University of Nebraska - LincolnDigitalCommons@University of Nebraska - LincolnTheses, Dissertations, and Student Research inAgronomy and Horticulture Agronomy and Horticulture Department

8-2019

Hormonal Signaling Induced in Soybean byLysobacter enzymogenes Strain C3Jessica C. WalnutUniversity of Nebraska-Lincoln

Follow this and additional works at: https://digitalcommons.unl.edu/agronhortdiss

Part of the Agricultural Science Commons, Agriculture Commons, Agronomy and CropSciences Commons, Botany Commons, Horticulture Commons, Other Plant Sciences Commons,and the Plant Biology Commons

This Article is brought to you for free and open access by the Agronomy and Horticulture Department at DigitalCommons@University of Nebraska -Lincoln. It has been accepted for inclusion in Theses, Dissertations, and Student Research in Agronomy and Horticulture by an authorizedadministrator of DigitalCommons@University of Nebraska - Lincoln.

Walnut, Jessica C., "Hormonal Signaling Induced in Soybean by Lysobacter enzymogenes Strain C3" (2019). Theses, Dissertations, andStudent Research in Agronomy and Horticulture. 173.https://digitalcommons.unl.edu/agronhortdiss/173

Hormonal signaling induced in soybean by Lysobacter enzymogenes strain C3

by

Jessica C. Walnut

A THESIS

Presented to the Faculty of

The Graduate College at the University of Nebraska

In Partial Fulfillment of Requirements

For the Degree of Master of Science

Major: Agronomy

Under the Supervision of

Professor Gary Yuen

Lincoln, Nebraska

August, 2019

Hormonal signaling induced in soybean by Lysobacter enzymogenes strain C3

Jessica C. Walnut, M.S.

University of Nebraska, 2019

Advisor: Gary Yuen

The biological control bacterium Lysobacter enzymogenes strain C3 has been

shown to suppress fungal diseases by producing a suite of lytic enzymes and antimicrobial

secondary metabolites. Previous studies have found that C3, when applied to grass and

cereal plants, also is capable of inducing local and systemic resistance against fungal

pathogens. It is unknown, however, whether the bacterium has the ability to induce

resistance in dicots and what signaling pathways are involved. This study assessed the

ability of C3 to trigger local and systemic induced resistance responses in soybean (Glycine

max ‘Williams82’) by analyzing relative expression of salicylic acid (SA), jasmonic acid

(JA), and ethylene pathway genes using qPCR. The first set of experiments determined

that foliar treatments with C3 induced all three defense hormone pathways in the treated

leaves. Upstream marker genes Allene Oxide Synthase (AOS) and Aminocyclopropane-1-

carboxylic acid Synthase (ACS) for jasmonate and ethylene pathways respectively, were

upregulated by C3 treatment, indicating activation of these pathways. Downstream marker

genes Pathogenesis Related Proteins 1 (PR1) and Pathogenesis Related Proteins 3 (PR3)

for the SA and JA/ET pathways, respectively, were also upregulated by C3 treatment. The

second set of experiments involved C3 treatment applications to soybean roots and

measuring changes in transcription of PR genes in the foliage. Systemic induction of PR1

and PR3 was not observed after root treatment. This is the first study to provide evidence

of a biocontrol bacteria inducing three hormone pathways upon application to soybean

foliage. The ability of C3 to induce systemic resistance in dicots after root treatment

remains unclear.

iv

Acknowledgements

The UNL Department of Plant Pathology has become like a second family to me.

My time spend here has been a wonderful learning experience filled with great memories.

There are so many people who have helped me achieve my goals and who have shaped

me into a better person and scientist.

I cannot begin to express how grateful I am to my advisor Dr. Gary Yuen, who

guided me through my research with kindness, patience, and understanding. His

commitment to his students is unparalleled. He took time to teach me how to convey my

research effectively through presentations and writing. Beyond the lab he was there to

offer support in times of stress and was there to celebrate with me in times of triumph. I

have no doubt that through his mentorship I have become a better scientist.

I want to also thank our lab technician Christy Jochum, who became a dear friend

and confidant to me during my time at UNL. She is a brilliant researcher that taught me

valuable protocols that helped me complete my research. It was always a pleasure just

spending time with her and talking to her. Thank you to my lab mates Rufus Akinrinlola

and Anthony Muhle, it was a pleasure working with you. I want to extend a special

thanks to my lab mate Dongxue Shi who assisted me every step of the way, whether it

was through helping me troubleshoot my protocols or helping me prepare for

presentations. She is truly an amazing person who I am eternally grateful for.

Thank you to my committee members Dr. Paul Staswick and Dr. Josh Herr who

gave me valuable feedback on my research methods and on my writing. Thank you to the

Wilson lab group who helped me with my project and lent me their thermocycler to run

v

my samples. Special thanks to Raquel Rocha and Lauren Segal who patiently taught me

protocols that allowed me to conduct my research.

I want to thank my wonderful husband, Fred Walnut, for his constant love and

support. Thank you to my mother who shaped the woman I have become. She instilled in

me compassion, a strong work ethic, a drive to follow my passions, and the ability to not

take myself too seriously. She always encouraged my interest in science and did

everything to make sure I was able to achieve my dreams. I want to thank my sister who

was always just a phone call away, as well as my husband’s wonderful family who

supported me though my research. Thank you to my wonderful friends who were always

there to offer great advice or outings to decompress from work.

I would also like to thank all of the faculty, staff, and graduate students of the

Department of Plant Pathology for their friendship and support.

vi

Dedication

For my dearest friend Edward Anthony Hillman III

vii

Table of Contents Title……………………………………………………………………………………...…i

Abstract……………………………………………………………………………………ii

Acknowledgements……………………………………………………………………….iv

Dedication………………………………………………………………………………...vi

Table of Contents………………………………………………………………………...vii

Chapter one

Literature Review……………………………………………….…………………………1

1.1 Introduction……………………………………………………………………………1 1.2 Lysobacter spp. …………………………………………………………….……….…2 1.2.1 Biocontrol Using Lysobacter spp. …………………………………………………..2 1.2.2 Lysobacter enzymogenes Strain C3……………………………………………….…4 1.3 Introduction to Induced Resistance ………………………………………………....…8 1.4 Pattern Triggered Immunity……………………………..….…….…….…….……….9

1.4.1 Pattern Recognition Receptors ……………………….…….………….…...10 1.4.2 Leucine-rich repeat (LRR) ……………………………….…….……..…....11 1.4.3 Lysine-motif (LysM) ………………………………….…….…….……….14 1.4.4 B-Lectin domains (B-Lec) and Epidermal growth factor like domains (EGF)………………………………………………………..16 1.4.5 Conservation of PTI signaling…………………………….…….…….……17 1.4.6 Downstream Signaling………………………………….…….…..……..…19

1.5 Phytohormones in plant defense……………………………………………………...20 1.5.1 Ethylene (ET) synthesis……………………………….…….…….…..……20 1.5.2 Jasmonic acid (JA) synthesis…………………….…….…….……..………21 1.5.3 Salicylic acid (SA) synthesis…………………….…….…….……..………22 1.5.4 Ethylene signaling pathway………………….…….…….…………………23 1.5.5 JA signaling pathway ………………….…….…….…….…………………24 1.5.6 Salicylic acid signaling pathway…………….…….…….…………………28

1.6 Can Arabidopsis be used as a model system to study soybeans? ….…………………31 1.7 Induced Resistance Types……………………….…….…….…….…….……...……34

1.7.1 Systemic Acquired Resistance (SAR) …..……….. ……………………….34 1.7.2 Induced Systemic Resistance (ISR) …………………….…….…….…...…37 1.7.3 Implementation of IR for disease control……………….…….……………39

1.8 Critical Questions and Objectives……………………….…….…….…..……………41 1.9 Literature Cited.……..…….…….…….……..…… .………..………………………43 1.10 Tables….…….…….…….…….…….…….…….…….…….…….…..……………63

Table 1 …………….…….……..…….…….…….…….…….…….…….………63 Table 2…………….…….…….…….…….…….…….…….…….…….…..……64

1.11 Figures…………………….…….…….…….…….…….…….…...….………….…65 Figure 1.…….…….…….…… .…….……………...…………….………………65

viii

Figure 2…………………………………………………………………..………66 Figure 3…………………………………………………………………..………67

Chapter 2 2.1 Introduction…………………………………………………………………………..68 2.2 Materials and Methods…………………………………………………………….…72

2.2.1 Plant Material Preparation………………………………………….………72 2.2.2 Treatment Preparation……………………………………………………...73 2.2.3 Foliar Application and Sample Collection……………………….…………73 2.2.4 Root Treatment Application Sample Collection……………………………74 2.2.5 RNA Extraction and cDNA synthesis………………………………………75 2.2.6 Quantitative PCR Analysis (qPCR) ……………………………………..…76 2.2.7 Statistical Analysis…………………………………………………………77

2.3 Results………………………………………………………………………………..78 2.3.1 Localized induction of a defense response upon C3 treatment…………….78 2.3.2 Localized induction of SA pathway upon C3 treatment………………….…78 2.3.3 Localized induction of JA and ET pathways upon C3 treatment ………….80 2.3.4 Systemic induction of defense hormones upon C3 root treatment…….……82

2.4 Discussion………………………………………………………………………........83 2.5 Literature cited……………………………………………………………………….88 2.6 Table………………………………………………………………………………….94

Table 1 …………………………………...………………………………………94 2.7 Figures………………………………………………………………………………..95

Figure 1…………………………………………………………………………..95 Figure 2…………………………………………………………………………..96 Figure 3…………………………………………………………………………..97 Figure 4…………………………………………………………………………..98 Figure 5…………………………………………………………………………..99 Figure 6………………………………………………………………………....100 Figure 7…………………………………………………………………………101 Figure 8…………………………………………………………………………102

Chapter 3 Thesis Conclusions……….……………………………………………………………104

1

Chapter 1 Literature Review

1.1 Introduction

The organism that is central to my research described in this thesis is Lysobacter

enzymogenes strain C3, a bacterium that is effective as a biological control agent for

diseases caused by fungal and nematode pathogens (Kobayashi et al.,2005; Yuen et al.,

2001; Yuen et al., 2018). This bacterium can control pathogen infection through

antagonism by producing lytic enzymes and secondary metabolites (Yuen et al., 2018;

Zhang et al., 2000). C3 also has the ability to induce resistance in monocots, i.e., cause a

response in treated plants that is capable of inhibiting fungal pathogen infection in distal

and local tissues (Jochum et al., 2006; Kilic-Ekici and Yuen, 2003).

In this review I will first discuss what work has been done towards understanding

Lysobacter enzymogenes C3’s mechanisms for pathogen inhibition, with a majority of the

focus on systemic resistance and the importance of understanding the signaling that

occurs as a result of C3 treatment. Prior to delving into the mechanisms behind systemic

induced resistance (SIR), I will first go through the Pattern Triggered Immunity (PTI)

defense response that is initiated by the plant upon microbe detection. I will start by

describing what induces PTI and the downstream signaling events that result from it,

including the involvement of jasmonic acid (JA), ethylene (ET) and salicylic acid (SA)

in downstream PTI signaling and defense. From there I will explain the importance of the

systemic signaling that occurs during PTI that lead to SIR, including but not limited to

reactive oxygen species (ROS), calcium, and phytohormone signaling.

2

1.2 Lysobacter spp.

The genus Lysobacter, part of the proteobacteria family Xanthomonadaceae, is

composed of over 40 species of aerobic gram-negative bacteria, that form highly mucoid

colonies that appear pink to yellow brown (Christensen and Cook 1978; Puopolo et al,

2018). A characteristic of this genus is the way in which it moves in its environment.

Lysobacter lacks flagella and, instead, moves on surfaces via twitching motility using

type IV pili (Christensen and Cook 1978; Zhou et al., 2015). Lysobacter is ubiquitous

and has been found in abundance in the rhizosphere of crop plants, the phyllosphere and

in freshwater systems (Puopolo et al.,2018). It has a cosmopolitan distribution, having

been isolated from soils across Europe, North America, and Asia (Kobayashi and Yuen,

2007; Reichenbach, 2006). Since its isolation, Lysobacter has emerged as a promising

biocontrol agent through field and greenhouse studies.

1.2.1 Biocontrol Using Lysobacter spp.

Members of the genus Lysobacter, along with members of Bacillus and

Pseudomonas, have been widely studied for their biocontrol capabilities and for their

growth promotion benefits on plants. Those strains noted primarily for the capability to

promote plant growth when applied to root systems are referred to as plant growth-

promoting rhizobacteria (PGPR). Growth promotion can occur through facilitating the

uptake of nutrients by plant roots or suppressing pathogenic microbes (Beneduzi et al.,

2012). Lysobacter has a number of characteristics that distinguish it from Bacillus and

Pseudomonas and that make it a compelling biocontrol agent. The methods of nutrient

3

acquisition, for instance, separates Lysobacter from Bacillus and Pseudomonas

biocontrol bacteria. PGPR and other microbes require plant exudates for nutrients. While

Lysobacter does feed on plant exudates, it has other strategies for nutrient acquisition if

exudates are unavailable or in limited supply. Nutrients can be obtained through

parasitism of other microbes such as bacteria or fungi. In minimal nutrient

conditions, Lysobacter parasitized Rhodococcus rhodochrous, Escherichia coli, and

Micrococcus luteus bacteria for required nutrients (Seccareccia et al., 2015). Lysobacter

parasitism of fungi and oomycetes offers a distinct advantage for utilizing Lysobacter as

a biocontrol bacterium against these groups of pathogens. Fungal and oomycetous plant

pathogens are able to reduce numbers of biocontrol bacteria through competition for root

colonization niches or through reduction of biocontrol bacteria colony fitness through

moderating bacterial gene expression (Bardin et al., 2015). For example, Pythium spp.

were able to outcompete strains of Pseudomonas fluorescens for nutrients and root

colonization niches causing P. fluorescens populations to decline in the wheat

rhizosphere (Mazzola and Cook, 1991). Lysobacter, on the other hand, does not need to

compete with fungal pathogens for resources as it can parasitize these pathogens for

nutrients (Patel et al.,2013).

The ability of a biocontrol bacterium to compete for nutrients and thrive in its

niche is an important consideration prior to implementation of said biocontrol bacterium.

Another important factor is the ability to produce lytic enzymes, toxins, and antibiotics to

antagonize plant pathogens, leading to the reduction of pathogen populations or inhibition

of pathogen activity. As with fungicides, the development of resistance to antimicrobial

compounds produced by biocontrol agents is an issue that can arise and must be

4

considered. Resistance to a biocontrol bacterium can occur if said bacterium only has one

mode of action in controlling the pathogen (Ajouz et l., 2010; Bardin et al., 2015; Li et

al., 1994). As an example, Botrytis cinerea, a fungal pathogen with a wide host range,

become insensitive to Bacillus subtilis CL27 and Pseudomonas chlororaphis strain

ChPhzS24 after twelve consecutive treatments of the biocontrol bacteria (Li et al., 1994).

The advantage of Lysobacter as a biocontrol agent is that it has multiple modes of action,

which can prevent pathogens from becoming insensitive. Lysobacter produce an array of

lytic enzymes that can degrade the cell walls of fungi, nematodes, and oomycetes. Some

examples are chitinases, β-1,3-glucanases, and metallopeptidase (Ko et al., 2009). In

addition to lytic enzymes Lysobacter, produces a variety of antibiotics including but not

limited to, 4- hydroxyphenylacetic acid, 2,5-dimethylpyrazine,2-methoxy-3-

methylpyrazine, decanal, and pyrrole (Lazazzara et al., 2017; Puopolo et al.,2018). Taken

together, the ability of Lysobacter to acquire nutrients through parasitism and to

antagonize pathogens with various modes of action makes Lysobacter a successful

biocontrol agent. Furthermore, these characteristics allow Lysobacter to be implemented

as a biocontrol bacterium to control various pathogens across different crop species

(Table1).

1.2.2 Lysobacter enzymogenes Strain C3

The Lysobacter strain studied during this project is Lysobacter enzymogenes

strain C3. It was first isolated from the foliage of Kentucky bluegrass (Poa pratensis)

(Giesler and Yuen, 1998). It was initially classified as Stenotrophomonas maltophilia

based on it physiological and metabolic characteristics such as nutrient utilization

5

(Giesler and Yuen, 1998). After an analysis of 16S rDNA sequence, fatty acid

composition, and mode of movement (gliding motility), C3 was accordingly reclassified

as a strain of Lysobacter enzymogenes (Sullivan et al., 2003). C3 is an antagonist of

nematode and fungal plant pathogens, producing lytic enzymes such as protease, lipase,

chitinase,and β -1,3-glucanase (Zhang and Yuen, 2000). In addition, C3 exudes a potent

antimicrobial secondary metabolite dyhydromaltophilin, also referred to as Heat Stable

Antifungal Factor (HSAF). HSAF is a complex of compounds described as tetramic acid-

containing macrolactam fused to a tricyclic system (Lou et al., 2011). It disrupts the

biosynthesis of sphingolipids critical in maintaining polarized growth of filamentous

fungi (Li et al., 2006). As mentioned previously Lysobacter species can parasitize other

microbes for nutrients, C3 is no exception. Studies have shown that C3 can acquire

nutrients directly from fungal pathogens, Magnaporthe oryzae (Rice Blast) and

Cryphonectria parasitica (Chestnut blight), by breaking down hyphae through lytic

enzymes and HSAF production (Mathioni et al., 2013; Patel et al., 2013). Since its

isolation, C3 has been studied as a biocontrol agent for controlling fungal and nematode

plant pathogens (Table 1). In field experiments with monocot crops, C3 was shown to be

effective in reducing disease incidence of Bipolaris leaf spot (Bipolaris sorokiniana) and

brown patch (Rhizoctonia solani) on tall fescue and Fusarium head blight (Fusarium

graminearum) of wheat (Giesler and Yuen, 1998; Jochum et al., 2006; Zhang and

Yuen,1999). Using C3 mutants defective in the production of lytic enzymes (chitinases

and β1,3-glucanases) and HSAF, the production of these compounds was demonstrated to

be the primary mechanism in biocontrol of B. sorokiniana and R. solani (Li et al., 2008;

Palumbo et al., 2005; Zhang et al., 2001). In addition to direct antagonism, C3 can also

6

inhibit infection by these two pathogens and F. graminearum infection though induced

resistance (Jochum et al., 2006; Kilic-Ekici and Yuen, 2003).

In studies on tall fescue, C3 was shown to induce two types of induced resistance,

localized and systemic (Kilic-Ekici and Yuen, 2003). As the names suggest, localized

induced resistance is expressed only in the C3-treated leaves but not in untreated leaves

of the same plant, whereas systemic induced resistance is manifested in the leaves of

plants in which the roots were treated with C3. In turfgrass, localized induced resistance

was exhibited when treatment of small sections of a tall fescue leaves with live and heat

killed cells of C3 inhibited B. sorokiniana infection on the treated leaves alone; the

results using heat-killed cells indicated that the pathogen inhibition was not due to direct

interaction between C3 and the pathogen (Kilic-Ekici and Yuen, 2003). In the same

study, C3 was also shown to inhibit B. sorokiniana through systemic induced resistance,

as application of live or heat-killed cells to tall fescue roots led to a reduction in B.

sorokiniana spore germination and leaf spot development on leaves of the treated plants.

In a subsequent study, C3 was compared with other strains of L. enzymogenes and with

systemic resistance-inducing strains of Pseudomonas spp. and Bacillus spp. for their

effects on Bipolaris leaf spot on tall fescue (Kilic-Ekici and Yuen, 2004). When applied

to roots, all bacterial strains induced systemic resistance to the pathogen in the foliage.

Furthermore, when bacterial strains were applied to individual leaves all treatments

appeared to induce localized resistance as the treatment reduced leaf spot development on

the treated leaves but not on non-treated leaves of the bacteria-treated plants.

Furthermore, C3 was the most effective in inducing localized and systemic resistance

among the L. enzymogenes strains. In both studies on tall fescue, an increase in

7

peroxidase activity in leaves within days after C3 root treatment was associated with both

local and systemic induced resistance. This indicates that the tall fescue plants responded

to C3 with an immune response, and that immune response was transmitted systemically.

Other than the elevation of peroxidase activity, there is no information regarding the

processes or mechanisms involved in induced resistance by C3.

In a study on biocontrol of Fusarium head blight using C3, application of C3 to

portions of wheat heads controlled disease throughout the wheat head, indicating that

localized induced resistance was involved (Jochum et al., 2006). This conclusion was

supported by the finding that the effects of treatment with C3 was dependent on the

wheat genotype. Interestingly, C3 was not able to induce systemic resistance as treatment

of wheat roots with C3 did not reduce FHB disease incidence on wheat heads (Jochum et

al., 2006). This can be due to a variety of reasons. First, induction of systemic resistance

is dependent on the applied microbe and the genotype of the host (Samain et al., 2019;

Tucci et al., 2011; Van Peer et al., 1992; Van Wees et al., 2007). It could be possible the

wheat cultivar used in the Fusarium head blight study was not amenable to being induced

by C3 to express system resistance. Alternatively, it may be possible that C3 can induce a

systemic response in that wheat cultivar, but the defense mechanisms induced in the

wheat heads may not have been sufficiently strong to affect the disease. Further

experiments using different wheat cultivars needs to be done prior to coming to a more

definitive conclusion regarding the systemic phenomenon.

8

1.3 Introduction to Induced Resistance

Systemic induced resistance occurs when the defense response initiated through

Pattern Triggered Immunity (PTI) is spread to uninfected tissues. PTI occurs upon

recognition of microbial conserved signals called Microbe Associated Microbial Patterns

(MAMPs). This recognition initiates a signaling cascade that involves calcium influx into

the cell, reactive oxygen species (ROS) production, and phosphorylation events that lead

to a change in transcription of downstream genes involved with defense (Saijo et

al.,2018). PTI is also associated with the activation of the phytohormones, jasmonic acid

(JA), ethylene (ET), and salicylic acid (SA). The induction of these hormonal pathways is

dependent on the type of pathogen infecting the host, specifically the mechanism by

which the pathogen acquires nutrients from host cells. Biotrophic pathogens, which

slowly take up nutrients from living cells, activate the JA and ET defense pathways

(Glazebrook, 2005), while necrotrophic pathogens, which kill host cells to acquire

nutrients, activate the SA pathway (Horbach et al., 2011). Systemic induced resistance

can be categorized as Induced Systemic Resistance (ISR) or Systemic Acquired

Resistance (SAR) depending on the inducing organism. Systemic resistance can be

elicited in plants either by beneficial and non-pathogenic microbes (ISR) or pathogenic

microbes (SAR). During SAR there is an upregulation of pathogenesis related proteins

(PR) gene transcription and SA production in distal untreated tissues (Shine et al., 2019).

During ISR, the JA/ET pathways are activated in treated tissues but there is no systemic

upregulation of defense genes or phytohormone production (Pieterse et al., 1998;

Verhagen et al.,2007). Instead, the hallmark of ISR is the priming effect that leads to a

9

more robust and timely response to pathogen infection in untreated tissue (Conrath et al.,

2006).

The traditional dogma categorizes the systemic responses based on three criteria,

whether the microbe is pathogenic or not, whether it elicits the JA/ET or SA pathways,

and, the induction of priming. The problem arises when the resistance response does not

strictly follow all of these criteria. Therefore, ISR and SAR will be distinguished here by

the inducing microbe, and the systemic induced resistance phenomenon by C3 will be

labeled as ISR for this project.

1.4 Pattern Triggered Immunity

Localized induced resistance is the defense response initiated by pattern triggered

immunity (PTI) within the infected tissue. Systemic induced resistance is the result of a

systemic spread of these PTI defenses. PTI is a broad defense response initialized upon

the recognition of microbes (Saijo et al.,2018). The defense response initiated is not

reliant on a single gene but instead is quantitative, with multiple genes contributing to

resistance (Saijo et al.,2018). Non-host resistance and basal resistance are other names

for this broad resistance response, but for the purpose of this review it will be referred to

solely as PTI. As PTI is not a targeted defense response, it is most effective against non-

adapted pathogens that can’t secrete proteins or toxins that can overcome the initial

defense response (Dodds and Rathjen, 2010). To mount a defense response, the plant

must first recognize that a microbe has entered the extracellular space. Plants utilize

transmembrane proteins called pattern recognition receptors (PRRs) to bind conserved

sequences that arise from critical components of pathogenic or nonpathogenic microbes

10

called microbe associated molecular patterns (MAMPs). If referring to sequences strictly

from a pathogen, they are called pathogen associated molecular patterns (PAMPs).

PAMPS/MAMPs include flagellin, components of the microbial the cell wall, and

secondary metabolites (Dodds and Rathjen, 2010; Newman et al., 2013). For the purpose

of this review, MAMPs will be used to refer to conserved sequences from pathogenic and

nonpathogenic microbes.

1.4.1 Pattern Recognition Receptors

Pattern Recognition Receptors (PRRs) are transmembrane receptor proteins (RP)

with an extracellular ligand binding domain. PRRs can be separated into receptor-like

kinases (RLKs) and receptor-like proteins (RLPs), with RLKs having an intracellular

kinase domain (Want et al., 2019; Saijo et al., 2018). RLPs typically associate with RLKs

to be able to initiate downstream signaling (Tang et al.,2017). Ligand-induced

oligomerization between RLKs and RLKs or RLPs and RLKs are a common mechanism

for the activation of PRRs (Li et al., 2016). As each MAMP has a specific molecular

composition, there exist classes of PRRs to correspond to the different components of

microbial molecules (Trdá et al.,2015). The classes are divided based on the ligand

binding domain and include, Leucine-rich repeat (LRR) bind proteins/peptides, Lysin-

motif (LysM) bind ligands containing N-acetylglucosamine (GluNAc) (chitin and chitin,

bacterial peptidoglycan (PGN), B-Lectin domains that bind components of the bacterial

cell wall such as lipid A and lipopolysaccharides as well as extracellular ATP, and

NAD+, and epidermal growth factor (EGF)‐like domains (Table 2) (Saijo et al., 2018;

Schwessinger and Ronald, 2012; Wan et al., 2019). Different PRRs activation initiates

11

different downstream signaling and as a result, different regulation of defense responses.

These variances in defense responses not only play a role in pathogen defense but also

the ability of biocontrol bacteria to colonize the plant. In this section I will provide

background information on the four classes of PRRs and the downstream signaling that

occurs during PTI.

