Hoofdstuk 16-mutations-dna repair

Genetics: Analysis and PrinciplesRobert J. Brooker

Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display

CHAPTER 16

GENE MUTION AND DNA REPAIR

INTRODUCTION The term mutation refers to a heritable change in

the genetic material

Mutations provide allelic variations On the positive side, mutations are the foundation for

evolutionary change needed for a species to adapt to changes in the environment

On the negative side, new mutations are much more likely to be harmful than beneficial to the individual and often are the cause of diseases

Since mutations can be quite harmful, organisms have developed ways to repair damaged DNA

16-2Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display

Mutations can be divided into three main types 1. Chromosome mutations

Changes in chromosome structure 2. Genome mutations

Changes in chromosome number 3. Single-gene mutations

Relatively small changes in DNA structure that occur within a particular gene

Types 1 and 2 were discussed in chapter 8 Type 3 will be discussed in this chapter


16.1 CONSEQUENCES OF MUTATIONS

16-3


A point mutation is a change in a single base pair It involves a base substitution

Mutations Change the DNA Sequence

16-4

5’ AACGCTAGATC 3’3’ TTGCGATCTAG 5’

5’ AACGCGAGATC 3’3’ TTGCGCTCTAG 5’

A transition is a change of a pyrimidine (C, T) to another pyrimidine or a purine (A, G) to another purine

A transversion is a change of a pyrimidine to a purine or vice versa

Transitions are more common than transversions


Mutations may also involve the addition or deletion of short sequences of DNA

Mutations Change the DNA Sequence

16-5


5’ AACGCGC 3’3’ TTGCGCG 5’


5’ AACAGTCGCTAGATC 3’3’ TTGTCAGCGATCTAG 5’

Deletion of four base pairs

Addition of four base pairs


Mutations in the coding sequence of a structural gene can have various effects on the polypeptide Silent mutations are those base substitutions that do not

alter the amino acid sequence of the polypeptide Due to the degeneracy of the genetic code

Missense mutations are those base substitutions in which an amino acid change does occur

Example: Sickle-cell anemia (Refer to Figure 16.1) If the substituted amino acid has no detectable effect on protein

function, the mutation is said to be neutral. This can occur if the new amino acid has similar chemistry

Mutations Can Alter the Coding Sequence Within a Gene

16-6


Mutations in the coding sequence of a structural gene can have various effects on the polypeptide

Mutations Can Alter the Coding Sequence Within a Gene

16-7

Nonsense mutations are those base substitutions that change a normal codon to a termination codon

Frameshift mutations involve the addition or deletion of nucleotides in multiples of one or two

This shifts the reading frame so that a completely different amino acid sequence occurs downstream from the mutation


In a natural population, the wild-type is the relatively prevalent genotype. Infrequently, some genes with multiple alleles may have two or more wild-types.

A forward mutation changes the wild-type genotype into some new variation

A reverse mutation changes a mutant allele back to the wild-type It is also termed a reversion

Gene Mutations and Their Effects on Genotype and Phenotype

16-9


Mutations can also be described based on their effects on the wild-type phenotype When a mutation alters an organism’s phenotypic

characteristics, it is said to be a variant Variants are often characterized by their differential

ability to survive Deleterious mutations decrease the chances of survival

The most extreme are lethal mutations Beneficial mutations enhance the survival or reproductive

success of an organism Some mutations are called conditional mutants

They affect the phenotype only under a defined set of conditions

An example is a temperature-sensitive mutation

16-10


A second mutation will sometimes affect the phenotypic expression of another

These second-site mutations are called suppressor mutations or simply suppressors

Suppressor mutations are classified into two types Intragenic suppressors

The second mutant site is within the same gene as the first mutation

Intergenic suppressors The second mutant site is in a different gene from the first

mutation Refer to Table 16.2

16-11


These mutations can still affect gene expression A mutation, may alter the sequence within a promoter

Up promoter mutations make the promoter more like the consensus sequence

They may increase the rate of transcription Down promoter mutations make the promoter less like the

consensus sequence They may decrease the rate of transcription

A mutation can also alter splice junctions in eukaryotes

Refer to Table 16.3 for other examples

Gene Mutations in Noncoding Sequences

16-12


Several human genetic diseases are caused by an unusual form of mutation called trinucleotide repeat expansion (TNRE) The term refers to the phenomenon that a sequence of 3

nucleotides can increase from one generation to the next

These diseases include Huntington disease (HD) Fragile X syndrome (FRAXA)

