Biochemical and Biophysical Research Communications 377 (2008) 752756

Contents lists available at ScienceDirect

Biochemical and Biophysical Research Communications

journal homepage: www.elsevier.com/ locate /ybbrcStaph y lo coc cal cas sette chro mo some mec (SCCmec) is a mobile

genetic ele ment, which con fers on its host resis tance to b-lac tam anti mi cro bial agents, such as pen i cil lins and cep hems [1,2]. It con-

sists of mec com plex (a region con tain ing mecA, mecR, IS/mecI, IS431),

ccr com plex (a region con tain ing recom bi nase genes such as ccrA,

ccrB, or ccrC), and directly repeated 15-base core sequences at both

ends, and is inserted into the attach ment site (att) located at the very

end of an open read ing frame (ORF), orfX of unknown func tion, in

meth i cil lin-sus cep ti ble Staph y lo coc cus aureus (MSSA) [13]. Seven

types of SCCmec (SCCmecI to SCCmecVII) have been described based

on dif fer ences in struc ture (mec com plex and ccr com plex) and size

for meth i cil lin-resis tant S. aureus (MRSA) [1,38].

Of those, e.g., SCCmecII or SCCmecIII are mainly asso ci ated with

hos pi tal-acquired MRSA (HA-MRSA) [1,9]. It has been con sid ered

that HA-MRSA emerged from MSSA by acqui si tion of SCCmec only

sev eral times, and a rel a tively small num ber of pan demic MRSA

clones spread world wide, such as New York/Japan clone (mul tilo-

cus sequence type [ST] 5, SCCmecII) and Hun gar ian clone (ST239 and

SCCmecIII) [10]. In con trast, SCCmecIV or SCCmecV are mainly asso-

ci ated with com mu nity-acquired MRSA (CA-MRSA) [5,9]. CA-MRSA

often pro duce Pan ton-Val en tine leu co ci din (PVL); exam ples are

pre dom i nant clones in the United States (geno type: ST8/SCCmecIV

[USA300]) or in Europe (geno type: ST80/SCCmecIV) [9,11,12].

For PVL-positive ST59 CA-MRSA in Tai wan, the SCCmec was

ini tially clas si fied as SCCmecVT, based on the genetic infor ma tion

(mec com plex C2 and ccr com plex C2) obtained from partial

sequence data [13]. Then, it was assigned as a novel SCCmec type

VII, based on the find ing (unique fea ture of the pres ence of two

ccrC genes [ccrC2 and ccrC8]) obtained from more pre cise sequence

data [8]. In this study, the entire struc ture of SCCmecVII was deter-

mined and its evo lu tion al char ac ter is tics were inves ti gated. Based

on the unique struc ture, a spe cific detec tion method of SCCmecVII

was devel oped.

Mate ri als and meth ods

Bac te rial strains. PVL-positive ST59 CA-MRSA (23 strains) from

Tai wan, includ ing strains PM1 (from which, partial SCCmecVII

sequence was obtained [8]), TSGH17 (for which, SCC mecVT was

pro posed [13]), SSF17, and Ce7, were described pre vi ously [8].

Strain TSGH17 and strains SSF17 and Ce7 were kindly pro vided by

C.C. Wang and M. Ling and L.K. Siu, respec tively. PVL-positive ST59

CA-MRSA strains (10 strains), iso lated in 2006 from Tai wan, were

also employed. Stan dard strains used for SCCmec typ ing included

strains 10442 (for SCCmecI), N315 (for SCCmecII), 85/2082 (for

SCCmecIII), JCSC1968 (for SCCmecIVa), JCSC1978 (for SCCmecIVb),

JCSC4788 (for SCCmecIVc), JCSC4469 (for SCCmecIVd), and WIS (for

SCCmecV); they were kindly pro vided by T. Ito and K. Hi ra ma tsu.

