High Resolution Melting Curve Analysis for Rapid Detection ...15... · Three SM-R and two EB-R...
Transcript of High Resolution Melting Curve Analysis for Rapid Detection ...15... · Three SM-R and two EB-R...
Mædica - a Journal of Clinical Medicine
Original paper
246 Maedica
A Journal of Clinical Medicine, Volume 12 No.4, 2017
MAEDICA – a Journal of Clinical Medicine2017; 12(4): 246-257
High Resolution Melting Curve Analysis for Rapid Detection of Streptomycin and Ethambutol Resistance in Mycobacterium tuberculosisFaranak REZAEIa, Mehri HAEILIb, Abbasali Imani FOOLADIc, Mohammad Mehdi FEIZABADId*
aDepartment of Microbiology, School of Medicine, Lorestan University of Medical Sciences, Khorramabad, IranbDepartment of Biology, Faculty of Natural Sciences, University of Tabriz, Tabriz, IrancApplied Microbiology Research Center, Baqiyatallah University of Medical Sciences, Tehran, IrandDepartment of Microbiology, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran
Address for correspondence:Mohammad Mehdi Feizabadi, Professor in MicrobiologyDepartment of Microbiology, School of Medicine, Tehran University of Medical Sciences, Tehran, IranTel: +982188955810, Fax: +982188955810, E-mail: [email protected]
Article received on the 30th of October 2017 and accepted for publication on the 14th of December 2017.
ABSTRACTObjectives: Development of molecular techniques for rapid detection of drug resistant tuberculosis allows
for the prompt initiation of appropriate anti-TB treatment. We aimed to assess high-resolution melting (HRM) analysis for the detection of rpsL, rrs and embB mutations to identify streptomycin and ethambutol resistance in Mycobacterium tuberculosis.
Materials and Methods: A total of 76 clinical isolates of M. tuberculosis including 25 SM-R, 21 EB-R and 30 drug susceptible – determined by the proportion method of drug susceptibility testing (DST) – were analyzed by HRM analysis, and the results were confirmed using DNA sequencing.
Results: The sensitivity and specificity of the HRMA compared to phenotypic DST were 88% and 100.0%, respectively for the detection of streptomycin resistance (SM-R), and 90.4% and 96.6%, respectively for ethambutol resistance (EB-R). Three SM-R and two EB-R isolates had no mutations in the studied regions of rpsL, rrs and embB genes determined by DNA sequencing and therefore were not identified as resistant by HRM assay. Interestingly, one phenotypic EM-S isolate was found by sequencing to have a mutation at codon 423 (Met → Ilu) of embB gene and was clustered as resistant by HRM as well.
Conclusions: The sensitivity and specificity of HRM curve assay was consistent with DNA sequencing, which is the gold standard method for genotypic DST. This assay can be utilized as a screening method for detection of drug-resistant tuberculosis, offering the advantages of a high throughput, single step, cost effectiveness, and rapid work flow method.
Keywords: HRM analysis; Mycobacterium tuberculosis; rpsL; rrs; embB.
HigH Resolution Melting CuRve AnAlysis foR RApid deteCtion of stReptoMyCin And etHAMbutol ResistAnCe in MyCobACteRiuM tubeRCulosis
247Maedica A Journal of Clinical Medicine, Volume 12 No.4, 2017
INTRODUCTION
The fact remains that tuberculosis (TB), the cause of ill health among millions of people each year, is still a considerable problem. It ranks as the second leading cause of death from an infectious di-
sease, after the human immunodeficiency virus (HIV). The latest estimates are 9.0 million new TB cases in 2013 and 1.5 million TB deaths (1).
The association of streptomycin resistance (SM-R) in Mycobacterium tuberculosis with muta-tions in rpsL and rrs, encoding the ribosomal pro-tein S12 and 16S rRNA, respectively is evident (2). Within the rpsL gene, mutations at codon 88 and – the most commonly occurring mutation – at co-don 43 (K43R) in SM-R M. tuberculosis have been described. Mutations within rrs have been found in the 530 loop and the 912 loop, but these are less common compared to mutations within the rpsL gene (3-5).
The major mechanism of resistance to etham-butol (EB) is related to mutations in the embCAB operon, encoding three homologous arabinosyl transferases, mostly at codon 306 of embB (6, 7).