1.4.2 Leucine-rich repeat (LRR)

LRR receptors are the most common found receptors in plants. The first identified

receptor-ligand interaction was RLK-LRR Flagellin-Sensing 2 (FLS2) and its bacterial

MAMP ligand 22-amino-acid peptide (flg22) (Table 2). Now, a substantial amount of the

signaling components have been identified for the FLS2-flg22 interaction. FLS2 forms a

complex with Brassinosteroid Insensitive 1-associated receptor kinase 1/Somatic

Embryogenesis Kinase(AtBAK1/SERK3), to elicit an immune response to flg-22

(Chinchilla et al., 2007; Gómez and Boller 2000; Li, et al., 2016, Saijo et al., 2018). In

the absence of flg22, LRR-RLK Brassinosteroid Insensitive 2 (BIR2) binds to AtBAK1,

preventing it from associating with LRR-RLK AtFLS2. Once flg22 is detected, AtBIR2 is

phosphorylated by AtBAK1, then dissociates from BAK1 (Halter et al., 2014). Upon,

flg22 binding Botrytis-Induced Kinase 1 (AtBIK1), a kinase bound to the kinase domains

of FLS2 and AtBAK1, is phosphorylated by the activated AtBAK1, AtBAK1 then

transphosphorylates FLS2/BAK1 (Lu et al., 2009). Flagellin is a common component of

bacteria, therefore it is no surprise that FLS2 orthologs have been found in other

dicotyledonous species such as Solanum lycopersicum (tomato) and Nicotiana

benthamiana (Hann and Rathjen, 2007, Robatzek et al., 2007). In rice, a model system

12

for grasses and monocots, an FLS2 ortholog OsFLS2 has also been uncovered (Chen et

al., 2014; Takai et al., 2008). OsFLS2 forms a complex with OsSERK2 upon ligand

binding and is important for PTI downstream signaling, similar to Arabidopsis.

OsSERK2 acts as a positive regulator of Ax21, as in flg22 induced defense (Chen et al.,

2014). During Xanthomonas oryzae pv. oryzae (Xoo) infection, OsXA3 and OsXA21

RLKs recognize peptides from the Ax21 protein, and activate the defense pathway (Lee

et al., 2009). OsSERK2 and XA21 initiate a phosphorylation signaling cascade by

transphosphorylation (Chen et al., 2014). LRRs are important in recognizing pathogen

peptides, but they also serve to recognize damage signals from plant cells.

During pathogen infection or insect feeding plant cells can be broken down or

sustain damage. As a result, host derived peptides called damage associated molecular

patterns (DAMPs) are released and bind to LRRs, which induce an immune response

(Choi et al., 2016). In Arabidopsis, AtPep1, a 23 amino acid peptide from protein

PROPEP1, induces defense responses such as PDF1.2 gene transcription and

downstream immune signaling when bound to PEPR1 LRR Receptor kinase (Table 2)

(Huffaker et al.,2006; Qi et al., 2010; Yamaguchi et al., 2006). In tobacco experiments,

in which AtPEPR1 was inserted into the genome, tobacco cells were able to recognize

and respond to AtPep1 when added to the media. This indicates that the signaling events

are conserved in the downstream response of AtPep1 binding. Kinase domains of

signaling peptides tend to be conserved in plant species, therefore the phosphorylation

target may be similar in tobacco and Arabidopsis (Yamaguchi et al., 2006). Work in

soybeans has identified peptides that act as DAMPs. GmPep890 and GmPep914 are eight

amino acid long peptides part of the carboxy-terminal end of a 52-amino acid precursor

13

protein GmPROPEP890 and GmPROPEP914 respectively (Yamaguchi et al., 2011).

When applied to soybean suspension cells, the media became alkalized, indicating that

the cells were synthesizing defense compounds in response to GmPep890 and GmPep914

(Yamaguchi et al., 2011). The extracellular alkalization assay has been developed as a

marker for early immune signaling. It is a result of calcium ions being exported from the

cell during the PTI defense response (Moroz et al., 2017). In addition, a 12 amino acid

long peptide, Glycine max Subtilase (protease) peptide (GmSubPep), also induces defense

responses (Pearce et al., 2010). However, the receptors that bind these peptides are still

unknown. The ability to recognize and respond to DAMPs and MAMPs is crucial to plant

defense, and plants undergo selection pressure to be able to do so.

Multiple receptors may recognize different peptides from a common protein

complex to combat MAMP diversification in pathogens. MAMP diversification occurs

due to selection pressure faced by the microbes to evade host detection and can occur

through horizontal gene transfer or sequence mutations (Clarke et al.,2013). Evolving a

new receptor while maintaining the old receptor allows the plant to not only recognize the

mutated MAMP sequences, but also the conserved peptides that are still present in non-

evolved microbes. One example of this phenomena can be found in tomato plants. In

tomato, Flagellin-Sensing 3 (FLS3) has been recently characterized as a novel receptor

that binds flgII-28, a separate peptide of the flagellin protein that is recognized by FLS2

(Table 2) (Hind et al., 2016). Some plant species lack these alternate receptors, which

opens the door for possible transgenic studies, such as inserting these novel receptors like

FLS3 into susceptible plant species to examine if it increases resistance.

14

1.4.3 Lysine-motif (LysM)

While evolving new receptors is beneficial for the plant, it is not feasible to have

an individual receptor for every MAMP. Plants interact with a diverse array of

microorganisms, and instead of having a separate receptor for every microbe MAMP,

there are receptors that recognize multiple microbe targets. For example, LysM receptors

recognize chitin, a structural component of fungi and bacterial peptidoglycan. In rice,

chitin and bacterial peptidoglycan are recognized by a LysM-RK , OsCERK1 (chitin

elicitor receptor kinase), and an extracellular protein OsCEBiP (chitin elicitor binding

protein) (Kaku et al., 2006; Shimizu et al., 2010). MAMPs trigger a general response that

has significant overlap between different microbes such as a phosphorylation cascade,

ROS production, and calcium signaling. However, each MAMP also triggers a distinct

signaling response for that specific PRR-MAMP combination (Gust et al., 2007). These

defense responses involve correct antimicrobial enzyme synthesis and hormone

production. For example, during infection by a fungal pathogen the host synthesizes

chitinases to break down the chitin in the fungal cell wall. After degradation, the chitin

fragments also induce further defense responses (Pusztahelyi, 2018). Chitinases would

not be beneficial during a bacterial infection and synthesis of them would simply be a

waste of the plant’s energy. Since these receptor complexes can bind multiple targets,

how can the ligands be differentiated to mount the correct response? Currently, the

mechanism is still unclear. Though work by Hayafune et al., (2014) using rice LysM

receptor CEBiP and chitin, introduced the sandwich hypothesis. (GlcNAc)8, an

15

oligosaccharide of chitin, is composed of chains of N-Acetylglucosamine (glucose with

bound N-acetyl moieties) attached by β-(1→4)-linkages. The N-acetyl groups are found

in an alternating pattern along the N-Acetylglucosamine chains. These N-acetyl groups

are what bind to the LysM1 domain of CEBiP. As the N-acetyl groups are found on

alternating sides of the chitin molecule it allows for two CEBiP LysM1 domains to bind

to each side, creating a dimer (Hayafune et al., 2014). To discern whether dimer

formation was indeed the source of downstream immune responses, a unique

oligosaccharide (GlcNβ1,4GlcNAc)4, with N-acetyl moieties all on one side was used to

prevent CEBiP dimer formation. (GlcNβ1,4GlcNAc)4 was able to bind to one CEBiP

receptor, but did not lead to a measurable ROS response, indicating that dimerization, or

a “sandwich” of the two CEBiP receptors was necessary for an induction of immunity

(Hayafune et al., 2014). In addition, for proper binding a minimum of five N-acetyl

groups are required, further providing specification for chitin and not a peptidoglycan

molecule, as GlcNAc would only be present as a monomer with one N-acetyl group

(Hayafune et al., 2014). The full mechanism behind peptidoglycan specification is not

fully understood, however it is known that OsCERK1 interaction with OsCEBiP occurs

during peptidoglycan recognition. Furthermore, yeast two-hybrid analysis implicated the

interaction of OsCERK1 and OsCEBiP with Lys-RLPs OsLYP4 and OsLYP6 as part of

the specification (Kouzai et al., 2014). OsCERK1 not only recognizes chitin and

peptidoglycan, but also short chitin related oligomers (Myc-LCOCO4) called Nod Factors

(NFs) from arbuscular mycorrhiza fungi (Shinya et al., 2015).

In addition to plant defense, LysM receptors play a role in establishing symbiotic

relationships with microorganisms, such as root nodule rhizobia and arbuscular

16

mycorrhiza fungi (AM). During symbiotic interactions signaling molecules released by

rhizobia involved in root nodule symbiosis, called NFs, are recognized by host plant

receptors NFR1/LYK3 (Shinya et al., 2015). AM and rhizobia NFs are similar in

structure to chitin, but with the N-acylation at the end of the molecule. Furthermore, the

receptors, NFR1/LYK3, share a conserved sequence with AtCERK1 (Shinya et al., 2015).

LysM receptors in other plants such as Lotus japonicus (LjNFR5/LfNFR1) and Medicago

truncatula (MtNFP/MtLYK3) have been found to recognize NFs as well (Maillet et al.,

2011). More work still needs to be done on what downstream signaling that occurs upon

ligand binding. If conserved signaling between chitin and NFs occurs, it could lead to

engineering different crops that can form symbiotic relationships with AM and rhizobia.

Experiments looking at conserved pathway signaling between chitin and NF could be

done by transforming plants, that normally cannot form symbiotic relationships with AM,

by inserting NFR1/LYK3. Further studies comparing the transformed plant’s expression

during treatment with either rhizobia or AM versus a non-transformed plant can elucidate

which components of the PTI pathway is regulated upon NFR1/LYK3-NF binding.

1.4.4 B-Lectin domains (B-Lec) and Epidermal growth factor like domains (EGF)

B-Lec domains bind Lipopolysaccharide (LPS) from Gram-negative bacteria as

well as extracellular ATP released during pathogen infection (Table 2) (Choi et al.,

2014; Ranf et al., 2015). In Arabidopsis a B-Lec receptor called Lipooligoasaccharide-

Specific Reduced Eliciation (AtLORE) has been identified in binding the Lipid A moiety

from Pseudomonas and Xanthomonas LPSs (Ranf et al., 2015). B-Lec can also

recognize ATP released during wounding or pathogen attack. Members of the Wall-

17

Associated Kinase (WAK) family are thought to recognize DAMPs such as

Oligogalacturonides (OGs) from the plant cell wall. Currently one EGF-like receptor has

been identified, EGF‐like RLK WAK1(Table1) (Brutus et al., 2010).

1.4.5 Conservation of PTI signaling

Transgenic studies that examine signaling between PRRs from different species

can lead to new insights into conserved signaling, and possible targets for genetic

modification of more resistant crops. For example, one study transformed wheat plants

with the EFR receptor, only present in members of the Brassicaceae family, to examine if

a receptor not normally present in wheat can make the plant more resistant to bacterial

pathogens (Schoonbeek et al., 2015). EFR binds a conserved MAMP elf18, a peptide

from the Bacteria Elongation Factor Tu (Ef-Tu). When Arabidopsis EFR (AtEFR) is

inserted into wheat plants, transgenic plants were able to respond to the presence of elf18

and mount and appropriate immune response such as callose deposition and upregulation

of defense related genes (Schoonbeek et al., 2015). This result indicates that receptors not

normally found outside a plant family can still elicit an immune response in a different

plant species due to components of the defense signaling pathway being conserved. Not

only can AtEFR induce a defense response in transformed wheat upon elf18 treatment,

but it can induce a successful defense response reducing disease severity. Disease

development of transformed wheat infected with the cereal pathogen Pseudomonas

syringae pv. oryzae was less severe, with smaller paler lesions compared to the control.

Reduction in disease severity is a result of the plant being able to recognize additional

MAMPs from the bacteria, inducing a more robust response (Schoonbeek et al., 2015).

18

Further evidence of conserved signaling pathways is the ability of transgenic Arabidopsis

containing a chimera of two well studied receptors from EFR (Arabidopsis) and XA21

(rice) to confer resistance to Pseudomonas syringae pv. tomato DC3000 and

Agrobacterium tumefaciens. When XA21 intracellular domain is fused with the

extracellular EFR domain, an immune response is still mounted when elf18 binds to

AtEFR. Furthermore, the co-receptor AtBAK1 was able to associate with XA21 (Holton

et al., 2015). In Rice expressing AtEFR was able to interact with OsXA21 associated

proteins such as OsSERK2 and XB24. Furthermore, rice plants expressing AtEFR had

increased resistance to Xanthomonas oryzae pv. oryzae isolates (Schwessinger et

al.,2015). Naturally if pathway conservation has been reported between dicots and

monocots, the next logical conclusion is there is conservation between dicot species.

Arabidopsis thaliana EFR was inserted into Nicotiana benthamiana ( a close relative of

tobacco) and tomato plants. Transgenic N. benthamiana had decreased disease severity

when inoculated with P. syringae pv. syringae B728a, P. syringae pv. tabaci 11528, and

Agrobacterium tumefaciens. Transgenic tomato plants were also less affected by

phytopathogenic bacteria. When inoculated with Ralstonia solanacearum or

Xanthomonas perforans, tomato plants exhibited less wilting and lesions, respectively

(Lacombe et al., 2010). Conclusions that can be drawn from these studies are that

receptors capable of being biochemically active in other species and the ability to induce

a defense response is due to conserved downstream defense signaling components

present in the transformed plant. Taken together, these results open the door for

transforming plants with different PRRs between monocots and dicots for disease control

(Schoonbeek et al., 2015). It would be interesting to see more work being done

19

examining conserved signaling outside of model systems such as Arabidopsis, tomato,

and rice. As mentioned, some transgenic work points to the possibility of inserting

receptors from one plant species into another can result in better resistance. Testing that

hypothesis in crops such as vegetable and fruit crops could increase disease management.

1.4.6 Downstream Signaling

Upon the recognition of MAMPs, a cascade of phosphorylation events occur that

initiate downstream signaling cascades ( Li et al., 2016) (Figure 1). An integral step to

initiate defense signaling is the opening of calcium (Ca2+ ) plasma membrane channels

(Jeworutzki et al., 2010). Ca2+ acts as a messenger in plant cells during plant defense and

is an important component of systemic signaling and local gene expression. In unstressed

conditions cellular Ca2+ concentration is generally at approximately 200 nM (Sanders et

al., 1999). Immediately after MAMP recognition, a rapid influx of calcium ions from the

apoplast into the cell leads to intracellular depolarization (Saijo et al., 2018). A change in

intracellular Ca2+ induces the release of intracellular calcium, triggering a secondary burst

of Ca2+ within the cell (Cheng et al., 2002). Plant cells can alter PTI responses by fine

tuning Ca2+ signaling (Dodd et al., 2010; Hetherington and Brownlee, 2004; Segonzac et

al., 2011). The initial magnitude of the Ca2+ cytoplasmic burst varies on the MAMP

recognized, as cytoplasmic Ca2+ signatures differ among MAMPs such as flg22, elf18,

ch8, fungal cryptogeins, and DAMP Pep1 (Lecourieux et al., 2002, Ranf et al., 2011;

Segonzac et al., 2011). However, while Ca2+ influx varies on the initial stimuli, there is

some overlap in signaling. For example, FLS2 and EFR receptors, that bind different

MAMPs, activate the same calcium ion channels during defense (Jeworutzki et al., 2010).

20

Ca2+ influx initiates reactive oxygen species (ROS) synthesis by activating NADPH

oxidases. Calcium Dependent Protein Kinases (CDPK) activated upon Ca2+ binding

phosphorylate NADPH oxidase that synthesizes ROS (Cheng et al., 2002; Segonzac et

al., 2011). ROS burst plays a role in systemic defense signaling, through self-propagation

of ROS induced activation of RBOHD, and NADPH oxidase (Miller et al, 2009; Gilroy

et al., 2016). In addition, Ca2+ activates two types of kinases, mitogen-activated protein

kinases (MAPKs) and calcium-dependent protein kinases (CDPKs) (Cheng et al., 2002;

Li et al., 2016; Segonzac et al., 2011; Tena et al., 2011). CDPKs and MAPKs play an

important role in post translational protein modification through phosphorylation during

plant defense (Figure 1). During PTI resistance CDPKs and MAPKs moderate the

activity of transcription factors through phosphorylation. Phosphorylation can inhibit or

activate these transcription factors which in turn can lead to the induction or inhibition of

defense gene transcription (Bigeard and Hirt, 2018).

1.5 Phytohormones in plant defense

Plants produce a variety of hormones involved in growth and defense. Three key

hormones that are involved are ethylene (ET), jasmonic acid(JA), and salicylic acid (SA).

In this section I will review synthesis, signaling, and cross talk of these three hormones.

1.5.1 Ethylene (ET) synthesis

ET is a gaseous hormone involved in plant immune signaling. The first step of

ethylene synthesis is the conversion of the amino acid methionine to S-

adenosylmethionine (SAM) by SAM Synthetase (Figure 2) (Wang et al., 2002). Next, the

21

rate limiting step, 1-aminocyclopropane-1-carboxylic acid Synthase (ACS), converts

SAM to 1-aminocyclopropane-1-carboxylic acid (ACC) (Yang and Hoffman, 1984). The

final step is the catalysis of ACC to ethylene by ACC Oxidase (Wang et al., 2002).

1.5.2 Jasmonic acid (JA) synthesis

Jasmonic acid is a fatty acid derivative. Synthesis begins when galactolipids are

exported out of the chloroplast and into the plastid and then converted to α-linolenic acid

(18:3) by Defective in Anther Dehiscence 1 (DAD1) (Wasternack et al., 2013). From

there 13-Lipoxygenase (LOX) oxidizes α-linolenic acid (18:3) into (13S)-

hydroperoxyoctadecatrienoic acid (13-HPOT) (Figure 2) (Wasternack et al., 2013). The

first committal and crucial step in JA synthesis is the conversion of 13-HPOT to allene

oxide by Allene Oxide Synthase (AOS) (Park et al., 2002). Allene oxide is then

converted to cis-12-oxo phytodienoic acid (OPDA) by Allene Oxide Cyclase (AOC)

(Browse et al., 2009). OPDA is transported to the peroxisome where 12-

oxophytodienoate reductase 3 (OPR3) cleaves olefinic bonds to synthesize 3-2(2’(Z)-

pentenyl) cyclopentane-1-octanoic acid (OPC-8:0). OPC-8:0 undergoes 3 rounds of β-

oxidation to form JA (Wasternack et al., 2013). However, JA cannot act in defense

signaling until it is converted into its active form. Jasmonoyl-L-Amino Acid Synthetase

(JAR1) is required to synthesize JA to its active form, JA-isoleucine (JA-Ile) (Staswick et

al., 2004). JA-Ile is able to bind Coronatine-Insensitive Protein 1 (COI1), the coreceptor

that induces downstream JA signaling (Fonseca et al., 2009).

22

1.5.3 Salicylic acid (SA) synthesis

SA levels during infection vary depending on the host plant. During rice and

potato plant infection SA levels remain unchanged as SA is present at a high basal

concentration as a free acid, and it is thought to act as an antioxidant during infection

(Coquoz et al., 1998; Silverman et al., 1995; Yang et al., 2004). In some dicot species

such as Arabidopsis, the basal concentration of SA is low, but doubles during infection

(Malamy and Klessig, 1992). SA is synthesized via the shikimate pathway, via two

separate branches, the isochorismate pathway and the phenylpropanoid pathway (Figure

2) (Chen et al., 2009). Isochorismate Synthase (ICS) converts chorismate to

isochorismate, which is then converted to SA via Isochorismate Pyruvate Lyase (IPL)

(Boatwright et al., 2013; Li et al., 2019; Wildermuth et al., 2001). Phenylalanine

Ammonia Lyase (PAL) converts phenylalanine to trans-cinnamic acid (t-CA), then

through an unknown enzyme t-CA is converted to benzoic acid (BA). After a side chain

oxidation and a hydroxylation event BA is converted to SA via Benzoic Acid 2-

Hydroxylase (BA2H) (Boatwright et al., 2013; Chong et al., 2001; Li et al., 2019). The

preferred branch to synthesize SA is dependent on the plant species. In tobacco and

Arabidopsis, 90% of SA is synthesized via the isochorismate pathway, while in rice SA is

synthesized via the phenylpropanoid pathway (Silverman et al.,1995; Wildermuth et al.,

2001). Interestingly in soybean, there is no preferential pathway. Instead, both PAL and

ICS are required for SA synthesis (Shine et al., 2016). Soybean knockout mutants pal and

ics could not synthesize SA, and as a result, mutant soybean plants were not able to

inhibit infection by Phytophthora sojae and Pseduomonas syringae compared to wild

23

type plants. In addition, mutants did not induce significant expression of the SA regulated

gene PR1 compared to the wild type (Shine et al., 2016).

1.5.4 Ethylene signaling pathway

Prior to ET synthesis, Raf-like kinase Constitutive Ethylene Response 1 (CTR1)

phosphorylates the cytosolic C-terminal domain (CEND) of transmembrane protein

Ethylene Insensitive 2 (EIN2), preventing ET activated responses (Figure 3) ( Alonso et

al., 1999; Ju et al., 2012; Qiao et al., 2012; Thomma et al., 1999). After ethylene is

synthesized and perceived by ETR1, CTR1 is phosphorylated, thereby inhibiting its

interaction with EIN2 (Kieber et al., 1993). Once EIN2 is activated through

dephosphorylation, CEND is cleaved and is able to enter the nucleus to inhibit EIN3

Binding F-Box Protein 1 (EBF1) from marking transcription factor Ethylene Insensitive 3

(EIN3) for degradation (Alonso et al., 1999; Ju et al., 2012; Qiao et al., 2012). ET

transcription factors, EIN3 and EIN3-LIKE 1 (EIL1), act downstream of EIN2 to activate

ethylene response genes (Figure 3) (Li et al., 2019; Lorenzo et al., 2003). Ethylene

response Factors (ERFs) are transcription factors involved in not only ethylene signaling

but also JA and SA signaling (Liu et al., 2012; Lorenzo et al., 2003). For example,

Soybean ERF5 (GmERF5) positively regulates pathogenesis related (PR) genes, PR1-1,

PR10, and PR10-1 in response to Phytophthora sojae infection (Dong et al., 2015).

Another example is OsERF83, a rice ERF, induced by rice blast infection, MeJA,

ethephon, and SA treatment; and upregulated PR genes PR1, PR2, PR3, PR5, and PR10

(Liu et al., 2012).

24

1.5.5 JA signaling pathway

JA signaling is tightly regulated, and in recent years more mechanisms have been

uncovered that control JA accumulation and downstream signaling. The SCFCOI1-

Jasmonate ZIM Domain (JAZ) protein complex is the central component of jasmonate

signaling. The SCFCOI1 complex is a site of perception of the plant hormone jasmonoyl-

isoleucine (JA-Ile) (Thines et al., 2007). JA-Ile initiates interaction between of E3

ubiquitin-ligase Skip-Cullin-F-box complex (SCFCOI1) and a family of JAZ proteins,

which are inhibitors of JA response gene transcription (Figure 3). JAZ proteins are

targeted for ubiquitination by SCFCOI1 ubiquitin ligase (Thines et al., 2007). SCFCOI1

mediated control of JA signaling is conserved in many plant species. In soybeans and

Arabidopsis, GmCOI1 and AtCOI1 share significant sequence homology (Wang et al.,

2007). Two chimeric proteins were created, GmCOL1 F-box motif fused with the

AtCOL1 Leucine rich repeat domain and AtCOI1 F-box motif fused with the GmCOL1

Leucine rich repeat domain were both able to rescue the Arabidopsis coi1-1 mutant

phenotype, confirming functional equivalence. Furthermore, GmCOI1 was able to form a

complex with AtSCFCOI1, indicating overlap in biochemical properties of the two proteins

(Wang et al., 2007). JA signaling can also be controlled by altering JA-Ile homeostasis

within the cell. This can be achieved by regulating the synthesis of JA-Ile or through the

removal of the isoleucine group from JA by hydrolases (Woldemariam et al., 2014). In

recent years two new proteins have been implicated in JA-Ile homeostasis. The first is a

jasmonate transporter, Arabidopsis JAT1/ABCG16 (Li et al., 2017). Arabidopsis

JAT1/ABCG16 regulates the appropriate concentration of JA-Ile in the nucleus by

exporting JA and importing the active form JA-Ile (Li et al., 2017) (Figure 3). This

25

allows for downstream jasmonate signaling to occur. The second is Jasmonate-Induced

Oxygensases (JOXs). In unstressed cells JOXs down regulate JA responses by reverting

JA to its precursor, 12-OH-JA (Caarls et al., 2017). This is to prevent overaccumulation

of JA (and thereby JA-Ile) in the cell that could negatively impact growth and

development. During pathogen infection, JOXs are induced by JA as part of a negative

feedback loop to control JA concentration in the cell (Caarls et al., 2017). These

regulatory features shed light on an additional mechanism of maintaining the correct

jasmonate homeostasis within the cell, as is well established for other plant hormones.

The appropriate concentration of JA-Ile induces downstream JA signaling by activating

transcription factors.

There are two signaling branches in the JA pathway, MYC and ERF. MYC is

activated upon wounding or herbivory, while the ERF branch is activated during

necrotrophic pathogen infection (Li et al., 2019). The MYC branch is controlled by the

basic helix-loop-helix leucine zipper positive transcription factors MYC2/3/4 (Li et al.,

2019). To activate JA response gene transcription, MYC2 binds to the G-box region of

the promoter (Fernández-Calvo et al., 2011; Wasternack et al., 2013). However, under

low JA-Ile conditions, JAZ forms a complex with Novel Interactor of JAZ (NINJA) and

TOPLESS (TPL). The complex then binds to MYC2 to prevent transcription of JA

response genes by blocking promoter activation (Pauwels et al. 2010). Further, JA

response gene repression occurs through TPL bound Histone Deacetylase 6 (HDA6) and

Histone Deacetylase 19 (HDA19), that remodel chromatin to prevent transcription of the

gene, even though MYC2 is bound to the G-box (Wu et al., 2008; Zhou et al., 2005).

Upon MYC transcription, MYC goes on to activate transcription of many genes including

26

VEGETATIVE STORAGE PROTEIN (VSP) and LOX2 (Li et al., 2019). As the focus of

this literature review is on plant-microbe interactions, the majority of the review will

focus on the ERF branch. The ERF branch is activated through synergistic signaling of

the JA and ET pathways.