Sequenc ing of SCCmecVII region. Sequenc ing of the SCCmecVII

region of strain PM1 was per formed between two ORFs flank ing

SCCmec [2]: orfX and orf (for puta tive tRNA dihydro uri dine syn thase)

on the non-orfX side (the lat ter orf was des ig nated as orfY in this

study). ORF anal y sis of deter mined sequences was per formed using

Structure and specific detection of staphylococcal cassette chromosome mec

type VII

Wataru Higuchi a, Tomomi Takano a, Lee-Jene Teng b, Tatsuo Yamamoto a,*

a Divi sion of bac te ri ol ogy, Depart ment of Infec tious Dis ease Con trol and Inter na tional Med i cine, Nii gata Uni ver sity Grad u ate School of Med i cal and Den tal Sci ences, 1-757,

As ahi mach i do ri, Nii gata 951-8510, Japanb National Tai wan Uni ver sity Hos pi tal and National Tai wan Uni ver sity Col lege of Med i cine, Tai pei, Tai wan

a r t i c l e i n f o a b s t r a c t

Article history:

Received 2 October 2008

Available online 14 October 2008

Staph y lo coc cal cas sette chro mo some mec (SCCmec) type VII, found in com mu nity-acquired meth i cil lin-resis-

tant Staph y lo coc cus aureus belong ing to mul tilo cus sequence type (ST) 59 from Tai wan, was 41,347 bp in size

and flanked by 19-bp attL and attR sequences. It was inserted into the att site at the 39-end of orfX in the orfX-orfY (puta tive tRNA dihydro uri dine syn thase) region in ST59 S. aureus. The 59-end side 9911-bp core region of SCCmecVII, which con tained attL and the cas sette chro mo some recom bi nase gene (ccrC8), was shared by

other SCC struc tures, SCC mer cu ry and mosaic SCCmec from Swit zer land, indi cat ing its impor tant role in SCC

evo lu tion. The cen tral 21,245-bp core region con tained mec com plex (C2b) and another ccrC gene (ccrC2),

and was highly homol o gous to SCCmecV, but with sub sti tu tions, inser tion and replace ment. The 39-end side 10,191-bp sequence was unique. There fore, SCCmecVII has emerged through recom bi na tion and inser tion

events. Mul ti plex and real-time PCR assays were devel oped for spe cific detec tion of SCCmecVII.

2008 Else vier Inc. All rights reserved.

Key words:

Meth i cil lin-resis tant Staph y lo coc cus aureus

(MRSA)

Staph y lo coc cal cas sette chro mo some mec

type VII (SCCmecVII)

The cas sette chro mo some recom bi nase C

gene (ccrC)

Evo lu tion

* Cor re spond ing author. Fax: +81 25 227 0762.

E-mail address: tats uoy@med.nii gata-u.ac.jp (T. Yamamoto).0006-291X/$ - see front matter 2008 Else vier Inc. All rights reserved.

doi:10.1016/j.bbrc.2008.10.009

http://www.sciencedirect.com/science/journal/0006291Xhttp://www.elsevier.com/locate/ybbrcmailto:tatsuoy@med.niigata-u.ac.jp

W. Hig u chi et al. / Biochemical and Biophysical Research Communications 377 (2008) 752756 753

the soft ware in sil ico Mo lec u lar Cl on ing (R) GE ver sion 1.5.2 (in sil ico

biol ogy, Kanag a wa, Japan). Homol ogy anal y sis was per formed using

the soft ware BLAST (http://blast.ddbj.nig.ac.jp/top-e.html).

Phy lo ge netic anal y sis of the ccr sequences. The ccr sequences

were taken from Gen Bank Acces sion Nos. AB121219 for ccrC1;

AY894416 for ccrC2; AB037671 for ccrC3; U10927 for ccrC4;

AP006716 for ccrC5; EF190467 for ccrC6; EF190468 for ccrC7;

AB462393 or AB353125 for ccrC8; and AM292304 for ccrC9 (ccrC

of SCCmecZH47). The phy lo ge netic diver sity was ana lyzed by CLU-

STALW (http://clu stalw.ddbj.nig.ac.jp/top-j.html), and the graph

was con structed by using Tree View X.

