl-tRNA from ribosomes. Antimicrob.Agents Chemother. 21, 810–818

10. Kannan, K. et al. (2012) Selective protein synthesis by ribosomeswith a drug-obstructed exit tunnel. Cell 151, 508–520

11. Almutairi, M.M. et al. (2017) Co-produced natural ketolidesmethymycin and pikromycin inhibit bacterial growth by preventingsynthesis of a limited number of proteins. Nucleic Acids Res. 45,9573–9582

12. Starosta, A.L. et al. (2010) Interplay between the ribosomaltunnel, nascent chain, and macrolides influences drug inhibition.Chem. Biol. 17, 504–514

13. Tenson, T. et al. (1997) Erythromycin resistance peptidesselected from random peptide libraries. J. Biol. Chem. 272,17425–17430

14. Tripathi, S. et al. (1998) Ketolide resistance conferred by shortpeptides. J. Biol. Chem. 273, 20073–20077

15. Vimberg, V. et al. (2004) Peptide-mediated macrolide resistancereveals possible specific interactions in the nascent peptide exittunnel. Mol. Microbiol. 54, 376–385

16. Lovmar, M. et al. (2006) The molecular mechanism of peptide-mediated erythromycin resistance. J. Biol. Chem. 281, 6742–6750

682 Trends in Biochemical Sciences, September 2018, Vol. 43, N

17. Tai, P.C. et al. (1974) Selective action of erythromycin on initiatingribosomes. Biochemistry 13, 4653–4659

18. Tu, D. et al. (2005) Structures of MLSBK antibiotics bound tomutated large ribosomal subunits provide a structural explanationfor resistance. Cell 121, 257–270

19. Arenz, S. et al. (2016) A combined cryo-EM and moleculardynamics approach reveals the mechanism of ErmBL-mediatedtranslation arrest. Nat. Commun. 7, 12026

20. Arenz, S. et al. (2014) Drug sensing by the ribosome inducestranslational arrest via active site perturbation. Mol. Cell 56, 446–452

21. Arenz, S. et al. (2014) Molecular basis for erythromycin-depen-dent ribosome stalling during translation of the ErmBL leaderpeptide. Nat. Commun. 5, 3501

22. Weisblum, B. (1995) Insights into erythromycin action from stud-ies of its activity as inducer of resistance. Antimicrob. AgentsChemother. 39, 797–805

23. Ingolia, N.T. et al. (2009) Genome-wide analysis in vivo of trans-lation with nucleotide resolution using ribosome profiling. Science324, 218–223

24. Davis, A.R. et al. (2014) Sequence selectivity of macrolide-inducedtranslational attenuation.Proc.Natl. Acad. Sci. U. S. A. 111,15379–15384

25. Kannan, K. et al. (2014) The general mode of translation inhibitionby macrolide antibiotics. Proc. Natl. Acad. Sci. U. S. A. 111,15958–15963

26. Svetlov, M.S. et al. (2017) Kinetics of drug–ribosome interactionsdefines the cidality of macrolide antibiotics. Proc. Natl. Acad. Sci.U. S. A. 114, 13673–13678

27. Lovmar, M. et al. (2009) Erythromycin resistance by L4/L22mutations and resistance masking by drug efflux pump defi-ciency. EMBO J. 28, 736–744

28. Lovmar, M. et al. (2004) Kinetics of macrolide action: the josa-mycin and erythromycin cases. J. Biol. Chem. 279, 53506–53515

29. Woosley, L.N. et al. (2010) CEM-101 activity against Gram-positive organisms. Antimicrob. Agents Chemother. 54,2182–2187

30. Zhanel, G.G. et al. (2002) The ketolides: a critical review. Drugs62, 1771–1804

31. Johansson, M. et al. (2014) Sequence-dependent elongationdynamics on macrolide-bound ribosomes. Cell Rep. 7, 1534–1546