The ERF branch is mediated by transcription factor Octadecanoid-responsive

AP2/ERF 59 (ORA59) and Ethylene Response Factor 1 (ERF1) ( Li et al., 2019; Pré et

al., 2008). In the presence of ethylene, TGACG sequence-specific binding proteins

(TGA) bind to the inverted TGACGT motif in the ORA59 promoter, inducing

transcription (Zander et al., 2014). ORA59 interacts with transcription factors EIN3 and

EIL1 in the nucleus to mediate the synergistic interaction between ET and JA (He et al.,

2017; Zhu et al., 2011) (Figure 3). In the absence of JA, JAZ and histone deacetylase

(HDA6) binding inhibit EIN3/EIL1 transcription (Zhu et al., 2011). Once JA

accumulation occurs JAZ gets degraded by 26S proteasome and EIN3/EIL1 transcription

occurs (Zhu et al., 2011). Using a yeast two-hybrid screen, ORA59 was found to interact

with Related TO AP2.3 (RAP2.3), another ERF transcription factor. The interaction

occurs in the nucleus in an ethylene-dependent manner. RAP2.3 is crucial for ORA59

mediated responses, as rap2.3 mutants lacked ORA59 downstream orchestrated

responses such as pathogen resistance (Kim et al., 2018). In addition to ORA59, basic

leucine zipper (bZIP) class‐II TGA transcription factors (TGA2/TGA5/TGA6) act as

positive regulators of PDF1.2 expression when JA and ET concentrations are elevated

(Zander et al., 2010). In Arabidopsis tga2,5,6 mutants were unable to induce PDF1.2

transcription. ERF1 but not ORA59 expression was enhanced in the tga256 mutant during

JA/ACC treatment. ERF1 induction didn’t increase PDF1.2 expression, indicating that

27

another mechanism is regulated by TGA2/TGA5/TGA6 to upregulate PDF1.2 (Zander et

al., 2010). Penninckx et al., (2007) further examined the effect of ET and JA signaling on

defense gene expression. To do so Arabidopsis mutants ein2-1 and coi-1 were created

and then infected with Alternaria brassicicola. When infected with Alternaria

brassicicola, the ein2-1 mutants were still able to induce the JA defense pathway and still

exhibited increased JA synthesis like the wild type plants. Similar observations were

made for A. brassicicola infected coi-1 mutants, downstream ethylene responses still

occurred compared to the wild type. However, neither mutants were able to induce

PDF1.2 gene expression upon MeJA or ethylene treatment, indicating that both hormone

pathways are required for PDF1.2 expression (Penninckx et al., 2007). Even though

synergistic activity between hormones may be required for a complete defense response,

it does not always occur. Many factors can cause this, especially when breeding for

specific traits at the unknown expense of altering a defense pathway. As a result, some

cultivars become more susceptible than others to pathogens. Depending on the plant

cultivar different hormone pathways may be activated to defend against the same virulent

isolate of a pathogen. For example, in Arabidopsis, Col-0 and Bur-0, susceptible and

partially resistant lines, respectively, require two different pathways for successful

suppression of Clubroot Agent Plasmodiophora brassicae (Lemarié et al., 2015). During

P. brassicae infection Bur-0 activated the SA pathway, upregulating SA response genes

PR2 and PR5. This induction of SA genes was not observed in Col-0. P. brassicae

infection increased transcription of the JA pathway genes Arginine Amidohydrolase 2

(ARGAH2) and Thionin 2.1(THI2.1) in Col-0 wild type lines. When Col-0 plants were

pre-treated with JA, they showed less disease severity (Lemarié et al., 2015).

28

Interestingly, SA treatment on Col-0 and Bur-0 decreased disease severity. These results

indicate that both JA and SA hormone pathways can provide partial resistance. The

different degree of resistance between these two lines also indicates that while both JA

and SA are involved in clubroot defense, they are not equally effective in doing so.

1.5.6 Salicylic acid signaling pathway

Upon SA pathway induction during PTI, Enhanced Disease Susceptibility (EDS1)

recruits Phytoalexin Deficient 4 (PAD4) to initiate downstream signaling and SA

synthesis (Feys et al., 2001; Jirage et al., 1999) (Figure 3). AtEDS1 forms a complex with

AtPAD4, which stabilizes the AtPAD4 protein. The AtEDS1-AtPAD4 complex not only

regulates downstream SA signaling but also acts as a positive regulator for PAD4

transcription (Feys et al., 2001; Rietz et al., 2011; Wiermer et al., 2005). AtPAD4 -

AtEDS1 complex is required not only for local signaling but also systemic SA defense

signaling. The complex creates a ROS and SA-stimulated positive feedback loop to

promote SA production during infection (Feys et al., 2001; Ruste´rucci et al., 2001; Zhou

et al., 1998;). In rice PAD4 and EDS1 homologs (OsPAD4, OsEDS1) encode a plasma

membrane protein that is associated with the JA defense pathways, as both were induced

upon exogenous JA treatment (Ke et al., 2014; Ke et al., 2019) (Figure 3). In rice,

OsEDS1 is involved in resistance to necrotrophic pathogens Xanthomonas

oryzae pv. oryzae (Xoo) and Xanthomonas oryzae pv. oryzicola (Xoc), as knockout

mutants were more susceptible to these pathogens (Ke et al., 2019). Similar to

Arabidopsis, OsPAD4 and OsEDS1 form a complex at the plasma membrane.

29

Furthermore, PAD4 and EDS1 homologs were able to interact successfully in vivo and

vitro (Ke et al., 2019). Downstream of the PAD4-EDS1 complex and SA synthesis,

Nonexpresser of PR gene 1 (NPR1) is the primary receptor that interacts with SA to

regulate signaling. NPR1 is a transcripton factor that works in parallel other transcription

factors, depending on the species. In Arabidopsis, AtNPR1 is the main regulator of SA

signaling, while in rice OsNPR1 acts in conjunction with OsWRKY45 to regulate the SA

pathway, through SA gene transcription activation (Shimono et al., 2007; Sugano et al.,

2010). NPR1 is an oligomer connected by intermolecular disulfide bonds in the

cytoplasm. Upon SA induction thioredoxins catalyze the reduction of intermolecular

disulphide bonds, breaking apart the oligomer to form a monomer of NPR1, which then

travels into the nucleus (Mou et al., 2003; Koornneef et al., 2008; Tada et al., 2008). In

the nucleus NPR1 forms a complex with TGACG motif binding factor (TGA1), a basic

domain/Leu zipper transcription factor. Similar to NPR1, TGA1 also has intramolecular

disulfide bridges through Cysteine residues that are reduced during SA signaling. The

TGA1/NPR1 complex binds to the promoter region of PR-1, inducing transcription

(Després et al., 2003; Lindermayr et al., 2010; Zhou et al., 2007). In addition to PR-1

transcription,NPR1 also induces expression of WRKY70 (Ding et al., 2018).

WRKY70 has been implicated in the suppression of JA signaling upon SA pathway

activation. Using wrky70 mutants, researchers were able to demonstrate that WRKY70

inhibits JA responses as downstream JA genes were upregulated compared to the wild

type. Further evidence includes an experiment in which WRKY70 was upregulated in

transgenic Arabidopsis, creating plants that were more resistant to biotrophic pathogen

Erysiphe cichoracearum, but more susceptible to necrotrophic pathogen Alternaria

30

brassicicola. As mentioned previously, the JA pathway is activated upon biotrophic

pathogen infection, while SA is activated by necrotrophic pathogens (Li et al., 2004; Li et

al., 2006). during JA induced resistance responses WRKY70 transcription is negatively

regulated by Nonexpresser of PR genes 3/4 (NPR3/ NPR4) and TGA2/TGA5/TGA6

(Ding et al., 2018). TGA2 can also inhibit JA gene transcription. During SA signaling,

TGA2 binds specifically to TGACG sequence located in the promoter region of the JA

response gene PDF1.2, preventing transcription (Spoel et al., 2003).

Aside from regulating downstream JA signaling through the E3 ubiquitin-ligase Skip-

Cullin-F-box complex (SCFCOI1) and WRKY70, SA can inhibit JA defense responses by

repressing transcription of JA transcription factors (Leon-Reyes et al., 2010; Van der

Does et al., 2013). One example is the inhibition of ORA59 transcription.

Glutaredoxin480 (GRX480) interacts with TGA2 and TGA6 to inhibit ORA59 expression

by binding to the promotor region, which in turn inhibits ERF96, MYB113, and PDF1.2

transcription (Figure 3) (Ndamukong et al., 2007; Van der Does et al., 2013; Zander et

al., 2014). SA and ET also work in conjunction to inhibit JA defenses. EIN3 and EIL,

regulated by the ethylene pathway, are required for SA suppression of PDF1.2 gene

expression, as demonstrated when SA was no longer able to suppress PDF1.2 expression

in ein3 and eil1 mutants (He et al., 2017). Under low ethylene conditions NPR1 is

required to inhibit JA regulated gene expression. However, in pathogen elicited defense

responses, ET signaling can overrule the NPR1 dependency on SA suppression of JA

(Leon-Reyes et al., 2009).

Even though traditionally JA and SA are thought to be antagonistic to one another,

they can have synergistic effects in a concentration dependent manner. Treatment with

31

low concentrations (<100μm) of both JA and SA increased expression of both SA and JA

responsive genes, PDF1.2, Thi1.2, and PR1. This synergy was lost in coi1 and npr1

mutants, indicating both COI1 and NPR1 are required (Mur et al., 2005). Further

evidence of a synergistic relationship comes from a study performed by Van den Berg et

al (2018). Transcription of JA and SA regulated genes were measured in response to

Phytophthora cinnamomi infection of a resistant avocado cultivar(Persea americana). SA

and PTI mediated responses were upregulated at 6hpi, with simultaneous gene responses

of JA and SA occurring at 18hpi. At 24hpi most gene upregulation was regulated by JA.

This study shows that a biphasic JA and SA defense response is possible, and more than

one hormone can be involved in defense at different time points during hemi-biotroph

pathogen infection (Van den Berg et al., 2018). Hormone cross talk is complex, and as

discussed, the mechanisms can vary depending on the plant species.

1.6 Can Arabidopsis be used as a model system to study soybeans?

As part of this thesis, marker genes for soybean hormone pathways JA, SA, and

ET were selected based upon the hormone signaling map created by Jing et al., (2015).

This signaling map was created using known protein interactions in Arabidopsis and

cluster analysis of soybean proteins (Jing et al., 2015). While Arabidopsis and soybean

share defense signaling components, there are differences between the two. This brings

up the question of whether Arabidopsis can be used as a template for soybean hormone

research.

Recent work studying the sequence similarity between Arabidopsis and other

dicotyledonous species suggests that the Arabidopsis molecular and genetic map can be

32

used to infer gene expression and possibly signaling in legumes, cotton, and Solanacea

(Grant et al., 2000). Studies have found that soybean and Arabidopsis have significant

sequence similarity (Grant et al., 2000). Soybean unigenes (transcripts from the same

locus) were put through a TBLASTX search against the Arabidopsis proteome to

determine sequence homology (Tian et al., 2004). Expectation values (E-value) below

1.0E1 yielded up to 76.92% , but the more stringent the E-value such that; <1.0E180,

there was only1.80% homology between Arabidopsis and soybean (Tian et al., 2004).

Approximately 49.3% (21,299) soybean unigenes could not be corresponded to proteins

from Arabidopsis, likely due from further genome duplication events in Soybean and

other possible mutations since its divergence from Arabidopsis (Tian et al., 2004).

Functional compatibility of some Arabidopsis genes with soybean identified genes that

may be used to engineer resistance to nematodes. AtPAD4 and GmPAD4 (soybean

homolog) share 41.8% amino acid identity, so the sequence is considered moderately

conserved (Youssef et al., 2013).

To determine whether this homology leads to conserved functionality between the

two, Youssef et al, transformed soybean plants to express AtPAD4 gene in soybean roots.

Transformed soybean plants were able to express AtPAD4. In addition, transformed

soybeans that overexpressed AtPAD4 and AtPR1 compared to the empty vector plants

were more resistant to Soybean cyst nematode and root knot nematode (Youssef et al.,

2013). To examine if Arabidopsis genes could confer resistance to Soybean Cyst

Nematode (Heterodera glycines), Matthews et al., (2014) inserted Arabidopsis defense

genes into soybean seedlings via Agrobacterium mediated transformation. Soybean

seedlings overexpressing SA related defense genes (AtNPR1, AtTGA2, and AtPR-5)

33

exhibited a 60% decrease in cysts. Another study tested whether the insertion of a

soybean gene GmEREBP1, encoding a transcription factor, into Arabidopsis would be

successful in eliciting downstream signaling. In soybeans GmEREBP1 localizes to the

nucleus to induce expression of PR2, PR3, PR1 an ET regulated gene, a JA and ET

regulated gene, and a SA regulated gene respectively (Mazarei et al., 2007). When

GmEREBP1 was inserted into the Arabidopsis genome, the expression profile of

downstream genes exhibited some conserved signaling (Mazarei et al., 2007). For

example, AtPDF1.2 and AtPR3 were up regulated as well as SA responsive gene AtPR1.

However, PR2 was not upregulated as it was in soybean (Mazarei et al., 2007). This

discrepancy could stem from PR2 being regulated by ethylene in soybeans and salicylic

acid in Arabidopsis. Even though there are some successful examples of soybean and

Arabidopsis genes being able to induce a similar, if not better immune response when

inserted into the other’s genome, it cannot be assumed that all genes with conserved

sequences can be interchangeable and used for improved resistance. For example, even

though salicylic acid pathway genes AtEDS1 and GmEDS1 show considerable conserved

amino acids, overexpression of AtEDS1 in soybean seedlings did not confer the same

level of resistance to soybean cyst nematode as GmEDS1 (Mazarei et al., 2007). As of

now there is a lack of research applying knowledge gained from Arabidopsis to other

agronomic crops. More work is required to study the insertion of Arabidopsis genes into

genomes of agronomic crops to determine their impact on disease

susceptibility/resistance.

34

1.7 Induced Resistance Types

1.7.1 Systemic Acquired Resistance (SAR)

Ross (1961) describes SAR as providing resistance to a secondary infection by a

broad spectrum of pathogens in uninfected tissues after primary infection with a pathogen

(Shine et al., 2019). In Arabidopsis, and other dicots, SAR is typically associated with

activation of the salicylic acid pathway. In Arabidopsis there have been reports

implicating JA in SAR (Truman et al., 2007). However, another study found that while

JA is involved in SAR signaling, it is not crucial to SAR establishment (Attaran et al.,

2009). During SAR changes in transcription can be measured in uninfected tissues (Shine

et al., 2019). Upon pathogen infection, four major compounds are synthesized in local

tissues. First local tissues synthesize SA via ICS1, then some SA gets converted to

methyl salicylate (MeSA), an SAR signaling molecule. For some plant species, such as

tobacco, MeSA is the long-distance signaling molecule that travels via phloem A study

performed in tobacco by Park et al., (2007) using Tobacco mosaic virus (TMV)

concluded that both salicylic acid–binding protein 2 (SABP2) and SA methyl transferase

are required for SAR establishment. SA methyl transferase converts SA to MeSA which

is transported to distal tissue. Upon MeSA translocation to un-infected tissues SABP2, a

MeSA esterase, converts MeSa to SA in order for downstream SA signaling to occur

(Park et al., 2007). Another signaling molecule, pipecolic acid (Pip), is synthesized via

ALD1 and is a crucial regulator of SAR and priming (Bernsdorff et al., 2015).

Pseudomonas syringae pv. Maculicola infection leads to Pip and SA accumulation in

inoculated and distal leaves of wild type plants. In sid2 aald1 mutants, unable to produce

Pip or SA ,showed less resistance to Pseudomonas syringae pv. Maculicola, indicating

35

both are required for a full resistant response (Bernsdorff et al., 2015). Pip also primes

distal tissues for phenolic compound and SA synthesis (Vogel-Adghough et al., 2013).

Pip acts in a positive loop with MPK3/6, WRKY33, and ALD1. This positive feedback

loop occurs when Pip accumulation triggers MPK3/6 activation, which in turn activates

transcription factor WRKY33. WRKY33 goes on to bind the ALD1 promoter, activating

transcription and in turn activating Pip synthesis (Wang et al., 2018). Flavin-Dependent

Monooxygenase1 (FMO1) is a pipecolate N-hydroxylase that catalyzes Pip to N-

hydroxypipecolic acid (NHP) and is critical in SAR establishment (Hartmann et al., 2018;

Mishina et al., 2006; Návarová et al., 2012). Arabidopsis fmo1 mutants were not able to

establish systemic SA accumulation nor SAR in response to P. syringae pv. maculicola

avrRpm1(avirulent) or virulent P. syringae pv. maculicola (virulent). However, local

gene expression and hormone accumulation was not affected in local tissue infected with

avirulent (Psm avrRpm1) or virulent (Psm) bacteria, indicating that FMO1 is required for

systemic signaling, but not local defenses (Mishina et al., 2006). In addition, the

hydroxylation of Pip to NHP by FMO1 results in the transcription of ALD1 and

FMO1(Chen et al., 2018). Along with NHP, there is an amplification loop with PAD4,

ICS, FMO1, and ALD1, which drives SA and Pip synthesis (Návarová et al., 2012; Shah

and Zeier, 2013). SA synthesis activates NPR1, which is a two-step process. First, SA

promotes the monomerization of NPR1. Then, SNF1-Related Protein Kinase 2.8

(SnRK2.8), activated by signaling independent of SA, phosphorylates NPR1 so that it can

be imported into the nucleus where it activates defense genes (Lee et al., 2015). In

addition to Pip, lipids have also been discovered to play a key role during SAR.

36

ROS and nitric oxide (NO) induce the conversion of free C18 unsaturated fatty

acids to azelaic acid (AzA), which in turn stimulates glycerol-3-phosphate (G3P)

synthesis (Wang et al., 2014;Yu et al., 2013). G3P synthesis is vital to distal signaling as,

G3P synthesis mutants, gly1 and gli1, were not able to elicit SAR with exogenous AzA

treatment (Chanda et al., 2011; Yu et al., 2013). Defective in Induced Resistance (DIR1),

an apoplastic lipid transfer protein, is required for transporting lipid derived signaling

molecule to distal tissues to establish SAR (Champigny et al., 2011; Maldonado et al.,

2002). DIR1 is not involved in PTI, just SAR. Dir1-1 mutants are still capable of

inducing local immune responses but are not able to induce defenses in distal tissues

upon infection (Maldonado et al., 2002). DIR1 and AZI1 are required for Aza, and MeSA

induced SAR (Chaturvedi et al., 2012; Jung et al., 2009).

In soybeans, the SAR pathway seems to be similar to Arabidopsis, as SAR is

established in a SA and NPR1 dependent manner. However, in some monocot species,

such as barley, there appears to be a different mechanism involved in SAR. A study

performed by Dey et al., (2014) examined bacteria-induced systemic immunity in barley

and compared it to SAR in dicots (Dey et al., 2014). Unlike in Dicots, HvNPR1 is not

required for systemic resistance as Hvnpr1 mutants were not compromised in their ability

to establish SAR. Bacteria-induced systemic immunity resembles Arabidopsis ISR (Dey

et al., 2014). Furthermore, transcript analysis of systemic tissues after local infection with

Pseudomonas syringae pathovar japonica (avirulent) revealed JA mediated WRKY and

ERF-like transcription factors were induced in local and systemic tissues (Dey et al.,

2014).

37

1.7.2 Induced Systemic Resistance (ISR)

ISR is triggered by certain non-pathogenic microbes. Induction of ISR is

dependent on the microbe, the host plant species, and the genotype of the host, meaning

that not all microbes can elicit ISR on all plants within a species (Shine et al., 2019;

Vallad and Goodman, 2004). All forms of ISR have some signaling components in

common such as requiring NPR1for downstream signaling (Jain et al.,2016; Lee et al.,

2015; Shimono et al., 2007; Sugano et al., 2010; Van Wees et al.,2000). However, unlike

in SAR, NPR1 does not act as a regulator of SA synthesis and defense genes. Currently,

the role of NPR1 during ISR is not fully understood. Current work suggests that when JA

and ET accumulate, a signal thought to be methyl jasmonate (MeJA) travels through the

phloem, activating NPR1 signaling in distal cells (MeJA) (Jain et al., 2016). Even though

both ISR and SAR involve NPR1 signaling in distal cells, changes to defense gene

transcription cannot be measured in these tissues prior to pathogen infection in ISR

(Shine et al., 2019; Verhagen et al., 2007).

The lack of an immediate distal response can be due to beneficial microbes

silencing the defense response in order to establish a beneficiary relationship with the

host. In a study by Stringlis et al. (2018), transcripts from Arabidopsis roots elicited by

live cells of the PGPR Pseudomonas fluouresence WCS417, a MAMP from WCS417

(flg22417 peptide) and MAMP from the pathogen Pseudomonas aeruginosa (flg22Pa

peptide) were compared (Stringlis et al.,2018). Both MAMPs induced a similar

immediate transcriptome response, indicating that the plant cannot differentiate

between pathogenic or beneficial bacteria solely on the basis of their MAMPs. WCS417

live cells and MAMP from WCS417 also had a high overlap in induced transcripts, but

38

at later time points, WCS417 live cell induced transcripts were silenced. This led

researchers to the conclusion that while plants will recognize beneficial bacteria and

mount a defense response, beneficial bacteria can silence those responses to facilitate

colonization of the host (Stringlis et al.,2018). The mechanisms involved in this defense

suppression are still unknown.

Another distinction between SAR and ISR is the dependency on SA

accumulation. SAR requires SA accumulation, but ISR does not require SA synthesis

though it can occur (Pieterse et al.,1998). Instead ISR elicitation is dependent on JA

and ET signaling. In a well-studied biocontrol bacteria Pseudomonas fluorescens

WCS417r, ISR is induced without SA involvement, but instead JA and ET (Pieterse et

al.,1998). Arabidopsis mutants compromised in the JA or ET pathways were not able to

elicit an ISR response to WCS417r treatment, indicating that the JA and ET pathways

are required for WCS417r mediated ISR (Pieterse et al.,1998). In a separate study

WCS417r treated Arabidopsis plant inoculated with P. syringae pv. tomato DC3000

induced JA/ET regulated genes but no SA controlled PR proteins were induced

(Verhagen et al., 2007). While SA is not involved in WCS417r- mediated ISR, studies

have confirmed its involvement in ISR in other host-microbe interactions.

ISR has historically been associated with the JA/ET pathways, but recent work

has implicated that depending on the microbe, SA may also be involved. PGPR Bacillus

cereus AR156 induced ISR in Arabidopsis against Pseudomonas syringae DC3000 (Niu

et al., 2011). Upon pathogen inoculation, SA and JA/ET controlled genes , PR1, PR2,

PR5, and PDF1.2, were expressed in the foliage of AR156 treated plants (Niu et al.,

2011). Trichoderma is also an interesting ISR inducer, as it has been shown to induce and

39

prime JA, ET, and SA pathways (Martínez-Medina et al., 2013; Martínez‐Medina et al.,

2017). In Arabidopsis, Trichoderma harzianum Rifai T39 and Trichoderma hamatum

T382 induces resistance to necrotrophic leaf pathogen Botrytis cinerea via the JA/ET

pathway (Korolev et al., 2008). SA impaired Arabidopsis mutants were not affected in

resistance to B. cinerea and were able to express ISR, while ET/JA impaired mutants

were more susceptible and unable to express ISR (Korolev et al., 2008; Mathys et al.,

2012). In tomato plants, Trichoderma is able to prime both SA and JA pathways, which

confers an increased defense response by tomato. The primed SA defenses limited initial

root penetration by the Meloidogyne incognita (root knot nematode). Then a second wave

of primed JA pathway responses inhibited silencing of the JA pathway by nematodes and

thereby minimizing gall formation (Martínez‐Medina et al., 2017). While work in

Trichoderma demonstrates the ability of a beneficial fungi eliciting all three separate

pathways, more work in beneficial bacteria needs to be done.

1.7.3 Implementation of IR for disease control

One paper argues that SAR and ISR reinforce and are an extension of PTI induced

hormone defenses, therefore depending on the hormone pathway normally involved in a

certain pathogen response, SAR or ISR will be more effective (Ton et al., 2005). In

Arabidopsis effectiveness of INA-mediated SAR and WCS417r-mediated ISR was tested

using four different pathogens that activate a different hormone defense pathway upon

infection ,Peronospora parasitica and Turnip crinkle virus (TCV) (SA pathway),

Alternaria brassicicola (JA/ET pathway) and Xanthomonas campestris pv. armoraciae

(JA/ET/SA pathway). SAR but not ISR was effective against P. parasitica and TCV.

40

Conversely, ISR was effective at inhibiting A. brassicicola while SAR wasn’t. Both ISR

and SAR were effective in inhibiting X. campestris pv. armoraciae (Ton et al., 2005).

Synthetic inducers are capable of activating the plants immune response, without

detrimental effects on the plant (Alexandersson et al., 2016). Some examples of well-

studied inducers on the market areβ-Aminobutyric acid (BABA) and Benzothiadiazole

(BTH). BABA is a non-protein amino acid inducer and has been effective in controlling

pathogens in the greenhouse and in the field across a variety of monocot and dicot crops

(Beckers and Conrath, 2007). In lettuce, BABA application reduced Bremia

lactucae infection (Cohen et al., 2010). Foliar application of BABA reduced Plasmopara

viticola (Downy Mildew) infection and symptoms in grapes sampled over five field trials

(Reuveni et al., 2001). BTH is an inducer of SAR and is tolerated by most crops and is

the main active ingredient in commercial induced resistance products such as Actigard®

(Beckers and Conrath, 2007). Aside from chemical inducers, beneficial microbes have

been tested in their efficacy at protecting crops in the field through induced resistance.

Unfortunately, there is a lack of field trials being performed to test the efficacy of

ISR. Seed treatment with, MycoGrow™ Micronized Endo/Ecto Seed Mix, a mixture of

eight species of mycorrhizal fungi, increased disease resistance and growth promotion in

field studies (Beckers and Conrath, 2007). Through various field trials, Bacillus pumilus

INR-7, has proven to be an effective biocontrol agent against foliar pathogens. Cucumber

with seed treatment of Bacillus pumilus INR-7 showed effective control of cucumber

plants against Colletotrichum lagenarium (anthracnose) and Pseudomonas syringae

pv.lachrymans (angular leaf spot) in several field trials (Vallad and Goodman, 2004). In

pepper, a root dip treatment of INR7 prior to field planting decreased disease symptoms

41

of bacterial leaf spot (X. axonopodis pv. vesicatoria) (Yi et al., 2013). A seed treatment of

PGPR strains P. fluorescens strains Pf1 and PB2 was effective in reducing rice sheath

blight symptoms and incidence in the field (Nandakumar, 1998).

While there is field work studying the efficacy of induced resistance in various

crops, there is a lack of work studying the signaling involved in IR in plants aside from

Arabidopsis and other model organisms. More work needs to be done on crop systems, as

the end goal of IR studies is the implementation of these microbes that can induce

systemic induced resistance in the field for crops.

1.8 Critical Questions and Objectives Depending on the phytohormones C3 induces in the plant, JA/ET or SA, it may be

more effective against one pathogen compared to another. Knowing what hormone

pathway(s) C3 induces will allow for more accurate implementation, as it will prevent the

use of C3 ISR against a pathogen that may not be sensitive to the hormone pathway

induced.

While there is work done in monocots such as wheat and grass, there is no work

studying C3-induced resistance in dicots. Dicots make up a large and diverse portion of

important crops, such as soybean, cotton, and tomato. The United States is currently the

leading producer of soybeans, making soybeans an important commercial crop, hence

why it was chosen for this study. According to the USDA, in 2018 the United States

harvested 8.9 million acres of soybeans with a value of $41 billion. While the industry is

profitable, the annual loss of bushels due to fungal pathogens and fungicide resistance

alone was 300 million bushels in 2016 (United Soybean Board, 2018). Currently, there is

not much work studying induced resistance in soybean elicited by bacteria, instead the

42

majority of studies focus on IR induced by chemical elicitors or insects (Lin et al., 1990;

Nafie and Mazen, 2008). The aim of this study is to increase the knowledge of ISR in

soybean, and to increase the understanding of ISR elicited by C3.