Iran, with an estimated TB incidence rate of 21 per 100,000, shares geographical borders with high TB-burden countries, including Azerbaijan, Arme-nia, Pakistan and Afghanistan; the reported rate of resistance to any anti-TB drug was 23% and 65% in new and previously treated cases, respectively. Also, 19% of new TB cases and 44% of previously treated patients were found to be resistant to SM. These amounts were 4% and 31% for new cases and previously treated patients in the case of EB (8, 9).
Conventional phenotypic methods are used to investigate M. tuberculosis drug resistance. How-ever, the conventional drug susceptibility testing (DST) methods are time consuming due to the slow growth rate of M. tuberculosis. Therefore, the rapid identification of drug-resistant M. tuberculo-sis using molecular methods is a useful aid in the appropriate treatment given earlier, and decreases transmission of resistant strains. In addition, the development of a rapid, low cost and sensitive as-say could potentially be used in settings where cost effectiveness is essential (10).
High resolution melting (HRM) curve analysis assay has been investigated for rapid detection of point mutations, single-nucleotide polymorphism (SNP), internal tandem duplications, simultaneous mutation scanning and genotyping in various bac-
teria. This method needs only the usual unlabeled primers and a dsDNA binding dye and detects se-quence variants based on differences in the mel-ting profiles between test and reference DNA. Also, this method is a closed-tube system, thereby minimizing cross-contamination from amplified DNA. Furthermore, it can be used for analyzing a large number of samples per run in a short time, which makes it a good candidate tool for mutation scanning (11, 12).
In the present study, we aimed to evaluate HRM assay for detection of mutations in rpsL, rrs and embB genes, to identify SM-R and EB-R in M. tuber-culosis. To our knowledge, this is the first report to des cribe HRM analysis application for the detec-tion of ethambotul and streptomycin resistance in clinical isolates of M. tuberculosis from Iran.
MATERIALS AND METHODS
Clinical isolates of M. tuberculosis strains
Samples including 20 M. tuberculosis clinical isolates were obtained from patients with bacterio-logically confirmed pulmonary TB from hospitals in Tehran during the period between 2010 and 2012. These samples which consisted of 5 SM-R and 5 EB-R, and 10 drug susceptible isolates were used as the reference samples for initial develop-ment of the HRM assay. To validate the HRM as-say, a blinded series of clinical M. tuberculosis iso-lates comprising 25 SM-R, 21 EB-R and 30 drug susceptible collected between 2012-2014 from six different provinces of Iran (including Tehran, Alborz, Sistan-Baluchestan, Lurestan, Khorasan and Ker-manshah) were examined.
Drug susceptibility testing
Drug susceptibility testing (DST) was per-formed in three different institutions, including Tehran University of Medical Sciences, Kerman-shah University of Medical Sciences and Mashhad University of Medical Sciences. It was carried out using the proportion method on Lowenstein-Jen-sen (LJ) medium containing 4.0 µg/mL for SM or 2.0 µg/mL for EB. M. tuberculosis H37Rv ATCC 27294 strain (susceptible to both SM and EB) was considered as a control (13).
DNA extraction and primer design
The isolates were subcultured on Lowenstein-Jensen solid medium and incubated at 37°C for
HigH Resolution Melting CuRve AnAlysis foR RApid deteCtion of stReptoMyCin And etHAMbutol ResistAnCe in MyCobACteRiuM tubeRCulosis
248 Maedica
A Journal of Clinical Medicine, Volume 12 No.4, 2017
two to four weeks. Then, genomic DNA was ex-tracted from the isolates according to a method described previously, and DNA concentration ob-tained from each sample was measured using Nano Drop (Thermo Scientific, USA). The DNA samples were stored at –20°C for subsequent ex-periments (14). The primers used for HRM analysis of the rpsL, rrs and embB genes were designed using Primer3Plus web tool (available online http://www.bioinformatics.nl/cgi-bin/primer3plus/pri mer3plus.cgi/). HPLC-purified primers were used to achieve the best performance. The nucleo-tide sequences of primers used for PCR and pro-duct sizes of amplicons analyzed by HRM assay are mentioned in Table 1.
PCR and high resolution melting curve analysis
The PCR reaction was performed using mi-re-al-time EvaGreen® Master kit (Metabion, Martin-sried, Germany) including the following compo-nents per reaction: DNA template (2 µL), 2X master mix (12.5 µL), each primer (1.5 µL), and PCR grade water (Metabion) adjusted to a final volume of 25 µL.
