Ava i l ab l e on l i ne a t www.sc i enced i r ec t . com

www.e l sev i e r . com/ l oca te / sc r

Stem Cell Research (2012) 9, 196–207

REVIEW

Hepatocyte-like cells differentiated from humaninduced pluripotent stem cells: Relevance tocellular therapiesYue Yu a, b, Hongling Liu a, c, Yasuhiro Ikeda d, Bruce P. Amiot e,Piero Rinaldo f, Stephen A. Duncan g, Scott L. Nyberg a,⁎

a Division of Experimental Surgery, Mayo Clinic College of Medicine, Rochester, MN, USAb Liver Transplantation Center, The First Affiliated Hospital of Nanjing Medical University, Nanjing, Jiangsu Province, PR Chinac Liver Failure Diagnosis and Treatment Center, 302 Military Hospital, Beijing, PR Chinad Molecular Biology Program, Mayo Clinic College of Medicine, Rochester, MN, USAe Brami Biomedical Inc., Minneapolis, MN, USAf Department of Laboratory Medicine and Pathology, Mayo Clinic College of Medicine, Rochester, MN, USAg Department of Cell Biology, Neurobiology and Anatomy, Medical College of Wisconsin, Milwaukee, WI, USA

Received 22 May 2012; received in revised form 13 June 2012; accepted 18 June 2012Available online 28 June 2012

Abstract Maturation of induced pluripotent stem cells (hiPSCs) to hepatocyte-like cells (HLCs) has been proposed to addressthe shortage of human hepatocytes for therapeutic applications. The purpose of this study was to evaluate hiPSCs, HLCs andhepatocytes, all of human origin, in terms of performance metrics of relevance to cell therapies. hiPSCs were differentiated toHLCs in vitro using an established four-stage approach. We observed that hiPSCs had low oxygen consumption and possessedsmall, immature mitochondria located around the nucleus. With maturation to HLCs, mitochondria showed characteristicchanges inmorphology, ultrastructure, and gene expression. These changes inmitochondria included elongatedmorphology, swollencristae, dense matrices, cytoplasmic migration, increased expression of mitochondrial DNA transcription and replication-relatedgenes, and increased oxygen consumption. Following differentiation, HLCs expressed characteristic hepatocyte proteins includingalbumin and hepatocyte nuclear factor 4-alpha, and intrinsic functions including cytochrome P450 metabolism. But HLCs alsoexpressed high levels of alpha fetoprotein, suggesting a persistent immature phenotype or inability to turn off early stage genes.

Abbreviations: AFP, alpha fetoprotein; Alb, albumin; ATP5g1, mitochondrial F0 complex, subunit C1 (subunit 9), ATP synthase 5 subunit e;ATP8, ATP synthase 8; BAL, bioartificial liver; BMP4, bone morphogenetic protein 4; CYP, cytochrome P450; CYP2C19, CYP Family 2, SubfamilyC, polypeptide 19; CYP3A4, CYP Family 3, Subfamily A, polypeptide 4; ESC, embryonic stem cell; FGF2, fibroblast growth factor 2; GATA4,GATA-binding protein 4; HCF, human cardiac fibroblast; HGF, hepatocyte growth factor; hiPSC, human induced pluripotent stem cell; HLC,hepatocyte-like cell; HNF4α, hepatocyte nuclear factor 4-alpha; iPSC, induced pluripotent stem cell; MtDNA, mitochondrial DNA; ND1, NADHdehydrogenase subunit 1; ND5, NADH dehydrogenase subunit 5; OCT4, octamer-binding transcription factor 4; PAS, Periodic Acid-Schiff;QRT-PCR, Quantitative Reverse Transcription Polymerase Chain Reaction; QPCR, Quantitative Polymerase Chain Reaction; TEM, transmissionelectron microscopy.⁎ Corresponding author at: Mayo Clinic, 200 First Street SW, Rochester, MN 55905, USA. Fax: +1 507 266 2810.E-mail address: Nyberg.scott@mayo.edu (S.L. Nyberg).

1873-5061/$ - see front matter © 2012 Elsevier B.V. All rights reserved.doi:10.1016/j.scr.2012.06.004

197Human Hepatocyte-Like Cells for Cell Therapy

Furthermore, the levels of albumin production, urea production, cytochrome P450 activity, andmitochondrial function of HLCs weresignificantly lower than primary human hepatocytes.Conclusion- hiPSCs offer an unlimited source of human HLCs. However, reduced functionality of HLCs compared to primaryhuman hepatocytes limits their usefulness in clinical practice. Novel techniques are needed to complete differentiation ofhiPSCs to mature hepatocytes.

© 2012 Elsevier B.V. All rights reserved.