Prior to analyzing the systemic response of soybeans to C3, the hormone

pathways C3 induced was determined using marker genes for SA, JA, and ET. Then, the

ISR response was characterization in terms of the ability of C3 to induce a measurable

systemic change in hormone marker genes in the foliage post root drench. Implementing

greenhouse trials and molecular techniques, my research will be able to provide a better

understanding of the molecular mechanisms of pathogenesis and disease suppression by

Lysobacter enzymogenes strain C3. Based on that, new strategies can be developed to

improve the efficacy of biological control agents.

43

1.9 Literature Cited

Ajouz S., Nicot P. C., Bardin M. (2010). Adaptation to pyrrolnitrin in Botrytis cinerea and cost of resistance. Plant Pathology, 59: 556–566. 10.1111/j.1365-3059.2009.02230.x Albert, M., Krust, D., Felix, G., Einig, E., Fürst, U., & Wang, L. (2016). The pattern-recognition receptor CORE of Solanaceae detects bacterial cold-shock protein. Nature Plants, 2(12): 16185. https://doi.org/10.1038/nplants.2016.185 Alexandersson, E., Mulugeta, T., Lankinen, Å., Liljeroth, E., & Andreasson, E. (2016). Plant resistance inducers against pathogens in Solanaceae species-from molecular mechanisms to field application. International Journal of Molecular Sciences, 17(10): 1673. doi:10.3390/ijms17101673 Alonso J.M., Hirayama T., Roman G., Nourizadeh S., Ecker J.R. (1999). EIN2, a bifunctional transducer of ethylene and stress responses in Arabidopsis. Science, 284: 2148–2152. doi: 10.1126/science.284.5423.2148. Attaran E, Zeier TE, Griebel T, Zeier J. (2009) Methyl salicylate production and jasmonate signaling are not essential for systemic acquired resistance in Arabidopsis. Plant Cell, 21(3): 954–971. Bardin, M., Ajouz, S., Comby, M., Lopez-Ferber, M., Graillot, B., Siegwart, M., & Nicot, P. C. (2015). Is the efficacy of biological control against plant diseases likely to be more durable than that of chemical pesticides?. Frontiers in Plant Science, 6:566. doi:10.3389/fpls.2015.00566 Beckers, G. J., & Conrath, U. (2007). Priming for stress resistance: from the lab to the field. Current Opinion in Plant Biology. https://doi.org/10.1016/j.pbi.2007.06.002 Beneduzi, A., Ambrosini, A., & Passaglia, L. M. (2012). Plant growth-promoting rhizobacteria (PGPR): Their potential as antagonists and biocontrol agents. Genetics and Molecular Biology, 35(4) 1044–1051. Bernsdorff, F., Döring, A. C., Gruner, K., Schuck, S., Bräutigam, A., & Zeier, J. (2015). Pipecolic acid orchestrates plant systemic acquired resistance and defense priming via salicylic acid-dependent and -independent pathways. The Plant Cell, 28(1): 102–129. doi:10.1105/tpc.15.00496 Bigeard, J., & Hirt, H. (2018). Nuclear signaling of plant MAPKs. Frontiers in Plant Science, 9. https://doi.org/10.3389/fpls.2018.00469 Boatwright, J. L. and Pajerowska‐Mukhtar, K. (2013), Salicylic acid: an old hormone up to new tricks. Molecular Plant Pathology, 14: 623-634. doi:10.1111/mpp.12035 Browse J (2009) Jasmonate passes muster: a receptor and targets for the defense hormone. Annu Rev Plant Biol 60: 183–205. Pmid:19025383 Brutus, A., Sicilia, F., Macone, A., Cervone, F., & De Lorenzo, G. (2010). A domain swap approach reveals a role of the plant wall-associated kinase 1 (WAK1) as a receptor of oligogalacturonides. Proceedings of the National Academy of Sciences of the United States of America, 107(20): 9452–9457. doi:10.1073/pnas.1000675107

44

Caarls, L., Elberse, J., Awwanah, M., Ludwig, N. R., de Vries, M., Zeilmaker, T., … Van den Ackerveken, G. (2017). Arabidopsis JASMONATE-INDUCED OXYGENASES down-regulate plant immunity by hydroxylation and inactivation of the hormone jasmonic acid. Proceedings of the National Academy of Sciences of the United States of America, 114(24): 6388–6393. doi:10.1073/pnas.1701101114 Carotenuto G, Chabaud M, Miyata K, et al.(2017). The rice LysM receptor-like kinase OsCERK1 is required for the perception of short-chain chitin oligomers in arbuscular mycorrhizal signaling. New Phytol, 214: 1440–1446. Champigny, M. J., Shearer, H., Mohammad, A., Haines, K., Neumann, M., Thilmony, R., et al. (2011). Localization of DIR1 at the tissue, cellular and subcellular levels during systemic acquired resistance in Arabidopsis using DIR1:GUS and DIR1:EGFP reporters. BMC Plant Biol. 11:125. doi: 10.1186/1471-2229-11-125 Chanda, B., Xia, Y., Mandal, M. K., Yu, K., Sekine, K.-T., Gao, Q.-M., et al. (2011). Glycerol-3-phosphate is a critical mobile inducer of systemic immunity in plants. Nat. Genet. 43, 421–427. Chaturvedi, R., Venables, B., Petros, R. A., Nalam, V., Li, M., Wang, X., et al. (2012). An abietane diterpenoid is a potent activator of systemic acquired resistance. Plant J. 71: 161–172. Chen, X. , Shang, J. , Chen, D. , Lei, C. , Zou, Y. , Zhai, W. , Liu, G. , Xu, J. , Ling, Z. , Cao, G. , Ma, B. , Wang, Y. , Zhao, X. , Li, S. and Zhu, L. (2006): A B‐lectin receptor kinase gene conferring rice blast resistance. The Plant Journal, 46: 794-804. doi:10.1111/j.1365-313X.2006.02739.x Chen, X., Zuo, S., Schwessinger, B., Chern, M., Canlas, P. E., Ruan, D., … Ronald, P. C. (2014). An XA21-associated kinase (OsSERK2) regulates immunity mediated by the XA21 and XA3 immune receptors. Molecular plant, 7(5): 874–892. doi:10.1093/mp/ssu003 Chen, Y.-C., Holmes, E. C., Rajniak, J., Kim, J.-G., Tang, S., Fischer, C. R., … Sattely, E. S. (2018). N-hydroxy-pipecolic acid is a mobile metabolite that induces systemic disease resistance in Arabidopsis. Proceedings of the National Academy of Sciences, 115(21): E4920–E4929. https://doi.org/10.1073/pnas.1805291115 Chen, Z., Zheng, Z., Huang, J., Lai, Z., & Fan, B. (2009). Biosynthesis of salicylic acid in plants. Plant Signaling & Behavior, 4(6): 493–496. doi:10.4161/psb.4.6.8392 Cheng, S. H., Willmann, M. R., Chen, H. C., & Sheen, J. (2002). Calcium signaling through protein kinases. The Arabidopsis calcium-dependent protein kinase gene family. Plant Physiology, 129(2): 469–485. doi:10.1104/pp.005645 Chinchilla, D., Zipfel, C., Robatzek, S., Kemmerling, B., Nürnberger, T., Jones, J. D. G., … Boller, T. (2007). A flagellin-induced complex of the receptor FLS2 and BAK1 initiates plant defense. Nature, 448(7152): 497–500. https://doi.org/10.1038/nature05999 Choi, H. W., & Klessig, D. F. (2016). DAMPs, MAMPs, and NAMPs in plant innate immunity. BMC Plant Biology, 16(1): 232. doi:10.1186/s12870-016-0921-2

45

Choi, J., Tanaka, K., Cao, Y., Qi, Y., Qiu, J., Liang, Y., Lee, S.Y. and Stacey, G. (2014) Identification of a plant receptor for extracellular ATP. Science, 343: 290–294. Chong, J., Pierrel, MA, Atanassova,R, Werck-Reichhart, D, Fritig, B, Saindrenan,P. (2001). Free and conjugated benzoic acid in tobacco plants and cell cultures. Induced accumulation upon elicitation of defense responses and role as salicylic acid precursors. Plant Physiology, 125(1): 318–328. https://doi.org/10.1104/pp.125.1.318 Christensen P, Cook FD (1978) Lysobacter, a new genus of nonfruiting, gliding bacteria with high base ratio. Int J Syst Bacteriol, 28:367–393 Clarke, C. R., Chinchilla, D., Hind, S. R., Taguchi, F., Miki, R., Ichinose, Y., … Vinatzer, B. A. (2013). Allelic variation in two distinct Pseudomonas syringae flagellin epitopes modulates the strength of plant immune responses but not bacterial motility. The New Phytologist, 200(3): 847–860. doi:10.1111/nph.12408 Cohen, Y., Rubin, A. E., & Kilfin, G. (2010). Mechanisms of induced resistance in lettuce against Bremia lactucae by DL-β-amino-butyric acid (BABA). European Journal of Plant Pathology, 126(4): 553–573. https://doi.org/10.1007/s10658-009-9564-6 Conrath U. (2006). Systemic acquired resistance. Plant Signaling & Behavior, 1(4): 179-84. Coquoz, J. L., Buchala, A., & Metraux, J. P. (1998). The biosynthesis of salicylic acid in potato plants. Plant physiology, 117(3): 1095–1101. doi:10.1104/pp.117.3.1095 Daxberger, A., Nemak, A., Mithöfer, A., Fliegmann, J., Ligterink, W., Hirt, H., & Ebel, J. (2007). Activation of members of a MAPK module in β-glucan elicitor-mediated non-host resistance of soybean. Planta, 225(6): 1559–1571. https://doi.org/10.1007/s00425-006-0442-6 Després, C., Chubak, C., Rochon, A., Clark, R., Bethune, T., Desveaux, D., & Fobert, P. R. (2003). The Arabidopsis NPR1 disease resistance protein is a novel cofactor that confers redox regulation of DNA binding activity to the basic domain/leucine zipper transcription factor TGA1. The Plant Cell, 15(9): 2181–2191. doi:10.1105/tpc.012849 Dey, S., Wenig, M., Langen, G., Sharma, S., Kugler, K. G., Knappe, C., … Vlot, A. C. (2014). Bacteria-triggered systemic immunity in barley is associated with WRKY and ETHYLENE RESPONSIVE FACTORs but not with salicylic acid. Plant physiology, 166(4): 2133–2151. doi:10.1104/pp.114.249276 Ding, Y., Sun, T., Ao, K., Peng, Y., Zhang, Y., Li, X., & Zhang, Y. (2018). Opposite roles of salicylic acid receptors NPR1 and NPR3/NPR4 in transcriptional regulation of plant immunity. Cell, 173(6): 1454-1467.e10. https://doi.org/10.1016/j.cell.2018.03.044 Dodd AN, Kudla J, Sanders D (2010) The language of calcium signaling. Annu Rev Plant Biol 61: 593–620 Dodds, P. N., & Rathjen, J. P. (2010). Plant immunity: towards an integrated view of plant–pathogen interactions. Nature Reviews Genetics, 11(8): 539–548. https://doi.org/10.1038/nrg2812 Dong, L., Cheng, Y., Wu, J., Cheng, Q., Li, W., Fan, S., … Zhang, S. (2015). Overexpression of GmERF5, a new member of the soybean EAR motif-containing ERF

46

transcription factor, enhances resistance to Phytophthora sojae in soybean. Journal of Experimental Botany, 66(9): 2635–2647. https://doi.org/10.1093/jxb/erv078 Fernández-Calvo, P., Chini, A., Fernández-Barbero, G., Chico, J. M., Gimenez-Ibanez, S., Geerinck, J., … Solano, R. (2011). The Arabidopsis bHLH transcription factors MYC3 and MYC4 are targets of JAZ repressors and act additively with MYC2 in the activation of jasmonate responses. The Plant Cell, 23(2): 701–715. doi:10.1105/tpc.110.080788 Feys, B. J., Moisan, L. J., Newman, M. A., & Parker, J. E. (2001). Direct interaction between the Arabidopsis disease resistance signaling proteins, EDS1 and PAD4. The EMBO Journal, 20(19): 5400–5411. doi:10.1093/emboj/20.19.5400 Fonseca S, Chini A, Hamberg M, et al. (2009). (+)-7-iso-jasmonoyl-L-isoleucine is the endogenous bioactive jasmonate. Nature Chemical Biology, 5:344–350. Furnkranz,M.,Adam,E.,Muller,H.,Grube,M.,Huss,H.,Winkler,J.andBerg,G.(2012)Promotion of growth, health, and stress tolerance of Styrian oil pumpkins by bacterial endophytes. Eur J Plant Pathol 143: 509–519. Giesler, L. J., & Yuen, G. Y. (1998). Evaluation of Stenotrophomonas maltophilia strain C3 for biocontrol of brown patch disease. Crop Protection, 17(6): 509–513. https://doi.org/10.1016/S0261-2194(98)00049-0 Gilroy, S., Białasek, M., Suzuki, N., Górecka, M., Devireddy, A. R., Karpiński, S., & Mittler, R. (2016). ROS, calcium, and electric signals: key mediators of rapid systemic signaling in plants. Plant Physiology, 171(3): 1606–1615. https://doi.org/10.1104/pp.16.00434 Glazebrook, J. (2005). Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens. Annual Review of Phytopathology, 43(1): 205–227. https://doi.org/10.1146/annurev.phyto.43.040204.135923 Gómez-Gómez, L., & Boller, T. (2000). FLS2: An LRR Receptor-like kinase involved in the perception of the bacterial elicitor flagellin in Arabidopsis. Molecular Cell, 5, 1003–1011. Grant, D., Cregan, P., & Shoemaker, R. C. (2000). Genome organization in dicots: genome duplication in Arabidopsis and synteny between soybean and Arabidopsis. Proceedings of the National Academy of Sciences of the United States of America, 97(8): 4168–4173. doi:10.1073/pnas.070430597 Gust, A. A., Biswas, R., Lenz, H. D., Rauhut, T., Ranf, S., Kemmerling, B., … Nürnberger, T. (2007). Bacteria-derived peptidoglycans constitute pathogen-associated molecular patterns triggering innate immunity in Arabidopsis. Journal of Biological Chemistry, 282(44): 32338–32348. https://doi.org/10.1074/jbc.M704886200 Gust, A. A., Biswas, R., Lenz, H. D., Rauhut, T., Ranf, S., Kemmerling, B., … Nürnberger, T. (2007). Bacteria-derived peptidoglycans constitute pathogen-associated molecular patterns triggering innate immunity in Arabidopsis. Journal of Biological Chemistry, 282(44): 32338–32348. https://doi.org/10.1074/jbc.M704886200

47

Halter, T., Imkampe, J., Mazzotta, S., Wierzba, M., Postel, S., Bücherl, C., … Kemmerling, B. (2014). The leucine-rich repeat receptor kinase BIR2 is a negative regulator of BAK1 in plant immunity. Current Biology, 24(2): 134–143. https://doi.org/10.1016/j.cub.2013.11.047 Hann, D. R., & Rathjen, J. P. (2007). Early events in the pathogenicity of Pseudomonas syringae on Nicotiana benthamiana. Plant Journal, 49(4): 607–618. https://doi.org/10.1111/j.1365-313X.2006.02981.x Hartmann, M., Zeier, T., Bernsdorff, F., Reichel-Deland, V., Kim, D., Hohmann, M., … Zeier, J. (2018). Flavin monooxygenase-generated N-hydroxypipecolic acid is a critical element of plant systemic immunity. Cell, 173(2): 456-469.e16. https://doi.org/10.1016/j.cell.2018.02.049 Hayafune, M., Berisio, R., Marchetti, R., Silipo, A., Kayama, M., Desaki, Y., … Shibuya, N. (2014). Chitin-induced activation of immune signaling by the rice receptor CEBiP relies on a unique sandwich-type dimerization. Proceedings of the National Academy of Sciences of the United States of America, 111(3): E404–E413. doi:10.1073/pnas.1312099111 He, X., Jiang, J., Wang, C. Q., & Dehesh, K. (2017). ORA59 and EIN3 interaction couples jasmonate-ethylene synergistic action to antagonistic salicylic acid regulation of PDF expression. Journal of Integrative Plant Biology, 59(4): 275–287. doi:10.1111/jipb.12524 Hetherington AM, Brownlee C. (2004) .The generation of Ca(2+) signals in plants. Annu Rev Plant Biol, 55: 401–427 Hind, S. R., Strickler, S. R., Boyle, P. C., Dunham, D. M., Bao, Z., O’Doherty, I. M., … Martin, G. B. (2016). Tomato receptor FLAGELLIN-SENSING 3 binds flgII-28 and activates the plant immune system. Nature Plants, 2(9). https://doi.org/10.1038/nplants.2016.128 Holton, N., Nekrasov, V., Ronald, P. C., & Zipfel, C. (2015). The phylogenetically-related pattern recognition receptors EFR and XA21 recruit similar immune signaling components in monocots and dicots. PLoS Pathogens, 11(1): e1004602. doi:10.1371/journal.ppat.1004602 Horbach, R., Navarro-Quesada, A. R., Knogge, W., & Deising, H. B. (2011). When and how to kill a plant cell: Infection strategies of plant pathogenic fungi. Journal of Plant Physiology. https://doi.org/10.1016/j.jplph.2010.06.014 Huffaker, A., Pearce, G., & Ryan, C. A. (2006). An endogenous peptide signal in Arabidopsis activates components of the innate immune response. Proceedings of the National Academy of Sciences, 103(26): 10098–10103. https://doi.org/10.1073/pnas.0603727103 Jain, S., Varma, A., Tuteja, N., & Choudhary, D. K. (2016). Plant growth-promoting microbial-mediated induced systemic resistance in plants: Induction, mechanism, and expression. In Microbial-Mediated Induced Systemic Resistance in Plants (pp. 213–226). Springer Singapore. https://doi.org/10.1007/978-981-10-0388-2_15

48

Jeworutzki, E. , Roelfsema, M. R., Anschütz, U. , Krol, E. , Elzenga, J. T., Felix, G. , Boller, T. , Hedrich, R. and Becker, D. (2010): Early signaling through the Arabidopsis pattern recognition receptors FLS2 and EFR involves Ca2+‐associated opening of plasma membrane anion channels. The Plant Journal, 62: 367-378. doi:10.1111/j.1365-313X.2010.04155.x Jing, M., Ma, H., Li, H., Guo, B., Zhang, X., Ye, W., … Wang, Y. (2015). Differential regulation of defense-related proteins in soybean during compatible and incompatible interactions between Phytophthora sojae and soybean by comparative proteomic analysis. Plant Cell Reports, 34(7): 1263–1280. https://doi.org/10.1007/s00299-015-1786-9 Jirage, D., Tootle, T. L., Reuber, T. L., Frost, L. N., Feys, B. J., Parker, J. E.,et al. (1999). Arabidopsis thaliana PAD4 encodes a lipase-like gene that is important for salicylic acid signaling. Proc. Natl. Acad. Sci. U.S.A. 96: 13583–13588. doi: 10.1073/pnas.96.23.13583 Jochum, C. C., Osborne, L. E., & Yuen, G. Y. (2006). Fusarium head blight biological control with Lysobacter enzymogenes strain C3. Biological Control, 39(3): 336–344. https://doi.org/10.1016/j.biocontrol.2006.05.004 Ju C., Yoon G.M., Shemansky J.M., Lin D.Y., Ying Z.I., Chang J., Garrett W.M., Kessenbrock M., Groth G., Tucker M.L., et al. (2012). CTR1 phosphorylates the central regulator EIN2 to control ethylene hormone signaling from the ER membrane to the nucleus in Arabidopsis. Proc. Natl. Acad. Sci. USA. ,109:19486–19491. doi: 10.1073/pnas.1214848109. Kaku, H., Nishizawa, Y., Ishii-Minami, N., Akimoto-Tomiyama, C., Dohmae, N., Takio, K., … Shibuya, N. (2006). Plant cells recognize chitin fragments for defense signaling through a plasma membrane receptor. Proceedings of the National Academy of Sciences of the United States of America, 103(29): 11086–11091. doi:10.1073/pnas.0508882103 Ke, Y., Kang, Y., Wu, M., Liu, H., Hui, S., Zhang, Q., … Wang, S. (2019). Jasmonic acid-involved OsEDS1 signaling in rice-bacteria interactions. Rice, 12(1). https://doi.org/10.1186/s12284-019-0283-0 Ke, Y., Liu, H., Li, X., Xiao, J., and Wang, S. (2014). Rice OsPAD4 functions differently from Arabidopsis AtPAD4 in host-pathogen interactions. Plant Journal, 78: 619–631. doi: 10.1111/tpj.125002 Kieber JJ, Rothenberg M, Roman G, Feldmann KA, Ecker JR. (1993). CTR1, a negative regulator of the ethylene response pathway in Arabidopsis, encodes a member of the raf family of protein kinases. Cell,72:427–441. Kilic-Ekici, O., & Yuen, G. Y. (2003). Induced resistance as a mechanism of biological control by Lysobacter enzymogenes Strain C3. Phytopathology, 93(9): 1103–1110. https://doi.org/10.1094/PHYTO.2003.93.9.1103 Kilic-Ekici, O., & Yuen, G. Y. (2004). Comparison of strains of Lysobacter enzymogenes and PGPR for induction of resistance against Bipolaris sorokiniana in tall fescue. Biological Control, 30(2): 446–455.

49

Kim, N. Y., Jang, Y. J., & Park, O. K. (2018). AP2/ERF family transcription factors ORA59 and RAP2.3 interact in the nucleus and function together in ethylene responses. Frontiers in Plant Science, 9, 1675. doi:10.3389/fpls.2018.01675 Ko HS, Jin RD, Krishnan HB, Lee SB, Kim KY (2009) Biocontrol ability of Lysobacter antibioticus HS124 against phytophthora blight Is mediated by the production of 4-hydroxyphenylacetic acid and several lytic enzymes. Current Microbiology 59 (6): 608–615 Kobayashi, D. Y., & Yuen, G. Y. (2005). The role of clp -regulated factors in antagonism against Magnaporthe poae and biological control of summer patch disease of Kentucky bluegrass by Lysobacter enzymogenes C3 . Canadian Journal of Microbiology, 51(8): 719–723. https://doi.org/10.1139/w05-056 Kobayashi, DY. and Yuen, G.Y. (2007). The potential of Lysobacter spp. for biological control of plant diseases. CAB Reviews: Perspectives in Agriculture, Veterinary Science, Nutrition and Natural Resources,2(7) Koornneef, A., Leon-Reyes, A., Ritsema, T., Verhage, A., Den Otter, F. C., Van Loon, L. C., & Pieterse, C. M. (2008). Kinetics of salicylate-mediated suppression of jasmonate signaling reveal a role for redox modulation. Plant Physiology, 147(3): 1358–1368. doi:10.1104/pp.108.121392 Korolev, N., Rav David, D., & Elad, Y. (2008). The role of phytohormones in basal resistance and Trichoderma-induced systemic resistance to Botrytis cinerea in Arabidopsis thaliana. Biocontrol, 53(4): 667–683. https://doi.org/10.1007/s10526-007-9103-3 Kouzai, Y., Mochizuki, S., Nakajima, K., Desaki, Y., Hayafune, M., Miyazaki, H., … Nishizawa, Y. (2014). Targeted gene disruption of OsCERK1 reveals its indispensable role in chitin perception and involvement in the peptidoglycan response and immunity in rice . Molecular Plant-Microbe Interactions, 27(9): 975–982. https://doi.org/10.1094/mpmi-03-14-0068-r Krol E., Mentzel T., Chinchilla D., Boller T., Felix G., Kemmerling B., Postel S., Arents M., Jeworutzki E., Al-Rasheid K.A.S., Becker D., Hedrich R. (2010). Perception of the Arabidopsis danger signal peptide 1 involves the pattern recognition receptor AtPEPR1 and its close homologue AtPEPR2. J. Biol. Chem. 285: 13471–13479. Kunze, G. (2004). The N terminus of bacterial elongation factor Tu elicits innate immunity in Arabidopsis plants. Plant Cell 16: 3496–3507. Lacombe, S., Rougon-Cardoso, A., Sherwood, E., Peeters, N., Dahlbeck, D., Van Esse, H. P., … Zipfel, C. (2010). Interfamily transfer of a plant pattern-recognition receptor confers broad-spectrum bacterial resistance. Nature Biotechnology, 28(4): 365–369. https://doi.org/10.1038/nbt.1613 Lazazzara, V., Perazzolli, M., Pertot, I., Biasioli, F., Puopolo,G. and Cappellin, L. (2017) Growth media affect the volatilome and antimicrobial activity against Phytophthora infestansin four Lysobacter type strains.Microbiol Res, 201: 52–62

50

Lecourieux, D., Mazars C., Pauly N. , Ranjeva R., Pugin A.(2002). Analysis and effects of cytosolic free calcium increases in response to elicitors in Nicotiana plumbaginifolia cells. The Plant Cell Online, 14(10): 2627–2641. https://doi.org/10.1105/tpc.005579 Lee, H. J., Park, Y. J., Seo, P. J., Kim, J. H., Sim, H. J., Kim, S. G., & Park, C. M. (2015). Systemic immunity requires SnRK2.8-mediated nuclear import of NPR1 in Arabidopsis. The Plant Cell, 27(12): 3425–3438. doi:10.1105/tpc.15.00371 Lee, S. W., Han, S. W., Sririyanum, M., Park, C. J., Seo, Y. S., & Ronald, P. C. (2009). A type I-secreted, sulfated peptide triggers XA21-mediated innate immunity. Science, 326(5954): 850–853. https://doi.org/10.1126/science.1173438 Lemarié, S., Robert-Seilaniantz, A., Lariagon, C., Lemoine, J., Marnet, N., Jubault, M., … Gravot, A. (2015). Both the jasmonic acid and the salicylic acid pathways contribute to resistance to the biotrophic clubroot agent Plasmodiophora brassicae in Arabidopsis. Plant and Cell Physiology, 56(11): 2158–2168. https://doi.org/10.1093/pcp/pcv127 Leon-Reyes, A., Spoel, S. H., De Lange, E. S., Abe, H., Kobayashi, M., Tsuda, S., … Pieterse, C. M. J. (2009). Ethylene modulates the role of NONEXPRESSOR OF PATHOGENESIS-RELATED GENES1 in cross talk between salicylate and jasmonate signaling. Plant Physiology, 149(4): 1797–1809. https://doi.org/10.1104/pp.108.133926 Leon-Reyes, A., Van der Does, D., De Lange, E. S., Delker, C., Wasternack, C., Van Wees, S. C., … Pieterse, C. M. (2010). Salicylate-mediated suppression of jasmonate-responsive gene expression in Arabidopsis is targeted downstream of the jasmonate biosynthesis pathway. Planta, 232(6): 1423–1432. doi:10.1007/s00425-010-1265-z Li H., Leifert C. (1994). Development of resistance in Botryotinia fuckeliana (de Barry) Whetzel against the biological control agent Bacillus subtilis CL27. Z. Pflanzenkr. Pflanzenschutz 101: 414–418. Li J., Brader G.,Palva Et.(2004). The WRKY70 transcription factor: a node of convergence for jasmonate-mediated and salicylate-mediated signals in plant defense. The Plant Cell Online, 16(2): 319–331. https://doi.org/10.1105/tpc.016980 Li N, Han X, Feng D, Yuan D, Huang LJ.(2019). Signaling crosstalk between salicylic acid and ethylene/jasmonate in plant defense: do we understand what they are whispering?. Int J Mol Sci, 20(3):671 doi:10.3390/ijms20030671 Li, B., Meng, X., Shan, L., & He, P. (2016). Transcriptional regulation of pattern-triggered immunity in plants. Cell Host and Microbe. Cell Press. https://doi.org/10.1016/j.chom.2016.04.011 Li, J. , Brader, G. , Kariola, T. and Tapio Palva, E. (2006), WRKY70 modulates the selection of signaling pathways in plant defense. The Plant Journal, 46: 477-491. doi:10.1111/j.1365-313X.2006.02712.x Li, L., Yu, Y., Zhou, Z., & Zhou, J.-M. (2016). Plant pattern-recognition receptors controlling innate immunity. Science China Life Sciences, 59(12): 1350–1350. https://doi.org/10.1007/s11427-016-0291-9