PCR and HRM curve analysis was performed using a Rotor-Gene 6000 apparatus (Qiagen). The PCR condition used for generating amplicons for HRM analysis consisted of one cycle of 95°C for 2 min, 40 cycles of 95°C for 15 s and 60°C for 40 s. The post-PCR HRM analysis was carried out fol-lowing the amplifications by heating the samples from 80°C to 95°C at a rate of 0.1°C per step, with
continuous fluorescence detection. All samples were examined in duplicate to ensure reproduci-bility of the melting curves. HRM curve data ana-lysis was performed using Rotor-Gene 6000 Series Software (Version 1.7) to calculate the derivative of the intensity of fluorescence at different tem-peratures (dF/dT).
The software analyzes the differences in the shape of the melting curve between a sample and the wild-type control strain (M. tuberculosis H37Rv) by generating a difference plot curve. This plot helps with clustering samples into groups having similar melting curves; hence, sequence polymorphisms can be detected.
DNA sequencing
Another set of primers were designed for deter-mination of the nucleotide sequences of an ex-tended region of all gene analyzed by HRM to as-sess the mutations conferring resistance and to confirm the results obtained by HRM (Table 2).
Amplification reactions were carried out in a final volume of 50 µL of PCR master kit (Ampliqon, Denmark), 0.2 µM of each primer and 10 ng of template DNA. The PCR cycling was run under the following conditions: 5 min at 94°C, followed by 30 cycles of 30 s at 94ºC, 45 s at 58°C and 45 s at 72°C, followed by a final extension at 72°C for 5 min. Then, the PCR products were used as tem-plates for targeted DNA sequencing that was per-formed by Macrogen Company (Korea). All se-quencing reactions were carried out in both forward and reverse directions using the primer
Primer name Gene Sequence (5'-3') Product size (bp) Tm Nucleotide
positionsrpsl_F rpsL TATGCACCCGCGTGTACA 199 59 98-115
rpsl_R CGGATGATCTTGTAGCGC 56 279-296
rrs1_F rrs CGGGTTCTCTCGGATTGACG 128 60 456-475rrs1_R CAAACCACCTACGAGCTCTT 57 583-564rrs2_F GGGTTTCCTTCCTTGGGATC 130 58 825-844rrs2_R AATTAATCCACATGCTCCGC 60 954-935
embB1_F embB TCGTCGGACGACGGCTACAT 277 62 867-884
embB1_R AGTAGGCGGGTTTGCTGGCC 63 1143-1126
embB2_F ATGCCGTTCAACAACGGC 333 59 1186-1203embB2_R GGTGGCTTCCAACACCGT 60 1518-1501
F=Forward, R=Reverse
TABLE 1. Primer sequences used for HRM assay
HigH Resolution Melting CuRve AnAlysis foR RApid deteCtion of stReptoMyCin And etHAMbutol ResistAnCe in MyCobACteRiuM tubeRCulosis
249Maedica A Journal of Clinical Medicine, Volume 12 No.4, 2017
pairs that were similar to the primers for PCR am-plification. The sequences were analyzed using ChromasProver. 1.7.1 Software (Technelysium), and mutations were determined by comparing our sequencing data with the nucleotide sequences of rpsL, rrs and embB genes of M. tuberculosis H37Rv deposited at Tuberculist (http://genolist.pasteur.fr/
TubercuList/) and the GenBank databases (http://www.ncbi.nih.gov/gene).
Statistical analysis
Sensitivity was determined as [Number of drug-resistant isolates with mutations]/ [number of drug-resistant isolates with mutations+number of
Primer name Gene Sequence (5'-3') Product size (bp) Tm Nucleotide
positionsrpsl_F rpsL GGTCGTCGGGACAAGATCAGT 340 61 31-51
rpsl_R CCTTCTCCTTCTTAGCGCCGT 62 370-350
rrs_F rrs GGAATATTGCACAATGGGCG 668 58 360-379rrs_R CCACAAGGGAACGCCTATCTC 60 1027-1007
embB_F embB GCTCAATTGCCCAGCTCCTC 899 61 737-756embB_R GATCAAAAAGCCGAAGCGCC 60 1635-1616
Phenotype No of isolates HRM assay DNA sequencing Nucleotid changes
Streptomycin rpsL rrs rpsL rrsSusceptible (30) 30 NM NM WT WTResistant (25) 7 M NM AAG→AGG WT Lys→Arg codon 43
5 M NM AAG→ATG WT Lys→Met codon 88
1 M NM AAG→AGG WT Lys→Arg codon 44
4 NM M WT nt907A→C 60 -
3 NM M WT nt516C→T -
1 NM MWT
nt526C→T -
1 NM M WT nt856A→T -
2 NM NM WT WT -Etambutol EmbB EmbB -
Susceptible (30) 29 NM WT -1 M ATG →ATA Met →Ile codon423
Resistant (21) 11 M ATG→GTG Met →Val codon306
5 M CAG→CGG Gln →Arg codon497
2 M CAG→CGG Gly →Asp codon406
1 M TCG→TCT Ser →Leu codon366
2 NM WT -NM=no mutation; M=mutation; WT=wild type; S=susceptible; R=resistant
TABLE 2. Primer sequences used in PCR reaction for sequencing
TABLE 3. Results of HRM assay to detect the mutations conferring resistance in SM and EB in blinded series of M. tuberculosis samples
HigH Resolution Melting CuRve AnAlysis foR RApid deteCtion of stReptoMyCin And etHAMbutol ResistAnCe in MyCobACteRiuM tubeRCulosis
250 Maedica
A Journal of Clinical Medicine, Volume 12 No.4, 2017
drug-resistant isolates without mutation]; and specificity as [Number of drug-susceptible isolates without mutations]/ [number of drug susceptible isolates with mutations+number of drug-suscepti-ble isolates without mutations]. Calculation of the 95% confidence interval was done using the Ad-justed Wald method (http://www.measuringus-ability.com/wald.htm).
