Hepatocyte nuclear factor 4 is a central regulator of bile acid ...

Regulation of bile acid conjugation by HNF4

Inoue et al. 1

Hepatocyte nuclear factor 4 is a central regulator of bile acid

conjugation.

Yusuke Inoue, Ai-Ming Yu, Junko Inoue, and Frank J. Gonzalez*

Laboratory of Metabolism, Center for Cancer Research, National Cancer Institute,

National Institutes of Health, Bethesda, Maryland 20892

Running title; Regulation of bile acid conjugation by HNF4α

*To whom correspondence should be addressed: Laboratory of Metabolism, Center for

Cancer Research, National Cancer Institute, National Institutes of Health, 9000 Rockville

Pike, Building 37, Room 3106, Bethesda, Maryland 20892, USA. Phone: (301) 496-

9067; Fax: (301) 496-8419; E-mail: [email protected]

JBC Papers in Press. Published on October 28, 2003 as Manuscript M311015200 by guest on M

arch 1, 2018http://w

ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


Inoue et al. 2

SUMMARY

Hepatocyte nuclear factor 4α (HNF4α) has an important role in regulating the expression

of liver-specific genes. Since bile acids are produced from cholesterol in liver and many

enzymes involved in their biosynthesis are preferentially expressed in liver, the role of

HNF4α in regulation of bile acid production was examined. In mice, unconjugated bile

acids are conjugated with taurine by the liver-specific enzymes, bile acid CoA ligase

(BAL) and bile acid CoA:amino acid N-acyltransferase (BAT). Mice lacking hepatic

HNF4α expression exhibited markedly decreased expression of the very long chain acyl-

CoA synthase-related gene (VLACSR), a mouse candidate for BAL, and BAT. This was

associated with markedly elevated levels of unconjugated and glycine-conjugated bile

acids in gallbladder. HNF4α was found to directly bind to the mouse VLACSR and BAT

gene promoters, and the promoter activities were dependent on HNF4α binding sites and

HNF4α expression. In conclusion, HNF4α plays a central role in bile acid conjugation by

direct regulation of VLACSR and BAT in vivo.

by guest on March 1, 2018

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


Inoue et al. 3

INTRODUCTION

Bile acids (BAs) are synthesized from cholesterol mainly in hepatocytes by a cascade of

enzyme reactions. In humans, these reactions are initiated by steroid nucleus and side

chain hydroxylation of cholesterol and followed by β-oxidation of the side chain and

resulting in the production of the primary BAs cholic acid and chenocholic acid (1, 2). In

mice, cholic acid and β-murichoric acid are the predominant primary BAs (3). Following

BA biosynthesis, BAs are conjugated with glycine or taurine resulting in conjugates that

are exported from hepatocytes via hepatic BA transporters such as the bile salt export

pump (BSEP) located at the apical or canulicular membrane (1, 4-6). These BAs are

stored in gallbladder and then transported into the small intestine. BAs are biological

detergents that serve to solubilize fats, sterols, fat-soluble vitamins in the intestine. Most

BAs are recycled from the jejunum and ileum by transporters such as apical sodium-

dependent bile acid transporter (ASBT) (4, 7), and then transported back into hepatocytes

from the portal circulation by transporters including sodium taurocholate cotransporter

polypeptide (NTCP) and organic anion transporter polypeptide 1 (OATP1) located at the

basolateral membrane (4).

Hepatocyte nuclear factor 4α (HNF4α) is an orphan member of nuclear receptor

hormone superfamily that is mainly expressed in liver, intestine, kidney and pancreas and

regulates expression of target genes including several serum proteins such as

apolipoproteins, blood coagulation factors, P450s, and enzymes involved in glucose,

lipid, ammonia, steroid and fatty acid metabolism by binding to direct repeat-1 (DR-1)

elements in their promoter or enhancer regions (8, 9). Indeed, the expression of hepatic

apolipoproteins including A-II, A-IV, C-II, and C-III, ornithine transcarbamylase


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


Inoue et al. 4

involved in ureagenesis, and CYP3A, associated with xenobiotic metabolism, was

significantly reduced in livers of liver-specific HNF4α-null mice (10-12). A second line

of liver-specific HNF4α-null mice, established to delete in the fetal liver using cre

recombinase under the control of the albumin promoter and the α-fetoprotein enhancer,

exhibited a marked reduction in expression of hepatic glycogen synthase, and

phosphoenolpyruvate carboxykinase and glucose 6-phosphatase, involved in

gluconeogenesis, and reduced levels of E-cadherin, ZO-1 and CEACAM1 proteins, that

are critical for normal liver morphology (13).

Liver-specific HNF4α-null mice in adult exhibited increased serum BAs and

expression of the BA transporters, NTCP and OATP1 was also reduced in these mice

(10). While BA biosynthesis and transport are controlled to some degree by HNF4α, it

remains unknown whether HNF4α regulates the BA conjugation pathway. Nuclear

receptors are involved in control of the BA biosynthesis and transport system (6, 14, 15),

but the mechanism regulating BA conjugation pathways have not been analyzed. BA

conjugation reactions are catalyzed by two liver-enriched enzymes, bile acid-CoA ligase

(BAL) and bile acid-CoA:amino acid N-acyltransferase (BAT) (1, 14). BAL activities are

associated with rat BAL protein (16) and human very long chain acyl-CoA synthase

homolog 2 (VLACSR-H2) protein (17), but enzymatic analysis of BAL protein has not

been performed in mouse. Since the mouse very long chain acyl-CoA synthase-related

(VLACSR) gene, that is highly expressed only in liver (18) as well as rat BAL and

human VLACSR-H2 genes, has a high homology to these proteins (16), it was reasonable

to assume that the VLACSR gene might be the mouse homolog for the BAL gene. On the

other hand, BAT genes have been cloned from mouse (19), rat (20), and human (21). The


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


Inoue et al. 5

human BAT protein has conjugation activity with both taurine and glycine as substrates

(21), but the mouse BAT protein only uses taurine as a substrate (19).

In the present study, the biological function of HNF4α was investigated in vivo and in

vitro using liver-specific HNF4α-null mice. These mice exhibit increased unconjugated

and glycine-conjugated BAs in gallbladder bile and decreased expression of VLACSR

and BAT. Expression of the VLACSR and BAT was shown to be directly regulated by

HNF4α via HNF4α binding sites in their promoter regions. These results indicate that

HNF4α has an important role in the maintenance of BA homeostasis by regulating BA

conjugation pathways.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


Inoue et al. 6

EXPERIMENTAL PROCEDURES

Animals and treatment—Liver-specific HNF4α-null mice were generated as described

previously (10). All experiments were performed with 45-day-old HNF4αflox/flox ×

albumin-Cre+ (KO) and HNF4αflox/flox × albumin-Cre- (FLOX) mice. Mice were housed in

a pathogen-free animal facility under standard 12 hr light/12 hr dark cycle with ad libitum

water and chow. All experiments with mice were performed under ALAC guidelines with

approval of the NCI Animal Care and Use Committee.