32. Credito, K.L. et al. (1999) Activity of telithromycin (HMR 3647)against anaerobic bacteria compared to those of eight otheragents by time-kill methodology. Antimicrob. Agents Chemother.43, 2027–2031

o. 9

33. Vazquez-Laslop, N. et al. (2008) Molecular mechanism of drug-dependent ribosome stalling. Mol. Cell 30, 190–202

34. Ramu, H. et al. (2011) Nascent peptide in the ribosome exit tunnelaffects functional properties of the A-site of the peptidyl transfer-ase center. Mol. Cell 41, 321–330

35. Sothiselvam, S. et al. (2016) Binding of macrolide antibiotics leadsto ribosomal selection against specific substrates based on theircharge and size. Cell Rep. 16, 1–11

36. Mao, J.C.-H. and Robishaw, E.E. (1971) Effects of macrolides onpeptide-bond formation and translocation. Biochemistry 10,2054–2061

37. Tanaka, K. et al. (1971) Peptidyl puromycin synthesis; effect ofseveral antibiotics which act on 50 S ribosomal subunits. FEBSLett. 13, 65–67

38. �Cerna, J. et al. (1971) Effects of macrolide antibiotics on theribosomal peptidyl transferase in cell-free systems derivedfrom Escherichia coli B and erythromycin-resistant mutant ofEscherichia coli B. Biochim. Biophys. Acta 240, 109–121

39. Sothiselvam, S. et al. (2014) Macrolide antibiotics allostericallypredispose the ribosome for translation arrest. Proc. Natl. Acad.Sci. U. S. A. 111, 9804–9809

40. Vazquez-Laslop, N. et al. (2011) Role of antibiotic ligand innascent peptide-dependent ribosome stalling. Proc. Natl. Acad.Sci. U. S. A. 108, 10496–10501

41. Koch, M. et al. (2017) Critical 23S rRNA interactions for macro-lide-dependent ribosome stalling on the ErmCL nascent peptidechain. Nucleic Acids Res. 45, 6717–6728

42. Weisblum, B. (1995) Erythromycin resistance by ribosome mod-ification. Antimicrob. Agents Chemother. 39, 577–585

43. Sutcliffe, J. and Leclercq, R. (2002) Mechanisms of resistance tomacrolides, lincosamides, and ketolides. In Macrolide Antibiotics(Schönfeld, W. and Kirst, H.A., eds), pp. 281–318, BirkhäuserVerlag

44. Gupta, P. et al. (2013) Deregulation of translation due to post-transcriptional modification of rRNA explains why erm genes areinducible. Nat. Commun. 4, 1984

45. Horinouchi, S. and Weisblum, B. (1980) Posttranscriptionalmodification of mRNA conformation: mechanism that regulateserythromycin-induced resistance. Proc. Natl. Acad. Sci. U. S. A.77, 7079–7083

46. Gryczan, T.J. et al. (1980) Conformational alteration of mRNAstructure and the posttranscriptional regulation of erythromycin-induced drug resistance. Nucleic Acids Res. 8, 6081–6097

47. Depardieu, F. et al. (2007) Modes and modulations of antibioticresistance gene expression. Clin. Microbiol. Rev. 20, 79–114

48. Dar, D. and Sorek, R. (2017) Regulation of antibiotic-resistance bynon-coding RNAs in bacteria. Curr. Opin. Microbiol. 36, 111–117

49. Mayford, M. and Weisblum, B. (1990) The ermC leader peptide:amino acid alterations leading to differential efficiency of induc-tion by macrolide-lincosamide-streptogramin B antibiotics. J.Bacteriol. 172, 3772–3779

50. Ramu, H. et al. (2009) Programmed drug-dependent ribosomestalling. Mol. Microbiol. 71, 811–824

51. Subramanian, S.L. et al. (2011) Inducible resistance to macrolideantibiotics. In Antibiotic Drug Discovery and Development(Dougherty, T.J. and Pucci, M.J., eds), Springer Publishing