Contents

Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 197Experimental procedures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 198

Feeder-free iPSCs culture conditions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 198In vitro differentiation of hiPSCs to HLCs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 198Primary hepatocytes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 198Immunofluorescence . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 198Periodic acid-schiff (PAS) staining . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 198Quantitative reverse transcription polymerase chain reaction (QRT-PCR) . . . . . . . . . . . . . . . . . . . . . . . 198Analysis of mitochondria . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 198

Mitochondrial staining . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 198Count of mitochondria number . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 199Mitochondrial DNA copy number by quantitative polymerase chain reaction (QPCR) . . . . . . . . . . . . . 200

Quantification of albumin, AFP, ammonia, ureagenesis, diazepam metabolism . . . . . . . . . . . . . . . . . . . . 200Oxygen consumption . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 200Statistical analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 200

Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 200Generation HLCs from hiPSCs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 200Human HLCs vs. primary human hepatocytes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 202

Higher AFP and lower albumin by HLCs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 202Incomplete urea cycle activity by HLCs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 203Lower CYP activity by HLCs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 203Immature mitochondria and lower oxygen consumption by HLCs . . . . . . . . . . . . . . . . . . . . . . . . 203

Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 203Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 205Acknowledgements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 206References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 206

Introduction

Liver transplantation is a successful treatment for patientswith end-stage liver disease. However, transplantable donorlivers are in short supply. Hepatocyte transplantation andbioartificial liver (BAL) devices have been proposed as thera-peutic alternatives to the shortage of transplantable livers. BALis an extracorporeal supportive therapy developed to bridgepatients with liver failure to liver transplantation or to recoveryof the native liver. Hepatocyte transplantation is best suited forpatients with metabolic liver disease for which smaller numberof cells (b10% of liver mass) may be curative. Both BAL andhepatocyte transplantation are cellular therapies that avoid useof a whole liver.

Though once controversial, it is now well accepted thathepatocytes can be derived from progenitor cells which includepluripotent stem cells, either embryonic or native to the liver orin blood (Basma et al., 2009; Wang et al., 2011). Furthermore,techniques now exist for production of human inducedpluripotent stem cells (hiPSCs) from somatic cells (Yu et al.,2007). Therefore, in theory, hiPSCs could provide an unlimited

source of human hepatocytes for BAL therapy and celltransplantation. Preliminary reports indicate that humanhepatocyte-like cells (HLCs) can be derived from hiPSCs underin vitro conditions (Si-Tayeb et al., 2010). These findings areexciting since they suggest the possibility of producing HLCsfrom the patient's own cells and cell transplantation withoutimmunosuppression.

The HLCs derived from hiPSCs express characteristichepatocyte proteins including alpha-1-antitrypsin, albumin(Alb), and hepatocyte nuclear factor 4-alpha (HNF4α). Theyalso display intrinsic hepatocyte functions including cyto-chrome P450 (CYP) metabolism. The efficiency of inducedpluripotent stem cells (iPSCs) directed-differentiation intoHLCs is variable. Some protocols describe over 80% differ-entiation efficiency, but none yet achieve complete differ-entiation of hiPSCs into hepatocytes. Transplantation ofundifferentiated iPSCs in immunodeficient recipients resultsin the formation of teratomas. However, the risks and benefitsof transplantation of iPSCs into immunocompetent recipientsare poorly studied. Reports of BAL therapy using HLCs derivedfrom hiPSCs do not yet exist.

198 Y. Yu et al.

The present study was designed to assess the differentia-tion status and functionality of three human cell types (hiPSCs,HLCs and primary hepatocytes) under in vitro conditions withregards to their usefulness in human cell therapy. Function-ality and differentiation of these three cell types were judgedby liver-specific biochemical activities including the ureacycle, mitochondrial maturation including ultrastructure, andliver-related gene expression.

Experimental procedures

Feeder-free iPSCs culture conditions

Human iPSCs were generated from human cardiac fibroblasts(HCFs) as previously described (Thatava et al., 2011). Briefly,1×105 HCFs (ScienCell Research Laboratories, Carlsbad, CA,USA; no. 6300) were seeded 1 day before infection in eachwell of six-well plates with Dulbecco's modified Eagle'smedium (DMEM) containing 10% FBS, penicillin (100 U/mL)and streptomycin (100 mg/mL) (complete DMEM), and trans-duced with pluripotency factor-expressing lentiviral vectors(octamer-binding transcription factor 4 (OCT4), SOX2, KLF4,c-MYC). Putative hiPSCs colonies were observed 1 to 2 weeksafter vector transduction. Clones of hiPSCs were picked basedon morphology and size. A suitable clone (HCF#1 hiPSCs) wasselected. This clone was maintained on tissue culture platescoated with Matrigel (BD Biosciences, San Jose, CA, USA;no. 354277) in feeder-free medium (HEScGRO [Millipore, noSCM020] supplemented with 20% mTeSR1 complete medium[STEMCELL Technologies Inc., Vancouver, BC, Canada; no.05850]) under a mix of 5% CO2/ambient air.