Northern blot analysis—Total liver or intestine RNA (10 µg) extracted with Trizol

reagent (Invitrogen, Carlsbad, CA), was fractionated by electrophoresis through a

formaldehyde-agarose gel and transferred to GeneScreen Plus membranes (Dupont,

Wilmington, DE). Blots were hybridized at 68°C in PerfectHyb plus solution (Sigma, St.

Louis, MO) with random primer-labelled cDNA probes and exposed to a phosphorimager

screen cassette followed by visualization using a Molecular Dynamics Storm 860

Phosphorimager system (Sunnyvale, CA). All probes were amplified from a mouse

cDNA library using gene-specific primers and cloned into the pCR II vector (Invitrogen).

Sequences were verified using CEQ 2000 Dye Terminator cycle sequencing kits

(Beckman Coulter, Fullerton, CA) and a CEQ 2000XL DNA Analysis System (Beckman

Coulter).

Extraction of bile acids from bile—Three µl of bile or a 1/100 dilution (in methanol)

was added into 200 µl of acetonitrile containing 20 µl of 50 µM dehydrocholic acid

(DHCA). The sample was vortexed for 10 s, then subsequently centrifuged at 14,000 × g


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


Inoue et al. 7

at 4°C for 5 min. The supernatant was transferred to a new glass tube and extracted with

2 ml of a mixture of ethyl acetate and t-butyl methyl ether (2/1, v/v). After centrifugation

at 3,000 × g at 4°C for 15 min, the organic phase was evaporated under a stream of

nitrogen gas. The residue was reconstituted in 60 µl of a 50% methanol solution

containing 0.2% formic acid. Ten µl of each reconstituted sample was injected for liquid

chromatography tandem mass spectrometry/mass spectrometry (LC-MS/MS) analysis.

Identification and quantitation of intact free and conjugated bile acids by LC-

MS/MS—LC-MS/MS analysis was performed on a PE SCIEX API2000 ESI triple-

quadrupole mass spectrometer (PerkinElmer, Foster City, CA) controlled by Analyst

software. A Phenomenex Luna C18 3µm 100 mm × 2 mm i.d. column (Torrance, CA)

was used to separate free bile acids. The flow rate through the column at ambient

temperature was 0.2 ml/min, and optimal resolution was achieved by elution with a linear

gradient of water containing 0.1% formic acid (45% → 0%) and methanol (55%

→100%) in 10 min at room temperature. Separation of glycine and taurine conjugated

bile acids was performed on an Aquasil C18 5µm 50 mm × 2 mm i.d. column (Keystone

Scientific Operations, Bellefonte, PA), and the HPLC system was operated isocratically

at a flow rate of 0.2 ml/min with the mobile phase (acetonitrile/water/methanol =

30/45/25, v/v/v) containing 0.1% formic acid. The mass spectrometer was operated in

the turbo ion spray mode with positive ion detection. The turbo ion spray temperature

was maintained at 350°C, and a voltage of 4.8 kV was applied to the sprayer needle.

Nitrogen was used as the turbo ion spray and nebulizing gas. The detection and

quantification of free and conjugated bile acids and the internal standard were


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


Inoue et al. 8

accomplished by multiple reactions monitoring (MRM) with the transitions m/z

403.3/367.4 for DHCA, 359.1/135.0 for lithocholic acid (LCA), 375.1/357.2 for

deoxycholic acid (DCA), chenodeoxycholic acid (CDCA), hyodeoxycholic acid

(HDCA), ursodeoxycholic acid (UDCA) and murideoxycholic acid (MDCA),

373.1/355.3 for cholic acid (CA), hyocholic acid (HCA), α- and ω-muricholic acid

(MCA), 391.1/355.2 for β-MCA, 466.4/412.3 for glycocholic acid (GCA), 450.4/414.4

for glycodeoxycholic acid (GDCA) and glycochenodeoxycholic acid (GCDCA),

516.3/462.4 for taurocholic acid (TCA) and tauro-β-muricholic acid (T-β-MCA), and

500.4/464.4 for taurodeoxycholic acid (TDCA) and taurochenodeoxycholic (TCDCA).

All raw data were processed using Analyst Software. Calibration curves were linear for free

DCA, CDCA, HDCA, UDCA and MDCA concentrations ranging from 0.05 to 10 µM, free

CA, HCA α-, β- and ω-MCA from 0.2 to 20 µM, GDCA and GCDCA from 0.1 to 10 µM,

TDCA and TCDCA from 1.0 to 200 µM, and GCA, TCA and T-β-MCA from 2.5 to 500

µM.

Determination of the transcription start sites of the mouse VLACSR and BAT

genes—5'-RACE was performed to determine the transcription start site of the mouse

VLACSR and BAT genes using GeneRacer kit (Invitrogen). PCR products were cloned

into pCR TOPO II and 20 individual clones were sequenced. Based on these results, the

major transcription start site was determined.

Construction of the mouse VLACSR and BAT-luciferase reporter plasmids—The mouse

VLACSR (-2219, -1435, -1014, -256, -220, -194, and -146/-47 bp from translation start


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


Inoue et al. 9

site) and BAT (-1972, -1567, -1447, -1322, -602, -505, -136, and -52/+178 bp from

transcription start site) promoters were amplified by PCR using sequence data derived

from the Celera database (Celera Genomics, Rockville, MD) and cloned into KpnI and

XhoI sites of the pGL3/basic vector (Promega, Madison, WI). Mutations were introduced

into the putative HNF4α binding site in the VLACSR-luciferase constructs by PCR-

based site-directed mutagenesis using the following primer pair; 5'-

acaaaCTGACAGAGTCCAtgggt-3' and 5'-acccaTGGACTCTGTCAGtttgt -3' (M2;

mutations in the HNF4α binding site are bold and underlined). Similarly, mutations were

introduced into an Sp1 binding site in the VLACSR-luciferase constructs by PCR-based

site-directed mutagenesis using the following primer pair; 5'-

tgtccaagTAAAGAAGTGag-3' and 5'-ctCACTTCTTTActtggaca-3' (mutations in the

GC box are bold and underlined). Similarly, mutations were introduced into an HNF4α

binding site in the BAT-luciferase constructs by PCR-based site-directed mutagenesis

using the following primer pair; 5'-agtccaCTTTCCAAGGTCTtagtct-3' and 5'-

agactaAGACCTTGGAAAGtggact-3' (mutations in the HNF4α binding site are bold and

underlined). Sequences were verified using a CEQ 2000XL DNA Analysis System

(Beckman Coulter).