51

Li, S., Du, L., Yuen, G.Y., and Harris, S.D. (2006) Distinct ceramide synthases regulate polarized growth in the filamentous fungus Aspergillus nidulans. Molec. Biol. Cell, 17:1218-1227. Li, S., C.C. Jochum, F. Yu, K. Zaleta-Rivera, L. Du, S.D. Harris, and G.Y. Yuen. (2008) An antibiotic complex from Lysobacter enzymogenes strain C3: antimicrobial activity and role in plant disease control. Phytopathology, 98:695-701. Li, Q., Zheng, J., Li, S., Huang, G., Skilling, S. J., Wang, L., … Liu, P. (2017). Transporter-mediated nuclear entry of jasmonoyl-isoleucine is essential for jasmonate signaling. Molecular Plant, 10(5), 695–708. https://doi.org/10.1016/j.molp.2017.01.010 Lin, H, Kogan, M, Fischer, D. (1990). Induced resistance in soybean to the mexican bean beetle (Coleoptera coccinellidae): comparisons of inducing factors, Environmental Entomology, 19(6): 1852–1857, https://doi.org/10.1093/ee/19.6.1852 Lindermayr, C., Sell, S., Müller, B., Leister, D., & Durner, J. (2010). Redox regulation of the NPR1-TGA1 system of Arabidopsis thaliana by nitric oxide. The Plant Cell, 22(8): 2894–2907. doi:10.1105/tpc.109.066464 Liu, B., Li, J. F., Ao, Y., Qu, J., Li, Z., Su, J., … Wang, H. B. (2012). Lysin motif-containing proteins LYP4 and LYP6 play dual roles in peptidoglycan and chitin perception in rice innate immunity. The Plant Cell, 24(8): 3406–3419. doi:10.1105/tpc.112.102475 Liu, D., Chen, X., Liu, J., Ye, J., & Guo, Z. (2012). The rice ERF transcription factor OsERF922 negatively regulates resistance to Magnaporthe oryzae and salt tolerance. Journal of Experimental Botany, 63(10): 3899–3912. https://doi.org/10.1093/jxb/ers079 Lorenzo, O. Piqueras R., Sanchez-Serrano, Solano R. (2003). ETHYLENE RESPONSE FACTOR1 integrates signals from ethylene and jasmonate pathways in plant defense. The Plant Cell Online, 15(1): 165–178. https://doi.org/10.1105/tpc.007468 Lou L, Qian G, Xie Y, Hang J, Chen H, Zaleta-Rivera K, Li Y, Shen Y, Dussault P, Liu F, and Du L (2011) Biosynthesis of HSAF, a tetramic acid-containing macrolactam from Lysobacter enzymogenes Journal of the American Chemical Society, 133 (4): 643-645 Lu, D., Wu, S., Gao, X., Zhang, Y., Shan, L., & He, P. (2009). A receptor-like cytoplasmic kinase, BIK1, associates with a flagellin receptor complex to initiate plant innate immunity. Proceedings of the National Academy of Sciences of the United States of America, 107(1), 496–501. doi:10.1073/pnas.0909705107 Maillet F, Poinsot V, Andre O, et al.(2011). Fungal lipochitooligosaccharide symbiotic signals in arbuscular mycorrhiza. Nature, 469: 58–63. Malamy, J., and Klessig, D. F. (1992). Salicylic acid and plant disease resistance. Plant J. 2: 643–654. doi: 10.1111/j.1365-313X.1992.tb00133.x Maldonado AM, Doerner P, Dixon RA, Lamb CJ, Cameron RK(2002).: A putative lipid transfer protein involved in systemic resistance signaling in Arabidopsis. Nature, 419(6905): 399-403. 10.1038/nature00962. Martínez-Medina, A., Fernández, I., Sánchez-Guzmán, M. J., Jung, S. C., Pascual, J. A., & Pozo, M. J. (2013). Deciphering the hormonal signaling network behind the systemic

52

resistance induced by Trichoderma harzianum in tomato. Frontiers in Plant Science, 4. https://doi.org/10.3389/fpls.2013.00206 Martínez‐Medina, A. , Fernandez, I. , Lok, G. B., Pozo, M. J., Pieterse, C. M. and Van Wees, S. C. (2017), Shifting from priming of salicylic acid‐ to jasmonic acid‐regulated defences by Trichoderma protects tomato against the root knot nematode Meloidogyne incognita. New Phytol, 213: 1363-1377. doi:10.1111/nph.14251 Mathioni, S. M., Patel, N., Riddick, B., Sweigard, J. A., Czymmek, K. J., Caplan, J. L., … Donofrio, N. M. (2013). Transcriptomics of the rice blast fungus Magnaporthe oryzae in response to the bacterial antagonist Lysobacter enzymogenes reveals candidate fungal defense response genes. PLoS ONE, 8(10). https://doi.org/10.1371/journal.pone.0076487 Mathys, J., De Cremer, K., Timmermans, P., Van Kerckhove, S., Lievens, B., Vanhaecke, M., … De Coninck, B. (2012). Genome-wide characterization of ISR induced in Arabidopsis thaliana by Trichoderma hamatum T382 against Botrytis cinerea infection. Frontiers in Plant Science, 3. https://doi.org/10.3389/fpls.2012.00108 Matthews, B. F., Beard, H., Brewer, E., Kabir, S., MacDonald, M. H., & Youssef, R. M. (2014). Arabidopsis genes, AtNPR1, AtTGA2 and AtPR-5, confer partial resistance to soybean cyst nematode (Heterodera glycines) when overexpressed in transgenic soybean roots. BMC Plant Biology, 14(1). https://doi.org/10.1186/1471-2229-14-96 Mazarei, M., Elling, A. A., Maier, T. R., Puthoff, D. P., & Baum, T. J. (2007). GmEREBP1 is a transcription factor activating defense genes in soybean and Arabidopsis . Molecular Plant-Microbe Interactions, 20(2): 107–119. https://doi.org/10.1094/mpmi-20-2-0107 Mazzola M., Cook R. J. (1991). Effects of fungal root pathogens on the population dynamics of biocontrol strains of fluorescent pseudomonads in the wheat rhizosphere. Appl. Environ. Microbiol., 57: 2171–2178 Miller, G., Schlauch, K., Tam, R., Cortes, D., Torres, M. A., Shulaev, V., … Mittler, R. (2009). The plant NADPH oxidase RBOHD mediates rapid systemic signaling in response to diverse stimuli. Science Signaling, 2(84). https://doi.org/10.1126/scisignal.2000448 Mishina, T. E., & Zeier, J. (2006). The Arabidopsis flavin-dependent monooxygenase FMO1 is an essential component of biologically induced systemic acquired resistance. Plant Physiology, 141(4): 1666–1675. doi:10.1104/pp.106.081257 Miya, A., Albert, P., Shinya, T., Desaki, Y., Ichimura, K., Shirasu, K., … Shibuya, N. (2007). CERK1, a LysM receptor kinase, is essential for chitin elicitor signaling in Arabidopsis. Proceedings of the National Academy of Sciences of the United States of America, 104(49): 19613–19618. doi:10.1073/pnas.0705147104 Moroz, N., Fritch, K. R., Marcec, M. J., Tripathi, D., Smertenko, A., & Tanaka, K. (2017). Extracellular alkalization as a defense response in potato cells. Frontiers in Plant Science, 8: 32. doi:10.3389/fpls.2017.00032 Mou, Z., Fan, W., & Dong, X. (2003). Inducers of plant systemic acquired resistance regulate NPR1 function through redox changes. Cell, 113(7): 935–44. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/12837250

53

Mur LJ, Kenton P. Atzorn R,, Miersch O, Wasternack C. (2005). The outcomes of concentration-specific interactions between salicylate and jasmonate signaling include synergy, antagonism, and oxidative stress leading to cell death. Plant Physiology, 140(1): 249–262. https://doi.org/10.1104/pp.105.072348 Nafie, E., & Mazen, M. (2008). Chemical – induced resistance against brown stem rot in soybean : the effect of benzothiadiazole. Journal of Applied Sciences, 4(12): 2046–2064. Nandakumar, R., 1998. Induction of systemic resistance in rice with fluorescent pseudomonads for the management of sheath blight disease. M.Sc. (Agric.). Thesis, TNAU, Coimbatore, India, p. 105. Návarová, H., Bernsdorff, F., Döring, A.-C., and Zeier, J. (2012). Pipecolic acid, an endogenous mediator of defense amplification and priming, is a critical regulator of inducible plant immunity. Plant Cell 24: 5123–5141. Ndamukong, I. , Abdallat, A. A., Thurow, C. , Fode, B. , Zander, M. , Weigel, R. and Gatz, C. (2007), SA‐inducible Arabidopsis glutaredoxin interacts with TGA factors and suppresses JA‐responsive PDF1.2 transcription. The Plant Journal, 50: 128-139. doi:10.1111/j.1365-313X.2007.03039.x Newman, M. A., Sundelin, T., Nielsen, J. T., & Erbs, G. (2013). MAMP (microbe-associated molecular pattern) triggered immunity in plants. Frontiers in Plant Science, 4: 139. doi:10.3389/fpls.2013.00139

Niu, D.-D., Liu, H.-X., Jiang, C.-H., Wang, Y.-P., Wang, Q.-Y., Jin, H.-L., & Guo, J.-H. (2011). The plant growth–promoting rhizobacterium Bacillus cereus AR156 induces systemic resistance in Arabidopsis thaliana by simultaneously activating salicylate- and jasmonate/ethylene-dependent signaling pathways . Molecular Plant-Microbe Interactions, 24(5), 533–542. https://doi.org/10.1094/mpmi-09-10-0213 Palumbo, J.D., Yuen, G.Y., Jochum, C.C, Tatum, K. and Kobayashi, D.Y. 2005. Mutagenesis of β-1,3-glucanase genes in Lysobacter enzymogenes strain C3 results in reduced biological control activity towards bipolaris leaf spot of tall fescue and pythium damping off of sugarbeet. Phytopathology, 95:701-707. Patel N, Oudemans PV, Hillman BI, Kobayashi DY (2013) Use of the tetrazolium salt MTT to measure cell viability effects of the bacterial antagonist Lysobacter enzymogenes on the filamentous fungus Cryphonectria parasitica. Antonie Van Leeuwenhoek, 103: 1-10. Park, J. H., Halitschke, R., Kim, H. B., Baldwin, I. T., Feldmann, K. A., & Feyereisen, R. (2002). A knock-out mutation in allene oxide synthase results in male sterility and defective wound signal transduction in Arabidopsis due to a block in jasmonic acid biosynthesis. Plant Journal, 31(1): 1–12. https://doi.org/10.1046/j.1365-313X.2002.01328.x Park, S.-W., Kaimoyo, E., Kumar, D., Mosher, S., and Klessig, D. F. (2007). Methyl salicylate is a critical mobile signal for plant systemic acquired resistance. Science, 318: 113–116.

54

Pauwels, L., Barbero, G. F., Geerinck, J., Tilleman, S., Grunewald, W., Pérez, A. C., … Goossens, A. (2010). NINJA connects the co-repressor TOPLESS to jasmonate signalling. Nature, 464(7289): 788–791. doi:10.1038/nature08854 Pearce, G., Munske, G., Yamaguchi, Y., & Ryan, C. A. (2010). Structure-activity studies of GmSubPep, a soybean peptide defense signal derived from an extracellular protease. Peptides, 31(12): 2159–2164. https://doi.org/10.1016/j.peptides.2010.09.004 Pearce, G., Yamaguchi, Y., Barona, G., & Ryan, C. A. (2010). A subtilisin-like protein from soybean contains an embedded, cryptic signal that activates defense-related genes. Proceedings of the National Academy of Sciences, 107(33): 14921–14925. https://doi.org/10.1073/pnas.1007568107 Penninckx, I. A. M. A., Thomma, B. P. H. J., Buchala, A., Metraux, J.-P., & Broekaert, W. F. (2007). Concomitant activation of jasmonate and ethylene response pathways is required for induction of a plant defensin gene in Arabidopsis. The Plant Cell, 10(12): 2103. https://doi.org/10.2307/3870787 Pieterse CMJ, van Wees SCM, van Pelt JA, Knoester M, Laan R, Gerrits H, Weisbeek PJ, van Loon LC (1998) A novel signalling pathway controlling induced systemic resistance in Arabidopsis. Plant Cell, 10:1571–1580 Postma, J., Stevens, L. H., Wiegers, G. L., Davelaar, E., & Nijhuis, E. H. (2009). Biological control of Pythium aphanidermatum in cucumber with a combined application of Lysobacter enzymogenes strain 3.1T8 and chitosan. Biological Control, 48(3): 301–309. https://doi.org/10.1016/j.biocontrol.2008.11.006 Pré, M., Atallah, M., Champion, A., De Vos, M., Pieterse, C. M., & Memelink, J. (2008). The AP2/ERF domain transcription factor ORA59 integrates jasmonic acid and ethylene signals in plant defense. Plant Physiology, 147(3): 1347–1357. doi:10.1104/pp.108.117523 Pruitt R.N., et al. (2015). The rice immune receptor XA21 recognizes a tyrosine-sulfated protein from a gram-negative bacterium. Sci. Adv. 1: e1500245. Puopolo G ,Cimmino A , Palmieri M.C., Giovannini O. , Evidente A. (2014) Lysobacter capsici AZ78 produces cyclo(L-Pro-L-Tyr), a 2,5-diketopiperazine with toxic activity against sporangia of Phytophthora infestans and Plasmopara viticola. Journal of Applied Microbiology, 117: 1168-1180 Puopolo G, Palmieri MC, Giovannini O, Pertot I (2015) Impact of temperature on the survival and the biocontrol efficacy of Lysobacter capsici AZ78 against Phytophthora infestans. Biocontrol 60:681–689 DOI 10.1007/s10526-015-9672-5 Puopolo G & Pertot, I. (2018). The impact of the omics era on the knowledge and use of Lysobacter species to control phytopathogenic micro-organisms. Journal of Applied Microbiology. Blackwell Publishing Ltd. https://doi.org/10.1111/jam.13607 Pusztahelyi T. (2018). Chitin and chitin-related compounds in plant-fungal interactions. Mycology, 9(3): 189–201. doi:10.1080/21501203.2018.1473299 Qi, Z., Verma, R., Gehring, C., Yamaguchi, Y., Zhao, Y., Ryan, C. A., & Berkowitz, G. A. (2010). Ca2+ signaling by plant Arabidopsis thaliana Pep peptides depends on

55

AtPepR1, a receptor with guanylyl cyclase activity, and cGMP-activated Ca2+ channels. Proceedings of the National Academy of Sciences of the United States of America, 107(49): 21193–21198. doi:10.1073/pnas.1000191107 Qi, Z., Verma, R., Gehring, C., Yamaguchi, Y., Zhao, Y., Ryan, C. A., & Berkowitz, G. A. (2010). Ca2+ signaling by plant Arabidopsis thaliana Pep peptides depends on AtPepR1, a receptor with guanylyl cyclase activity, and cGMP-activated Ca2+ channels. Proceedings of the National Academy of Sciences of the United States of America, 107(49): 21193–21198. doi:10.1073/pnas.1000191107 Qiao H., Shen Z., Huang S.C., Schmitz R.J., Urich M.A., Briggs S.P., Ecker J.R. (2012). Processing and subcellular trafficking of ER-tethered EIN2 control response to ethylene gas. Science, 338:390–393. doi: 10.1126/science.1225974. Ranf S, Gisch N, Schaffer M, et al.(2015) A lectin S-domain receptor kinase mediates lipopolysaccharide sensing in Arabidopsis thaliana. Nat Immunol,16: 426–433. Ranf, S. , Eschen‐Lippold, L. , Pecher, P. , Lee, J. and Scheel, D. (2011), Interplay between calcium signaling and early signaling elements during defense responses to microbe‐ or damage‐associated molecular patterns. The Plant Journal, 68: 100-113. doi:10.1111/j.1365-313X.2011.04671.x Reichenbach H. (2006). The genus Lysobacter, in the prokaryotes, eds Dworkin M., Falkow S., Rosenberg E., Schleifer K.-H., Stackebrandt E., editors. (New York, NY: Springer; ), 939–957 Reuveni, M., Zahavi, T., & Cohen, Y. (2001). Controlling downy mildew (Plasmopara viticola) in field-grown grapevine with β-aminobutyric acid (BABA). Phytoparasitica, 29(2), 125–133. https://doi.org/10.1007/BF02983956 Rietz, S. , Stamm, A. , Malonek, S. , Wagner, S. , Becker, D. , Medina‐Escobar, N. , Corina Vlot, A. , Feys, B. J., Niefind, K. and Parker, J. E. (2011), Different roles of Enhanced Disease Susceptibility1 (EDS1) bound to and dissociated from Phytoalexin Deficient4 (PAD4) in Arabidopsis immunity. New Phytologist, 191: 107-119. doi:10.1111/j.1469-8137.2011.03675.x Robatzek, S., Bittel, P., Chinchilla, D., Köchner, P., Felix, G., Shiu, S. H., & Boller, T. (2007). Molecular identification and characterization of the tomato flagellin receptor LeFLS2, an orthologue of Arabidopsis FLS2 exhibiting characteristically different perception specificities. Plant Molecular Biology, 64(5): 539–547. https://doi.org/10.1007/s11103-007-9173-8 Ron, M., & Avni, A. (2004). The receptor for the fungal elicitor ethylene-inducing xylanase is a member of a resistance-like gene family in tomato. The Plant cell, 16(6): 1604–1615. doi:10.1105/tpc.022475 Rosier, A., Medeiros, F. H. V., & Bais, H. P. (2018) Defining plant growth promoting rhizobacteria molecular and biochemical networks in beneficial plant-microbe interactions. Plant and Soil,428(1–2):35–55 https://doi.org/10.1007/s11104-018-3679-5 Ross AF (1961) Systemic acquired resistance induced by localized virus infections in plants. Virology, 14:340–358

56

Roux M., Schwessinger B., Albrecht C., Chinchilla D., Jones A., Holton N., Malinovsky F.G., Tör M., de Vries S., Zipfel C. (2011). The Arabidopsis leucine-rich repeat receptor-like kinases BAK1/SERK3 and BKK1/SERK4 are required for innate immunity to hemibiotrophic and biotrophic pathogens. Plant Cell 23: 2440–2455. Ruste´rucci C, Aviv DH, Holt BF, Dangl JL, Parker JE. (2001). The disease resistance signaling components EDS1 and PAD4 are essential regulators of the cell death pathway controlled by LSD1 in Arabidopsis. Plant Cell, 13:2211-2224. Saijo, Y., Loo, E. P. iian, & Yasuda, S. (2018). Pattern recognition receptors and signaling in plant–microbe interactions. Plant Journal, 93(4), 592–613. https://doi.org/10.1111/tpj.13808 Samain, E., Aussenac, T., & Selim, S. (2019). The effect of plant genotype, growth stage, and Mycosphaerella graminicola Strains on the efficiency and durability of wheat-induced resistance by Paenibacillus sp. strain B2. Frontiers in Plant Science, 10. https://doi.org/10.3389/fpls.2019.00587 Sanders D, Brownlee C, Harper JF.(1999) Communicating with calcium. Plant Cell, 11:691-706; PMID:10213787; http://dx.doi.org/10.1105/tpc.11.4.691 Schoonbeek, H. jan, Wang, H. H., Stefanato, F. L., Craze, M., Bowden, S., Wallington, E., … Ridout, C. J. (2015). Arabidopsis EF-Tu receptor enhances bacterial disease resistance in transgenic wheat. New Phytologist, 206(2): 606–613. https://doi.org/10.1111/nph.13356 Schwessinger, B., & Ronald, P. C. (2012). Plant innate immunity: perception of conserved microbial signatures. Annual Review of Plant Biology, 63(1): 451–482. https://doi.org/10.1146/annurev-arplant-042811-105518 Schwessinger, B., Bahar, O., Thomas, N., Holton, N., Nekrasov, V., Ruan, D., … Ronald, P. C. (2015). Transgenic expression of the dicotyledonous pattern recognition receptor EFR in rice leads to ligand-dependent activation of defense responses. PLoS Pathogens, 11(3), e1004809. doi:10.1371/journal.ppat.1004809 Seccareccia, I., Kost, C., & Nett, M. (2015). Quantitative analysis of Lysobacter predation. Applied and Environmental Microbiology, 81(20): 7098-105. Segonzac, C., Feike, D., Gimenez-Ibanez, S., Hann, D. R., Zipfel, C., & Rathjen, J. P. (2011). Hierarchy and roles of pathogen-associated molecular pattern-induced responses in Nicotiana benthamiana. Plant Physiology, 156(2): 687–699. doi:10.1104/pp.110.171249 Shimizu, T., Nakano, T., Takamizawa, D., Desaki, Y., Ishii-Minami, N., Nishizawa, Y., … Shibuya, N. (2010). Two LysM receptor molecules, CEBiP and OsCERK1, cooperatively regulate chitin elicitor signaling in rice. The Plant journal : For Cell and Molecular Biology, 64(2): 204–214. doi:10.1111/j.1365-313X.2010.04324.x Shimono, M., Sugano, S., Nakayama, A., Jiang, C. J., Ono, K., Toki, S., & Takatsuji, H. (2007). Rice WRKY45 plays a crucial role in benzothiadiazole-inducible blast resistance. The Plant Cell, 19(6): 2064–2076. doi:10.1105/tpc.106.046250

57

Shine, M. B., Xiao, X., Kachroo, P., & Kachroo, A. (2019). Signaling mechanisms underlying systemic acquired resistance to microbial pathogens. Plant Science, 279: 81-86 https://doi.org/10.1016/j.plantsci.2018.01.001 Shine, M. B., Yang, J. , El‐Habbak, M. , Nagyabhyru, P. , Fu, D. , Navarre, D. , Ghabrial, S. , Kachroo, P. and Kachroo, A. (2016), Cooperative functioning between phenylalanine ammonia lyase and isochorismate synthase activities contributes to salicylic acid biosynthesis in soybean. New Phytol, 212: 627-636. doi:10.1111/nph.14078 Shinya T, Nakagawa T, Kaku H, Shibuya N. (2015) Chitin-mediated plant-fungal interactions: catching, hiding and handshaking. Curr Opin Plant Biol, 26:64–71. Silverman, P., Seskar, M., Kanter, D., Schweizer, P., Metraux, J. P., & Raskin, I. (1995). Salicylic acid in rice (biosynthesis, conjugation, and possible role). Plant Physiology, 108(2): 633–639. https://doi.org/10.1104/pp.108.2.633 Spoel, S. H., Koornneef, A., Claessens, S. M., Korzelius, J. P., Van Pelt, J. A., Mueller, M. J., … Pieterse, C. M. (2003). NPR1 modulates cross-talk between salicylate- and jasmonate-dependent defense pathways through a novel function in the cytosol. The Plant Cell, 15(3): 760–770. doi:10.1105/tpc.009159 Staswick, P. E., & Tiryaki, I. (2004). The oxylipin signal jasmonic acid is activated by an enzyme that conjugates it to isoleucine in Arabidopsis. The Plant Cell, 16(8): 2117–2127. doi:10.1105/tpc.104.023549 Stringlis, I. A., Proietti, S. , Hickman, R. , Van Verk, M. C., Zamioudis, C. and Pieterse, C. M. (2018), Root transcriptional dynamics induced by beneficial rhizobacteria and microbial immune elicitors reveal signatures of adaptation to mutualists. Plant J, 93: 166-180. doi:10.1111/tpj.13741 Sugano, S., Jiang, C. J., Miyazawa, S. I., Masumoto, C., Yazawa, K., Hayashi, N.,et al. (2010). Role of OsNPR1 in rice defense program as revealed by genome wide expression analysis. Plant Mol. Biol. 74: 549–562. doi: 10.1007/s11103-010-9695-3 Sullivan, R. F., Holtman, M. A., Zylstra, G. J., White, J. F, Jr., and Kobayashi, D. Y.(2003). Taxonomic positioning of two biological control agents for plant diseases as Lysobacter enzymogenes based on phylogenetic analysis of 16S rDNA, fatty acid composition and phenotypic characteristics. J. Appl. Microbiol., 94:1079-1086. Tada, Y., Spoel, S. H., Pajerowska-Mukhtar, K., Mou, Z., Song, J., Wang, C., … Dong, X. (2008). Plant immunity requires conformational changes [corrected] of NPR1 via S-nitrosylation and thioredoxins. Science (New York, N.Y.), 321(5891): 952–956. doi:10.1126/science.1156970 Takai, R., Isogai, A., Takayama, S., & Che, F.-S. (2008). Analysis of flagellin perception mediated by flg22 receptor OsFLS2 in Rice. Molecular Plant-Microbe Interactions, 21(12): 1635–1642. https://doi.org/10.1094/mpmi-21-12-1635 Takeuchi Y, Yoshikawa M, Takeba G, Tanaka K, Shibata D, Horino O(1990) Molecular cloning and ethylene induction of mRNA encoding a phytoalexin elicitor-releasing factor, β-1,3-Endoglucanase, in Soybean. Plant Physiology.