In vitro differentiation of hiPSCs to HLCs

HLCs were produced by differentiation of HCF#1 hiPSCs invitro using an established 4-stage approach (Si-Tayeb et al.,2010) with minor modifications: Stage 1 (S1)—endoderminduction, Stage 2 (S2)—hepatic specification, Stage 3 (S3)—hepatoblast expansion and Stage 4 (S4)—hepatic maturation.Briefly, endoderm differentiation was initiated by removingfeeder-free medium and exposing 70% confluent cultures ofHCF#1 hiPSCs to RPMI1640 media containing B27 SupplementsMinus Insulin (Invitrogen, 0050129-SA), 100 ng/mL Activin A(R&D Systems, 338-AC-050/CF), 10 ng/ml bone morphogeneticprotein 4 (BMP4) (Peprotech) and 20 ng/ml fibroblast growthfactor 2 (FGF2) (Invitrogen, PHG0024). After 8 days of culturein 5% CO2 with ambient oxygen, culture dishes containinginduced definitive endoderm were moved to 5%CO2/4%O2 inRPMI/B27 Supplements (Invitrogen, 0080085-SA) mediumsupplemented with 20 ng/mL BMP4 and 10 ng/mL FGF2 for5 days. We then cultured the specified hepatic cells in RPMI/B27 supplemented with 20 ng/mL hepatocyte growth factor(HGF, Peprotech), under 5% CO2/4%O2 for 5 days. For the finalstage of differentiation, cultures were transferred to 5%CO2/ambient O2, and the media were replaced with HCM™hepatocyte culture medium (Lonza, Walkersville, MD USA,CC-3198 but omitting the EGF) supplemented with 20 ng/mLOncostatin M (R&D Systems, 295-OM-010/CF) for an additional5 days. In summary, cell-types were selected as follows:hiPSCs (day 0), S1—endoderm (day 8), S2—specified hepatic(day 13), S3—hepatoblast (day 18), and S4—HLCs (day 23).

Primary hepatocytes

The human hepatocytes were purchased from Yecuris Corpo-ration. These primary human hepatocytes were produced byrobust in vivo expansion in genetically engineeredmice (Azumaet al., 2010). Human hepatocytes were cultured in collagen IVcoated plates with William's E medium.

Immunofluorescence

For immunocytochemistry, cultured cells were fixed with 4%paraformaldehyde for 30 min at room temperature, washedwith phosphate-buffered saline (PBS) three times for 5 mineach, and permeabilized with 0.5% Triton X-100 (Sigma) inPBS for 15 min, and blocked with 3% BSA in PBS for 15 min.Cells were incubated overnight at 4 °C with primary anti-bodies diluted in 1% BSA in PBS. Primary antibodies includedOCT4 (Santa Cruz Biotechnology Inc., CA, #sc-9081), GATA4(Santa Cruz, #sc-1237), HNF4α (Santa Cruz, #sc-6556), alphafetoprotein (AFP) (Sigma-Aldrich, #A8452), and albumin(Bethy Laboratories Inc. A80-129A). Antigens were visual-ized using secondary antibodies conjugated with eitherAlexa 488 or Alexa 568 (Invitrogen, #A11057, A11055, A21202,A21206).

Periodic acid-schiff (PAS) staining

PAS staining was performed on the last day of S4, using acommercial staining kit (Sigma-Aldrich, #395) according tothe manufacturer's instructions.

Quantitative reverse transcription polymerasechain reaction (QRT-PCR)

Total RNA was extracted from cultured cells at each timepoint using an RNeasy Plus MiniKit (Qiagen, Valencia, CA)according to the manufacturer's instructions. All PCR wereperformed in 96-well optical reaction plates (AppliedBioSystems, Foster City, CA) in 20 μL reaction volume usingSYBR Green PCR Master Mix (Applied Biosystems, No.4389986). Reactions were carried out on the ABI PRISM®7900HT Sequence Detection System (SDS) (Applied Biosys-tems) and data were analyzed with the SDS Version 2.4software. Triplicate amplifications were carried out for eachtarget gene. Quantification was performed using the com-parative Ct method normalized with the housekeeping geneglyceraldehyde 3-phosphate dehydrogenase (GAPDH). Ex-pression of each target gene at each stage of differentiationwas normalized to its level in hiPSCs (day 0). For expression ofgenes that could not be detected in hiPSCs, we used expressionlevels on day 8 for normalization. Primer sequences are listed inTable 1.

Analysis of mitochondria

Mitochondrial stainingCells for mitochondria labeling were washed twice with PBS

and incubated at 37 °C for 20 min in 50 nM mitochondrion-selective dye MitoTracker Red CMXRos (Molecular Probes Inc.,#M7512). Nuclei were stained with DAPI. Staining solution was

Table 1 Primer sequences for RT-PCR.

Genes Abbr. 5′→3′ Product size(bp)

Alpha fetoprotein AFP Forward: AGCTTGGTGGTGGATGAAAC 248Reverse: CCCTCTTCAGCAAAGCAGAC

Albumin Alb Forward: GCACAGAATCCTTGGTGAACAG 101Reverse: ATGGAAGGTGAATGTTTCAGCA

Arginase 1 Arg1 Forward: GCAGAAGTCAAGAAGAACGG 153Reverse: GGTTGTCAGTGGAGTGTTG

Arginosuccinate lyase Asl Forward : GAGGTGCGGAAGCGGATCAATGT 233Reverse: TTGGTGCAGTAGAGGATGAGGTCC

Arginosuccinate synthetase Ass Forward: TCGTGCATCCTCGTGTGGCTGAA 157Reverse: CCACAAACTCCCTGCTGACATCC

ATP synthase 5 subunit e Atp5g1 Forward: TTCCAGACCAGTGTTGTCTCC 146Reverse: GACGGGTTCCTGGCATAGC

ATP synthase 8 ATP8 Forward: AACAAGTGCTCCATCAATGGC 146Reverse: AGGCTGGGGTCCCAAAATAAG