Transient transfection assay—HepG2 and CV-1 cell lines were cultured at 37°C in

Dulbecco’s modified Eagle’s medium (Invitrogen) containing 10% fetal bovine serum

(HyClone, Logan, UT) and 100 units/ml penicillin/streptomycin (Invitrogen). Cells were

seeded in 24-well tissue culture plates, and grown to 90-95% confluency. For

transfections, 500 ng/well of pGL3 basic or the wild-type or mutated BAL and BAT


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


Inoue et al. 10

promoters and 200 ng/well of pRL/TK (Promega) were used with the total amount of

DNA adjusted to 900 ng by the addition of pUC19 as a carrier DNA. For co-

transfections, 200 ng/well of the rat HNF4α expression plasmid, pSG5/HNF4α was used.

All transfections were performed using Lipofectamine 2000 reagent (Invitrogen)

according to the manufacturer’s instructions. After 48 hr, the cells were washed with

phosphate-buffered saline and assayed for dual luciferase activity using commercial kits

(Promega).

Gel shift analysis—Crude nuclear extracts were prepared and gel shift analysis was

carried out as described previously (11). The following three double-stranded probes were

used; HNF4α binding site for the mouse VLACSR promoter (wild-type); 5'-

acaaaAGGACAGAGTCCAtgggt-3' and 5'-acccaTGGACTCTGTCCTtttgt-3', the mouse

VLACSR promoter (mutant); 5'-acaaaCTGACAGAGTCCAtgggt-3' and 5'-

acccaTGGACTCTGTCAGtttgt-3' (mutations in the HNF4α binding site are bold and

underlined), GC box for the mouse VLACSR promoter (wild-type); 5'-

tgtccaagGGGGCGGGGCag-3' and 5'-ctGCCCCGCCCCcttggacaC-3', HNF4α binding

site for the mouse VLACSR promoter (mutant); 5'-tgtccaagTAAAGAAGTGag-3' and 5'-

ctCACTTCTTTActtggaca-3' (mutations in the GC box are bold and underlined), the

mouse BAT promoter (wild-type); 5'-agtccaAGTTCCAAGGTCTtagtct-3' and 5'-

agactaAGACCTTGGAACTtggact-3', and the mouse BAT promoter (mutant); 5'-

agtccaCTTTCCAAGGTCTtagtct-3' and 5'-agactaAGACCTTGGAAAGtggact-3'

(mutations in the HNF4α binding site are bold and underlined). End-labelled double-

stranded oligonucleotide (2 × 105 cpm) was added, and the reaction mixture was


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


Inoue et al. 11

incubated at room temperature for 30 min. For competition experiments, a 25-fold excess

of unlabelled oligonucleotide was added to the reaction mixture, and the mixture was

incubated at room temperature for 20 min prior to the addition of a 32P-labelled

oligonucleotide probe. For supershift analysis, 1 µg of anti-HNF4α antibody (Santa

Cruze Biotechnology) was added to the reaction mixture, and the mixture was incubated

at room temperature for 30 min after the addition of a 32P-labelled oligonucleotide probe.

Statistical analysis—All values are expressed as the mean ± standard error (S.E., Fig. 3,

4, 6, and 7) or standard deviation (S.D., Table I and II). All data were analyzed by the

unpaired Student’s t test for significant differences between the mean values of each

group.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


Inoue et al. 12

RESULTS

Expression of genes involved in BA conjugation is reduced in liver-specific HNF4a-null

mice—Free BAs are at first esterified with acetyl-CoA by BAL, and the esterified BAs

are conjugated with glycine or taurine by BAT. The enzyme activity of BAL has not been

analyzed in mouse, but the mouse VLACSR gene might be a candidate for a mouse BAL

since VLACSR has high homology to both the rat BAL and human VLACSR-H2 that

have BAL activities. Human BAT is able to conjugate both of glycine and taurine (21),

but mouse BAT has conjugation specificity toward taurine and not glycine (19). Northern

blots were performed to determine whether the expression of VLACSR and BAT is

significantly different between liver-specific HNF4α-null (HNF4α-floxed/floxed,

albumin-Cre; H4LivKO) and control (HNF4α-floxed/floxed, without albumin-Cre;

H4Flox) mice. Expression of VLACSR and BAT was markedly reduced in the livers of

H4LivKO mice as compared to H4Flox mice (Fig. 1). It is also noteworthy that the

expression of alanine:glyoxylate aminotransferase (AGXT) and taurine transporter

(TAUT), two enzymes that determine the levels of cytosolic glycine and taurine, were

unchanged.

Free BAs and glycine-conjugated BAs are increased in gallbladder bile of liver-specific

HNF4 -null mice—Since the expression of VLACSR and BAT was decreased in

H4LivKO mice, it was expected that free BAs are increased and conjugation patterns are

altered in H4LivKO mice. Most BAs in the H4Flox mice are also found as conjugated

derivatives in gallbladder bile since only small amounts of free BAs were detected (Table

I). However, free BAs were significantly increased in the gallbladders of H4LivKO mice


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


Inoue et al. 13

(Table I), indicating that the BAs conjugation enzymatic machinery might be impaired by

decreased expression of VLACSR in the livers of H4LivKO mice.

The conjugation pattern of BA in gallbladder bile was further determined by LC-

MS/MS (Table II). In male H4Flox mice, taurocholic acid (TCA) and tauro-β-muricholic

acid (T-β-MCA) were the predominant BAs. The concentrations of these BAs (Table II,

upper) were decreased in H4LivKO mice, but the total amounts (Table II, lower) were

almost unchanged (TCA) or increased (T-β-MCA). Most mammals secrete BAs

conjugated with taurine and/or glycine, but mouse gallbladder bile contains only the

taurine-conjugated forms (18). However, small amounts of glycine-conjugated BAs

including glycocholic acid (GCA), glycodeoxycholic acid (GDCA), and

glycochenodeoxycholic acid (GCDCA) were detected in the H4Flox mice, and their

levels were much lower as compared to their taurine-conjugated derivatives. In contrast

to the results with control mice, taurodeoxycholic acid (TDCA), GDCA,

taurochenodeoxycholic acid (TCDCA), and glycochenodeoxycholic acid (GCDCA) were

increased in H4LivKO mice with GDCA and GCDCA being markedly elevated. These

results indicate that the conjugation pattern of BAs in H4LivKO mice is significantly

different from H4Flox mice due to decreased expression of BAT. Since glycine-

conjugated BAs are increased and taurine-conjugated BAs are maintained in H4LivKO

mice, an unidentified BAT that can use both glycine and taurine as substrates might play

an important role in H4LivKO mice.