Mutations Due to Trinucleotide Repeats

16-14


Certain regions of the chromosome contain trinucleotide sequences repeated in tandem In normal individuals, these sequences are transmitted

from parent to offspring without mutation However, in persons with TRNE disorders, the length of a

trinucleotide repeat increases above a certain critical size It also becomes prone to frequent expansion This phenomenon is shown here with the trinucleotide repeat CAG

16-16

CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

n = 11

n = 18


In some cases, the expansion is within the coding sequence of the gene Typically the trinucleotide expansion is CAG (glutamine) Therefore, the encoded protein will contain long tracks of

glutamine This causes the proteins to aggregate with each other This aggregation is correlated with the progression of the disease

In other cases, the expansions are located in noncoding regions of genes Some of these expansions are hypothesized to cause

abnormal changes in RNA structure Some produce methylated CpG islands which may silence

the gene

16-17


A chromosomal rearrangement may affect a gene because the break occurred in the gene itself

A gene may be left intact, but its expression may be altered because of its new location This is termed a position effect

There are two common reasons for position effects: 1. Movement to a position next to regulatory sequences

2. Movement to a position in a heterochromatic region

Changes in Chromosome Structure Can Affect Gene Expression

16-19

Figure 16.216-20

Regulatory sequences are often

bidirectional


Geneticists classify the animal cells into two types Germ-line cells

Cells that give rise to gametes such as eggs and sperm Somatic cells

All other cells Germ-line mutations are those that occur directly in a

sperm or egg cell, or in one of their precursor cells Refer to Figure 16.4a

Somatic mutations are those that occur directly in a body cell, or in one of its precursor cells

Refer to Figure 16.4b AND 16.5

Mutations Can Occur in Germ-Line or Somatic Cells

16-21

Figure 16.416-22

Therefore, the mutation can be

passed on to future generations

The size of the patch will depend on the timing of the mutation

The earlier the mutation, the larger the patch

An individual who has somatic regions that are genotypically different

from each other is called a genetic mosaic

Therefore, the mutation cannot be passed on to future generations

Mutations can occur spontaneously or be induced

Spontaneous mutations Result from abnormalities in cellular/biological processes

Errors in DNA replication, for example

Induced mutations Caused by environmental agents Agents that are known to alter DNA structure are termed

mutagens These can be chemical or physical agents

Refer to Table 16.5


16.2 OCCURRENCE AND CAUSES OF MUTATION

16-23


Are mutations spontaneous occurrences or causally related to environmental conditions? This is a question that biologists have asked themselves

for a long time

Spontaneous Mutations Are Random Events

16-25


These two opposing theories of the 19th century were tested in bacteria in the 1940s and 1950s

Salvadore Luria and Max Delbruck studied the resistance of E. coli to infection by bacteriophage T1 tonr (T one resistance) They wondered if tonr is due to spontaneous mutations or

to a physiological adaptation that occurs at a low rate

The physiological adaptation theory predicts that the number of tonr bacteria is essentially constant in different bacterial populations

The spontaneous mutation theory predicts that the number of tonr bacteria will fluctuate in different bacterial populations

Their test therefore became known as the fluctuation test

16-26

An important evidence for the emergence of mutations in a random manner (‘at random’):

“ Fluctuationtest “ (1943) with bacteria: “Classic”

experiment: Origin of resistance (mutation) in E. coli against lysis through a ‘bacterio phage’ in cultures

Hypotheses:1. Each E.coli can become resistant through a growing

condition : fysiological induction >> aprox. the same mutation in each

culture

2. Origin through coincidence: no mutants, early, or late in the growing process of the bacterial cultures >> expectations is: large differences (‘fluctuation’) in number of

mutants between the cultures

Experiment: small bac. cultures: to test on phage-resistant bacteria

Test of the two hypotheses: Fluctuation TestPredictions:

Results FluctuationTest

Gekwantifiseerd:

>> counting of phage-resistant colonies

- If you take 0.2 mL of a great culture and plate it out, on each plate you shall see the same amount of colonies- but, if you let 0.2 mL of cultures grow separately, and thereafter you plate them out in presence of phages, you shall see great differences in numbers of colonies (from 0 to >100 !)