Carbamoyl-phosphate synthetase 1 Cps1 Forward: GGCCATCCATCCTCTGTTGC 171Reverse: GCTAAGTCCCAGTTCATCCA

C-X-C chemokine receptor type 4 Cxcr4 Forward: CCTATGCAAGGCAGTCCATGT 86Reverse: GGTAGCGGTCCAGACTGATGA

Cytochrome P450, family 2, subfamily C, polypeptide19

Cyp2C19 Forward: TCCAGATATGCAATAATTTTCCCAC 164Reverse: GAAGCAATCAATAAAGTCCCGA

Cytochrome P450, family 3, subfamily A, polypeptide 4 Cyp3A4 Forward: CAGGAGGAAATTGATGCAGTTTT 78Reverse:GTCAAGATACTCCATCTGTAGCACAGT

Forkhead box A2 FoxA2 Forward: ATTGCTGGTCGTTTGTTGTG 169Reverse: TACGTGTTCATGCCGTTCAT

Glyceraldehyde 3-phosphate dehydrogenase GAPDH Forward: CAGAACATCATCCCTGCCTCTAC 251Reverse: TTGAAGTCAGAGGAGACCACCTG

GATA binding protein 4 Gata4 Forward: CTAGACCGTGGGTTTTGCAT 275Reverse: TGGGTTAAGTGCCCCTGTAG

Hepatocyte nuclear factor 4α HNF4α Forward: TGTCCCGACAGATCACCTC 121Reverse: CACTCAACGAGAACCAGCAG

N-acetylglutamate synthase Nags Forward: CAGCAGGGCGTATCCAGTC 180Reverse: GTTGTGTCGAAGCGCGTCTA

NADH dehydrogenase subunit 1 ND1 Forward: TTCTAATCGCAATGGCATTCCT 109Reverse: AAGGGTTGTAGTAGCCCGTAG

NADH dehydrogenase subunit 5 ND5 Forward: TTCATCCCTGTAGCATTGTTCG 154Reverse: GTTGGAATAGGTTGTTAGCGGTA

Octamer-binding transcription factor 4 Oct4 Forward: AGCGAACCAGTATCGAGAAC 142Reverse: TTACAGAACCACACTCGGAC

Ornithine carbamoyltransferase Otc Forward: AATCTGAGGATCCTGTTAAACAATG 106Reverse: CCTTCAGCTGCACTTTATTTTGTAG

Mitochondrial-specific DNA polymerase gamma Polg Forward: GCTGCACGAGCAAATCTTCG 163Reverse: GTCCAGGTTGTCCCCGTAGA

Mitochondrial-specific DNA polymerase gamma 2 Polg2 Forward: GCTTAGCCGGGATTCTCTTCT 98Reverse: CCGAGGTCCACCATTCTGC

Sex determining region Y box 17 Sox17 Forward: GTGGACCGCACGGAATTTG 94Reverse: GGAGATTCACACCGGAGTCA

Mitochondrial transcription factor A Tfam Forward: ACCGAGGTGGTTTTCATCTG 218Reverse: TATATACCTGCCACTCCGCC

Mitochondrial uncoupling protein 2 Ucp2 Forward: ATGTTGCTCGTAATGCCATTGT 104Reverse: GCAAGGGAGGTCATCTGTCA

199Human Hepatocyte-Like Cells for Cell Therapy

then replaced with fresh pre-warmed media, and cells werevisualized using a confocal microscope LSM 510 (Zeiss,Germany, Axiovert 100M).

Count of mitochondria numberTransmission electron microscopy (TEM) was used to

investigate the morphological features of the mitochondrial

200 Y. Yu et al.

network within differentiated and undifferentiated cells. Cellswere fixed in Trumps solution, sectioned, and imaged by TEM inthe Microscopy Core Facility (Mayo Clinic, Rochester, MN).Mitochondria numbers were quantified by manually countingthe number of mitochondria per cell. A minimum of 12 cellswere examined in 4–6 representative TEM images (80,000-foldmagnification).

Mitochondrial DNA copy number by quantitative polymer-ase chain reaction (QPCR)

Copy number of mitochondrial DNA (mtDNA) was esti-mated by QPCR analysis using the mitochondrial gene NADHdehydrogenase subunit 1 (ND1) and ND5. Total cellular DNAwas collected and amplified. ND1 and ND5 levels were nor-malized to half the level of GAPDH since each cell contains twocopies of genomic DNA compared to a single copy of DNA perchromosome. Each sample was run in triplicate, and QPCRanalysis was performed as described above. Primer sequencesare reported in Table 1.