Expression of the mouse VLACSR gene is directly regulated by HNF4 —To

investigate why expression of VLACSR was reduced in H4LivKO mice, the promoter


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


Inoue et al. 14

region of the mouse VLACSR gene was cloned (Fig. 2). A transcription start site was

determined by 5'-RACE and five major sites were identified between -143 and -85 from

translation start site (+1). A putative HNF4α binding site and a GC box were found

between -162 and -150, and -238 and -229, respectively (Fig. 2). To determine whether

HNF4α has the potential to activate the mouse VLACSR promoter, several VLACSR

promoter-luciferase reporter plasmids were constructed (Fig. 3A). When HepG2 cells,

which express HNF4α, were used for transient transfections, the promoter activity of the

-194 bp fragment containing a putative HNF4α binding site was higher than that of the

promoterless construct (pGL3/basic) and the -146 bp fragment (Fig. 3A). The promoter

activities of the -220 bp fragment was higher than -194 bp fragment, indicating that the

nucleotide sequence between -220 and -195 bp, which are GC-rich regions similar to the

GC box between -238 and -229 bp, might be important for promoter activity.

Furthermore, the promoter activities of the -256, -1014, -1435, and -2219 bp fragments,

which contain an HNF4α binding site and GC-rich sequences, were much higher than

that of -194 and -220 bp fragments. To determine whether HNF4α positively regulates

the promoter activity, CV-1 cells, which do not express HNF4α, were used. The

promoter activity of the -146 bp fragment was unchanged by co-transfection of the

HNF4α-expression vector, consistent with the absence of an HNF4α binding site (Fig.

3B). However, the promoter activity of the -194 bp fragment was increased by

cotransfection with an HNF4α expression vector. The same results were obtained using

the longer fragments, indicating that HNF4α positively regulates expression of the

VLACSR gene. Interestingly, the basal promoter activity of -220 bp fragment was

increased in the absence of HNF4α expression, and the activity of -256 bp fragment was


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


Inoue et al. 15

much higher. Since a GC-rich sequence was observed in the region between -256 and -

195 bp, the Sp1 family proteins might be important in activating maximal promoter

activity in the presence of HNF4α.

To determine whether HNF4α can bind to the HNF4α binding site in the mouse

VLACSR promoter, gel shift analysis was performed (Fig. 3C). Liver nuclear extracts

from H4Flox mice contained proteins that bound to the HNF4α binding site (Fig. 3C,

lane 1). Binding was diminished by the addition of excess amounts of unlabelled

VLACSR probe (wild-type), but not by the mutated probe, indicating that a protein

specifically bound to this site (Fig. 3C, lanes 2 and 3, the lower arrow). Furthermore,

these bands were supershifted by the addition of anti-HNF4α antibody, indicating that the

protein bound to this HNF4α binding site was indeed HNF4α (Fig. 3C, lane 4, the upper

arrow). However, supershifted bands were not detected using liver nuclear extracts from

H4LivKO mice (Fig. 3C, lane 9) and no specific complex, indicated by the lower arrow,

was detected using the labelled mutated probe (Fig. 3C, lanes 5 and 10). These results

indicate that the HNF4α binding site in the mouse VLACSR promoter is capable of

binding HNF4α.

To determine whether disruption of the HNF4α binding site and GC box decreases the

promoter activity, mutations were introduced into the HNF4α binding site and GC box in

the mouse VLACSR (-1014/-47)-luciferase construct (Fig. 4A). As shown in Fig. 4B,

when HepG2 cells were used for transient transfections, the promoter activity of the

HNF4α mutant (-1014/HNF4α Mut) was decreased as compared to the wild-type

construct (-1024/WT). The promoter activity of the GC box mutant (-1014/GC box Mut)

was further decreased and the double mutants for both the HNF4α binding site and GC


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


Inoue et al. 16

box (-1014/HNF4α/Gcbox Mut) had almost no promoter activity. When CV-1 cells were

used for transient transfections, the promoter activity of the HNF4α mutant

(-1014/HNF4α Mut) was decreased to 40% as compared to the wild-type fragment

(-1014/WT) in the presence of HNF4α (Fig. 4C). The basal activity of the GC box

mutant (-1014/GC box Mut) was decreased to the same level as the promoterless vector,

but the activity was still increased by HNF4α. Furthermore, introduction of mutations

into the binding sites of the both factors (-1014/HNF4α/Gcbox Mut) caused a marked

reduction of promoter activities even in the presence of HNF4α. These results indicate

that the HNF4α and a GC box-binding protein can activate expression of the VLACSR

gene, but both are needed for the maximal activation.

Expression of the mouse BAT gene is directly regulated by HNF4 —In order to

investigate why the expression of BAT was reduced in H4LivKO mice, the promoter

region of the mouse BAT gene was cloned (Fig. 5B). An HNF4α binding site was found

between -68 and -56 from the transcription start site (Fig. 5A and B). However, the

promoter activity of the 3078 bp fragment between the beginning of intron 1 and

translation start site was not induced in HepG2 and CV-1 cells by cotransfection with

HNF4α (data not shown). To determine whether HNF4α has the potential to activate the

mouse BAT promoter, several BAT promoter-luciferase reporter plasmids were

constructed (Fig. 6A). When HepG2 cells were used for transient transfections, the

promoter activity of the -136 bp fragment containing a putative HNF4α binding site was

higher than that of the promoterless construct (pGL3/basic) and the -52 bp fragment (Fig.

6A). The promoter activities of the longer fragments were much higher than that of the -


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


Inoue et al. 17

136 bp fragment. To determine whether this effect was due to HNF4α, CV-1 cells were

used. The promoter activity of the -52 bp fragment was unchanged by co-transfection of

the HNF4α-expression vector, consistent with the absence of an HNF4α binding site

(Fig. 6B). However, the promoter activity of the -136 bp fragment was increased by

HNF4α. The same results were obtained from experiments using the longer fragments.