Conclusion: Induction of resistance occurs randomly instead of directed or physiological induces. Mutation= random process

16-27The Luria-Delbruck fluctuation testFigure 16.6

E.. coli is grown in the absence of T1 phages

20 million cells each

20 million cells each

Many tonr bacteria

Mutation occurred at an early stage of population growth, before T1 exposure

No tonr bacteria

Spontaneous mutation did not occur

Several independent tonr mutations occurred during different stages

These are mixed together in a big flask to give an average value of tonr cells

Great fluctuation in the number of tonr coloniesRelatively even distribution of tonr colonies


The term mutation rate is the likelihood that a gene will be altered by a new mutation It is commonly expressed as the number of new mutations

in a given gene per generation It is in the range of 10-5 to 10-9 per generation

The mutation rate for a given gene is not constant It can be increased by the presence of mutagens

Mutation rates vary substantially between species and even within different strains of the same species

Mutation Rates and Frequencies

16-30


Within the same individual, some genes mutate at a much higher rate than other genes

Some genes are larger than others This provides a greater chance for mutation

Some genes have locations within the chromosome that make them more susceptible to mutation

These are termed hot spots

Note: Hot spots can be also found within a single gene


16-31

Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-32Figure 6.20

Contain many mutations at exactly the same site within

the gene


The mutation frequency for a gene is the number of mutant genes divided by the total number of genes in a population If 1 million bacteria were plated and 10 were mutant

The mutation frequency would be 1 in 100,000 or 10-5

The mutation frequency depends not only on the mutation rate, but also on the

Timing of the mutation Likelihood that the mutation will be passed on to future

generations


16-33


Spontaneous mutations can arise by three types of chemical changes

1. Depurination

2. Deamination

3. Tautomeric shift

Causes of Spontaneous Mutations

16-34

The most common


Depurination involves the removal of a purine (guanine or adenine) from the DNA The covalent bond between deoxyribose and a purine base

is somewhat unstable It occasionally undergoes a spontaneous reaction with water that

releases the base from the sugar This is termed an apurinic site

Fortunately, apurinic sites can be repaired However, if the repair system fails, a mutation may result during

subsequent rounds of DNA replication

16-35

Causes of Spontaneous Mutations

16-36Spontaneous depurinationFigure 16.8

Three out of four (A, T and G) are the incorrect nucleotide

There’s a 75% chance of a mutation


Deamination involves the removal of an amino group from the cytosine base The other bases are not readily deaminated

16-37

Figure 16.9

DNA repair enzymes can recognize uracil as an inappropriate base in DNA and remove it

However, if the repair system fails, a C-G to A-T mutation will result during subsequent rounds of DNA replication


Deamination of 5-methyl cytosine can also occur

16-38

Thymine is a normal constituent of DNA This poses a problem for repair enzymes

They cannot determine which of the two bases on the two DNA strands is the incorrect base

For this reason, methylated cytosine bases tend to create hot spots for mutation

Figure 16.9


A tautomeric shift involves a temporary change in base structure The common, stable form of thymine and guanine is the

keto form At a low rate, T and G can interconvert to an enol form

The common, stable form of adenine and cytosine is the amino form

At a low rate, A and C can interconvert to an imino form

These rare forms promote AC and GT base pairs

For a tautomeric shift to cause a mutation it must occur immediately prior to DNA replication

16-39

16-40Figure 16.10

RareCommon

16-41Figure 16.10

16-42Figure 16.10

Temporary tautomeric shift

Shifted back to its normal form


An enormous array of agents can act as mutagens to permanently alter the structure of DNA

The public is concerned about mutagens for two main reasons: 1. Mutagens are often involved in the development of

human cancers 2. Mutagens can cause gene mutations that may have

harmful effects in future generations Mutagenic agents are usually classified as

chemical or physical mutagens

16-52

Types of Mutagens


Chemical mutagens come into three main types

1. Base modifiers

2. Intercalating agents

3. Base analogues

16-54

Mutagens Alter DNA Structure in Different Ways


Base modifiers covalently modify the structure of a nucleotide

16-55

For example, nitrous acid, replaces amino groups with keto groups (–NH2 to =O)