Quantification of albumin, AFP, ammonia,ureagenesis, diazepam metabolism

On days 0, 8, 13, 18, and 23 of differentiation culture and day 1of human hepatocyte culture, old medium was exchanged withfresh William's E medium supplemented with 10% fetal bovineserum (FBS; Mediatech, Inc., Herndon, VA), 20 μM diazepamand 5% v/v heavy deuterium-enriched ammonia gas (15ND3)(2.23 mM; Cambridge Isotope Laboratories, Inc, Andover, MA).Cells were incubated for an additional 24 h. Supernatantmedium was collected and stored at −20 °C prior to analysis.The concentration of human albumin in the sampled mediumwas determined by enzyme-linked immunosorbent assay(ELISA) kit (Bethyl, Montgomery, TX, #E80-129). The concen-tration of human AFP was determined in the AutomatedImmunoAssay Laboratory of the Mayo Division of ClinicalBiochemistry and Immunology. The concentration of totalurea was performed using a QuantiChromTM DIUR-500 UreaAssay Kit (BioAssay System, Hayward, CA) according to themanufacturer’s instructions. Production of urea through thecomplete urea cycle was determined by the conversion ofheavy ammonia (15ND3) to native and deuterium-enriched urea.Isotopes of urea were quantified by capillary gas chromatogra-phy/mass spectrometry as previously reported (Rinaldo, 2008).Concentrations of diazepam and its three major metabolites(nordiazepam, temazepam, oxazepam) were determined byhigh performance liquid chromatography (HPLC) with massspectrometry detection in the CTSA Metabolomics Core lab atMayo Clinic (Baskin-Bey et al., 2005; Mandrioli et al., 2008).Samples were deconjugated in β-glucuronidase/arylsulfatase(600 Fishman units and 4800 Roy units/mL, respectively;Roche, Indianapolis, IN) and sodium acetate buffer (0.1 M) for2 h. Reactions were quenched with ethanol. Data acquisitionwas completed by Chrom Perfect® software (Denville, NJ). Allassays were performed in triplicate.

Oxygen consumption

Rates of oxygen consumption were determined by syringetechnique as previously reported (Lillegard et al., 2011).Briefly, cells were resuspended in 3 mL of culture medium

and oxygen tensions of the medium were determined at 2 minintervals over 6 min by a GEM Premier 3000 gas analyzer.The rate of oxygen consumption was determined using theequation:

Oxygen consumption molO2=minð Þ¼ pO2: initial mmHg– pO2: final mmHgð Þ

� 1:29� 109molO2=mL=mmHg� �

� volumemlð Þ= timeminð Þ

Statistical analysis

Data are expressed as mean±standard deviation of indepen-dent samples. Comparisons between two groups were per-formed by unpaired Student's t-test. p-Values≤0.01 wereconsidered significant. Data were analyzed by SPSS 16 andExcel 2003, Microsoft, Redmond, WA.

Results

Generation HLCs from hiPSCs

The morphology of hiPSCs changed significantly from day0 to day 23 during four stages of differentiation. The lightmicroscopic appearance of representative cultures of hiPSCs(day 0), endoderm (day 8), hepatic specific (day 13),hepatoblast (day 18), HLCs (day 23), and primary humanhepatocytes are shown in Fig. 1A. hiPSCs gradually trans-formed into less dense, flatter cells with prominent nucleiand spiky shape (day 8) before eventually forming anepithelial monolayer on day 23. Other features of HLCsincluded a large cytoplasmic-to-nuclear ratio, numerousand prominent nucleoli, and occasional binucleated cells.These features were also characteristic of primary hepato-cytes (Fig. 1A).

To confirm the differentiation status of cells during thefour stages ofmaturation we examined the relative expressionof 22 genes using QRT-PCR analyses. These genes included thepluripotency marker (OCT4) and four endoderm markers(FOXA2, GATA4, CXCR4, SOX17) shown in Fig. 1B. Expressionof three liver-related genes (HNF4α, AFP, Alb) are shown inFig. 2A. Expression of the six urea cycle genes (Nags, Cps1,Otc, Ass, Asl, Arg1) were included in Fig. 4A because of theirimportance to ammonia detoxification and their therapeuticrole in cell therapy of liver failure. Expression of CYP3A4 andCYP2C19, whose protein products are important phase 1enzymes, are shown in Fig. 5A. Expression of Atp5g1, Atp8,Ucp2, Tfam, Polg, Polg2 (Fig. 6A) were used to assess mito-chondrial differentiation.

As expected, loss of the pluripotency marker OCT4 wasobserved during the 4 stages of differentiation as shown inFig. 1B. Expression of the four endoderm genes shown inFig. 1B was significantly higher on day 8 and at all later timepoints compared to hiPSCs (day 0).

To further assess the differentiation of hiPSCs, weperformed immunofluorescence staining (Fig. 1C). All ofthe undifferentiated hiPSCs expressed the pluripotencymarker OCT4 on day 0. By day 8, end of the S1, a sharpdecline in OCT4 staining and a rapid rise in the number ofcells staining positive for the definitive endoderm marker

Figure 1 Generation of HLCs from hiPSCs. A. Cell morphologyby light phasemicroscopy. The cells gradually transformed into lessdense, flatter layers with prominent nuclei (S1), a spiky shape, andthen formed an epithelial monolayer (S4). HLCs with largecytoplasmic-to-nuclear ratio, numerous, and prominent nucleoliwere observed on day 23, which were of similar morphology andcharacter to primary hepatocytes. B. Relative expression of earlystage genes of differentiation. The early stage of hiPSCs differen-tiation was characterized by the loss of pluripotency marker OCT4.All of the other genes were expressed significantly higher at day 23(HLCs) than at day 0 (hiPSCs). The special markers for differentstages of differentiation (GATA4 for S1, HNF4α for S2, AFP for S3and Alb for S4) confirmed the successful differentiation ofhiPSCs to HLCs. C. Immunofluorescence staining of human cellsduring 4 stages (23 days) of differentiation. Human hepato-cytes are included for comparison (far right column).