To determine whether HNF4α can bind to the DR1-like elements in the mouse BAT

promoter, gel shift analysis was performed (Fig. 6C). Liver nuclear extracts from H4Flox

mice contained proteins that bound to the HNF4α binding site (Fig. 6C, lane 1). Binding

was diminished by the addition of excess amounts of unlabelled BAT probe (wild-type),

but not by the mutated probe, indicating that a protein specifically bound to this site (Fig.

6C, lanes 2 and 3, the lower arrow). Furthermore, these bands were supershifted by the

addition of anti-HNF4α antibody, indicating that the protein bound to this HNF4α

binding site was indeed HNF4α (Fig. 6C, lane 4, the upper arrow). Supershifted bands

were not detected using liver nuclear extracts from H4LivKO mice (Fig. 6C, lane 9) and

no specific complex, indicated by the lower arrow, was detected using the labelled

mutated probe (Fig. 6C, lanes 5 and 10). These results indicate that the HNF4α binding

site in the mouse BAT promoter is capable of binding HNF4α.

To determine whether disruption of the HNF4α binding site decreases the promoter

activity, the same mutations used in Fig. 6C were introduced into the HNF4α binding site

in the mouse BAT (-602/+178)-luciferase construct (Fig. 7A). As shown in Fig. 7B, when

HepG2 cells were used for transient transfections, the promoter activity of the mutated -

602 bp fragment (-602/Mut) was decreased to 25 % as compared to the wild-type

fragment (-602/WT). When CV-1 cells were used, the promoter activity of the mutated


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


Inoue et al. 18

fragment was decreased to 15% by co-transfection of HNF4α as compared to the wild-

type fragment (Fig. 7C), indicating that the HNF4α binding site is important for

activation of the mouse BAT promoter.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


Inoue et al. 19

DISCUSSION

Bile acids (BAs) are synthesized by steroid nucleus and side chain hydroxylation of

cholesterol followed by β-oxidation of the side chain. Since serum BA levels are

significantly increased and expression of OATP1 and NTCP was decreased in liver-

specific HNF4α-null mice (10), HNF4α is likely a critical transcription factor regulating

genes involved in BA biosynthesis. In this study, HNF4α was also found to control the

BA conjugation pathway by direct binding to the promoter regions of both the VLACSR

and BAT genes and activation of their transcription.

Since the levels of unconjugated (free) BAs are very low in gallbladder bile (22),

increased levels of unconjugated BAs in liver-specific HNF4α-null mice appear to be due

to decreased expression of VLACSR and BAT. Since VLACSR and BAT are

preferentially expressed in liver (18, 19) as well as HNF4α, HNF4α is a central factor in

the regulation of VLACSR and BAT in vivo. An HNF4α binding site and a GC-rich

region were identified in the promoter region of the mouse VLACSR gene. Indeed,

HNF4α binds to this HNF4α binding site and the promoter activities were dependent on

this site and expression of HNF4α. Furthermore, a GC-rich sequence was also important

for maximal activation of the VLACSR gene since the mutated GC-rich sequence

reduced its basal promoter activity. It was reported that HNF4α and Sp1, a prototypical

GC box-binding protein, binds to promoter regions of genes including apolipoprotein C-

III and CYP27, and increases their expression (23, 24). In the mouse VLACSR promoter,

HNF4α can still activate promoter activity when mutations were introduced into the GC

box, but the resultant activity was much lower when compared to that of the wild-type

promoter. This result indicates that cooperative binding of HNF4α and Sp1 to the


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


Inoue et al. 20

promoter might be required for maximal induction of VLACSR expression in the liver.

Furthermore, the expression of sterol carrier protein x (SCPx), that is involved in the side

chain β-oxidation of BA, was also reduced in liver-specific HNF4α-null mice and Sp1

was identified as a critical factor regulating the SCPx gene in an HNF4α-independent

manner (data not shown). Since expression of Sp1 and Sp3, typical GC box-binding

proteins, was unchanged and VLACSR expression is markedly reduced in liver-specific

HNF4α-null mice (data not shown), post-transcriptional modification of Sp1 and/or Sp3

could reduce the expression of VLACSR in these null mice.

In addition to increased unconjugated BAs in serum, glycine-conjugated BAs such as

GDCA and GCDCA were significantly increased in gallbladder of liver-specific HNF4α-

null mice. Since mouse BAT has no glycine-conjugation activity (19), expression of an

unidentified BAT gene might be activated in H4LivKO mice. Actually a few mouse

genes that exhibit similarity to mouse BAT were cloned, but their function is still

unknown. Expression of one of these genes (Genbank accession number NM_145368)

was found to be increased in the livers of H4LivKO mice (data not shown). However, it

remains unclear whether this gene encodes an enzyme with glycine-conjugation activity.

Furthermore, the physiological role of increased GDCA and GCDCA in H4LivKO mice

also remains unclear, but these BAs in the intestinal lumen might change many aspects of

intestinal and whole body cholesterol homeostasis.

Recently it was reported that a mutation of the BAT coding sequence causes human

familial hypercholanemia that is characterized by elevated serum BA, and serum of

homozygous individuals for this mutation contains only unconjugated BAs (25). Since

serum unconjugated BAs are increased, but most BAs in the gallbladder are conjugated


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


Inoue et al. 21

forms in liver-specific HNF4α-null mice, protein and enzyme activity of VLACSR and

BAT might still be active in these mice. In human disease, mutations in the HNF4α

binding sites were reported in HNF1α, blood coagulation factor VII, and IX (9). Since

HNF4α regulates many liver-enriched genes, human diseases might be found to be

caused by mutations of the HNF4α binding sites in the VLACSR and BAT genes.

It was reported that the expression of BAL and BAT is induced by treatment with

ligands for the farnesoid X receptor (FXR) in rat and this induction was due to the

binding of FXR to FXR binding sites in their promoter regions (26). Since this

phenomenon was not observed in mouse, regulation of both genes by FXR exhibits a

species difference between rat and mouse (26). Actually, neither VLACSR nor BAT gene

was induced in wild-type mice treated with cholic acid, a ligand for FXR (data not

shown). Unlike other nuclear receptors including FXR, HNF4α is constitutively activated

in vivo and in vitro without exogenous compounds (9). Thus, HNF4α positively regulates

the basal levels of expression of the VLACSR and BAT genes. It may also be involved in

the regulation of transporters such as OATP1 and NTCP that are required for hepatocyte

uptake of conjugated BAs from the portal circulation (Fig. 8).