This can change cytosine to uracil and adenine to hypoxanthine

These modified bases do not pair with the appropriate nucleotides in the daughter strand during DNA replication

Refer to Figure 16.13

Some chemical mutagens disrupt the appropriate pairing between nucleotides by alkylating bases within the DNA

Examples: Nitrogen mustards and ethyl methanesulfonate (EMS)

16-56Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display

Mispairing of modified basesFigure 16.13

These mispairings create mutations in the newly replicated strand


Intercalating agents contain flat planar structures that intercalate themselves into the double helix

This distorts the helical structure

When DNA containing these mutagens is replicated, the daughter strands may contain single-nucleotide additions and/or deletions resulting in frameshifts

Examples: Acridine dyes Proflavin (Ethidiumbromide (ook gebruikt om DNA zichtbaar te maken in

een gel))16-57


Base analogues become incorporated into daughter strands during DNA replication For example, 5-bromouracil is a thymine analogue

It can be incorporated into DNA instead of thymine

16-58

Figure 16.14

Normal pairing This tautomeric shift occurs at a relatively

high rate

Mispairing


Figure 16.14

In this way, 5-bromouracil can promote a change of an AT base pair into a GC base pair


Physical mutagens come into two main types 1. Ionizing radiation 2. Nonionizing radiation

Ionizing radiation Includes X rays and gamma rays Has short wavelength and high energy Can penetrate deeply into biological molecules Creates chemically reactive molecules termed free radicals Can cause

Base deletions Single nicks in DNA strands Cross-linking Chromosomal breaks

16-60


Nonionizing radiation Includes UV light Has less energy Cannot penetrate deeply

into biological molecules Causes the formation of

cross-linked thymine dimers

Thymine dimers may cause mutations when that DNA strand is replicated

Figure 16.15


Many different kinds of tests have been used to evaluate mutagenicity One commonly used test is the Ames test

Developed by Bruce Ames The test uses a strain of Salmonella typhimurium that cannot

synthesize the amino acid histidine It has a point mutation in a gene involved in histidine biosynthesis

A second mutation (i.e., a reversion) may occur restoring the ability to synthesize histidine

The Ames test monitors the rate at which this second mutation occurs

16-62

Testing Methods Can Determine If an Agent Is a Mutagen

16-63The Ames test for mutagenicityFigure 16.16

Provides a mixture of

enzymes that may activate a

mutagen

The control plate indicates that there is a low

level of spontaneous

mutation

Since most mutations are deleterious, DNA repair systems are vital to the survival of all organisms Living cells contain several DNA repair systems that can

fix different type of DNA alterations

In most cases, DNA repair is a multi-step process 1. An irregularity in DNA structure is detected 2. The abnormal DNA is removed 3. Normal DNA is synthesized


16.3 DNA REPAIR

16-64


In a few cases, the covalent modifications of nucleotides can be reversed by specific enzymes

Photolyase can repair thymine dimers It splits the dimers restoring the DNA to its original condition

O6-alkylguanine alkyltransferase repairs alkylated bases It transfers the methyl or ethyl group from the base to a cysteine

side chain within the alkyltransferase protein Surprisingly, this permanently inactivates alkyltransferase!

16-66

Damaged Bases Can Be Directly Repaired

16-67Direct repair of damaged bases in DNAFigure 16.17


Base Excision Repair (BER) involves a category of enzymes known as DNA N-glycosylases These enzymes can recognize an abnormal base and

cleave the bond between it and the sugar in the DNA

Depending on the species, this repair system can eliminate abnormal bases such as Uracil; Thymine dimers 3-methyladenine; 7-methylguanine

16-68

Base Excision Repair Removes a Damaged DNA

16-69Figure 16.18

Depending on whether a purine or pyrimidine is

removed, this creates an apurinic and an apyrimidinic

site, respectively

Nick replication would be a more accurate

term


An important general process for DNA repair is Nucleotide Excision Repair (NER)

This type of system can repair many types of DNA damage, including Thymine dimers and chemically modified bases missing bases, some types of cross-link