RESULTS
Initial development of HRM assay for detection of streptomycin and ethambutol resistance
The HRM assay developed in this study was designed to identify dominant mutations related to drug resistance in rpsL, rrs and embB genes by using 20 M. tuberculosis DNA samples. By the HRM assay, the mutated isolates were easily dif-ferentiated from the susceptible (wild-type) isolates by comparing the differences in the melting-curve shapes.
The results obtained by HRM assay were con-sistent with those of phenotypic DST in all refe-rence samples. The HRM assay used for scanning of the rpsL and rrs genes in five clinical SM-R refe-rence samples, correctly identified corresponding mutations including K43R (AAG→AGG) and K88Q (AAG→ATG) alterations in rpsL and 516C/T and 907A/C alterations in rrs gene. Similarly, all five EMB resistant reference strains harboring M306I
(ATG→GTG) mutation determined by sequencing was correctly clustered as resistant by HRM.
Validation of HRM assay with blinded samples
A series of 76 samples was blindly analyzed to validate the HRM assay (Table 3). By HRM analysis of A fragment of 199 pb of rpsL gene and two frag-ments of 128 bp and 130 pb of rrs gene in 25 SM-R strains, 22 isolates were accurately identified as resistant (Table 3). However, three streptomycin-resistant isolates had no detectable mutation in the studied regions of rpsL and rrs using HRM. Im-portantly, DNA sequencing results of the regions encompassed by the HRM assay showed concor-dance with the HRM assay results for these iso-lates.
Similarly, HRM analysis correctly recognized embB mutations in 19/21 of phenotypically EB-R strains. The remaining two phenotypically EB-R isolates which had been falsely clustered as sus-ceptible (wild-type) by HRM, were confirmed for lacking any mutation in the studied regions of embB by sequencing. All 30 SM-S and 29 EB-S strains showed the wild-type HRM curve pattern and sequencing data confirmed the absence of mutation in the target regions of rpsL, rrs and embB genes in these isolates. However, one phenotypi-cally EB-S isolate showed a melting curve distinct from susceptible isolates but similar to those of re-sistant ones (Figure 1). Nucleotide sequencing
A. Normalized and shifted melting curves of rpsL
FIGURE 1. Representative normalized and difference plots of HRM curve analysis for mutant discrimination in rpsL genes (A and a, respectively), rrs1 (B and b, respectively) rrs2 genes (C and c, respectively, embB1genes (D and d, respectively) and embB2genes (F and f, respectively).
HigH Resolution Melting CuRve AnAlysis foR RApid deteCtion of stReptoMyCin And etHAMbutol ResistAnCe in MyCobACteRiuM tubeRCulosis
251Maedica A Journal of Clinical Medicine, Volume 12 No.4, 2017
a. Normalized and temp-shifted difference plot of rpsL
B. Normalized and shifted melting curves of rrs1
b. Normalized and temp-shifted difference plot of rrs1
HigH Resolution Melting CuRve AnAlysis foR RApid deteCtion of stReptoMyCin And etHAMbutol ResistAnCe in MyCobACteRiuM tubeRCulosis
252 Maedica
A Journal of Clinical Medicine, Volume 12 No.4, 2017
C. Normalized and shifted melting curves of rrs2
c. Normalized and temp-shifted difference plot of rrs 2
D. Normalized and shifted melting curves of embB1
HigH Resolution Melting CuRve AnAlysis foR RApid deteCtion of stReptoMyCin And etHAMbutol ResistAnCe in MyCobACteRiuM tubeRCulosis
253Maedica A Journal of Clinical Medicine, Volume 12 No.4, 2017
d. Normalized and temp-shifted difference plot of embB1
F. Normalized and shifted melting curves of embB2
f. Normalized and temp-shifted difference plot of embB2
HigH Resolution Melting CuRve AnAlysis foR RApid deteCtion of stReptoMyCin And etHAMbutol ResistAnCe in MyCobACteRiuM tubeRCulosis
254 Maedica
A Journal of Clinical Medicine, Volume 12 No.4, 2017
iden tified a mutation at codon 423 of embB gene for this isolate.