58

Tang, D., Wang, G., & Zhou, J. M. (2017). Receptor kinases in plant-pathogen interactions: more than pattern recognition. The Plant Cell, 29(4): 618–637. doi:10.1105/tpc.16.00891 Tena, G., Boudsocq, M., & Sheen, J. (2011). Protein kinase signaling networks in plant innate immunity. Current Opinion in Plant Biology, 14(5): 519–529. doi:10.1016/j.pbi.2011.05.006 Thines, B., Katsir, L., Melotto, M., Niu, Y., Mandaokar, A., Liu, G., … Browse, J. (2007). JAZ repressor proteins are targets of the SCFCOI1 complex during jasmonate signaling. Nature, 448(7154): 661–665. https://doi.org/10.1038/nature05960 Thomma, B. P., Eggermont, K., Tierens, K. F., & Broekaert, W. F. (1999). Requirement of functional ethylene-insensitive 2 gene for efficient resistance of Arabidopsis to infection by Botrytis cinerea. Plant Physiology, 121(4): 1093–1102. Tian, A. G., Wang, J., Cui, P., Han, Y. J., Xu, H., Cong, L. J., … Chen, S. Y. (2004). Characterization of soybean genomic features by analysis of its expressed sequence tags. Theoretical and Applied Genetics, 108(5): 903–913. https://doi.org/10.1007/s00122-003-1499-2 Ton J, Jakab G, Toquin V, Flors V, Iavicoli A, Maeder MN, Métraux JP, Mauch-Mani B. (2005) Dissecting the beta-aminobutyric acid-induced priming phenomenon in Arabidopsis. Plant Cell 17: 987–999 Trail, F. (2009). For blighted waves of grain: Fusarium graminearum in the postgenomics era. Plant Physiology, 149(1): 103–110. https://doi.org/10.1104/pp.108.129684 Trdá L, Boutrot F, Claverie J, Brulé D, Dorey S, Poinssot B,.(2015). Perception of pathogenic or beneficial bacteria and their evasion of host immunity: pattern recognition receptors in the frontline. Frontiers in Plant Science, 6. https://doi.org/10.3389/fpls.2015.00219 Truman W, Bennett MH, Kubigsteltig I, Turnbull C, Grant M. (2007) Arabidopsis systemic immunity uses conserved defense signaling pathways and is mediated by jasmonates. Proc Natl Acad Sci USA 104: 1075–1080 Tucci, M. , Ruocco, M. , De Masi, L. , De Palma, M. and Lorito, M. (2011). The beneficial effect of Trichoderma spp. on tomato is modulated by the plant genotype. Molecular Plant Pathology, 12: 341-354. doi:10.1111/j.1364-3703.2010.00674.x Umemoto, N., Kakitani, M., Iwamatsu, A., Yoshikawa, M., Yamaoka, N., & Ishida, I. (2002). The structure and function of a soybean -glucan-elicitor-binding protein. Proceedings of the National Academy of Sciences, 94(3): 1029–1034. https://doi.org/10.1073/pnas.94.3.1029 United Soybean Board. (2018). Fungicide resistance. Retrieved from https://unitedsoybean.org/media-center/issue-briefs/fungicide-resistance/ Vallad, G. E., & Goodman, R. M. (2004). Systemic acquired resistance and induced systemic resistance in conventional agriculture. Crop Science,44: 1920–1934

59

Van den Berg, N., Mahomed, W., Olivier, N. A., Swart, V., & Crampton, B. G. (2018). Transcriptome analysis of an incompatible Persea americana-Phytophthora cinnamomi interaction reveals the involvement of SA- and JA-pathways in a successful defense response. PloS One, 13(10), e0205705. doi:10.1371/journal.pone.0205705 Van der Does, D., Leon-Reyes, A., Koornneef, A., Van Verk, M. C., Rodenburg, N., Pauwels, L., … Pieterse, C. M. (2013). Salicylic acid suppresses jasmonic acid signaling downstream of SCFCOI1-JAZ by targeting GCC promoter motifs via transcription factor ORA59. The Plant Cell, 25(2): 744–761. doi:10.1105/tpc.112.108548 Van Peer R & Schippers B.(1992). Lipopolysaccharides of plant growth-promoting Pseudomonas sp. strain WCS417r induce resistance in carnation to fusarium wilt. Neth J Plant Pathol, 98:129–39. Van Wees SCM, de Swart EAM, van Pelt JA, van Loon LC, Pieterse CMJ (2000) Enhancement of induced disease resistance by simultaneous activation of salicylate- and jasmonate dependent defense pathways in Arabidopsis thaliana. Proceedings of the National Academy of Sciences,97:8711–8716 Van Wees, S. C. M., Pieterse, C. M. J., Trijssenaar, A., Van ’t Westende, Y. A. M., Hartog, F., & Van Loon, L. C. (2007). Differential induction of systemic resistance in arabidopsis by biocontrol bacteria . Molecular Plant-Microbe Interactions, 10(6): 716–724. https://doi.org/10.1094/mpmi.1997.10.6.716 Verhagen, B. W. M., Glazebrook, J., Zhu, T., Chang, H.-S., van Loon, L. C., & Pieterse, C. M. J. (2007). The transcriptome of rhizobacteria-induced systemic resistance in Arabidopsis . Molecular Plant-Microbe Interactions, 17(8): 895–908. https://doi.org/10.1094/mpmi.2004.17.8.895 Vogel-Adghough, D., Stahl, E., Návarová, H., & Zeier, J. (2013). Pipecolic acid enhances resistance to bacterial infection and primes salicylic acid and nicotine accumulation in tobacco. Plant Signaling & Behavior, 8(11), e26366. doi:10.4161/psb.26366 Wan, W. L., Fröhlich, K., Pruitt, R. N., Nürnberger, T., & Zhang, L. (2019). Plant cell surface immune receptor complex signaling. Current Opinion in Plant Biology. Elsevier Ltd. https://doi.org/10.1016/j.pbi.2019.02.001 Wang, J., Shine, M. B., Gao, Q.-M., Navarre, D., Jiang, W., Liu, C., … Kachroo, A. (2014). Enhanced disease susceptibility1 mediates pathogen resistance and virulence function of a bacterial effector in soybean. Plant Physiology, 165(3): 1269–1284. https://doi.org/10.1104/pp.114.24249 Wang, K. L.-C., Li, H., & Ecker, J. R. (2002). Ethylene biosynthesis and signaling networks. The Plant Cell, 14(suppl 1), S131–S151. https://doi.org/10.1105/tpc.001768 Wang, Y., Schuck, S., Wu, J., Yang, P., Döring, A. C., Zeier, J., & Tsuda, K. (2018). A MPK3/6-WRKY33-ALD1-pipecolic acid regulatory loop contributes to systemic acquired resistance. The Plant Cell, 30(10): 2480–2494. doi:10.1105/tpc.18.00547 Wang, Z., Dai, L., Jiang, Z., Peng, W., Zhang, L., Wang, G., & Xie, D. (2007). GmCOI1 , a soybean F-Box protein gene, shows ability to mediate jasmonate-regulated plant defense and fertility in Arabidopsis . Molecular Plant-Microbe Interactions, 18(12): 1285–1295. https://doi.org/10.1094/mpmi-18-1285

60

Wasternack, C., & Hause, B. (2013). Jasmonates: biosynthesis, perception, signal transduction and action in plant stress response, growth and development. An update to the 2007 review in Annals of Botany. Annals of botany, 111(6): 1021–1058. doi:10.1093/aob/mct067 Wiermer, M., Feys, B. J., & Parker, J. E. (2005). Plant immunity: The EDS1 regulatory node. Current Opinion in Plant Biology. https://doi.org/10.1016/j.pbi.2005.05.010 Wildermuth, M. C., Dewdney, J., Wu, G., & Ausubel, F. M. (2001). Isochorismate synthase is required to synthesize salicylic acid for plant defense. Nature, 414(6863): 562–565. https://doi.org/10.1038/35107108 Willmann, R., Lajunen, H. M., Erbs, G., Newman, M. A., Kolb, D., Tsuda, K., … Nürnberger, T. (2011). Arabidopsis lysin-motif proteins LYM1 LYM3 CERK1 mediate bacterial peptidoglycan sensing and immunity to bacterial infection. Proceedings of the National Academy of Sciences of the United States of America, 108(49): 19824–19829. doi:10.1073/pnas.1112862108 Woldemariam, M. G., Gális, I., & Baldwin, I. T. (2014). Jasmonoyl-l-isoleucine hydrolase 1 (JIH1) contributes to a termination of jasmonate signaling in N. attenuata. Plant Signaling & Behavior, 9, e28973. Advance online publication. doi:10.4161/psb.28973 Yamaguchi, Y., Barona, G., Ryan, C. A., & Pearce, G. (2011). GmPep914, an eight-amino acid peptide isolated from soybean leaves, activates defense-related genes. Plant Physiology, 156(2): 932–942. https://doi.org/10.1104/pp.111.173096 Yamaguchi, Y., Huffaker, A., Bryan, A. C., Tax, F. E., & Ryan, C. A. (2010). PEPR2 is a second receptor for the Pep1 and Pep2 peptides and contributes to defense responses in Arabidopsis. The Plant cell, 22(2): 508–522. doi:10.1105/tpc.109.068874 Yamaguchi, Y., Pearce, G., & Ryan, C. A. (2006). The cell surface leucine-rich repeat receptor for AtPep1, an endogenous peptide elicitor in Arabidopsis, is functional in transgenic tobacco cells. Proceedings of the National Academy of Sciences, 103(26): 10104–10109. https://doi.org/10.1073/pnas.0603729103 Yang, S.F., and Hoffman, N.E. (1984). Ethylene biosynthesis and its regulation in higher-plants. Annu. Rev. Plant Physiol: Plant Mol. Biol. 35: 155–189. Yang, Y. N., Qi, M., and Mei, C. S. (2004). Endogenous salicylic acid protects rice plants from oxidative damage caused by aging as well as biotic and abiotic stress. Plant J. 40: 909–919. doi: 10.1111/j.1365-313X.2004.02267.x Yi, H.-S., Yang, J. W., & Ryu, C.-M. (2013). ISR meets SAR outside: additive action of the endophyte Bacillus pumilus INR7 and the chemical inducer, benzothiadiazole, on induced resistance against bacterial spot in field-grown pepper. Frontiers in Plant Science, 4. https://doi.org/10.3389/fpls.2013.00122 Yong SL, Anees M, Hyun HN, and Kim KY (2013) Biocontrol potential of Lysobacter antibioticus HS124 against the root-knot nematode, Meloidogyne incognita, causing disease in tomato. Nematology, 15(5):545 – 555

61

Yoshikawa M, Matama M, Masago H(1981) Release of a soluble phytoalexin elicitor from mycelial walls of Phytophthora megasperma var. sojae by soybean tissues. Plant Physiol, 67:1032–1035. Youssef, R. M., MacDonald, M. H., Brewer, E. P., Bauchan, G. R., Kim, K. H., & Matthews, B. F. (2013). Ectopic expression of AtPAD4 broadens resistance of soybean to soybean cyst and root-knot nematodes. BMC Plant Biology, 13(1). https://doi.org/10.1186/1471-2229-13-67 Yu K Soares JM Mandal MK Wang C Chanda B Gifford AN Fowler JS Navarre D Kachroo A Kachroo P. (2013). A feedback regulatory loop between G3P and lipid transfer proteins DIR1 and AZI1 mediates azelaic-acid-induced systemic immunity. Cell Reports, 3: 1266–1278. Yuen, G. Y., Broderick, K. C., Jochum, C. C., Chen, C. J., & Caswell-Chen, E. P. (2018). Control of cyst nematodes by Lysobacter enzymogenes strain C3 and the role of the antibiotic HSAF in the biological control activity. Biological Control, 117: 158–163. https://doi.org/10.1016/j.biocontrol.2017.11.007 Yuen, G. Y., Steadman, J. R., Lindgren, D. T., Schaff, D., & Jochum, C. (2001). Bean rust biological control using bacterial agents. Crop Protection, 20(5): 395–402. https://doi.org/10.1016/S0261-2194(00)00154-X Zander, M. , La Camera, S. , Lamotte, O. , Métraux, J. and Gatz, C. (2010), Arabidopsis thaliana class‐II TGA transcription factors are essential activators of jasmonic acid/ethylene‐induced defense responses. The Plant Journal, 61: 200-210. doi:10.1111/j.1365-313X.2009.04044.x Zander, M., Thurow, C., & Gatz, C. (2014). TGA transcription factors activate the salicylic acid-suppressible branch of the ethylene-induced defense program by regulating ORA59 expression. Plant Physiology, 165(4): 1671–1683. doi:10.1104/pp.114.243360 Zhang Z and Yuen G (2000) Effects of culture fluids and preinduction of chitinase production on biocontrol of Bipolaris Leaf Spot by Stenotrophomonas maltophilia C3. Biological Control, 18(3): 277-286 Zhang, L., Kars, I., Essenstam, B., Liebrand, T. W., Wagemakers, L., Elberse, J., … van Kan, J. A. (2013). Fungal endopolygalacturonases are recognized as microbe-associated molecular patterns by the arabidopsis receptor-like protein RESPONSIVENESS TO BOTRYTIS POLYGALACTURONASES1. Plant Physiology, 164(1): 352–364. doi:10.1104/pp.113.230698 Zhang, W., Huffman, J., Li, S., Shen, Y., & Du, L. (2017). Unusual acylation of chloramphenicol in Lysobacter enzymogenes, a biocontrol agent with intrinsic resistance to multiple antibiotics. BMC Biotechnology, 17(1). https://doi.org/10.1186/s12896-017-0377-y Zhang, Z., & Yuen, G. Y. (1999). Biological Control of Bipolaris sorokiniana on Tall Fescue by Stenotrophomonas maltophilia Strain C3. Phytopathology, 89(9): 817–822. https://doi.org/10.1094/PHYTO.1999.89.9.817

62

Zhang, Z., Yuen, G.Y., Sarath, G., and Penheiter, A. (2001). Chitinases from the plant disease biocontrol agent, Stenotrophomonas maltophilia C3. Phytopathology, 91:204-211. Zhou, C., Zhang, L., Duan, J., Miki, B., & Wu, K. (2005). HISTONE DEACETYLASE19 is involved in jasmonic acid and ethylene signaling of pathogen response in Arabidopsis. The Plant Cell, 17(4): 1196–1204. doi:10.1105/tpc.104.028514 Zhou, J.-M., Trifa, Y., Silva, H., Pontier, D., Lam, E., Shah, J., & Klessig, D. F. (2007). NPR1 differentially interacts with members of the TGA/OBF family of transcription factors that bind an element of the PR-1 gene required for induction by salicylic acid . Molecular Plant-Microbe Interactions, 13(2): 191–202. https://doi.org/10.1094/mpmi.2000.13.2.191 Zhou, N., Tootle, T. L., Tsui, F., Klessig, D. F., and Glazebrook, J. (1998). PAD4 functions upstream from salicylic acid to control defense responses in Arabidopsis. Plant Cell, 10: 1021–1030. doi: 10.1105/tpc.10.6.1021 Zhou, X., Qian, G., Chen, Y., Du, L., Liu, F., & Yuen, G. Y. (2015). PilG is involved in the regulation of twitching motility and antifungal antibiotic biosynthesis in the biological control agent Lysobacter enzymogenes. Phytopathology, 105(10): 1318–1324. https://doi.org/10.1094/PHYTO-12-14-0361-R Zhu S, Jeong RD, Venugopal SC, Lapchyk L, Navarre D, et al. (2011) SAG101 forms a ternary complex with EDS1 and PAD4 and is required for resistance signaling against Turnip Crinkle Virus. PLOS Pathogens, 7(11): e1002318. https://doi.org/10.1371/journal.ppat.1002318 Zhu, Z., An, F., Feng, Y., Li, P., Xue, L., A, M., … Guo, H. (2011). Derepression of ethylene-stabilized transcription factors (EIN3/EIL1) mediates jasmonate and ethylene signaling synergy in Arabidopsis. Proceedings of the National Academy of Sciences, 108(30): 12539–12544. https://doi.org/10.1073/pnas.1103959108 Zipfel, C., Kunze, G., Chinchilla, D., Caniard, A., Jones, J.D.G., Boller, T., and Felix, G. (2006). Perception of the bacterial MAMP EF-Tu by the receptor EFR restricts agrobacterium-mediated transformation. Cell, 125: 749–760.

63

1.10 Tables Table 1: Biocontrol of various pathogens by Lysobacter

Species Pathogen Disease Host References

L.antibioticus HS124 Meloidogyne incognita Root knot Tomato Lee et al., 2013

Phytophthora capsici Phytophthora blight Pepper Ko et al., 2009

L. antibioticus 13-6

Meloidogyne incognita Tomato root-knot Tomato Zhou et al., 2016

Phytophthora infestans Tomato late blight Tomato Puopolo et al., 2015

L. capsici AZ78 Plasmopara viticola Grapevine downy mildew Grape vine Puopolo et al., 2014

L. enzymogenes 3.1 T8

Pythium aphanidermatum Root and crown rot Cucumber Postma et al., 2009

L. enzymogenes C3

Bipolaris sorokiniana Leaf spot Tall fescue Zhang & Yuen, 1999

Fusarium graminearum Fusarium Head Blight Wheat Jochum et al., 2006

Heterodera glycines Soybean cyst nematode Soybean Yuen et al., 2018

Heterodera schachtii Sugarbeet cyst nematode Sugar beet Yuen et al.,2018

Magnaporthe poae Summer patch Kentucky bluegrass

Kobayashi & Yuen, 2005

Rhizoctonia solani Brown spot Tall fescue Giesler & Yuen, 1998

Uromyces appendiculatus Bean rust Pinto bean Yuen et al., 2001

L. gummosus L101 Sphaerotheca fuliginea Powdery mildew Pumpkin Furnkranz et al., 2012

64

Table 2: PRRs and their corresponding MAMPs and DAMPs *created by Walnut J, adapted from Saijo et al., 2018

Family PRR or PRR complex

Cell surface receptors Ligand Plant References

LRR

FLS2/BAK1 RLK flg22 Arabidopsis Chinchilla et al., 2007; Gómez and Boller, 2000; Roux et al., 2011

FLS3/BAK1 RLK flgII-28 Tomato Hind et al., 2016

EFR/BAK1 RLK elf18 Arabidopsis Kunze et al., 2004; Roux et al., 2011; Zipfel et al., 2006

XA21/SERK2 RLK RarX21-sY Rice Pruitt et al., 2015

CORE/SERK3a RLK CSP22 Tomato Albert et al., 2016

LeEix2 RLP xylanase Tomato Ron et al., 2004

Unknown Unknown GmPep914 soybean Yamaguchi et al., 2011

Unknown Unknown GmPep890 soybean Yamaguchi et al., 2011

RBPG1 RLP endopolygalacturonases Arabidopsis Zhang et al., 2013

PEPR1/2 RLK AtPep1/2 Arabidopsis Huffaker et al., 2006; Krol et al., 2010; Qi et al., 2010; Yamaguchi et al., 2010

LysM

OsCERK1/OsCEBiP RLK/RLP chitin Rice Shimizu et al., 2010

AtCERK1/AtLYK5 RLK chitin Arabidopsis Miya et al., 2007

AtLYM1/AtLYM3 /AtCERK1

RLP/RLP/RLK

Peptidoglycan Arabidopsis Willmann et al., 2011

OsLYP4/OsLYP6/ OsCERK1

RLP/RLP and RLK

Peptidoglycan Rice Liu et al., 2012

OsCERK1 RLK Myc-LCOCO4 Rice Carotenuto et al., 2017

LjNFR5/LfNFR1 RLK Nod factor L. japonicus Maillet et al., 2011

MtNFP/MtLYK3 RLK Nod factor M. truncatula Maillet et al., 2011

GmGEBP/β-glucan-binding protein

RLK β-Glucan elicitors (GEs)

Soybean Daxberger et al., 2007; Takeuchi et al., 1990; Umemoto et al., 2002; Yoshikawa et al., 1981

B-Lec

LORE RLK lipid A Arabidopsis Ranf et al., 2015

Pi‐d2 RLK unknown Rice Chen et al., 2006

DORN1/LecRK‐I.9 RLK ATP Arabidopsis Choi et al., 2014

EGF WAK1 RLK ligogalacturonides Arabidopsis Brutus et al., 2010

65

Figures 1.11

Figure 1: PTI induced phosphorylation signaling cascade. MAMP binding leads to the dimerization of PRRs. Membrane-anchored kinases associated and the kinase domain of the PRR transphosphorylate each other inducing a signaling cascade of MAPKKK,MAPKK, and finally MAPK. Ca2+ influx into the cell and ROS production initiate defense responses. Ca2+

binds to CDPKs, activating them. MAPKs and CDPKS go onto phosphorylate transcription factors that will either induces or suppress defense genes. Ca2+ influx The ROS act as self-propagating systemic defense signals.

Figure created by Walnut J

66

Figure 2: Synthesis of ET, JA, and SA. Created by Walnut J.

67

Figure 3: Simplified interactions between JA (Blue), SA (Orange), and ET (Green) signaling during plant defense responses in Arabidopsis. During necrotrophic pathogen infection, JA and ET signaling is activated. JA and ET signaling activate ET response factors and PR2,PR3, and PDF1.2 Rice PAD4 induces JA accumulation, not SA. During biotrophic pathogen infection, SA and ET signaling is activated. In Arabidopsis ICS is the main gene for SA synthesis, but in Soybean both ICS and PAL genes are required for SA synthesis. Unlike Arabidopsis, cytosolic not nucleic NPR1 monomers inhibit JA signaling in rice. In rice, NPR1 is not the main regulatory node during SA signaling, but acts in parallel with WRK45 to mediate defense responses. In Arabidopsis, EIN3 targets ORA59 for ubiquitination. During, JA signaling EIN3 is prevented from binding to ORA59 .Arrows in purple represent signaling differences in rice, and red indicated differences in soybeans. Arrows indicate positive interactions, blunt-ended lines indicate inhibitory interactions. Created by Walnut J.

68

Chapter 2 Hormonal signaling induced in soybean by Lysobacter

enzymogenes strain C3

2.1 Introduction

Lysobacter enzymogenes strain C3 is a biocontrol bacterium that is capable of

inhibiting fungal and nematode pathogens in the greenhouse and field ( Jochum et al.,

2006; Kilic Ekici and Yuen, 2003; Kobayashi et al.,2005; Yuen et al., 2001; Yuen et al.,

2018; Zhang et al., 2000). The biological control activity of C3 has been shown to be due

in part to antagonism via the production of antimicrobial compounds such as proteases,

lipases, chitinases, and β-1,3-glucanases. (Puopolo et al., 2018; Zhang et al., 2000). In

addition, C3 exudes a potent antimicrobial secondary metabolite Heat Stable Antifungal

Factor (HSAF), that disrupts sphingolipids synthesis critical in maintaining polarized

growth of filamentous fungi (Li et al., 2006; Li et al., 2008). In addition to antagonism,

localized and systemic induced resistance also have been shown to be a mechanism for

biological control by C3 (Kilic-Ekici and Yuen, 2003). Localized induced resistance is

confined to the treated plant tissue. Systemic induced resistance leads to the inhibition of

pathogen infection in untreated or uninfected tissues (Van Loon, 1997).When heat killed

or live C3 cells were applied to a portion of a single tall fescue leaf blade or wheat leaf,

the treatment provided protection for the entire leaf blade against B. sorokiniana

infection, but there was no inhibitory effect against pathogen conidial germination on

non-treated leaves (Kilic-Ekici and Yuen, 2003). Treatment of tall fescue roots with C3

led to a systemic induced resistance response in leaves. Furthermore, root treatments

69

enhanced peroxidase activity, a common marker for plant defense responses, in the roots

and foliage indicating that the plant response to C3 is spread throughout the plant (Kilic-

Ekici and Yuen, 2003). There are limitations of which pathogens C3 systemic induced

resistance is effective at controlling. For example, treatment of wheat heads protected

those parts from infection by Fusarium graminearum through localized induced

resistance, but application of C3 to roots did not led to a significant decrease in Fusarium

head blight (FHB) in the wheat heads (Jochum et al., 2006). Currently, there is no work

studying C3 induced resistance in dicots.

Depending on the inducing organism, systemic induced resistance can either be

characterized as Induced Systemic Resistance (ISR) which is elicited by beneficial and

non-pathogenic microbes or Systemic Acquired Resistance (SAR) which is elicited by

pathogenic microbes. Both forms of systemic induced resistance result in protection

against a broad spectrum of pathogens. SAR is typically associated with activation of the

phytohormone salicylic acid (SA) and pathogenesis related proteins (PRs) in local and

systemic tissues (Shine et al., 2019). Salicylic acid leads to an immediate induction of

defense genes in distal tissues. ISR, typically is not dependent on SA, but instead is

associated with jasmonic acid (JA) and ethylene (ET) signaling (Pieterse et al., 1998;

Verhagen et al.,2007). During ISR, there is typically no immediate systemic upregulation

of defense genes or phytohormones. This is a typical response during jasmonic acid (JA)

and ethylene (ET) mediated induced resistance. Instead, all studies have shown ISR leads

to priming. Priming is the phenomena in which untreated plant parts can evoke a more

robust and timely responses to pathogens (Conrath et al., 2006). While pathogenic

microbes can lead to a priming effect, it is often overlooked as there is an immediate

70

defense response in distal tissues that is effective in inhibiting pathogens. Induced

through ISR is part of the biocontrol arsenal that will lead to more effective disease

control. Plants that are primed, evoke a faster defense response as well as an increased

production of defense compounds when a pathogen is introduced (Conrath et al., 2006).

As mentioned above, ISR historically has been associated with the induction of

the JA/ET pathways by nonpathogenic microbes. Yet, there are many exceptions to this

concept, such as rhizobia capable of inducing SAR marker PR1 during ISR (Niu et al.,

2011). Moreover, there are examples of beneficial fungi such as Trichoderma being able

to elicit a systemic induced resistance response with measurable upregulation of AOS

(JA) ACO (ET) , and PAD4 (SA) genes systemically. Trichoderma treatment can show

measurable induced defenses in distal tissues as little as 2 days after treatment, without

pathogen inoculation (Yuan et al., 2019). Other than the inducing agents, it is becoming

increasingly difficult to distinguish ISR and SAR the associated traits are not mutually

exclusive and can be overlapping.

The response to the same bacterial inducer can vary by plant species. One study

found that Pseudomonas putidaWCS358r can induce ISR in Arabidopsis but not in other

dicot species such as radishes. While, P. fluorescens WCS374r was not able to induce

ISR in Arabidopsis (Van Peer et al., 1992). Previous work has shown that WCS374r is

able to induce resistance in radish and carnation (Leeman et al., 1995; Van Wees et al.,

2007). As previously stated, there is no current work studying the interaction between C3

and soybeans in terms of induced resistance. If C3 were to be implemented as a

biocontrol agent in the field, especially for important agronomic crops, it is important to

understand how it interacts with said crops. The information gained from C3 studies in

71

monocots such as wheat and tall fescue can be used as starting points but cannot be

transferred to dicots.