Clon ing of the ccrC2 and ccrC8 sequences. For clon ing of the ccrC2

and ccrC8 gene sequences, the ccrC2 and ccrC8 gene sequences

were ampli fied by PCR, and the PCR prod ucts were inserted into

a vec tor pUC18 (Ta ka ra Bio, Shi ga, Japan) using In-Fusion sys tem

(Ta ka ra Bio); resul tant recombinant plas mids were des ig nated

pUC18-ccrC2 and pUC18-ccrC8, respec tively.

Mul ti plex and real-time PCR assay. Prim ers for PCR (and mul ti plex

PCR), and prim ers and probes for real-time PCR, designed in this study,

are listed in Table 1. Elec tro pho re sis was per formed in 1.5% aga rose

with the molec u lar size stan dards (sta ble 100 bp DNA lad der; Sigma,

Tokyo, Japan). For real-time PCR, the probes for the mec com plex C2

of SCCmecV (des ig nated as C2a in this study) and the mec com plex

C2 of SCCmecVII (des ig nated as C2b in this study), respec tively, con-

tained the reporter dye FAM (6-car boxy fluo res cein; Applied Bio sys-

tems, Fos ter City, CA) and VIC at the 59-end. FAM and VIC were detected at 492516 and 535555 nm in wave length, respec tively.

The 39-end of the probes con tained the quencher dye, a minor groove binder (MGB) mol e cule, and non-fluo res cent quencher (NFQ) (MGB-

NFQ, Applied Bio sys tems). Bac te rial DNA was prepared using zir co-

nia beads as pre vi ously described [14]. Real-time PCR was per formed

with an ABI 7900HT sequence detec tor (Applied Bio sys tems), fol low-

ing the man u fac turers instruc tions. The cycling con di tions were an

ini tial sin gle cycle for 2 min at 50 C, fol lowed by a sin gle cycle for

10 min at 95 C, and 50 cycles of two-tem per a ture cycling con sist ing

of 15 s at 95 C and 1 min at 60 C.

Results

Entire struc ture of SCCmecVII

The entire nucle o tide sequence of the orfX-orfY (puta tive tRNA

dihydro uri dine syn these) region car ry ing SCCmecVII of PVL+

ST59 CA-MRSA strain PM1 was deter mined (Fig. 1). The orfX-orfY

region of strain PM1 was 49,137 bp in size (Gen Bank Acces sion

No. AB462393). SCCmecVII was 41,347 bp and flanked by 19-bp

directly repeated sequences (attL and attR). When com pared with

ST59 MSSA strain 15585, attR of SCCmecVII was iden ti cal to the att

site sequence of strain 15585, while attL of SCCmecVII dif fered by

two nucle o tides (Fig. 1A). orfX and the orfY side region (from attR

to orfY) of strain PM1 were highly (99.2% and 99.9%, respec tively)

homol o gous to orfX and the att-orfY region of strain 15585.

SCCmecVII con tained 39 ORFs, and was com posed of three

dis tinct regions (Fig. 1B). The left side ccrC region, which was defined

as a region from attL to three small ORFs (tsORF) next to IS431,

was 9911 bp in size, and con tained 10 ORFs includ ing ccrC8. Inter-

est ingly, this region was shared by SCC mer cu ry con tain ing ccrC3;

they were 97.5% homol o gous (Fig. 1B). The cen tral mec com plex

C2-ccrC2 region (21,245 bp in size) was homol o gous to SCCmecV

(Fig. 1B). How ever, com pared with SCCmecV, there existed, e.g., (i)

nucle o tide sub sti tu tions in IS431 (result ing in trun cated trans pos-

ase in WIS431) in mec com plex C2 (mec com plex C2 of SCCmecV and VII was named C2a and C2b, respec tively); (ii) inser tion of the

1270-bp IS Sau4-like sequence (which showed 97.0% homol o gous

to IS Sau4 [1261 bp]) into orf21 (such IS Sau4-like sequence was also

pres ent in SCCmecII and IVg); (iii) non-syn on y mous sub sti tu tions

in ccrC (result ing in con ver sion of ccrC1 into ccrC2); and (iv) two

small replace ments includ ing replace ment in orf33. The 10,191-bp

right side region showed no homol ogy to S. aureus sequences, and

showed a rel a tively low GC con tent (Fig. 1C).