DNA sequencing
Nucleotide sequences of three genes analyzed by HRM were determined to study the type and frequency of mutations and also to confirm the HRM results.
Twenty eight percent (7/25) of SM-R isolates was found to have a mutation (AAG→AGG, Lys→Arg) at codon 43, 20% (5/25) of isolates had a mutation (AAG→ATG, Lys→Met) at codon 88, and 4% (1/25) of isolates had a mutation (AAG→AGG, Lys→Arg) at codon 44 of rpsL. In to-tal, 52% (13/25) and 36% (9/25) of SM-R isolates harbored mutations at rpsL, and rrs genes respec-tively. No mutation was found within the rpsL and rrs genes in the remaining 12% (3/25) of the SM-R isolates by direct sequencing method (Table 3).
Among 21 EB-R isolates, 11 were found to har-bor a mutation at codon 306 (ATG→GTG, Met→Val), five at codon 497 (CAG→CGG, Gln→Arg), two at codon 406 (GGC→GAC, Gly→Asp) and one at codon 366 (TCG→TCT, Ser →Leu) of the embB gene. However, the remaining 9.5% (2/21) of the EB-R isolates lacked any muta-tion within the embB gene determined by direct sequencing method. Interestingly, one EB-S isolate had a mutation at codon 423 (ATG→ATA, Met →Ile) of embB gene (Table 3).
Sensitivity and specificity
In order to evaluate the sensitivity and specifi-city, the HRM curve analysis for SM-R and EB-R was compared to the conventional DST results. The sensitivity for identification of resistance was found to be 88% for streptomycin (95% confi-dence interval 69.2-96.6) and 90.4% for ethambu-tol (95% CI 69.8-98.5), while the specificity was found to be 100% (95% CI 90.1-100.0) and 96.6% (95% CI 81.9-99.9) for streptomycin and ethambu-tol, respectively. Altogether, there was a 100% concordance between HRM analysis and DNA sequencing for the detection of resistance confer-ring mutations in all genes.
DISCUSSION
Drug resistance in tuberculosis is currently de-termined using culture-based methods such
as the agar proportion method, or liquid media
methods like the BACTEC MGIT 960. Although these methods are more rapid it requires at least one week for the determination of drug suscepti-bility (15). Getting an early drug susceptibility re-sult is clinically essential for patients to initiate an appropriate TB treatment regimen leading to better outcomes. It also allows surveillance of an-tibiotic resistance rates, which are relevant to TB control (16). HRM has been recognized as a rela-tively new post-PCR method providing the de-tection of subtle sequence variations by analy-zing the melting-curve shape after PCR amplification using saturating DNA dye, which produces an amplicon-specific melting curve. This technique has been successful in mutation scanning, single nucleotide polymorphism geno-typing, and identification of many bacterial spe-cies, including screening for drug resistance in M. tuberculosis (17-19). Usually, it is recommended that the size of PCR product should be less than 400 bp for HRM, but shorter amplicons are more sensitive for the detection of minor changes and offer higher resolution. Therefore, we designed primers which got the amplicons with this length.
In order to expedite the detection of SM-R and EB-R in M. tuberculosis, we have developed HRM assay to search for mutations in the corresponding rpsL, rrs and embB genes. To our knowledge, this is the first report of the use of HRM for rapid iden-tification of streptomycin and ethambutol resis-tance by analyzing rpsL, rrs and embB genes muta-tions in the clinical samples of M. tuberculosis from Iran.
In our study, the concordance of HRM curve analysis with DNA sequencing was found to be 100%. The assay was successfully used for the de-tection of dominant rpsL (codons 43 and 88) and rrs mutations (nucleotides 513 to 907).