Currently, there is work studying induced resistance in soybean elicited by nodule

forming rhizobia, chemical elicitors, and insects. In legumes, such as soybean, there has

been particular interest in resistance induced by nodule forming bacteria. For example,

one study isolated Nod Bj-V (C18:1, MeFuc) from soybean symbiot, Bradyrhizobium

japonicum, and demonstrated that it can induce resistance in soybeans to powdery

mildew pathogen Microsphaera diffusa (Duzan et al., 2005). When applied to the roots,

Nod Bj-V (C18:1, MeFuc) enhanced PAL enzyme activity in soybean leaves, leading to

reduced disease severity (Duzan et al., 2005). Local induced resistance by co-treatment

with arbuscular mycorrhizal fungi (AMF) and rhizobia has been studied as well. Roots

treated with AMF Glomus mosseae and nodule forming rhizobia Bradyrhizobium sp has

reduced root crown rot (Cylindrocladium parasiticum) severity (Gao et al., 2012).

Researchers attributed this to direct antagonism and enhanced defense gene production.

Treated roots displayed higher PR and PAL induction when inoculated with C.

parasiticum compared to the untreated controls (Gao et al., 2012). In addition to

microbes, benzothiadiazole (BTH), a plant defense inducer, has been effective in

controlling soybean disease. When soybean plants were primed with BTH, leaves showed

reduced Phialophora gregata infection and an increased activity of PAL (Nafie and

Mazen, 2008).

The main objective of this study was to determine the induced resistance response

in soybeans upon C3 treatment. Soybean was selected as the research plant because it is

an important agronomic crop. According to the USDA, in 2018 the United States

72

harvested 8.9 million acres of soybeans with a value of $41 billion. While the industry is

profitable, the annual loss of bushels due to fungal pathogens and fungicide resistance

alone was 300 million bushels in 2016. Biological control is a sustainable method of

controlling pathogens that damage food and feed supply (United Soybean Board, 2018).

There were three objectives for this study. The first objective was to determine

whether C3 foliar treatment can induce a defense response locally in soybeans. The

second was to identify what hormone signaling pathways are activated in soybean foliage

by C3. The third was to determine whether the signaling pathway(s) elicited in the roots

by C3 can be manifested systemically in the foliage.

2.2 Materials and Methods

2.2.1 Plant Material Preparation

Soybean (Glycine max) cultivar Williams 82 was grown in approximately 150 ml

pasteurized potting mix contained in 21 cm deep Cone-tainers (Ray Leach, #SC-10U)

with one plant per Cone-tainer. Plants were grown in a greenhouse kept within a

temperature range of 23-26 oC. Cone-tainers were kept in trays (Ray Leach, #RL98) and

plants were watered through the tray underneath the Cone-tainers twice a day along with

fertilizer (20% nitrogen, 20% potassium, 20% phosphorous). Plants were grown until the

first pair of trifoliate leaves had expanded, between 14 to 20 days after planting.

Treatments were applied at that time. Plants that exhibited damage accrued during

emergence or insect feeding were discarded.

73

2.2.2 Treatment Preparation

Strain C3R5, a spontaneous rifampicin-resistant mutant of Lysobacter

enzymogenes C3, was used in all experiments. Cell suspensions containing108 colony-

forming units (CFU) ml−1 were made by transferring cells from 10% TSA culture plates

to sterile distilled water using a sterile spatula and adjusting turbidity to 0.0415 OD

measured using a spectrophotometer at 595 nm. The positive control used for the SA

pathway was acibenzolar-S-methyl (ASM), in the form of Actigard® 50WG (Syngenta),

that mimics the action of salicylic acid. A 3 mM solution of ASM was made by adding

1.26 g of Actigard to 1000 mL of sterilized distilled water (SDW) ( Kilic-Ekici & Yuen,

2003). The positive control used for the JA pathway was methyl jasmonate (MeJA)

(Sigma Aldrich, 392707) diluted with SDW to 50µM. The negative control was SDW. A

non-inducing surfactant (Induce; 0.25% v/v) was added to all solutions for foliar

treatments.

2.2.3 Foliar Application and Sample Collection

This experiment was performed to determine whether C3 can induce a general

defense response and to ascertain what defense hormones C3 elicits locally in soybean

foliage. All of the treatments described above were applied to soybean plants as a foliar

spray and then the leaves were assayed for their response to the treatments. This

experiment had a generalized randomized complete block design, with three repetitions

(trials). Wherein, each repetition was treated as a block and within each block the

treatments were arranged in a random fashion. The first trial had 3 biological replicates

per treatment per sampling date, and the subsequent two trials had 5 biological replicates

74

per treatment per sampling date. Treatments were sprayed onto foliage until they were

damp and dripping. The plants were left to dry. Plants were kept in the greenhouse placed

on trays and treatments were arranged randomly with space between each plant to avoid

cross contamination of treatments. A different plant was sampled at random at each

sampling time point. Each plant was only used for one sampling time, and then discarded.

Approximately 1 µg of leaf tissue from the first emerged trifoliate leaf was collected 2,

24 , 48 , and 72 hours after treatment (HrAT) and placed in separate sterile centrifuge

2.0ml tubes with copper beads. Samples were immediately placed in liquid nitrogen.

2.2.4 Root Treatment Application Sample Collection

The ability of C3 to induce defense responses in the foliage upon root treatment

was analyzed in a separate experiment. All treatments were applied as a root drench and

then the leaves were assayed for a defense response. This experiment had a generalized

randomized complete block design, with three repetitions (trials). Wherein, each

repetition was treated as a block and within each block the treatments were arranged in a

random fashion. Each trial had 3 biological replicates per treatment per sampling date. In

root drench treatments, 45ml of C3 (108 CFU ml−1) suspension, 3mM ASM , 50µM

MeJA, or SDW was added to the soil mix in each container. Treated plants were placed

in a randomized block in the trays, with space between each plant to avoid cross

contamination of treatments. A different plant was sampled at random at each sampling

time point. Each plant was only used for one sampling time, and then discarded. Samples

were collected at random 0,1,3,5,7, and 10 days after treatment (DAT). Approximately

1µg of leaf tissue from the first expanded trifoliate leaf was collected and placed in

75

separate sterile 2.0ml centrifuge tubes with copper beads. Upon sample collection, the

plant was discarded. In addition, roots were collected to quantify C3 populations at each

collection day, with three biological replicates per collection day. The purpose of

determining C3 populations was to verify that bacteria survived the root drench and

colonized soybean roots during the experiment. C3 populations were determined

following the method described by Musil (2016).

2.2.5 RNA Extraction and cDNA synthesis

Samples were ground into a fine powder using liquid nitrogen and sterile copper beads. 1

ml Tri reagent (T9424 Sigma ) was added to ground samples, and tubes were vortexed.

After incubation at room temperature for 5 minutes, 200 µl chloroform (EM Science

CX1059-1) was added and the tube was shaken vigorously for 15 sec, or until the mixture

became a cloudy milky color. Samples were incubated for 15 minutes. Tubes were spun

13,000 rpm for 15 min at 4°C, and the supernatant was pipetted into a sterile 1.5mL

centrifuge tube containing 500 µl isopropanol (I9516 Sigma). After a 10 min incubation

at room temperature, samples were centrifuged at 13,000 rpm 10 min at 4 °C. Pellets

were isolated and washed with 75% EtOH and then centrifuged at 12,000 rpm 5 min at

4°C. The EtOH was removed and 50µl of DNase- and Rnase-free sterile H2O was added

to dissolve the pellet. The extracted RNA was immediately placed on ice, and all

subsequent steps were performed on ice. RNA concentration and contamination in the

sample was measured using a nanodrop spectrophotometer (Thermo Scientific, Nanodrop

Lite spectrophotometer). Purified RNA samples were considered contamination free if

the 260nm/280nm absorbance ratio was between 1.80-2.10. An absorbance ratio below

76

1.80 indicates protein or phenol contamination. The RNA was then diluted to 1 µg/ul

with nuclease free water. Verso cDNA Synthesis Kit (Thermo Scientific™ AB1453A)

was used to synthesize cDNA. In a 200 µl sterile centrifuge tube the following materials

were added: 11µl sample RNA, 1 µl anchored oligo dT, and 2µl dNTP Mix (5 mM). The

mixture was placed in a thermocycler (Thermo Scientific, ARKTIK) with a program set

for 5min at 70 oC. After the cycle was completed the samples were placed back on ice

and the following materials were added, 4µl 5X cDNA Synthesis Buffer, 1µl RT

Enhancer, 1µl Verso™ Enzyme Mix. The mixture was placed back in the thermocycler

(Thermo Scientific, ARKTIK) to complete cDNA synthesis ( 45oC 45 min, 92 oC 2 min,

4 oC hold). The cDNA was then diluted 1:5 using nuclease-free water.

2.2.6 Quantitative PCR Analysis (qPCR)

The marker genes used in this study and the relationship of each gene in regard to

its function in the SA, JA, or ET pathways is provided in Figure 1. In order to measure

mRNA levels of marker genes, gene specific primers (Table 1) were designed using

mRNA sequences obtained from NCBI and primer design software Primer3 (v. 0.4.0).

Primer sets for PR1 and PR5 were reported in Mazarei et al., 200. Soybean Elongation

Factor alpha was used as a housekeeping gene in every qPCR run to normalize gene

expression (Table 1). Primers synthesized by Integrated DNA Technologies were diluted

to 100mM using nuclease-free water to be used as a stock solution. For qPCR reactions,

primers were diluted 1:10 using nuclease-free water. The qPCR reaction mixture

contained 9µl cDNA mix (5 µl QuantiFast SYBR Green PCR Kit [204054 Qiagen], 0.5

µl cDNA, 3.5 µl nuclease-free water) and 1µl primer mix (0.5 µl forward primer and

77

0.5µl reverse primer). qPCR mixture was pipetted into 0.1mL tube strips (Eppendorf,

#951022109) and place in a Mastercycler (Eppendorf Realplex2). The following qPCR

protocol was run: 94 oC 5 min, 40 times (94 oC, 45 sec, 55 oC 30 sec , 72 oC 1.5 min), in

addition a melting curve program (95oC, 15 sec, 60 oC15 sec,, 95 oC, 15 sec,) was run to

check for contamination. Fold changes of relative gene expression were calculated using

the delta-delta Ct method (Livak & Schmittgen, 2001). A fold change greater than 1.0

indicated upregulation, less than1.0 indicated downregulation, a 1.0 fold change indicated

that there was no change in gene regulation compared to the negative SDW control for

that sampling time. Extreme outliers were removed if the fold change seemed

biologically improbable based on other samples within the specific treatment and time.

2.2.7 Statistical Analysis

Results from multiple runs of an experiment were analyzed together. All

statistical analysis was performed using SAS (SAS Institute Inc., Cary, NC) and

Microsoft Excel. Data from each sampling date was analyzed separately by ANOVA to

determine whether there was a significant treatment effect. To determine whether

differences in fold change between pairs treatments were significant, a one tailed T-test

was performed., Differences between treatments and the SDW control at a particular

sampling time were considered significant when P≤0.1 and highly significant when

P<0.05. Differences between sampling times for a given treatment were considered

significant when there was no overlap in standard errors, which represents variation at the

90% confidence level.

78

2.3 Results

2.3.1 Local induction of the phenylpropanoid pathway upon C3 treatment

Prior to analyzing hormone responses to C3 treatment, the ability of C3 to induce a

resistance response in soybean needed to be ascertained. To this end, the activation of the

phenylpropanoid pathway was used as a determinant of a resistance response. During

pathogen infection, the phenylpropanoid pathway is involved in numerous defense

responses, including synthesis of lignin and in soybeans, isoflavone (Hahlbrock et al.,

1989; Yu et al., 2000). The gene transcript abundance of Phenylalanine ammonia-lyase

(PAL1) was measured. Relative gene transcript abundance, also referred to as relative gene

expression, was expressed as a fold change compared to SDW. C3 treatment elicited the

highest increase in GmPAL1 transcription as early as 2HrAT, with a 4.8-fold change in

transcription compared to SDW (Figure 2). C3 treatment induction of GmPAL1 continued

at 24HrAT (2.0-fold change) and 48HrAT (3.4-fold change), but gene transcription

upregulation was no longer present at 72HrAT (Figure 2). ASM is capable of inducing

resistance responses in soybeans (Tripathi et al., 2019) and therefore upregulation of

GmPAL1 by ASM treatment indicated that the experiment was successful. ASM induced

GmPAL1 expression at 48HrAT (3.1-fold change) and 72HrAT (1.8-fold change) (Figure

2). Taken together, C3 foliar treatment is capable of inducing a resistance response in

soybean foliage.

2.3.2 Local induction of SA pathway upon C3 treatment

To determine if C3 foliar treatment elicits local induction of the salicylic acid

(SA) pathway, the transcript abundance of 3 genes Phytoalexin Deficient 4 (GmPAD4),

79

Nonexpresser of PR genes 1 (GmNPR1), and Pathogenesis Related 1 (GmPR1) were

measured. SA signaling upstream of SA synthesis was assessed using GmPAD4 as a

marker gene because it is one of the first genes induced to begin SA accumulation (Jirage

et al., 1999; Zhou et al., 1998). PAD4 activity leads to SA accumulation, which in turns

leads to further PAD4 gene transcription (Jirage et al., 1999). C3 treatment resulted in an

initial decrease in GmPAD4 transcript abundance compared to SDW at 2HrAT (0.69-fold

change) (Figure 3). C3-treated foliage collected 24HrAT and 48HrAT showed a return in

GmPAD4 transcription to SDW levels. By 72HrAT GmPAD4 transcript abundance in C3

treated leaves were higher compared to the SDW treatment due to C3 treatment (1.54-

fold change) (Figure 3). ASM treated tissues did not show a significant increase in

GmPAD4 transcripts compared to SDW at any sampling time, which was expected as

ASM induces SA regulated genes downstream of SA accumulation.

Downstream of PAD4 activity and SA accumulation, NPR1 is an important

regulatory node of SA signaling. NPR1 activity is controlled through posttranslational

modifications and transcriptional regulation mediated by SA signaling (Cao et al.,1998;

Mukhtar et al., 2009; Yu et al., 2001). GmNPR1 is an oligomer connected by

intermolecular disulfide bonds in the cytoplasm. Upon reactive oxygen production

(ROS), the disulphide bonds are reduced and the NPR1 oligomer becomes a monomer,

allowing SA binding. After target binding is complete, the NPR1 monomer is degraded

and therefore new transcription of NPR1 needs to occur during SA signaling to replenish

NPR1 concentration (Mukhtar et al., 2009; Yu et al., 2001). GmNPR1-1 relative gene

transcription was upregulated by C3 treatment at 2HrAT (2.42-fold change) and 24HrAT

(1.98-fold change). Subsequent sampling times showed no increase in GmNPR1-1

80

transcription in the C3 treatment compared to SDW (Figure 4A). ASM showed similar

transcription levels as C3 treatment (Figure 4B).

NPR1 directly induces GmPR1,a well-established defense gene mediated by SA

signaling (Wu et al., 2011). Due to the interaction between NPR1 and GmPR1, it was

predicted that GmPR1 transcription would be upregulated by C3 treatment as it increased

GmNPR1-1 transcript abundance. GmPR1 transcript abundance was increased in the C3

over SDW at 24HrAT (8.04-fold change). C3 treated soybean tissues collected thereafter

also exhibited increased GmPR1 transcript abundance, with there being no significant

differences between the three sampling times (Figure 4B). The difference between timing

of GmNPR1-1 and GmPR1 transcript accumulation can be attributed to regular gene

activity during the SA signaling response as the positive control exhibited the same

transcript accumulation pattern of GmNPR1 and GmPR1 as in C3 treated tissues (Figure

4A,4B).

2.3.3 Local induction of JA and ET pathways upon C3 treatment

The jasmonic acid and ethylene pathways often act synergistically during

nonpathogenic microbe interactions (Pozo et al., 2004). To determine if this response

occurs during local induced resistance in response to C3 treatment, Allene Oxide

Synthase (GmAOS) and 1-aminocyclopropane-1-carboxylate synthase (GmACS), which

are genes involved in JA and ET synthesis, respectively, were selected. Both GmAOS

and GmACS encode enzymes critical to their respective biosynthetic pathways. AOS

converts (13S)-hydroperoxyoctadecatrienoic acid to allene oxide and ACS converts S-

Adenosyl methionine to 1-aminocyclopropane-1-carboxylic acid (ACC) (Park et

81

al.,2002; Staswick, 2004; Yang and Hoffman, 1984; Yang and Hoffman, 1984).

GmAOS2 transcripts accumulated to higher levels in the C3 treatment than SDW at

2HrAT (3.08-fold change), 24HrAT (1.87-fold change), and 72HrAT (1.92-fold change)

(Figure 5). C3 treatment did not result in an increase in GmAOS2 transcript abundance at

48HrAT compared to the SDW control. As with C3 treatment, MeJA treatment

upregulated transcription of GmAOS2 at 2HrAT and 24HrAT, but not at 48HrAT,

confirming that the regulation corresponds to jasmonic acid induced expression. C3

treatment caused increased GmACS abundance compared to SDW at 2HrAT (4.34-fold

change) (Figure 6).Then there was a significant reduction in GmACS transcription in the

C3 treatment such that GmACS transcription at 24HrAT and subsequent sampling times

were lower than or the same as in SDW. MeJA treatment led to a different expression

pattern. The initial upregulation of GmACS at 2HrAT was followed by a decrease in

transcription to SDW levels, similar to what was observed with C3 treatment. However,

MeJA treatment increased transcription at 48HrAT and 72HrAT, while C3 treatment did

not (Figure 6). These results suggest that C3 treatment leads to early activation of the JA

and ET pathways upstream of hormone synthesis.

Upstream transcription of genes involved in hormone synthesis does not

necessarily mean that JA and ET downstream signaling is occurring as JA signaling is

inhibited downstream of synthesis, through SA inhibition of JA mediated defense gene

transcription (Leon-Reyes et al., 2010; Van der Does et al., 2013). Therefore, a

downstream PR gene that is upregulated by JA and ET signaling was selected to assess

whether C3 treatment induces JA and ET mediated defense response. GmPR3, encoding a

chitinase, is activated by JA and ET, but not SA, therefore any upregulation of this gene

82

cannot be attributed to the SA pathway (Mazarei et al., 2007). C3 treatment led to an

accumulation of GmPR3 transcripts when applied to the foliage. GmPR3 induction

occurred 24HrAT (3.80-fold change), with a reduction in transcription 48HrAT (1.56-

fold change). , There was once again an upregulation of transcription (5.42-fold change)

in the C3 treatment at 72HrAT (Figure 7). MeJA treatment induced the same expression

pattern as C3 treatment from 2HrAT to 48HrAT. However, unlike C3 treatment, there

was no MeJA induced transcription of GmPR3 at 72HrAT (Figure 7). It is unclear if the

72HrAT expression difference is due to the difference in defense gene induction between

a bacterium and a hormone application. Nonetheless, the gene expression analyses

indicate that ET and JA pathways are activated upon C3 foliar treatment.

2.3.4 Systemic induction of defense hormones upon C3 root treatment

To assess if C3 root drench treatments applied to soybean could lead to systemic

induction of defense genes, GmPR1 and GmPR3 expression was analyzed in soybean

foliage after root treatment (Figure 8). Systemic resistance can lead to either measurable

transcription changes in distal tissues upon an induced resistance response, or a priming

response in which case no change in known defense related gene transcription will be

measured in distal tissues prior to pathogen inoculation. To assess if C3 root drench

treatments applied to soybean could lead to systemic induction of defense genes, GmPR1

and GmPR3 expression was analyzed in soybean foliage after root treatment (Figure 8).

ASM and MeJA were used as positive controls for systemic induction of GmPR1 and

GmPR3, respectively, as both treatments are known to induce systemic signaling in

soybeans. C3 treatment led to higher accumulation of GmPR1 transcripts 3DAT and

83

GmPR3 transcripts at 7DAT compared to SDW at those sampling dates (Figure 8A, 8B).

These responses to C3 treatment were relatively weak compared to the response to ASM

and MeJA, as both of these chemicals caused significantly higher transcription of their

response defense genes compared to SDW at most sampling dates. Unlike chemical

treatments, bacterial treatments may take more time to elicit a signal in the roots due to

time required to colonize the roots. This delayed induction of defense responses in

soybean foliage following root application compared to a foliage drench was also

reported by Kilic-Ekici and Yuen (2003) in tall fescue experiments. C3 foliar applications

increased peroxidase activity as early as 2HrAT, while a root drench activated peroxidase

activity 2DAT in the foliage (Kilic-Ekici and Yuen, 2003). As in root treatments in tall

fescue, C3 root treatment of soybean roots was able to induce a systemic resistance

response in the foliage.

2.4 Discussion

In this study, I investigated the nature of the response of soybean to treatment

with C3. The first objective was determining if soybeans can recognize and respond to

C3 treatment. To that end the phenylpropanoid pathway was selected, specifically the

gene that encode the first enzyme in said pathway, GmPAL1. Phenylpropanoids are

involved in plant defense through cell wall fortification (lignin) and antioxidant agents.

Phenolic compounds prevent ROS from diffusing across the membrane and in turn

preventing the oxidation of membrane lipids that can damage the cell membrane (Kulbat,

2016; Sharma et al., 2012). Transcript analysis indicated that C3 treatment does in fact

lead to a resistance response in soybeans. This response can be due to a defense response

84

requiring phenylpropanoid pathway products, the production of ROS when it induced

PTI, or both. After determining that there is a resistance response in soybean foliage,

hormone pathway responses were analyzed.

C3 application to soybean leaves increased gene transcripts in those leaves that

are associated with hormone responses involving JA and ET, and SA. C3 led to increases

in transcripts for all three pathways. Taken together this indicates that C3 treatment

activates SA, JA, and ET signaling pathways locally in soybean. This makes this study

with C3 the first report of a biocontrol bacterium inducing three hormone pathways in

soybean upon foliar application.

To examine the induction of these hormone signaling pathways, genes upstream

and downstream of hormone synthesis were selected. GmPAD4 transcripts were not

significantly different in C3 treated leaves compared to SDW until 72HrAT. This delay in

induction of gene transcription was only observed in GmPAD4, not in GmNPR1 and

GmPR1. This may be attributed to the SA amplification loop that occurs during SA

signaling. GmPAD4 is activated during SA signaling, which positively regulates SA

accumulation, and GmPAD4 transcription (Jirage et al., 1999). As mentioned previously,

C3 treatment increased the transcript level of GmNPR1. NPR1 is involved in signaling

occurring during both ISR and SAR (Cao et al., 1994; Pieterse et al., 1998). Unlike in

SAR, NPR1 does not act as a regulator of SA synthesis and defense genes during ISR.

Currently, the role of NPR1 in ISR is not fully understood. In soybeans, as with

Arabidopsis, NPR1 is constitutively expressed but is in its inactive form as an oligomer

(Sandhu et al., 2009). Soybean has two copies of the genes encoding GmNPR1,

GmNPR1-1 and GmNPR1-2, both of which are induced upon treatment with a SA inducer

85

2,6-dichloroisonicotinic acid (INA) (Sandhu et al., 2009). As with AtNPR1, GmNPR1

becomes a monomer after treatment with SA or with a SA inducer and activates the

transcription of PR1 (Sandhu et al., 2009). The basal level at which it is expressed is

often enough to induce an effective amount of defense gene transcription to inhibit

pathogen growth (van Wees et al., 2000). However, to prevent an accumulation of NPR1

monomers, NPR1 is degraded through a ubiquitin dependent proteasome pathway

(Mukhtar et al., 2009). Therefore, as a result, new NPR1 is required for further signaling,

in which case more NPR1 transcription may be necessary (Mukhtar et al., 2009). This

may explain why C3 treatment lead to an increased expression of NPR1 in soybeans.

Regardless, the increase in transcription of NPR1 can be beneficial, as just a two-fold

change has been shown to provide resistance in Arabidopsis to P. syringae pv.

maculicola ES4326 and Peronospora parasitica (Cao et al., 1998).

PR1 class of proteins are thought to be antifungal compounds (Mitsuhara et al.,

2008; Sarowar et al. 2005). The induction of SA pathway gene, GmPR1, by C3 treatment

correlates with experiments done in tall fescue plants (Kilic-Ekici & Yuen, 2003). C3

root and leaf treatment increased peroxidase activity, indicating that ROS production was

occurring systemically in the leaves and locally in the roots (Kilic-Ekici & Yuen, 2003).

ROS signaling occurs upstream and downstream of SA synthesis (Chen et al., 1993). The

initial ROS burst during early PTI responses induces SA synthesis, and consequently

activates NPR1 and induces PR1 transcription. Both genes were upregulated as a result of

C3 treatment in this study. SA in turn induces ROS production by regulating transcription

of redox genes (Herrera-Vásquez et al., 2015).

86

The JA and ET pathways were also activated locally when soybean foliage was

treated with C3. Tissues accumulated JA and ET marker genes, GmAOS, GmACS, and

GmPR3, transcripts. GmAOS and GmACS are both upstream of JA and ET synthesis,

respectively. As there weren’t any hormone synthesis studies carried out, it cannot

definitely be said that C3 treatment led to JA or ET accumulation. However, as GmPR3

transcription was upregulated post C3 treatment it can be stated that downstream

signaling for those two pathways occurred (Mazarei et al., 2007). Interestingly, GmPR3,

like GmPR1, encodes an antifungal defense related protein, specifically a chitinase (Ali et

al., 2018). It would be worthwhile to determine if C3 treatment can induce other defense

related genes, such as genes that encode other classes of PR proteins involved in

antibacterial activity.

One possible implication of signaling via three hormone pathways, JA/ET and

SA, versus only one hormone pathway is a higher level of induced resistance and towards

a broad range of pathogens with different modes of nutrient acquisition. Arabidopsis

plants treated with Trichoderma atroviride were less susceptible to infection by

hemibiotrophic pathogen Pseudomonas syringae pv. tomato and necrotrophic pathogen

Botrytis cinerea (Salas-Marina et al., 2011). This enhanced resistance was attributed to T.

atroviride inducing SA, JE, and ET pathways locally in the roots and systemically in the

foliage prior to pathogen inoculation (Salas-Marina et al., 2011). Penicillium

simplicissimum GP17-2 treated Arabidopsis seedlings had enhanced disease resistance to

Pseudomonas syringae pv. tomato due to induced resistance. Induced resistance by

GP17-2 was determined to act through the JA, ET, and SA pathways, upregulating

expression of PR-2 and PR-5 (Hossain et al., 2007). Further work in Arabidopsis has

87

demonstrated that the co-activation of SA and JA, by inducing ISR and SAR, leads to

increased resistance against pathogens. Arabidopsis plants treated a combination of both

SAR and ISR inducers, SA and Pseudomonas fluorescence WCS417r, resulted in higher

protection against Pseudomonas syringae pv. tomato infection (Van Wees et al., 2000).