Figure 2 Characteristics of the HLCs. A. Relative expressionof three hepatocyte-related genes using QRT-PCR analyses. Day23 HLCs expressed higher levels of AFP RNA and lower levels ofAlb mRNA than the primary hepatocytes. B. Accumulation ofalbumin and AFP in the culture supernatant were consistentwith expression of these genes in iPS cells (day 0), HLCs (day 23)and hepatocytes. No human albumin was detected in mediumof day 0 cultures, which confirmed specificity of our humanalbumin ELISA. Data are represented as mean±standard devia-tion. C. Immunofluorescence staining for AFP and Alb. On day 23most HLCs stained positively for AFP and Alb, while humanhepatocytes only stained positively for Alb.

201Human Hepatocyte-Like Cells for Cell Therapy

GATA4 was observed. This pattern of staining suggestedefficient differentiation of iPSCs to endoderm. By day 13,end of S2, HNF4α stained cells were observed. HNF4α isbelieved to be essential for specification of hepatic pro-genitors from human pluripotent stem cells (DeLaForest etal., 2011). By day 18, end of S3, the addition of hepatocytegrowth factor (HGF) to the culture conditions resulted inhigh levels of expression of AFP, and indicated that thespecified cells had committed to a hepatoblast fate. By day23, end of S4, remaining cells stained brightly for albuminthat could be quantified in the media by ELISA (Fig. 2B). Onaverage, 80% of the day 23 cells were Alb-positive (Fig. 2C).

On day 23, after completion of the differentiation protocol,the cells were found to display several known hepaticfunctions. PAS staining (Fig. 3) indicated glycogen synthesisby the differentiated cells. Analyses of the culture mediarevealed the ability of day 23 cells to secrete albumin (Fig. 2B),produce urea (Fig. 4B), and metabolize diazepam (CYP3A4 andCYP2C19 enzyme activities) (Fig. 5B).

We also examined the mitochondria to assess differentia-tion of hiPSCs to HLCs (Fig. 6). Cell ultrastructure by TEMdemonstrated that undifferentiated hiPSCs on day 0 possessed

Figure 3 PAS staining for glycogen synthesis. Left—hiPSCs stained very weakly positive for PAS on day 0. Middle—HLCs stainedpositively for PAS on day 23. A focus of less differentiated cells that do not stain for PAS is shown in the upper center of the image.Primary hepatocytes uniformly stain positive for PAS.

Figure 4 Expression of urea cycle genes and ureagenesis. A.The QRT-PCR assay of urea cycle genes. HLCs expressed lowermRNA level of urea cycle genes than the primary hepatocytes.B. Hepatoblasts (day 18) and HLCs (day 23) showed the ability toproduce urea. However, the concentration of urea in thesecultures was significantly lower than cultures of primary hepato-cytes (pb0.01). Furthermore, the formation of heavy urea fromheavy ammonia was only demonstrated by primary hepatocytes,indicating that only primary hepatocytes were capable of normalureagenesis. Data are represented as mean±standard deviation.

202 Y. Yu et al.

the fewest number and smallest size of mitochondria(Fig. 6C). On day 0, mitochondria were round-shaped, hadpoorly developed crista, and were located near the nucleus.As hiPSCs lost pluripotency and committed to a hepaticdifferentiation fate, the expression of mtDNA transcriptionand replication factors was upregulated (Fig. 6A). Thenumber of mitochondria/cell (Fig. 6D) and mtDNA copies/cell (Fig. 6B) also increased as cells lost pluripotency. Withdifferentiation, both cells and their mitochondria increased insize. The ultrastructural features ofmitochondria also becamemore mature (Fig. 6C). Maturing mitochondria acquired anelongated morphology with swollen cristae and dense matri-ces as they migrated into wider cytoplasmic areas. Concom-itantly, the rate of oxygen consumption by differentiated cellsincreased (Fig. 6E) as aerobic metabolism became active andmore efficient. Collectively, these observations were consis-tent with successful production of HLCs from hiPSCs.

Human HLCs vs. primary human hepatocytes

Higher AFP and lower albumin by HLCsTo test whether HLCs can provide functionality to ex vivo

cell therapies, such as a BAL, we compared the extent ofdifferentiation of HLCs to primary human hepatocytes. Wefirst compared the relative gene expression of Alb and AFP inHLCs and human hepatocytes using QRT-PCR. The resultsreveal that HLCs expressed a high level of albumin mRNA, butthis level was still lower than the level in primary hepatocytes(Fig. 2A). Consistentwith this difference in gene transcription,we observed significantly higher concentrations of albumin inthe supernatant of cultures of primary hepatocytes comparedto HLCs (Fig. 2B). In contrast, primary hepatocytes expressedlow levels of AFP mRNA compared to HLCs (Fig. 2A). No AFPwas detected in supernatant of primary hepatocytes (Fig. 2B)and primary human hepatocytes did not stain for AFP byimmunocytochemistry (Fig. 2C). Cultures of HLCs expressedhigh levels of AFP mRNA (Fig. 2A) and secreted high levels ofAFP into the medium (Fig. 2B). Interestingly, most HLCsstained positively for AFP by immunocytochemistry (Fig. 2C).An inverse relationship was observed between the expres-sion pattern of AFP and Alb in HLCs. These findings suggest

Figure 5 CYP3A4 activity and diazepam metabolism. A.Expression of CYP3A4 and CYP2C19 increased significantly duringthe 4 stages of differentiation and was greatest in primary humanhepatocytes. ND—expression of CYP3A4 was not detectable inhiPSCs. B. Clearance of diazepam and formation of its threemajormetabolites (nordiazepam, temazepam, oxazepam) was highestin cultures of primary hepatocytes (pb0.01), indicating greaterphase 1 metabolism by primary hepatocyte than HLCs (day 23) oriPSCs (day 0). Data are represented as mean±standard deviation.