Spe cific detec tion of SCCmecVII

The char ac ter is tic fea ture of SCCmecVII is the pres ence of two

ccrC (ccrC2 and ccrC8), WIS431 with trun cated trans pos ase in mec com plex C2b, and unique sequence at the right side region (e.g.,

orf35). Spe cific detec tion was per formed by PCR and real-time PCR,

tar get ing those fea tures (Fig. 2 and Table 1).

Since there were no MRSA strains which pos sess ccrC2 alone

or ccrC8 alone, each of the ccrC2 and ccrC8 sequence was cloned

into pUC18. PCR primer sets (ccrC2-F2 and ccrC2-R2) and (ccrC8-F

and ccrC8-R), respec tively, spe cifi cally detected the ccrC2 and

ccrC8 sequences (Fig. 2A), and pro duced positive results only for

SCCmecVII+ MRSA strains (Fig. 2A and B). Primer sets (mecC2-F and

mecC2-R) detected mec com plex C2 (both C2a and C2b), which was

unique to SCCmecV and VII (and pos sessed DmecR1 and IS431 or

Table 1

List of the prim ers and probes used in this study.

Tar get gene or sequence Primer or probe PCR prod uct size (bp) Gen Bank Acces sion No. or ref er ence

Name Sequence

(1) Prim ers for PCR assay

ccrC2 ccrC2-F2 59-AT A AGTTAAAAGCACGACTCA 257 AB353125, [8]ccrC2-R2 59-TTCAATCCTATTTTTCTTTGTG

ccrC8 ccrC8-F 59-GCATGGGTACTCAATCCA 562 AB462393, this studyccrC8-R 59-GGTTGTAATGGCTTT GAGG

orf33 orf33-F 59-CA AAATCAACGTGTGGGAAA 534 AB462393, this studyorf33-R 59-GAC TTCTTCCTCTATAGCTTGT

orf35 orf35-F 59-CA GA GGCTCATCTACATCCT 304 AB462393, this studyorf35-R 59-TGTTCTGCTATACCTTCC ACA

(2) Prim ers and probes for real-time PCR assay

mec com plex C2(C2a, C2b) mecC2-F 59-AT CAGTTCATTGCTCACGATATGTGTA 344 AB462393, this studymecC2-R 59-CA ATACGCCATTTGTAATAAGCTTTT

C2a mecC2a-P (FAM) 59-CTACCGTTGGGTTCAAG AB462393, this studyC2b mecC2b-P (VIC) 59-CTAGCGTTGAGTTCAAG

http://www.blast.ddbj.nig.ac.jp/top-e.htmlhttp://www.clustalw.ddbj.nig.ac.jp/top-j.html

754 W. Hig u chi et al. / Biochemical and Biophysical Research Communications 377 (2008) 752756

WIS431; Sup ple men tary Fig. 1), as shown in Fig. 2B. Mul ti plex PCR with three primer sets, tar get ing the ccrC2, ccrC8, and mec com plex

C2 (both C2a and C2b), gave all three bands for SCCmecVII+ MRSA,

only one band (for mec com plex C2) for SCCmecV+ MRSA, and no

bands for other SCCmecI+ to SCCmecIV+ MRSA (Fig. 2B). PCR primer

sets (orf35-F and orf35-R) and (orf33-F and orf33-R), tar get ing

the orf35 and orf33 sequences (Fig. 1B), also spe cifi cally detected

SCCmecVII+ MRSA (data not shown).