In previous studies, the association of rpsL and rrs mutations with SM-R varied, but it was likely that it accounted for approximately 25% to 80.4% of SM-genotypes (20-22). In this study, sequencing data revealed that 88% of SM-R isolates had muta-tions in rpsL or rrs, or both, which is consistent with the results obtained by previous studies. All of these strains were correctly identified by the current HRM curve analysis. However, HRM was unable to detect resistance when the studied gene regions lacked a nucleotide alteration. Indeed, three phenotypically SM-R strains not harboring any mutation in rpsL or rrs were not identified in the HRM curve analysis. This can be due to the
HigH Resolution Melting CuRve AnAlysis foR RApid deteCtion of stReptoMyCin And etHAMbutol ResistAnCe in MyCobACteRiuM tubeRCulosis
255Maedica A Journal of Clinical Medicine, Volume 12 No.4, 2017
involvement of other additional genes in strepto-mycin resistance such as gidB gene, which en-codes a 7-methylguanosine methytransferase spe-cific for 16S rRNA. Although mutations in the gidB gene have been demonstrated to be associated with low level streptomycin resistance, mutations in these genes have been reported for streptomy-cin-susceptible clinical isolates as well (23, 24). Thus, further investigations are needed to confirm the association of gidB with streptomycin resis-tance. However, we have only studied the most commonly involved genes, while other genes and mechanisms involved in streptomycin resistance were not traced. All SM-S isolates generated a wild-type HRM curve and were correctly classi-fied as susceptible (specificity, 100%).
Our HRM assay detected embB mutations in 19 of 21 (90%) EB-R isolates among the 52.38% (11/21) harbored embB 306 mutations. This level is much lower compared to Cuba and the Domini-can Republic (70%) and Germany (68%), but simi-lar to the level estimated in China (55%) and Russia (48%) (25, 26), which shows that geographic distri-bution of embB mutations among the EB-R M. tu-berculosis isolates differs around the world. Two EB-R isolates had no detectable mutations in re-gions not encompassed by our assay. It has been suggested that genetic alterations in other drug target genes such as embA and embC may be in-volved in drug resistance development in these isolates. One discordant isolate had a mutation at codon 423 of embB (Met→Ile) that was detected by both HRM and sequencing methods, but it was found to be susceptible to EB by phenotypic DST. It is assumed that the cause of this discrepancy is the failure of the phenotypic test by deterioration of drugs during storage. In addition, it is possible that the low or intermediate level resistance due to this mutation makes it difficult to be diagnosed by the phenotypic test and all mutations found in embB are not necessarily associated to ethambutol resistance. Unfortunately, this sample was not via-ble for repeating the susceptibility testing.
Compared to phenotypic DST, streptomycin resistance was identified by our HRMA with speci-ficities of 100% and sensitivities of 88%. Wang re-ported that HRM had a sensitivity and specificity of 100% for the detection of SM resistance (27). A study from Singapore showed a sensitivity and specificity of 87.5% and 100%, respectively for the detection of SM-R by HRM (28). HRM analysis performed by Sethi et al. was found to have a sen-
sitivity and specificity of 61.8% and 100%, respec-tively for SM-R identification (29). Also, Negai et al. reported that sensitivity and specificity of HRM were 95.9% and 100%, respectively for tracing SM resistance among SM-R and SM-S isolates (10).
On the other hand, the calculated sensitivity and specificity for HRM assay used in the current study for the detection of EB resistance was found to be 90.4% and 96.6%, respectively. Lately, just one study has evaluated the usefulness of an HRM analysis for the detection of drug resistant M. tu-berculosis; Negai et al. reported 100% sensitivity and specificity for the identification of EB-R in M. tuberculosis isolates; this can be attributed to the fact that samples studied by them were more likely to harbor mutations within the regions stu-died by HRM, while – as confirmed by direct se-quencing results – in our study, the inability of HRM to detect resistance in a few isolates was mainly due to the absence of mutation within the studied genes. Indeed, we did not have false nega-tive results compared to sequencing, which is con-sidered to be the gold standard method for geno-typic DST.
Concordance between the results of HRM as-say and DNA sequencing for all genes analyzed in this study was found to be 100 %, suggesting that this assay is extremely accurate for the rapid de-tection of drug-resistant M. tuberculosis. However, there is a difference in sensitivity of molecular di-agnostics due to the variation in frequency and type of mutations between different geographic regions.
The HRM assay has several advantages com-pared to other molecular methods. Firstly, it is simple and rapid, because the amplification and melting analysis can be done as a single procedure on a real-time PCR device. Secondly, the potential risk of cross-contamination from subsequent reac-tions can decrease, because this assay is per-formed in a single closed tube in just one step. Thirdly, there is no need to costly fluorescent probes or specialized reagents.