203Human Hepatocyte-Like Cells for Cell Therapy

differences between HLCs and primary hepatocytes, con-sistent with a less mature phenotype of HLCs than primaryhepatocytes.

Incomplete urea cycle activity by HLCsCompared to primary hepatocytes, day 23 HLCs expressed

lower levels of mRNA of the urea cycle genes (Fig. 4A). TheHLCs showed an ability to produce urea (Fig. 4B). However,this level of production was significantly lower than primaryhepatocytes. More importantly, neither hiPSCs nor HLCswere able to produce heavy urea when heavy ammonia(15ND3) was supplemented to their culture (Fig. 4B). Incontrast, over 40% of urea contained heavy isotopes afterthe culture medium of primary hepatocytes was supple-mented with heavy ammonia (Fig. 4B). These data indicatedurea cycle activity is complete in primary hepatocytes, butincomplete in less mature cells such as HLCs and iPSCs. Theurea formed in cultures of HLCs and iPSCs likely representedthe activity of its final step (i.e., arginase), rather than activityof the complete urea cycle.

Lower CYP activity by HLCsThe CYP enzymes are critical enzymes of phase 1 metabo-

lism. In particular, CYP3A4 is normally abundant in human liver.Of little surprise, expression of CYP3A4 genewas not detectablein hiPSCs, and rose steadily during the four stages ofdifferentiation (Fig. 5A). However, CYP3A4 expression did notreach the level of primary hepatocytes. Functionality of the CYPenzymes was assessed by the elimination of the classicalsubstrate, diazepam, and appearance of its major metabolites(temazepam, nordiazepam, and oxazepam). Temazepam is amarker of 3-hydroxylation by CYP3A4; nordiazepam is a markerof N-dealkylation by CYP2C19; and oxazepam is the productof both CYP activities. Therefore, Fig. 5B demonstratessignificantly higher CYP3A4 and CYP2C19 activity by primaryhepatocytes than HLCs. The higher concentrations of nordia-zepam in cultures of HLCs and primary hepatocytes suggestthat CYP2C19 is the major pathway of diazepam eliminationby both cell types. The low level of diazepam elimination incultures of hiPSCs suggests non-specific loss of drug since nomajor metabolites were detected in its supernatant.

Immature mitochondria and lower oxygen consumption byHLCs

Because of their role in energy production and thereforefunctionality of hepatocytes, mitochondria were a focus ofour analysis. Mitochondria were assessed in terms of geneexpression (Fig. 6A), replication (Figs. 6B and D), ultra-structure (Fig. 6C), and respiration (oxygen consumption,Fig. 6E). Replication of mtDNA is regulated by the nuclear-encoded mitochondrial transcription factor A (TFAM) andthe mitochondrial-specific DNA polymerase gamma (POLG),which consists of a catalytic (POLG1) and an accessory(POLG2) subunit. Our QRT-PCR showed that both Polg andTfam were expressed at baseline (day 0) and during thesteps of differentiation. Expression of Tfam declined duringdifferentiation, while expression of the five othermitochondrialgenes (Polg, Polg2, Ucp2, Atp5g, Atp8) was increased (Fig. 6A).Consistent with the rise inmitochondrial gene expression duringdifferentiation, mtDNA copy number increased 50-fold fromhiPSCs to HLCs (Fig. 6B). Mitochondrial number per cell andmtDNA copy number were highest in primary hepatocytes(Figs. 6B and D). The difference in maturity of HLCs vs. primaryhepatocytes was further uncovered by the ultrastructuralfeatures and redox status of their mitochondria (Fig. 6C).Consequently, oxygen consumption by primary human hepato-cytes was significantly higher than human HLCs (Fig. 6E).

Discussion

Access to an abundant, high quality supply of hepatocyteswith therapeutic potential for cell transplantation and ex-tracorporeal support of patients in liver failure has been theobjective of several research programs. Though hepaticdifferentiation of hiPSCs has been described (Chen et al.,2012), the functionality of HLCs derived from hiPSCs remainspoorly studied in the context of primary human hepatocytesor their application in cell based therapies. The Fox grouphas reported an implantable BAL device containing HLCsderived from embryonic stem cells (ESCs) in a murine modelof liver failure (Soto-Gutierrez et al., 2006). However, noreports have addressed functionality of HLCs derived from