Many nuclear receptors including FXR are involved in regulating the BA biosynthesis

pathway and transport system (6, 14, 15). Thus, these nuclear receptors also might have

important roles in inducing or repressing the expression of VLACSR and BAT to

regulate the BA conjugation pathway.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


Inoue et al. 22

REFERENCES

1. Vlahcevic, R. Z., Pandak, M. W., and Stravitz, T. R. (1999) Gastroenterol. Clin.

North Am. 28, 1-25

2. Björkhem, I., and Eggertsen, G. (2001) Curr. Opin. Lipidol. 12, 97-103

3. Wang, D. Q.-H., Lammert, F., Cohen, D. E., Paigen, B., and Carey, M. C. (1999)

Am. J. Physiol. 276, G751–G760

4. Bahar, J. R., and Stolz, A. (1999) Gastroenterol. Clin. North Am. 28, 27-57

5. St-Pierre, M. V., Kullak-Ublick, G. A., Hagenbuch, B., and Meier, P. J. (2001) J.

Exp. Biol. 204, 1673-1686

6. Trauner, M., and Boyer, J. L. (2003) Physiol. Rev. 83, 633-571

7. Meier, P. J., and Stieger, B. (2002) Annu. Rev. Physiol. 64, 635-661

8. Schrem, H., Klempnauer, J., and Borlak, J. (2002) Pharmacol. Rev. 54, 129-158

9. Sladek, F. M., and Seidel, S. D. (2001) in Nuclear receptors and genetic disease

(Burris, T. P., and McCabe, E., eds) pp. 309-361, Academic press, San Diego

10. Hayhurst, G. P., Lee, Y.-H., Lambert, G., Ward, J. M., and Gonzalez, F. J. (2001)

Mol. Cell. Biol. 21, 1393-1403

11. Inoue, Y., Hayhurst, G. P., Inoue, J., Mori, M., and Gonzalez, F. J. (2002) J. Biol.

Chem. 277, 25257-25265

12. Tirona, R. G., Lee, W., Leake, B. F., Lan, L. B., Cline, C. B., Lamba, V., Parviz, F.,

Duncan, S. A., Inoue, Y., Gonzalez, F. J., Schuetz, E. G., and Kim, R. B. (2003) Nat.

Med. 9, 220-224


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


Inoue et al. 23

13. Parviz, F., Matullo, C., Garrison, W. D., Savatski, L., Adamson, J. W., Ning, G.,

Kaestner, K. H., Rossi, J. M., Zaret, K. S., and Duncan, S. A. (2003) Nat. Genet. 34,

292-296

14. Russell, D. W. (2003) Annu. Rev. Biochem. 72, 137-174

15. Chiang, J. Y. (2002) Endocr. Rev. 23, 443-463

16. Falany, C. N., Xie, X., Wheeler, J. B., Wang, J., Smith, M., He, D., and Barnes, S.

(2002) J. Lipid Res. 43, 2062-2071

17. Steinberg, S. J, Mihalik, S. J., Kim, D. G., Cuebas, D. A., and Watkins, P. A. (2000)

J. Biol. Chem. 275, 15605-15608

18. Berger, J., Truppe, C., Neumann, H., and Forss-Petter, S. (1998) Biochem. Biophys.

Res. Commun. 247, 255-260

19. Falany, C. N., Fortinberry, H., Leiter, E., and Barnes, S. (1997) J. Lipid Res. 38,

1139-1148

20. Furutani, M., Arii, S., Higashitsuji, H., Mise, M., Fukumoto, M., Takano, S.,

Nakayama, H., Imamura, M., and Fujita, J. (1995) Biochem. J. 311, 203-208

21. Falany, C. N., Johnson, M. R., Barnes, S., and Diasio, R. B. (1994) J. Biol. Chem.

269, 19375-19379

22. Capocaccia, L., Attili, A. F., Cantafora, A., Bracci, F., Paciscopi, L., Puoti, C.,

Pieche, U., and Angelico, M. (1981) Dig. Dis. Sci. 26, 513-517

23. Kardassis, D., Falvey, E., Tsantili, P., Hadzopoulou-Cladaras, M., and Zannis, V.

(2002) Biochemistry 41, 1217-1228

24. Garuti, R., Croce, M. A., Piccinini, L., Tiozzo, R., Bertolini, S., and Calandra, S.

(2002) Gene 283, 133-143


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


Inoue et al. 24

25. Carlton, V. E. H., Harris, B. Z., Puffenberger, E. G., Batta, A. K., Knisely, A. S.,

Robinson, D. L., Strauss, K. A., Shneider, B. L., Lim, W. A., Salen, G., Morton, D.

H., and Bull, L. N. (2003) Nat. Genet. 34, 91-96

26. Pircher, P. C., Kitto, J. L., Petrowski, M. L., Tangirala, R. K., Bischoff, E. D.,

Schulman, I. G., and Westin, S. K. (2003) J. Biol. Chem. 278, 27703-27711


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


Inoue et al. 25

FIGURE LEGENDS

FIG. 1. Northern blot analysis of VLACSR and BAT. Total liver RNA was isolated,

and 10 µg subjected to electrophoresis on a 1% agarose gel, transferred to a nylon

membrane, and hybridized with the indicated 32P-labelled cDNA probes.

FIG. 2. Nucleotide sequence of the mouse VLACSR gene promoter. (A) Localization

of HNF4α binding site and GC box in the mouse VLACSR gene. (B) Numbering of

nucleotides is relative to the translation start site (nt +1, arrow). The star marks the

transcription start sites. The putative binding site for HNF4α at -162 and -150, and GC

box at -238 and -229 are designed by bold and underline, respectively.

FIG. 3. Promoter analysis of the mouse VLACSR gene. (A) Luciferase reporter

plasmids containing the mouse VLACSR promoter (-146, -194, -220, -256, -1014, -1435,

and -2219/-47 bp from translation start site) were transfected into HepG2 cells. The

normalized activity ± S.E. (n=4) of each construct is presented as arbitrary units. (B) CV-

1 cells were co-transfected with the HNF4α expression vector, as indicated. The

normalized activity ± S.E. (n=4) of each construct is presented as arbitrary units. (C)

Nuclear extracts (2 µg) from liver of H4LivFlox (left panel) and H4LivKO (right panel)

mice were incubated with the labelled HNF4α binding site oligonucleotide of the mouse

VLACSR promoter in the absence (lanes 1 and 6) or presence of a 25-fold excess of each

unlabelled oligonucleotide (lanes 2 and 7 for the wild-type of the HNF4α binding site of

the mouse VLACSR promoter, lanes 3 and 8 for the mutated site). Similarly, the labelled

mutated HNF4α binding site oligonucleotide of the mouse VLACSR promoter was


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


Inoue et al. 26

incubated with nuclear extracts from H4livFLOX (lane 5) and H4LivKO (lane 10) mice.