With root treatments, C3 was able to induce expression of SA or JA/ET

downstream genes GmPR1 and GmPR3, respectively, in soybean. There was a previous

report in which a biocontrol bacterium, Bacillus amyloliquefaciens strain KPS46, could

prime JA and SA in soybeans (Buensanteai et al., 2009). However, this is the first study

to report the ability of a biocontrol bacteria to induce a measurable change in defense

responses in systemic tissues prior to pathogen inoculation.

This project has laid the foundation for understanding the interaction between C3

and soybeans. C3’s ability to induce the SA pathway in systemic tissues and JA, ET, and

SA in local tissues can be further examined in terms of C3’s ability to inhibit different

pathogens that induce different hormonal pathways. To be able to utilize C3 induced

resistance in soybeans, more work needs to be done in understanding ISR responses. As

previously mentioned, ISR is dependent on the microbe and genotype of the host,

therefore the ability for C3 to induce resistance in other cultivars of soybean should be

determined. Furthermore, as a biocontrol agent, it is pertinent to assess the effectiveness

of C3 induced resistance on disease inhibition using various pathogens of economic

importance.

88

2.5 Literature Cited

Ali, S., Ganai, B. A., Kamili, A. N., Bhat, A. A., Mir, Z. A., Bhat, J. A., … Grover, A. (2018). Pathogenesis-related proteins and peptides as promising tools for engineering plants with multiple stress tolerance. Microbiological Research. Elsevier GmbH. https://doi.org/10.1016/j.micres.2018.04.008 Buensanteai, N., Yuen, G. Y., & Prathuangwong, S. (2009). Priming, signaling, and protein production associated with induced resistance by Bacillus amyloliquefaciens KPS46. World Journal of Microbiology and Biotechnology, 25(7): 1275–1286. https://doi.org/10.1007/s11274-009-0014-6 Cao, H., Bowling, S. A., Gordon, A. S., & Dong, X. (1994). Characterization of an Arabidopsis mutant that is nonresponsive to inducers of systemic acquired resistance. The Plant Cell, 6(11):1583–1592. doi:10.1105/tpc.6.11.1583 Cao, H., Li, X., & Dong, X. (1998). Generation of broad-spectrum disease resistance by overexpression of an essential regulatory gene in systemic acquired resistance. Proceedings of the National Academy of Sciences of the United States of America, 95(11): 6531–6536. doi:10.1073/pnas.95.11.6531 Chen Z., Silva H., Klessig D. F. (1993). Active oxygen species in the induction of plant systemic acquired resistance by salicylic acid. Science, 262: 1883–1886 10.1126/science.8266079 Conrath, U., Beckers, G. J. M., Flors, V., García-Agustín, P., Jakab, G., Mauch, F., … Mauch-Mani, B. (2006). Priming: getting ready for battle. Molecular Plant-Microbe Interactions, 19(10): 1062–1071. https://doi.org/10.1094/MPMI-19-1062 Duzan, H. M., Mabood, F., Zhou, X., Souleimanov, A., & Smith, D. L. (2005). Nod factor induces soybean resistance to powdery mildew. Plant Physiology and Biochemistry, 43(10–11): 1022–1030. https://doi.org/10.1016/j.plaphy.2005.08.004 Gao, X., Lu, X., Wu, M., Zhang, H., Pan, R., Tian, J., … Liao, H. (2012). Co-inoculation with rhizobia and AMF inhibited soybean red crown rot: From field study to plant defense-related gene expression analysis. PLoS ONE, 7(3). https://doi.org/10.1371/journal.pone.0033977 Hahlbrock, K. & Scheel, D. (1989).Physiology and molecular biology of phenylpropanoid metabolism. Plant Biology, 40: 347–369 Herrera-Vásquez, A., Salinas, P., & Holuigue, L. (2015). Salicylic acid and reactive oxygen species interplay in the transcriptional control of defense genes expression. Frontiers in Plant Science, 6: 171. doi:10.3389/fpls.2015.00171

89

Hossain, M. M., Sultana, F., Kubota, M., Koyama, H., & Hyakumachi, M. (2007). The plant growth-promoting fungus Penicillium simplicissimum GP17-2 induces resistance in Arabidopsis thaliana by activation of multiple defense signals. Plant and Cell Physiology, 48(12): 1724–1736. https://doi.org/10.1093/pcp/pcm144 Jirage D, Tootle TL, Reuber TL, Frost LN, Feys BJ, Parker JE, Ausubel FM, Glazebrook J. (1999). Arabidopsis thaliana PAD4 encodes a lipase‐like gene that is important for salicylic acid signaling. Proceedings of the National Academy of Sciences, USA 96: 13583–13588. Jochum, C. C., Osborne, L. E., & Yuen, G. Y. (2006). Fusarium head blight biological control with Lysobacter enzymogenes strain C3. Biological Control, 39(3): 336–344. https://doi.org/10.1016/j.biocontrol.2006.05.004 Kilic-Ekici, O., & Yuen, G. Y. (2003). Induced resistance as a mechanism of biological control by Lysobacter enzymogenes strain C3 . Phytopathology, 93(9): 1103–1110. https://doi.org/10.1094/phyto.2003.93.9.1103 Kobayashi, D. Y. & Yuen, G. Y. (2005). The role of clp -regulated factors in antagonism against Magnaporthe poae and biological control of summer patch disease of Kentucky bluegrass by Lysobacter enzymogenes C3. Canadian Journal of Microbiology, 51(8): 719-723 Kulbat, K. (2016). The role of phenolic compounds in plant resistance. Biotechnol Food Sci, 80(2): 97–108. Retrieved from http://www.bfs.p.lodz.pl Leeman, M., Van Pelt, J. A., Den Ouden, F. M., Heinsbroek, M., Bakker, P. A. H. M., and Schippers, B. 1995a. Induction of systemic resistance by Pseudomonas fluorescens in radish cultivars differing in susceptibility to Fusarium wilt, using a novel bioassay. Eur. J. Plant Pathol. 101:655-664. Leon-Reyes, A., Van der Does, D., De Lange, E. S., Delker, C., Wasternack, C., Van Wees, S. C., … Pieterse, C. M. (2010). Salicylate-mediated suppression of jasmonate-responsive gene expression in Arabidopsis is targeted downstream of the jasmonate biosynthesis pathway. Planta, 232(6): 1423–1432. doi:10.1007/s00425-010-1265-z Li, S., Jochum, C. C., Yu, F., Zaleta-Rivera, K., Du, L., Harris, S. D., & Yuen, G. Y. (2008). An antibiotic complex from Lysobacter enzymogenes strain C3: antimicrobial activity and role in plant disease control . Phytopathology, 98(6): 695–701. https://doi.org/10.1094/phyto-98-6-0695 Li, S., Du, L., Yuen, G., and Harris, S. D. (2006). Distinct ceramide synthases regulate polarized growth in the filamentous fungus Aspergillus nidulans. Mol. Biol. Cell 17:1218-1227.

90

Livak, K. J., & Schmittgen, T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods, 25(4): 402–408. https://doi.org/10.1006/meth.2001.1262 Mazarei, M., Elling, A. A., Maier, T. R., Puthoff, D. P., & Baum, T. J. (2007). GmEREBP1 is a transcription factor activating defense genes in soybean and Arabidopsis . Molecular Plant-Microbe Interactions, 20(2): 107–119. https://doi.org/10.1094/mpmi-20-2-0107 Mitsuhara, I., Iwai, T., Seo, S., Yanagawa, Y., Kawahigasi, H., Hirose, S., … Ohashi, Y. (2008). Characteristic expression of twelve rice PR1 family genes in response to pathogen infection, wounding, and defense-related signal compounds. Molecular genetics and genomics : MGG, 279(4), 415–427. doi:10.1007/s00438-008-0322-9 Mukhtar, M. S., Nishimura, M. T., & Dangl, J. (2009). NPR1 in plant defense: it’s not over ’til it’s turned over. Cell. https://doi.org/10.1016/j.cell.2009.05.010 Musil, Kelsie M., "Evaluations of biological control agents for the management of soybean cyst nematode (Heterodera glycines) in soybean (Glycine max L. Merr.)" (2016). Theses, Dissertations, and Student Research in Agronomy and Horticulture. 118. http://digitalcommons.unl.edu/agronhortdiss/118 Nafie, E., & Mazen, M. (2008). Chemical – induced resistance against brown stem rot in soybean : the effect of benzothiadiazole. Journal of Applied Sciences, 4(12): 2046–2064. Niu, D.-D., Liu, H.-X., Jiang, C.-H., Wang, Y.-P., Wang, Q.-Y., Jin, H.-L., & Guo, J.-H. (2011). The plant growth–promoting rhizobacterium Bacillus cereus AR156 induces systemic resistance in Arabidopsis thaliana by simultaneously activating salicylate- and jasmonate/ethylene-dependent signaling pathways . Molecular Plant-Microbe Interactions, 24(5): 533–542. https://doi.org/10.1094/mpmi-09-10-0213 Park, J. H., Halitschke, R., Kim, H. B., Baldwin, I. T., Feldmann, K. A., & Feyereisen, R. (2002). A knock-out mutation in allene oxide synthase results in male sterility and defective wound signal transduction in Arabidopsis due to a block in jasmonic acid biosynthesis. Plant Journal, 31(1): 1–12. https://doi.org/10.1046/j.1365-313X.2002.01328.x Pieterse, C. M., van Wees, S. C., van Pelt, J. A., Knoester, M., Laan, R., Gerrits, H., … van Loon, L. C. (1998). A novel signaling pathway controlling induced systemic resistance in Arabidopsis. The Plant Cell, 10(9): 1571–80. https://doi.org/10.1105/tpc.10.9.1571 Pozo, M. J., Van Loon, L. C., & Pieterse, C. M. J. (2004). Jasmonates - signals in plant-microbe interactions. Journal of Plant Growth Regulation. https://doi.org/10.1007/s00344-004-0031-5

91

Puopolo, G., Tomada, S., & Pertot, I. (2018). The impact of the omics era on the knowledge and use of Lysobacter species to control phytopathogenic micro-organisms. Journal of Applied Microbiology. Blackwell Publishing Ltd. https://doi.org/10.1111/jam.13607 Salas-Marina, M. A., Silva-Flores, M. A., Uresti-Rivera, E. E., Castro-Longoria, E., Herrera-Estrella, A., & Casas-Flores, S. (2011). Colonization of Arabidopsis roots by Trichoderma atroviride promotes growth and enhances systemic disease resistance through jasmonic acid/ethylene and salicylic acid pathways. European Journal of Plant Pathology, 131(1): 15–26. https://doi.org/10.1007/s10658-011-9782-6 Sandhu, D., Tasma, I. M., Frasch, R., & Bhattacharyya, M. K. (2009). Systemic acquired resistance in soybean is regulated by two proteins, orthologous to Arabidopsis NPR1. BMC Plant Biology, 9. https://doi.org/10.1186/1471-2229-9-105 Sarowar,S, Kim, Y.J., Kim, E.N., Kim, K.D., Hwang, B.K., Islam, R., Shin, J.S. (2005). Overexpression of a pepper basic pathogenesis-related protein 1 gene in tobacco plants enhances resistance to heavy metal and pathogen stresses Plant Cell Rep., 24:216-224 Sharma, P., Jha, A. B., Dubey, R. S., & Pessarakli, M. (2012). Reactive oxygen species, oxidative damage, and antioxidative defense mechanism in plants under stressful conditions. Journal of Botany, 2012, 1–26. https://doi.org/10.1155/2012/217037 Shine, M. B., Xiao, X., Kachroo, P., & Kachroo, A. (2019). Signaling mechanisms underlying systemic acquired resistance to microbial pathogens. Plant Science. Elsevier Ireland Ltd. https://doi.org/10.1016/j.plantsci.2018.01.001 Staswick, P. E. (2004). The oxylipin signal jasmonic acid is activated by an enzyme that conjugates it to isoleucine in Arabidopsis. The Plant Cell Online, 16(8): 2117–2127. https://doi.org/10.1105/tpc.104.023549 Tripathi, D., Raikhy, G., & Kumar, D. (2019). Chemical elicitors of systemic acquired resistance—salicylic acid and its functional analogs. Current Plant Biology. Elsevier B.V. https://doi.org/10.1016/j.cpb.2019.03.002 United Soybean Board. Fungicide Resistance - United Soybean Board. (2018). Van der Does, D., Leon-Reyes, A., Koornneef, A., Van Verk, M. C., Rodenburg, N., Pauwels, L., … Pieterse, C. M. (2013). Salicylic acid suppresses jasmonic acid signaling downstream of SCFCOI1-JAZ by targeting GCC promoter motifs via transcription factor ORA59. The Plant Cell, 25(2): 744–761. doi:10.1105/tpc.112.108548 Van Loon, L. C. (1997). Induced resistance in plants and the role of pathogenesis-related proteins. European Journal of Plant Pathology. https://doi.org/10.1023/A:1008638109140

92

Van Peer R & Schippers B.(1992). Lipopolysaccharides of plant growth-promoting Pseudomonas sp. strain WCS417r induce resistance in carnation to fusarium wilt. Neth J Plant Pathol, 98:129–39. Van Wees, S. C., de Swart, E. A., van Pelt, J. A., van Loon, L. C., & Pieterse, C. M. (2000). Enhancement of induced disease resistance by simultaneous activation of salicylate- and jasmonate-dependent defense pathways in Arabidopsis thaliana. Proceedings of the National Academy of Sciences of the United States of America, 97(15): 8711–8716. doi:10.1073/pnas.130425197 Van Wees, S. C. M., Pieterse, C. M. J., Trijssenaar, A., Van ’t Westende, Y. A. M., Hartog, F., & Van Loon, L. C. (2007). Differential induction of systemic resistance in Arabidopsis by biocontrol bacteria . Molecular Plant-Microbe Interactions, 10(6): 716–724. https://doi.org/10.1094/mpmi.1997.10.6.716 Verhagen, B. W. M., Glazebrook, J., Zhu, T., Chang, H.-S., van Loon, L. C., & Pieterse, C. M. J. (2004). The ttranscriptome of rhizobacteria-induced systemic resistance in Arabidopsis . Molecular Plant-Microbe Interactions, 17(8): 895–908. https://doi.org/10.1094/mpmi.2004.17.8.895 Wu, Y., Zhang, D., Chu, J. Y., Boyle, P., Wang, Y., Brindle, I. D., … Després, C. (2011). The Arabidopsis NPR1 protein is a receptor for the plant defense hormone salicylic acid. Cell Reports, 1(6): 639–647. https://doi.org/10.1016/j.celrep.2012.05.008 Yu, D., Chen, C., & Chen, Z. (2001). Evidence for an important role of WRKY DNA binding proteins in the regulation of NPR1 gene expression. The Plant Cell, 13(7): 1527–1540. doi:10.1105/tpc.010115 Yu, O., Jung, W., Shi, J., Croes, R. A., Fader, G. M., McGonigle, B., & Odell, J. T. (2000). Production of the isoflavones genistein and daidzein in non-legume dicot and monocot tissues. Plant Physiology, 124(2), 781–794. doi:10.1104/pp.124.2.781 Yuan, M., Huang, Y., Huang, Y., Ge, W., Jia, Z., Song, S., & Zhang, L. (2019). Involvement of jasmonic acid, ethylene and salicylic acid signaling pathways behind the systemic resistance induced by Trichoderma longibrachiatum H9 in cucumber. BMC Genomics, 20(1). https://doi.org/10.1186/s12864-019-5513-8 Yuen, G. Y., Broderick, K. C., Jochum, C. C., Chen, C. J., & Caswell-Chen, E. P. (2018). Control of cyst nematodes by Lysobacter enzymogenes strain C3 and the role of the antibiotic HSAF in the biological control activity. Biological Control, 117: 158–163. https://doi.org/10.1016/j.biocontrol.2017.11.007 Yuen, G. Y., Steadman, J. R., Lindgren, D. T., Schaff, D., & Jochum, C. (2001). Bean rust biological control using bacterial agents. Crop Protection, 20(5): 395–402. https://doi.org/10.1016/S0261-2194(00)00154-X

93

Zhang, Z., & Yuen, G. Y. (2000). Effects of culture fluids and preinduction of chitinase production on biocontrol of Bipolaris leaf spot by Stenotrophomonas maltophilia C3. Biological Control, 18(3): 277–286. https://doi.org/10.1006/bcon.2000.0834 Zhou, N., Tootle, T. L., Tsui, F., Klessig, D. F., & Glazebrook, J. (1998). PAD4 functions upstream from salicylic acid to control defense responses in Arabidopsis. The Plant Cell, 10(6): 1021. https://doi.org/10.2307/3870687

94

2.6 Tables

Table 1: Soybean primers for genes used during qPCR analysis.

NCBI Reference Sequence

Gene Tm (C)

Primer Sequence (5`-3`) Product length

Pathway

XM_003547647 elongation factor 1-alpha (ELF)

60.04 59.97

TCCCATCTCAGGTTTTGAGG GGAGCAAAAGTCACCACCAT

237 Housekeeping Gene

NM_001249516.2 Allene Oxide Synthase 2 (AOS2)

58.98 59.03

AGCTTCCGATCCGCAAAATC ACGGGGAAACTTTTGGCATC

220 JA

NM_001249212.2 ACC synthase (ACS)

59.07 58.88

CGTATTGTCATGAGCGGTGG TGGCCTTCTCATACGCATCT

220 ET

NM_001357058.1 Phenylalanine ammonia-lyase (PAL1)

58.94 59.01

AGCAGTGAGTGGGTGATGAA ACTAACATGGCTGCTCTGGT

209 Phenylpropanoid

XM_003523165.3 Phytoalexin Deficient 4 (PAD 4)

59.54 56.93

ACAAAGTTGGCTGTGCTGTG CTCCATCCAGAAACGGGTTA

202 SA

NM_001251729.1 Nonexpresser of PR genes (NPR1-1)

59.94 59.99

GACCCCAAGGTTGTTTCTGA CCTGCTCTGTTTTTGCATGA

235 SA

XM_003545723.4 Pathogenesis Related 1 (PR1)

64.53 64.22

AACTATGCTCCCCCTGGCAACTATATTG TCTGAAGTGGTAGCTTCTACATCGAAACAA

76 SA (Mazarei et al., 2007)

NM_001251632.1 Pathogenesis Related 3 (PR3)

65.52 65.40

AACTACAATTACGGGCAAGCTGGCAA TTGATGGCTTGTTTCCCTGTGCAGT

139 JA and ET (Mazarei et al., 2007)

95

2.7 Figures

Figure 1: The relationship of each gene used for qPCR analysis in regard to its function in the

salicylic acid (SA), jasmonic acid (JA), and ethylene (ET) pathways. Circles represent

hormones and squares represent the genes tested in this study.

96

Figure 2: Relative fold change of the phenylpropanoid pathway marker gene GmPAL1 in

soybean leaves after foliar treatment with 3mM Acibenzolar-S-Methyl (ASM), C3 (108

CFU ml−1) , and SDW. Gene expression levels were normalized using internal

housekeeping gene, Gm-Elongation factor alpha. Data are shown as the log2 values of the

fold change levels compared to SDW. ‘*’ and ‘**’ denotes treatment was significantly

different from SDW at the sampling time at the 90 and 95% confidence level,

respectively.

0

1

2

3

4

5

6

7

2 24 48 72

Rel

ativ

e G

ene

Exp

ress

ion

(Fol

d C

hang

e)

Hours After Treatment

Phenylalanine ammonia-lyase (PAL1)SDW ASM C3

*

**

**

****

97

Figure 3: Relative fold change of the salicylic acid pathway gene GmPAD4 in soybean

leaves after foliar treatment with 3mM Acibenzolar-S-Methyl (ASM), C3 (108 CFU ml−1)

, and SDW. Gene expression levels were normalized using internal housekeeping gene,

Gm-Elongation factor alpha. Data are shown as the log2 values of the fold change levels

compared to SDW. ‘*’ and ‘**’ denotes treatment was significantly different from SDW

at the sampling time at the 90 and 95% confidence level, respectively.

00.20.40.60.8

11.21.41.61.8

2

2 24 48 72

Rel

ativ

e G

ene

Expr

essi

on (F

old

Cha

nge)

Hours after treatment

Phytoalexin Deficient 4 (PAD4)SDW ASM C3

**

** **

98

Figure 4: Relative fold change of the salicylic acid pathway genes (A) GmNPR1-1 and

(B) GmPR1 in soybean leaves after foliar treatment with 3mM Acibenzolar-S-Methyl

(ASM), C3 (108 CFU ml−1) , and SDW. Gene expression levels were normalized using

internal housekeeping gene, Gm-Elongation factor alpha. Data are shown as the log2

0

0.5

1

1.5

2

2.5

3

3.5

4

2 24 48 72

Rel

ativ

e G

ene

Expr

essi

on (F

old

Cha

nge)

Hours After Treatment

Nonexpresser of PR genes (NPR1-1) SDW ASM C3

**** *

**

A

02468

101214161820

2 24 48 72

Rel

ativ

e G

ene

Expr

essi

on (F

old

Cha

nge)

Hours after treatment

Pathogenesis Related 1 (PR1) SDW ASM C3

**

**

**

**

****

*

B

99

values of the fold change levels compared to SDW. Treatments within a sampling time

with an asterisk are significantly different at the 90% (*) or 95% (**) confidence level.

Treatments between sampling times with different letters are significantly different at the

95% confidence level, lower case letters represent the positive control, upper case letters

represent C3 treatment.

Figure 5: Relative fold change of the jasmonic acid pathway gene GmAOS2 in soybean

leaves after foliar treatment with 50µM methyl jasmonate (MeJA), C3 (108 CFU ml−1) ,

and SDW. Gene expression levels were normalized using internal housekeeping gene,

Gm-Elongation factor alpha. Data are shown as the log2 values of the fold change levels

compared to SDW. ‘*’ and ‘**’ denotes treatment was significantly different from SDW

at the sampling time at the 90 and 95% confidence level, respectively.

0

1

2

3

4

5

6

7

8

2 24 48 72Rel

ativ

e G

ene

Exp

ress

ion

(Fol

d C

hang

e)

Hours after treatment

Allene Oxide Synthase 2 (AOS2) SDW MeJa C3

**

**

**** **

100

Figure 6: Relative fold change of the ethylene pathway gene GmACS in soybean leaves

after foliar treatment with 50µM methyl jasmonate (MeJA), C3 (108 CFU ml−1) , and

SDW. Gene expression levels were normalized using internal housekeeping gene, Gm-

Elongation factor alpha. Data are shown as the log2 values of the fold change levels

compared to SDW. ‘*’ and ‘**’ denotes treatment was significantly different from SDW

at the sampling time at the 90 and 95% confidence level, respectively.

0

1

2

3

4

5

6

2 24 48 72

Rela

tive

Gen

e Ex

pres

sion

(Fol

d Ch

ange

)

Hours after treatment

1-aminocyclopropane-1-carboxylate synthase (ACS) SDW MeJA C3

**

**

*

**

* **

101

Figure 7: Relative fold change of the downstream jasmonic acid and ethylene pathways

marker gene GmPR3 in soybean leaves after foliar treatment with 50µM methyl

jasmonate (MeJA), C3 (108 CFU ml−1) , and SDW. Gene expression levels were

normalized using internal housekeeping gene, Gm-Elongation factor alpha. Data are

shown as the log2 values of the fold change levels compared to SDW. ‘*’ and ‘**’

denotes treatment was significantly different from SDW at the sampling time at the 90

and 95% confidence level, respectively.

0

1

2

3

4

5

6

7

2 24 48 72

Rel

ativ

e G

ene

Expr

essi

on (F

old

Cha

nge)

Hours after treatment

Pathogenesis Related 3 (PR3)SDW MeJA C3

**

**

**

**

102

Figure 8: Relative fold change of the salicylic acid and jasmonic/ethylene pathway genes

(A) GmPR1 and (B) GmPR3 in soybean leaves after foliar treatment with 3mM

Acibenzolar-S-Methyl (ASM), 50µM methyl jasmonate (MeJA), C3 (108 CFU ml−1) ,

and SDW. Gene expression levels were normalized using internal housekeeping gene,

0123456789

10

0 1 3 5 7 10Rel

ativ

e G

ene

Expr

essi

on (F

old

Cha

nge)

Days after treatment

Pathogenesis Related 1 (PR1) SDW ASM C3

**

**

**

*

*

0

1

2

3

4

5

6

7

8

0 1 3 5 7 10

Rel

ativ

e G

ene

Expr

essi

on (F

old

Cha

nge)

Days after treatment

Pathogenesis Related 3 (PR3)SDW MeJa C3

* **

**

** ***

103

Gm-Elongation factor alpha. Data are shown as the log2 values of the fold change levels

compared to SDW. ‘*’ and ‘**’ denotes treatment was significantly different from SDW

at the sampling time at the 90 and 95% confidence level, respectively.

104

Chapter 3

Thesis Conclusions

The focus of this thesis was the defense hormone response initiated by C3 foliar

and root treatments on soybeans. Common approaches to determining what resistance

response a microbe can induce in a plant include analyzing the proteomic and genomic

changes that occur upon treatment and measuring hormone responses. In this study

changes in gene expression were used to determine what hormone pathways C3 treatment

induced, which came with its unique set of challenges. Unlike Arabidopsis, induced

resistance work in soybean is not as comprehensive. Therefore, there is no previous work

to use as an example for selecting marker genes specific to soybean induced resistance.

Selecting the proper genes to use as markers for each hormone pathway took multiple

attempts. Troubleshooting included, designing primers that correctly amplified the gene

of interest, selecting a housekeeping gene that was consistent for each qPCR run, and

genes that respond to the positive control. A consideration prior to beginning induced

resistance work in a plant aside from Arabidopsis is the possible differences that can

occur during hormone signaling. For example, PR2 is regulated by ethylene in soybeans

and salicylic acid in Arabidopsis, so it would be used to measure different hormone

activation in the two plants.

There were three questions posed in this study. First, what hormone signaling

pathways are activated in soybean foliage by C3? Second, when C3 applied is applied to

the foliage is the phenylpropanoid pathway activated? Third, can the signaling

pathway(s) elicited in the roots by C3 be manifested systemically in the foliage? Through

105

foliar treatment the first two questions were successfully answered, C3 treatment induced

JA, ET, SA, and the phenylpropanoid pathways in soybean foliage after a foliar spray

treatment. Root treatments with C3 indicated that two PR genes, PR1 and PR3, were not

induced in the foliage.

However, it is unknown if that is due to C3 local induced resistance not leading to

systemic induced resistance or if it leads to priming. The potential of C3 inducing a

priming response in soybeans can be linked with studies of disease control. Applying

pathogens with different methods of nutrient acquisition will enable the analysis of the

three different hormone pathway responses. Future work looking at C3 treatment

localized resistance should focus on understanding what local responses C3 induces in

the roots, and how those responses are comparable to the responses C3 induces in the

foliage. From there, the systemic signaling that occurs as a result of root treatment should

be investigated further than what was achieved during this thesis. Simple protein work,

such as peroxidase or PAL enzyme activity in the foliage after root treatment can be

assessed.