52. Almutairi, M.M. et al. (2015) Resistance to ketolide antibiotics bycoordinated expression of rRNA methyltransferases in a bacterialproducer of natural ketolides. Proc. Natl. Acad. Sci. U. S. A. 112,12956–12961

53. Min, Y.H. et al. (2008) Translational attenuation and mRNA sta-bilization as mechanisms of erm(B) induction by erythromycin.Antimicrob. Agents Chemother. 52, 1782–1789

54. Kamimiya, S. and Weisblum, B. (1997) Induction of ermSV by16-membered-ring macrolide antibiotics. Antimicrob. AgentsChemother. 41, 530–534

55. Thompson, J. et al. (2004) Effects of a number of classes of 50Sinhibitors on stop codon readthrough during protein synthesis.Antimicrob. Agents Chemother. 48, 4889–4891

56. Gupta, P. et al. (2013) Regulation of gene expression by macro-lide-induced ribosomal frameshifting. Mol. Cell 52, 629–642

57. Schmitz, F.J. et al. (2002) Molecular analysis of constitutivelyexpressed erm(C) genes selected in vitro by incubation in thepresence of the noninducers quinupristin, telithromycin, or ABT-773. Microb. Drug Resist. 8, 171–177

58. Bailey, M. et al. (2008) Induction of ermC expression by ‘non-inducing’ antibiotics. Antimicrob. Agents Chemother. 52, 866–874

59. Gupta, P. et al. (2016) Nascent peptide assists the ribosome inrecognizing chemically distinct small molecules. Nat. Chem. Biol.12, 153–158

60. Gong, F. and Yanofsky, C. (2002) Instruction of translating ribo-some by nascent peptide. Science 297, 1864–1867

61. Cruz-Vera, L.R. et al. (2005) Features of ribosome–peptidyl-tRNAinteractions essential for tryptophan induction of tna operonexpression. Mol. Cell 19, 333–343

62. Martinez, A.K. et al. (2014) Interactions of the TnaC nascentpeptide with rRNA in the exit tunnel enable the ribosome torespond to free tryptophan. Nucleic Acids Res. 42, 1245–1256

63. Bischoff, L. et al. (2014) Molecular basis for the ribosomefunctioning as an L-tryptophan sensor. Cell Rep. 9, 469–475

64. Hansen, J.L. et al. (2003) Structures of five antibiotics bound atthe peptidyl transferase center of the large ribosomal subunit. J.Mol. Biol. 330, 1061–1075

65. Seip, B. and Innis, C.A. (2016) How widespread is metabolitesensing by ribosome-arresting nascent peptides? J. Mol. Biol.428, 2217–2227

66. Garreau de Loubresse, N. et al. (2014) Structural basis for theinhibition of the eukaryotic ribosome. Nature 513, 517–522

67. Petersen, D.N. et al. (2016) A small-molecule anti-secretagogueof PCSK9 targets the 80S ribosome to inhibit PCSK9 proteintranslation. Chem. Biol. 23, 1362–1371

68. Lintner, N.G. et al. (2017) Selective stalling of human translationthrough small-molecule engagement of the ribosome nascentchain. PLoS Biol. 15, e2001882

69. Li, W. et al. (2018) Structural basis for selective stalling of humanribosome nascent chain complexes by a drug-like molecule.bioRxiv Published online May 5, 2018. http://dx.doi.org/10.1101/315325

70. Yonath, A. et al. (1987) A tunnel in the large ribosomal subunitrevealed by three-dimensional image reconstruction. Science236, 813–816

71. Nakatogawa, H. and Ito, K. (2002) The ribosomal exit tunnelfunctions as a discriminating gate. Cell 108, 629–636

72. Vazquez-Laslop, N. et al. (2010) The key role of a conserved andmodified rRNA residue in the ribosomal response to the nascentpeptide. EMBO J. 29, 3108–3117

73. Sohmen, D. et al. (2015) Structure of the Bacillus subtilis 70Sribosome reveals the basis for species-specific stalling. Nat.Commun. 6, 6941