There are also some disadvantages related to the use of HRM assay for the detection of drug resistance. Firstly, it can be performed only on cul-ture samples – therefore, if this method could be practicable for clinical specimens and the diagnos-tic interval in detection of drug resistant M. tuber-culosis would be further shortened. Secondly, the accuracy of HRM assay depends on some factors such as quality of the template DNA, instrument
HigH Resolution Melting CuRve AnAlysis foR RApid deteCtion of stReptoMyCin And etHAMbutol ResistAnCe in MyCobACteRiuM tubeRCulosis
256 Maedica
A Journal of Clinical Medicine, Volume 12 No.4, 2017
and dye, which is limiting its extensive application. Thirdly, the genetic basis of resistance is still not completely understood; therefore, similarly to oth-er genotypic DST methods, the HRM assay can-not detect drug resistance conferred by unknown mechanisms and it may not be able to fully replace the conventional culture based DST method (30).
CONCLUSION
In conclusion, we developed a specific HRM as-say for the detection of mutations in M. tubercu-
losis, conferring the targets for resistance to strep-tomycin and ethambutol. In order to screen the gene mutations associated with M. tuberculosis drug resistance, the rapid and sensitive HRM as-say could be used routinely at low costs, which
would be a suitable approach for laboratories lo-cated in less economically developed countries. One limitation of the present study is that this assay cannot yet replace conventional DST be-cause all kinds of mutations related to SM and EB resistance were not explored. q
Acknowledgements: We thank Tehran University of Medical Sciences.
Conflicts of interest: none declared.Funding: This study was part of PhD student
Faranak Rezaei’s postgraduate thesis, “HRMA for rapid detection of anti-TB drugs resistance in MTB”, that was supported by Tehran University of Medical Sciences (Project 20216).
1. WHO. Global Tuberculosis Report 2014: World Health Organization 2014.
2. Finken M, Kirschner P, Meier A, et al. Molecular basis of streptomycin resistance in Mycobacterium tuberculosis: alterations of the ribosomal protein S12 gene and point mutations within a functional 16S ribosomal RNA pseudoknot. Molecular microbiology 1993;9:1239-1246.
3. Zhang Y, Yew W. Mechanisms of drug resistance in Mycobacterium tuberculosis [State of the art series. Drug-resistant tuberculosis. Edited by CY. Chiang. Number 1 in the series]. The International Journal of Tuberculosis and Lung Disease 2009;13:1320-1330.
4. Bifani P, Mathema B, Campo M, et al. Molecular identification of streptomycin monoresistant Mycobacterium tuberculosis related to multidrug-resistant W strain. Emerging infectious diseases 2001;7:842.
5. Nhu N, Lan N, Phuong N, et al. Associa-tion of streptomycin resistance mutations with level of drug resistance and Mycobac-terium tuberculosis genotypes. The international journal of tuberculosis and lung disease 2012;16:527-531.
6. Telenti A, Philipp WJ, Sreevatsan S, et al. The emb operon, a gene cluster of Mycobacterium tuberculosis involved in resistance to ethambutol. Nature medicine 1997;3:567-570.
7. Sreevatsan S, Stockbauer KE, Pan X, et al. Ethambutol resistance in Mycobacterium tuberculosis: critical role of embB
mutations. Antimicrobial Agents and Chemotherapy 1997;41:1677-1681.
8. WHO. Global Health Observatory Data Repository 2011.
9. Nasiri MJ, Dabiri H, Darban-Sarokhalil D, et al. Prevalence of drug-resistant tuberculosis in Iran: systematic review and meta-analysis. American Journal of Infection Control 2014;42:1212-1218.
10. Nagai Y, Iwade Y, Hayakawa E, et al. High resolution melting curve assay for rapid detection of drug-resistant Mycobacterium tuberculosis. Journal of Infection and Chemotherapy 2013;19:1116-1125.
11. Liew M, Pryor R, Palais R, et al. Genotyp-ing of single-nucleotide polymorphisms by high-resolution melting of small amplicons. Clinical Chemistry 2004;50:1156-1164.
12. Ruskova L, Raclavsky V. The potential of high resolution melting analysis (HRMA) to streamline, facilitate and enrich routine diagnostics in medical microbiology. Biomedical Papers 2011;155:239-252.