For the supershift assays, nuclear extracts were incubated with labelled probe in the

presence of the anti-HNF4α antibody (lanes 4 and 9). HNF4α-DNA complex and the

supershifted complex, caused by the HNF4α-specific antibody, are shown by the lower

and upper arrow, respectively.

FIG. 4. Effects of mutations of the HNF4 binding site and GC box in the mouse

VLACSR promoter. (A) Schematic representation of the wild-type (WT) and mutated

(Mut) HNF4α binding site and GC box of the mouse VLACSR promoter. Mutations in

the HNF4α binding site and GC box are represented in bold type. Plasmids were

transfected into HepG2 (B) and CV-1 (C) cells and the normalized activity ± S.E. (n=4)

of each construct is presented as relative activity.

FIG. 5. Nucleotide sequence of the mouse BAT gene promoter. (A) Localization of

HNF4α binding site in the mouse BAT gene. The star marks the translation start site in

exon 2. (B) Numbering of nucleotides is relative to the transcription start site (+1, arrow).

The putative binding site for HNF4α at -68 and -56 is designed by bold and underline.

FIG. 6. Promoter analysis of the mouse BAT gene. (A) Luciferase reporter plasmids

containing the mouse BAT promoter were transfected into HepG2 cells. The normalized

activity ± S.E. (n=4) of each construct is presented as arbitrary units. (B) CV-1 cells were

co-transfected with the HNF4α expression vector, as indicated. The normalized activity ±

S.E. (n=4) of each construct is presented as arbitrary units. (C) Nuclear extracts from


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


Inoue et al. 27

liver of H4Flox (left panel) and H4LivKO (right panel) mice were incubated with the

labelled HNF4α binding site oligonucleotide of the mouse BAT promoter in the absence

(lanes 1 and 6) or presence of each unlabelled oligonucleotide (lanes 2 and 7 for the wild-

type of the HNF4α binding site of the mouse BAT promoter, lanes 3 and 8 for the

mutated site). Similarly, the labelled mutated HNF4α binding site oligonucleotide of the

mouse BAT promoter was incubated with nuclear extracts from H4Flox (lane 5) and

H4LivKO (lane 10) mice. For the supershift assays, nuclear extracts were incubated with

labelled probe in the presence of the anti-HNF4α (lanes 4 and 9). HNF4α-DNA complex

and the supershifted complex, caused by the HNF4α-specific antibody, are shown by the

lower and upper arrow, respectively.

FIG. 7. Effects of mutations of the HNF4 binding site in the mouse BAT promoter.

(A) Schematic representation of the wild-type (WT) and mutated (Mut) HNF4α binding

site of the mouse BAT promoter. Mutations in the HNF4α binding site are represented in

bold type. Plasmids were transfected into HepG2 (B) and CV-1 (C) cells and the

normalized activity ± S.E. (n=4) of each construct is presented as relative activity.

FIG. 8. Schematic representation of regulatory targets of HNF4 in bile acid

transport and conjugation. Bile acids, conjugated by VLACSR and BAT, are exported

from hepatocytes by transporters such as BSEP located at the canulicular membrane.

Most bile acids are recycled and transported from the portal circulation back into

hepatocytes by transporters including NTCP and OATP1 located at the basolateral

membrane. Expression of OATP1, NTCP, VLACSR, and BAT is reduced in liver-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


Inoue et al. 28

specific HNF4α-null mice. Note that HNF4α directly regulates the expression of

VLACSR and BAT via HNF4α-binding sites in their promoters.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

KOFLOX

HNF4α

AGXT

BAT

TAUT

18S

VLACSR

Fig. 1

Regulation of bile acid conjugation by HNF4α

Inoue et al. 29


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

GTCTTGGACCTTAAACGTTACTTGACCTTTATTCAAAATGCAAGTTTTAC

TGAAAATGGCTTCACCAAATCTCAATCCACAGGGCTACCAGAAGAGCAGG

CTCATAGTGGAAAGCATAAGTATGTTTAAATCCAGATGATAAAGGTGTTC

TAAGTATTTACTGAGTTGTCAACTGTCTACCTGACAGGCAGCCTGTTTCC

ATTCAGAGCAAGGGCTCAGCTTCATAAGTCAGGCAAATAAAACCACAGGC

TGAGCTGGGCGAGGTGGCATATTTAATCCCAGCACTCGGGAGGCAGAGGC

AGGAGAATTTCTGAGTTCTAGGCCAGCCTGGTCTACAGAGTGAGTTCCAG

GACAGCCAGGGCTACACAGAGAAATCCTGTCTCAAAAAAAACAAAAACCA

AACCAAAACAAAAACCCCACAGGCTGTGTATCTTATCTGGCTTTTTCACG

TGGCTAGAGTCAGGCAGGTCTTATTCTCTCTCTCCCTCATATCCCATACC

TAACAGGAGATGGAGACAATGCTGGCCCTGGAGAAGAGGATGGCTGGTGG

TGTCCAAGGGGGCGGGGCAGGCCGGGTGATCCGGCTGGGGGCTGGAACTG

TAGAATTCCCAGCCAGTAAGAACTAAGTAACAAAAGGACAGAGTCCATGG

GTCACATTCAGTTGCTGATAGTACTTGGTCATATTTGGGAAGTGGGTAGA

CAGATTTCCTTAAAGGCAGGTAGTTAGGGCTTTGGAGCACTCATCAGAGC

TAAGAGAGATTACACGCTCTCATCTACTTCAGAAAGAGCCAATGCCATGG+1

HNF4α

GC box

-46

-96

-146

-196

-246

-296

-346

-396

-446

-496

-546

-596

-646

-696

-746

-796

***

*

*

Exon1

HNF4αGC box

mouse VLACSR gene

+1

B

A

Fig. 2


Inoue et al. 30


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Untreated

+ HNF4α

0 10 20 30 40 50 60

Arbitrary units

C

-1014/HNF4α/GC box Mut

-1014/GC box Mut

-1014/HNF4α Mut

-1014/WT

pGL3/basic

WT 5’-acaaaAGGACAGAGTCCAtgggt-3’Mut 5’-acaaaCTGACAGAGTCCAtgggt-3‘

WT 5’-tgtccaagGGGGCGGGGCag-3’Mut 5’-tgtccaagTAAAGAAGTGag-3’