To dis tin guish between mec com plex C2a (of SCCmecV) and

mec com plex C2b (of SCCmecVII), real-time PCR was designed

(Sup ple men tary Fig. 1 and Table 1). In this real-time PCR, primer

sets (mecC2-F and mecC2-R) reacted with both C2a and C2b,

and probe mec2Ca-P spe cifi cally detected the IS431 sequence of

SCCmecV, while probe mec2Cb-P tar geted two sin gle nucle o tide

sub sti tu tions caus ing trun cated trans pos ase in WIS431, thus spe-cifi cally detected SCCmecVII (Sup ple men tary Fig. 2).

PVL-positive ST59 MRSA strains (33 strains includ ing strains

TSGH17, SSF17, and Ce7) iso lated from Tai wan, were exam ined by

PCR or real-time PCR, described above. SCCmec of those strains

was pre vi ously con sid ered to be SCCmecVT, but it was unam big u-

ously shown to be SCCmecVII in any case.

Dis tri bu tion of the left side ccrC region (attL-ccrC-tsORF) as a core

among SCC struc tures

The attL-ccrC-tsORF region was shared by SCCmecVII and

SCC mer cu ry (Fig. 1B). This attL-ccrC-tsORF region was also found

in SCCmecZH47 iso lated in MRSA from Swit zer land (Fig. 3), indi-

cat ing its impor tant role as a core in SCC evo lu tion. The ccrC

sequence of SCCmecZH47 was diver gent from other ccrC sequences

(Sup ple men tary Fig. 3); it was ten ta tively named ccrC9. When

three attL-ccrC-tsORF regions of SCCmecVII, SCC mer cu ry, and

A

B

C

Fig. 1. The entire sequence of SCCmecVII, its inser tion site in ST59 MSSA, and struc tural com par i son with SCC mer cu ry. In (A), the data of ST59 MSSA strain 15585 were taken

from [2]; Gen Bank Acces sion No. EU272082. Homol o gous regions are shown in shadow. Dots above the attL sequence show diver gent nucle o tide. In (B), the data of SCC-

mer cu rySCCmecIII and SCCmecV were from [15]; Gen Bank Acces sion Nos. AB037671 and AB121219, respec tively. Homol o gous regions between SCCmecVII and SCC mer cu ry

or between SCCmecVII and SCCmecV are shown in shadow, and num bers in shadow show percent homol ogy between the cor re spond ing ORFs. IS Sau4 was from IS FINDER

(http://www-is.bio toul.fr/IS.html). In (C), GC con tents in three regions of SCCmecVII (shown in (B)) are shown.

http://www-is.biotoul.fr/IS.html

W. Hig u chi et al. / Biochemical and Biophysical Research Communications 377 (2008) 752756 755

SCCmecZH47 were com pared, there existed IS (IS431) or trans po son

(Tn554) next to tsORF (Fig. 2B and 3A), sug gest ing a pos si bil ity that

a region next to tsORF pro vides sites for recom bi na tion. SCCmecVII

and SCCmecZH47 also shared the IS431-mecA region next to the

attL-ccrC-tsORF region, indi cat ing that the 15,350-bp left side attL-

ccrC-IS431-mecA region may also play a role as a core in SCCmec

evo lu tion.

More over, in the 9.9 kb left side ccrC regions (attL-ccrC-tsORF),

the 6.5 kb region, con sist ing of ccrC with tsORF on the right side

and three ORFs on the left side, was con served among sev eral

SCCmec and SCC struc tures con tain ing ccrC (Sup ple men tary Fig. 4).

Such a con served ccrC region (6.5 kb in size) was des ig nated the

ccrC-car ry ing unit.

Dis cus sion

The size of SCCmecVII (41.3 kb) was rel a tively large com pared

with SCCmecI (34.3 kb; Gen Bank Acces sion No. AB033763),

SCCmecII (53.0 kb; Gen Bank Acces sion No. D86934), SCCmecIII

(35.2 kb; Gen Bank Acces sion No. AB037671), SCCmecIV (24.2 kb;

Gen Bank Acces sion no. AB063172), and SCCmecV (27.6 kb;

Gen Bank Acces sion No. AB121219). The size of SCCmecVI has not

been described [7]. Ini tially described SCCmecIII was large in size

(66.9 kb; Gen Bank Acces sion No. AB037671), but it was actu ally

com posed with SCC mer cu ry (31.8 kb; Gen Bank Acces sion No.