13. Abdel Aziz M, Laszlo A, Raviglione MC, et al. Guidelines for surveillance of drug resistance in tuberculosis 2003.
14. van Soolingen D, Hermans P, De Haas P, et al. Occurrence and stability of insertion sequences in Mycobacterium tuberculosis complex strains: evaluation of an insertion sequence-dependent DNA polymorphism as a tool in the epidemiology of tuberculo-sis. Journal of Clinical Microbiology 1991;29:2578-2586.
15. Telles M, Bori A, Amorim A, et al. Rapid
detection of multidrug-resistant Mycobac-terium tuberculosis using the mycobacteria growth indicator tube (MGIT) system. Brazilian journal of medical and biological research 2002;35:1127-1131.
16. Bozeman L, Burman W, Metchock B, et al. Fluoroquinolone susceptibility among Mycobacterium tuberculosis isolates from the United States and Canada. Clinical infectious diseases 2005;40:386-391.
17. Ramirez MV, Cowart KC, Campbell PJ, et al. Rapid detection of multidrug-resistant Mycobacterium tuberculosis by use of real-time PCR and high-resolution melt analysis. Journal of clinical microbiology 2010;48:4003-4009.
18. Pang Y, Liu G, Wang Y, et al. Combining COLD-PCR and high-resolution melt analysis for rapid detection of low-level, rifampin-resistant mutations in Mycobacte-rium tuberculosis. Journal of microbiological methods 2013;93:32-36.
19. Krypuy M, Ahmed AA. Etemadmogha-dam D, et al. High resolution melting for mutation scanning of TP53 exons 5–8. BMC Cancer 2007;7:168.
20. Cuevas-Córdoba B, Cuellar-Sánchez A, Pasissi-Crivelli A, et al. rrs and rpsL mutations in streptomycin-resistant isolates of Mycobacterium tuberculosis from Mexico. Journal of Microbiology, Immunology and Infection 2013;46:30-34.
21. Yadav R, Sethi S, Dhatwalia S, et al. Molecular characterisation of drug resistance in Mycobacterium tuberculosis
References
HigH Resolution Melting CuRve AnAlysis foR RApid deteCtion of stReptoMyCin And etHAMbutol ResistAnCe in MyCobACteRiuM tubeRCulosis
257Maedica A Journal of Clinical Medicine, Volume 12 No.4, 2017
isolates from North India. The International Journal of Tuberculosis and Lung Disease 2013;17:251-257.
22. Sun YJ, Luo JT, Wong SY, et al. Analysis of rpsL and rrs mutations in Beijing and non-Beijing streptomycin-resistant Mycobacterium tuberculosis isolates from Singapore. Clinical Microbiology and Infection 2010;16:287-289.
23. Spies FS, Ribeiro AW, Ramos DF, et al. Streptomycin resistance and lineage-specific polymorphisms in Mycobacterium tuberculosis gidB gene. Journal of clinical microbiology 2011;49:2625-2630.
24. Wong SY, Lee JS, Kwak HK, et al. Mutations in gidB confer low-level streptomycin resistance in Mycobacterium tuberculosis. Antimicrobial agents and
chemotherapy 2011;55:2515-2522.25. Gui-Lian L, De-Fu Z, Tong X, et al.
Molecular characterization of drug-resistant Beijing family isolates of Mycobacterium tuberculosis from Tianjin, China. Biomedical and environmental sciences 2010;23:188-193.
26. Bakuła Z, Napiórkowska A, Bielecki J, et al. Mutations in the embB gene and their association with ethambutol resistance in multidrug-resistant Mycobacterium tuberculosis clinical isolates from Poland. BioMed research international 2013;2013.
27. Wang F, Shen H, Guan M, et al. High-resolution melting facilitates mutation screening of rpsL gene associated with streptomycin resistance in Mycobacterium tuberculosis. Microbiological research 2011;166:121-128.
28. Lee A, Ong D, Wong J, et al. High-resolution melting analysis for the rapid detection of fluoroquinolone and streptomycin resistance in Mycobacterium tuberculosis. PloS one 2012;7:e31934-e.
29. Yadav R, Sethi S, Mewara A, et al. Rapid detection of rifampicin, isoniazid and streptomycin resistance in Mycobacterium tuberculosis clinical isolates by high-resolution melting curve analysis. Journal of applied microbiology 2012;113:856-862.
30. Yin X, Zheng L, Liu Q, et al. High-resolution melting curve analysis for rapid detection of rifampin resistance in Mycobacterium tuberculosis: a meta-analysis. Journal of clinical microbiology 2013;51:3294-3299.