HNF4α binding site

GC box

A

B

0 5 10 15 20 25

Arbitrary units

-1014/HNF4α/GC box Mut

-1014/GC box Mut

-1014/HNF4α Mut

-1014/WT

pGL3/basic

Fig. 4


Inoue et al. 32


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

CCTCATTTGAATTCTAACAGGGCCATATGCCTTCTTCACAAATATAAAAT

GGCTAAGACTATAGATTTCAGCTGTCTTAACTTTTGCCCTTCCAGCTGTG

ACGTGAAAAACCCAATCTGGATCATCTAGAAAGACCACAAGGAGGCTCCC

ATATCCTTGGTGTCCCCAGCTCTGTTCCAGTATTGAGAACAAACATGTGC

AGGAGTGAATCCCAGATGATTCTATTCCCTTGCCTTGGAGATTTCCATGT

GAAATAACACACACTGTGTCACAGAGACAGCCTCTTTTTTGTTGTTGTTT

TACTCTTGTTTTTCTGAGACAGTCTCCCTATGTAGCCCAGGCTGGCTTTA

ACTTCCCTCCTGCCTCAGTCTCCCTAGTTCTGGGTACACAGGAGCTCTCT

GCCACATTCCAGCAAAGGACGTGGTTTCAGAGGACTGTTGCTGTCAAAGA

CCAGAGTTTGTTAGGGCCTTTCCACACTAGAAGCCCGATGCTTTCATTTT

TAGATCTTTATCTCAGGCATTTATTCAAAGTCCAAGTTCCAAGGTCTTAG

TCTCTTCTCTGGGTTCAGCCTACTTATATCTGGTTGAGGAGGGAAATACT

AAGATATTTTCCTCAGCTCTGACCGAATAGTCTGCATTTTTAAAAACTCT

TCCATTATCTACAGTGTTGTCAGAGCCTTGGTTTGAGAGTCTCTGAGAAG

TCCTGGGCATCTGTGCTGACCGACAGGGCCTCCTTCTCTAGAGCACACCA

CGTTCCTGAGGGTTGCTGTAAAACTACTGT

-102

-152

-202

-252

-302

-352

-402

-452

-502

-552

-602

+49

+99

-52

-2

HNF4α

+149 +178

+1

Exon1 Exon2

+1

3078 bp

mouse BAT gene

A

B

HNF4α *

Fig. 5


Inoue et al. 33


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

WT 5’-agtccaAAGTCCAAGGGCAtagtct-3’Mut 5’-tcaggtCTGTCCAAGGGCAatcaga-3’

A

B

C

0 5 10 15 20

Arbitrary units

-602/Mut

-602/WT

pGL3/basic

untreated

5 100 2515 20

+ HNF4α

-602/WT

pGL3/basic

-602/Mut

Arbitrary units

Fig. 7


Inoue et al. 35


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Bile acid

BSEP

OATP1 NTCP

Bilecanaliculus

HNF4α

Hepatocyte

VLACSR

BAT

Conjugated bile acids

Conjugated bile acids

Fig. 8


Inoue et al. 36


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

3α, 7α-Dihydroxy-5β-cholanoic acid (chenodeoxycholic acid)

3α, 7α, 12α-Trihydroxy-5β-cholanoic acid (cholic acid)

3α, 6β, 7β-Trihydroxy-5β-cholanoic acid (β-muricholic acid)

3α, 12α-Dihydroxy-5β-cholanoic acid (deoxycholic acid)

3α, 7β-Dihydroxy-5β-cholanoic acid (ursodeoxycholic acid)

7.2 ± 1.5 169 ± 31* 193 ± 44 21200 ± 5200*

Bile acidHNF4α genotype

FLOX KO

11.9 ± 3.1 447 ± 54** 325 ± 93 55200 ± 11200*

0.04 ± 0.01 1.06 ± 0.16**1.02 ± 0.19 163 ± 33*

4.5 ± 0.9 477 ± 54* 118 ± 24.2 37200 ± 9300*

Amounts of α-and ω-MCA were combined. Data are mean ± S.D. (FLOX, [n=7-8], KO, [n=6-8]).

N.D.; not detectable. Significant differences compared to FLOX mice: *, p<0.005; **, p<0.001.

TABLE I

Analysis of free bile acids in gallbladder bile of liver-specific HNF4α-null and control mice

3α, 6β, 7α-Trihydroxy-5β-cholanoic acid (α-muricholic acid)

3α, 6α, 7β-Trihydroxy-5β-cholanoic acid (ω-muricholic acid)

N. D. 0.8 ± 0.3N. D. 90.5 ± 36.1

N.D. N.D.N.D. N.D.

Concentration (µM)Amount (nmol/100g body weight)


Inoue et al. 37


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Taurocholic acid (TCA) 68300 ± 3800 22200 ± 4800*** 1810 ± 210 2440 ± 510

Glycocholic acid (GCA) 237 ± 47 67 ± 6* 6.7 ± 2.0 8.9 ± 1.6

Taurodeoxycholic acid (TDCA) 1690 ± 190 5650 ± 650***

45.4 ± 8.0 655 ± 104*** Glycodeoxycholic acid (GDCA) 2.0 ± 0.5 15.0 ± 1.4***

0.056 ± 0.016 2.0 ± 0.34***

Taurochenodeoxycholic acid (TCDCA) 689 ± 64 3390 ± 370***18.5 ± 3.1 410 ± 52***

Glycochenodeoxycholic acid (GCDCA) 0.6 ± 0.1 4.1 ± 0.7**0.016 ± 0.004 0.48 ± 0.1**

Tauro-β-muricholic acid (T-β-MCA) 68300 ± 5700 27500 ± 4400*** 1830 ± 290 3620 ± 720*

Concentration (µM)Amount (nmol/100g body weight)

Bile acidHNF4α genotype

FLOX KO

TABLE II

Analysis of conjugated bile acids in gallbladder bile of liver-specific HNF4α-null and control mice

Data are mean ± S.D. (FLOX, [n=7-8], KO, [n=6-8]). Significant differences compared to FLOX mice:

*, p<0.05; **, p<0.01; ***, p< 0.001.


Inoue et al. 38


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Yusuke Inoue, Ai-Ming Yu, Junko Inoue and Frank J. Gonzalez is a central regulator of bile acid conjugationαHepatocyte nuclear factor 4

published online October 28, 2003J. Biol. Chem.

10.1074/jbc.M311015200Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M311015200

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;M311015200v1&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2003/10/28/jbc.M311015200.citation

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=early/2003/10/28/jbc&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2003/10/28/jbc.M311015200.citation

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/

Hepatocyte nuclear factor 4 is a central regulator of bile acid ...

Documents

Transcript of Hepatocyte nuclear factor 4 is a central regulator of bile acid ...