74. Berisio, R. et al. (2003) Structural insight into the antibiotic actionof telithromycin against resistant mutants. J. Bacteriol. 185,4276–4279

75. Eyal, Z. et al. (2015) Structural insights into species-specificfeatures of the ribosome from the pathogen Staphylococcusaureus. Proc. Natl. Acad. Sci. U. S. A. 112 (43), E5805–E5814

76. Hansen, J.L.et al. (2002) The structures of four macrolide antibioticsbound to the large ribosomal subunit. Mol. Cell 10, 117–128

77. Menninger, J.R. (1985) Functional consequences of binding mac-rolides to ribosomes. J. Antimicrob. Chemother. 16 (Suppl A),23–34

78. Dunkle, J.A. et al. (2010) Structures of the Escherichia coli ribo-some with antibiotics bound near the peptidyl transferase centerexplain spectra of drug action. Proc. Natl. Acad. Sci. U. S. A. 107,17152–17157

79. Xiong, L. et al. (1999) A ketolide resistance mutation in domain II of23S rRNA reveals proximity of hairpin 35 to the peptidyl transfer-ase centre. Mol. Microbiol. 31, 633–639

Trends in Biochemical Sciences, September 2018, Vol. 43, No. 9 683

80. Hansen, L.H. et al. (1999) The macrolide-ketolide antibiotic bind-ing site is formed by structures in domains II and V of 23Sribosomal RNA. Mol. Microbiol. 31, 623–631

81. Liu, M. and Douthwaite, S. (2002) Activity of the ketolide telithro-mycin is refractory to Erm monomethylation of bacterial rRNA.Antimicrob. Agents Chemother. 46, 1629–1633

82. McGuire, J.M. et al. (1952) Ilotycin, a new antibiotic. Antibiot.Chemother. (Northfield) 2, 281–283

83. Bryskier, A. et al. (1993) Macrolides – Chemistry, Pharmacologyand Clinical Uses, Blackwell Science

84. Bryskier, A. (2001) Telithromycin – an innovative ketolide anti-microbials. Jpn. J. Antibiot. 54 (Suppl A), 64–69

85. Fernandes, P. (2015) Use of antibiotic core structures to generatenew and useful macrolide antibiotics. In Antibiotics Current Inno-vations and Future Trends (Sánchez, S. and Demain, A.L., eds),Caister Academic Press

86. Metersky, M.L. and Huang, Y. (2017) Ketolide antibiotics: will theyever be used for community-acquired pneumonia? Ann. Res.Hosp. 1, 16

87. Seiple, I.B. et al. (2016) A platform for the discovery of newmacrolide antibiotics. Nature 533, 338–345

684 Trends in Biochemical Sciences, September 2018, Vol. 43, N

88. Wohlgemuth, I. et al. (2008) Modulation of the rate of peptidyltransfer on the ribosome by the nature of substrates. J. Biol.Chem. 283, 32229–32235

89. Johansson, M. et al. (2011) pH-sensitivity of the ribosomalpeptidyl transfer reaction dependent on the identity of the A-siteaminoacyl-tRNA. Proc. Natl. Acad. Sci. U. S. A. 108, 79–84

90. Ito, K. and Chiba, S. (2013) Arrest peptides: cis-acting modu-lators of translation. Annu. Rev. Biochem. 82, 171–202

91. Wekselman, I. et al. (2017) The ribosomal protein uL22 modulatesthe shape of the protein exit tunnel. Structure 25, 1233–1241

92. Bulkley, D. et al. (2010) Revisiting the structures of several anti-biotics bound to the bacterial ribosome. Proc. Natl. Acad. Sci.U. S. A. 107, 17158–17163

93. Schlunzen, F. et al. (2003) Structural basis for the antibioticactivity of ketolides and azalides. Structure 11, 329–338

94. Llano-Sotelo, B. et al. (2010) Binding and action of CEM-101,a new fluoroketolide antibiotic that inhibits protein synthesis.Antimicrob. Agents Chemother. 54, 4961–4970

o. 9