AB037671) and SCCmecIII [15]. The mosaic SCCmec (SCCmecZH47),

mainly con sisted of SCC mer cu ry and SCCmecIVc, was 33.7 kb in

size [16]. It has been con sid ered that SCCmec of CA-MRSA with

smaller sizes, such as SCCmecIV and SCCmecV, may move more

fre quently, com pared with SCCmec of HA-MRSA with larger sizes,

such as SCCmecII and pre vi ous SCCmecIII (SCC mer cu rySCCmecIII),

and there fore CA-MRSA has been emerg ing recently [9,18]. Since

SCCmecVII with a large size is asso ci ated with major PVL-positive

ST59 CA-MRSA in Tai wan (pre vi ous SCCmecVT [13] was found to

be actu ally SCCmecVII in this study), this hypoth e sis remains to be

clar i fied.

SCCmecVII was inserted into the att site at the 39-end of orfX in ST59 MSSA to gen er ate ST59 MRSA. Noto et al. [2] pro posed that

the 15-bp core att sequence in MSSA plays an impor tant role in

SCCmec inser tion, and the inserted SCCmec has the 15-bp directly

repeated core att sequence at both ends. Indeed, for SCCmecVII, att

was assigned to be 19 bp, includ ing this core att sequence, although

attR of SCCmecVII was iden ti cal to the expected att site sequence

in ST59 MSSA, while attL was dif fer ent from the expected att site

sequence by two nucle o tides (two sin gle base sub sti tu tion). In

closed agree ment with the pre vi ous find ing by Noto et al. [2], there

was ORF (for puta tive tRNA dihydro uri dine syn these) (des ig nated

orfY in this study) 7.8-kb away from the att site in ST59 CA-MRSA

strain PM1.

SCCmecVII was com posed of three dis tinct regions. The left side

core region of SCCmecVII, which con tained attL, ccrC8, and tsORF,

was shared by other SCC struc tures, SCC mer cu ry and mosaic

Fig. 3. Struc tural com par i son of SCCmecVII with the mosaic SCCmec (SCCmecZH47). The data of SCCmecZH47 were taken from [16]; Gen Bank Acces sion No. AM292304. The data

of SCCmecIVc were from [17]; Gen Bank Acces sion No. AB245470. Homol o gous regions between SCCmecZH47 and SCCmecVII or between SCCmecZH47 and SCCme cIVc are shown

in shadow, and num bers in shadow show percent homol ogy between the cor re spond ing ORFs.

pUC18

-ccrC2

pUC18

-ccrC8

PM1

pUC18

-ccrC2

pUC18

-ccrC8

PM1

Marke

r

PCR forccrC2

PCR forccrC8

257562

(bp)

mec complex C2 (344)

SCCmec

I+MRSA

(104

42)

SCCmec

II+MRSA

(N31

5)

SCCmec

III+MRSA

(85/20

82)

SCCmec

IV+MRSA

(JCSC

1968

)

SCCmec

V+MRSA

(WIS)

SCCmec

VII+

MRSA

(PM1)

Marke

r

ccrC8 (562)

ccrC2 (257)

(bp)

Strain

Strain

A B

Fig. 2. Detec tion by PCR and mul ti plex PCR of SCCmecVII. In (A), PCR tar get ing the ccrC2 and ccrC8 sequences was per formed. In (B), mul ti plex PCR tar get ing three sequences

(ccrC2, ccrC8, and mec com plex C2) was per formed.