NER is found in all eukaryotes and prokaryotes However, its molecular mechanism is better understood in

prokaryotes

16-70

Nucleotide Excision Repair Removes Damaged DNA Segments


In E. coli, the NER system requires four key proteins These are designated UvrA, UvrB, UvrC and UvrD

Named as such because they are involved in Ultraviolet light repair of pyrimidine dimers

They are also important in repairing chemically damaged DNA

UvrA, B, C, and D recognize and remove a short segment of damaged DNA

DNA polymerase and ligase finish the repair job


16-71


16-72Figure 16.19

16-73Figure 16.19

Typically, the cuts are 4-5 nucleotides from the 3’ end of the damage, and 8 nucleotides from the 5’ end


Several human diseases have been shown to involve inherited defects in genes involved in NER These include xeroderma pigmentosum (XP), Cockayne

syndrome (CS) and PIBIDS A common characteristic of both syndromes is an increased

sensitivity to sunlight

Xeroderma pigmentosum can be caused by defects in seven different NER genes

16-74



A Base Mismatch is another type of abnormality in DNA

The structure of the DNA double helix obeys the AT/GC rule of base pairing However, during DNA replication an incorrect base may be

added to the growing strand by mistake

DNA polymerases have a 3’ to 5’ proofreading ability that can detect base mismatches and fix them

16-75

Mismatch Repair Systems Detect and Correct A Base Pair Mismatch


If proofreading fails, the methyl-directed mismatch repair system comes to the rescue

Mismatch repair systems are found in all species

In humans, mutations in the system are associated with particular types of cancer

16-76



The molecular mechanism of mismatch repair has been studied extensively in E. coli Three proteins, MutL, MutH and MutS detect the mismatch

and direct its removal from the newly made strand The proteins are named Mut because their absence leads to a

much higher mutation rate than normal

A key characteristic of MutH is that it can distinguish between the parental strand and the daughter strand

Prior to replication, both strands are methylated Immediately after replication, the parental strand is methylated

whereas the daughter is not yet!

16-77


16-78Methyl-directed mismatch repair in E. coliFigure 16.21

Acts as a linker between MutS and MutH

16-79Methyl-directed mismatch repair in E. coliFigure 16.21


DNA Double-Strand Breaks are very dangerous Breakage of chromosomes into pieces Caused by ionizing radiation and chemical mutagens Also caused by free radicals which are the byproducts of cellular metabolism 10-100 breaks occur each day in a typical human cell

Breaks can cause chromosomal rearrangements and deficiencies

They may be repaired by two systems known as homologous recombination repair (HRR) and nonhomologous end joining (NHEJ)


16-80

Double-Strand Breaks in DNA Can Be Repaired by Recombination

16-81Figure 16.22

16-82Figure 16.22


Not all DNA is repaired at the same rate Actively transcribed genes in eukaryotes and prokaryotes

are more efficiently repaired than is nontranscribed DNA

The targeting of DNA repair enzymes to actively transcribing genes has several biological advantages Active genes are more loosely packed

May be more vulnerable to DNA damage Transcription may make DNA more susceptible to damage DNA regions that contain active genes are more likely to

be important for survival than nontranscribed regions

16-83

Repair of Actively Transcribed DNA


In E. coli, a protein known as transcription-repair coupling factor (TRCF) mediates between DNA repair and transcription

It targets the NER system to actively transcribing genes having damaged DNA

16-84


16-85Figure 16.24


In eukaryotes, the mechanism that couples DNA repair and transcription is not completely understood

Several different proteins have been shown to act as transcription-repair coupling factors Some of these have been identified in people with high

rates of mutation For example, in Cockayne syndrome

Two genes, CS-A and CS-B, encode proteins that function as transcription-repair coupling factors

16-86


* Ataxia telangiectasia

* Bloom syndrome

* Cockayne's syndrome

* Progeria (Hutchinson-Gilford Progeria syndrome)

* Rothmund-Thomson syndrome

* Trichothiodystrophy

* Werner syndrome

* Xeroderma pigmentosum

Human diseases due to mutations in genes involved in DNA repair

End of Chapter 16

Hoofdstuk 16-mutations-dna repair

Documents

Transcript of Hoofdstuk 16-mutations-dna repair