756 W. Hig u chi et al. / Biochemical and Biophysical Research Communications 377 (2008) 752756

SCCmec from Swit zer land, indi cat ing its impor tant role in SCC

evo lu tion. Next to tsORF, there existed IS (IS431) or trans po son

(Tn554). For recom bi na tion events of the left side attL-ccrC core

region, tsORF region and IS or Tn may play a role. More over, the

ccrC-car ry ing unit, a smaller struc ture within the left side attL-

ccrC core region, could also be a core in evo lu tion. The cen tral mec

com plex (C2b)-ccrC2 core region of SCCmecVII was homol o gous to

SCCmecV, and the right end side of SCCmecVII was a unique region.

There fore, SCCmecVII has emerged obvi ously through multiple

recom bi na tion events.

Acknowl edg ment

This study was sup ported by a grant from the Japan Sci ence and

Tech nol ogy Agency, Japan.

Appen dix A. Sup ple men tary data

Sup ple men tary data asso ci ated with this arti cle can be found,

in the online ver sion, at doi:10.1016/j.bbrc.2008.10.009.

Ref er ences

[1] Epub, July 29, 2008 R.H. Deu ren berg, E.E. Stob ber ingh, The evo lu tion of Staph-y lo coc cus aureus, Infect. Genet. Evol. (2008) Epub, July 29, 2008.

[2] M.J. Noto, B.N. Kreiswirth, A.B. Monk, G.L. Archer, Gene acqui si tion at the inser tion site for SCCmec, the geno mic island con fer ring meth i cil lin resis tance in Staph y lo coc cus aureus, J. Bac te riol. 190 (2008) 12761283.

[3] T. Ito, K. Okuma, X.X. Ma, H. Yuz a wa, K. Hi ra ma tsu, Insights on anti bi otic resis-tance of Staph y lo coc cus aureus from its whole genome: geno mic island SCC, Drug Resist. Updat. 6 (2003) 4152.

[4] D.C. Oli veira, H. de Len cas tre, Mul ti plex PCR strat egy for rapid iden ti fi ca tion of struc tural types and vari ants of the mec ele ment in meth i cil lin-resis tant Staph y lo coc cus aureus, An ti mic rob. Agents Che mo ther. 46 (2002) 21552161.

[5] T. Ito, X.X. Ma, F. Takeu chi, K. Okuma, H. Yuz a wa, K. Hi ra ma tsu, Novel type V staph y lo coc cal cas sette chro mo some mec driven by a novel cas sette chro-mo some recom bi nase, ccrC, An ti mic rob. Agents Che mo ther. 48 (2004) 26372651.

[6] K. Zhang, J.A. McC lure, S. El sayed, T. Louie, J.M. Con ly, Novel mul ti plex PCR assay for char ac ter iza tion and con com i tant sub typ ing of staph y lo coc cal cas-sette chro mo some mec types I to V in meth i cil lin-resis tant Staph y lo coc cus aureus, J. Clin. Micro biol. 43 (2005) 50265033.

[7] D.C. Oli veira, C. Mil heirio, H. de Len cas tre, Rede fin ing a struc tural var i ant of staph y lo coc cal cas sette chro mo some mec, SCCmec type VIl, An ti mic rob. Agents Che mo ther. 50 (2006) 34573459.

[8] T. Tak ano, W. Hig u chi, T. Ot suka, T. Bar ano vich, S. En any, K. Sa i to, H. Is obe, S. Doh-mae, K. Ozaki, M. Tak ano, Y. Iwao, M. Shi buya, T. Ok ubo, S. Yabe, D. Shi, I. Reva, L.J. Teng, T. Ya mam ot o, Novel char ac ter is tics of com mu nity-acquired meth i cil lin-resis tant Staph y lo coc cus aureus strains belong ing to mul tilo cus sequence type 59 in Tai wan, An ti mic rob. Agents Che mo ther. 52 (2008) 837845.

[9] N. Zet ola, J.S. Fran cis, E.L. Nu erm ber ger, W.R. Bis hai, Com mu nity-acquired meth i cil lin-resis tant Staph y lo coc cus aureus: an emerg ing threat, Lan cet Infect. Dis. 5 (2005) 275286.

[10] M. Aires de Sousa, T. Con ceio, C. Si mas, H. de Len cas tre, Com par i son of genetic back grounds of meth i cil lin-resis tant and -sus cep ti ble Staph y lo coc cus aureus iso lates from Portuguese hos pi tals and the com mu nity, J. Clin. Micro-biol. 43 (2005) 51505157.

[11] F. Vande nesch, T. Na im i, M.C. En right, G. Lina, G.R. Nim mo, H. Hef fer nan, N. Lias sine, M. Bes, T. Green land, M.E. Rev er dy, J. Eti enne, Com mu nity-acquired meth i cil lin-resis tant Staph y lo coc cus aureus car ry ing Pan ton-Val-en tine leu ko ci din genes: world wide emer gence, Emerg. Infect. Dis. 9 (2003) 978984.

[12] F.C. Te nov er, L.K. McDo u gal, R.V. Goe ring, G. Killg or e, S.J. Pro jan, J.B. Patel, P.M. Dun man, Char ac ter iza tion of a strain of com mu nity-asso ci ated meth i cil lin-resis tant Staph y lo coc cus aureus widely dis sem i nated in the United States, J. Clin. Micro biol. 44 (2006) 108118.

[13] S. Bo y le-Va vra, B. Ere shef sky, C.C. Wang, R.S. Daum, Suc cess ful mul ti re sis tant com mu nity-asso ci ated meth i cil lin-resis tant Staph y lo coc cus aureus line age from Tai pei, Tai wan, that car ries either the novel Staph y lo coc cal chro mo some

cas sette mec (SCCmec) type VT or SCCmec type IV, J. Clin. Micro biol. 43 (2005) 47194730.

[14] S. Nak ag a wa, I. Tane ike, D. Mim ura, N. Iwak ura, T. Na kay ama, T. Em ura, M. Kit atsuji, A. Fu jim ot o, T. Ya mam ot o, Gene sequences and spe cific detec tion for Pan ton-Val en tine leu ko ci din, Bio chem. Bio phys. Res. Com mun. 328 (2005) 9951002.

[15] Y. Kondo, T. Ito, X.X. Ma, S. Wa tan a be, B.N. Kreiswirth, J. Eti enne, K. Hi ra ma-tsu, Com bi na tion of mul ti plex PCRs for staph y lo coc cal cas sette chro mo some mec type assign ment: rapid iden ti fi ca tion sys tem for mec, ccr, and major dif-fer ences in junk yard regions, An ti mic rob. Agents Che mo ther. 51 (2007) 264274.

[16] R. Heus ser, M. Ender, B. Ber ger-Bchi, N. McCal lum, Mosaic staph y lo coc cal cas-sette chro mo some mec con tain ing two recom bi nase loci and a new mec com-plex, B2, An ti mic rob. Agents Che mo ther. 51 (2007) 390393.

[17] I. Tane ike, T. Ot suka, S. Doh mae, K. Sa i to, K. Ozaki, M. Tak ano, W. Hig u chi, T. Tak ano, T. Ya mam ot o, Molec u lar nature of meth i cil lin-resis tant Staph y lo coc cus aureus derived from explo sive nos o co mial out breaks of the 1980s in Japan, FEBS Lett. 580 (2006) 23232334.

[18] R.S. Daum, T. Ito, K. Hi ra ma tsu, F. Huss ain, K. Mong kolr att ano thai, M. Jamk-lang, S. Bo y le-Va vra, A novel meth i cil lin-resis tance cas sette in com mu nity-acquired meth i cil lin-resis tant Staph y lo coc cus aureus iso lates of diverse genetic back grounds, J. Infect. Dis. 186 (2002) 13441347.

http://dx.doi.org/10.1016/j.bbrc.2008.10.009

Structure and specific detection of staphylococcal cassette chromosome mec type VIIMaterials and methodsResultsEntire structure of SCCmecVIISpecific detection of SCCmecVIIDistribution of the left side ccrC region (attL-ccrC-tsORF) as a core among SCC structures

DiscussionAcknowledgmentReferences