Figure 6 Mitochondrial features during differentiation of hiPSCs to hepatocytes. A. Expression of Polg, Polg2, Ucp2, Atp5g1 and Atp8role steadily during stages of differentiation, while expression of Tfamdeclined over this time frame. B. The ratio ofmitochondrial DNA tonuclear DNA rose significantly (pb0.01) during differentiation reflecting the robust expansion of mitochondria in differentiating cells.ND1 and ND5 are genes encoded on mitochondrial DNA. Data are represented as mean±standard deviation. C. Top row—cells wereexamined by confocal microscopy using MitoTracker Red to assess their expanding density of functional mitochondria (red stain) duringstages of differentiation. Nuclei were stained blue by DAPI. Middle row (Low power TEM) and Lower Row (high power TEM)—mitochondriawere observed to elongate, develop swollen cristae and dense matrices, and migrate deeper into the cytoplasm during stages ofdifferentiation. The mitochondria of HLCs (day 23) appeared less mature than the mitochondria in primary hepatocytes. D. Mitochondriawere counted from TEM images. The number of mitochondria rose steadily through stages of differentiation and reached a maximum inprimary hepatocytes. The number of mitochondria in HLCs (day 23) was significantly less than in primary hepatocytes (pb0.01). Data arerepresented as mean±standard deviation. E. The level of oxygen consumption by HLCs (day 23) was significantly lower than primaryhepatocytes (pb0.01). Data are represented as mean±standard deviation.

204 Y. Yu et al.

hiPSCs in a cell-based BAL. Our results show a characteristicpolygonal epithelial morphology and large cytoplasm of HLCsderived from hiPSCs. These HLCs contained cytoplasmicgranules of hepatocytes and expressed hepatocyte-specificgenes. Additionally, HLCs exhibited known functions of mature

hepatocytes, such as albumin production and the appearanceof urea in culture medium. We also observed CYP activityand PAS staining consistent with glycogen storage by HLCs.Collectively, these observations confirm the generation ofHLCs from hiPSCs.

205Human Hepatocyte-Like Cells for Cell Therapy

To address the question of whether these HLCs could servein cellular therapies, a variety of markers of hepatocyte dif-ferentiation were considered. For example, production ofalbumin, a classic marker of hepatocyte differentiation, wasobserved in HLCs (Fig. 2). However, production of albumin hasbeen shown to be non-predictive of response to cell-basedtherapy (Dunn et al., 1991; Koike et al., 1996; Nahmias et al.,2007). Alternatively, mitochondria play a crucial role in manycellular functions relevant to cell based therapy includingenergy production, differentiation, apoptosis, and ammoniadetoxification. Mitochondria are the site of several enzymes ofthe urea cycle and thus essential to ammonia detoxificationand prevention of hepatic encephalopathy. Our data indicatesignificant maturation of mitochondria in HLCs compared totheir hiPSCs precursors. However the mitochondria of HLCsremain noticeable lessmature than the gold standard - primaryhepatocytes.

Our experience with hiPSCs and HLCs is analogous to thematuration of ESCs. Reviewed evidence suggests that respira-tory activity in mitochondria of ESCs is low to minimizegeneration of reactive oxygen species which may damage andmutate DNA during early development (Parker et al., 2009). Asstem cells of the early embryo commit to differentiation, theirmitochondria undergo dramatic functional maturation. Suc-cessful differentiation of mammalian ESCs involves transcrip-tion and replication of the mtDNA genome, replication ofmitochondria, and up-regulation of enzymes required foraerobicmetabolism (Chen et al., 2008; Cho et al., 2006; Chunget al., 2007; Schieke et al., 2008; Suhr et al., 2010). Thesechanges are needed to fulfill the elevated ATP requirements offully differentiated cells. In the case of primary hepato-cytes, they are rich in mitochondria to fulfill their manyvital roles including metabolism, synthesis of blood proteinsand biotransformation. Our results suggest that HLCs derivedfrom hiPSCs are capable of many of these functions, but theydo not appear to detoxify ammonia to urea under ex vivoconditions.

Our results also demonstrate that cultured HLCs expresshigher levels of AFP and lower levels of albumin than humanhepatocytes produced by in vivo expansion in geneticallyengineered mice (Azuma et al., 2007). Our observations aresimilar to other reports of significant but lower than normalproduction of albumin by HLCs (Cai et al., 2007; Sancho-Bru etal., 2011; Si-Tayeb et al., 2010; Song et al., 2009). The highlevels of AFP production in HLCs are unexplained, but suggestthat HLCs exhibit an inability to turn off early stage gene(s) asthe mechanism of persistent immature phenotype.

As mentioned above, the liver is a major site of detoxifica-tion, and ammonia is arguably the most important endogenoustoxin which requires clearance by the liver (Denis et al., 1983).Ammonia accumulation causes cerebral edema, the mostfeared complication of acute liver failure (Haussinger et al.,1992). A functioning urea cycle must be present for ammonia tobe effectively detoxified and eliminated from the body (Ytreboet al., 2009). Therefore, ammonia removal and urea productionare important considerations for ex vivo cell therapies. Our dataindicate that HLCs are inferior to primary hepatocytes at bothammonia detoxification and ureagenesis. The CYP enzymes,found in high levels in the human liver, are also important todetoxification of endogenous and exogenous wastes. Our HLCsexpressed high levels of mRNA from CYP3A4 and CYP2C19 anddetectable CYP3A4 andCYP2C19 enzymeactivity. However, the

CYP activities of HLCs were significantly below that of primaryhuman hepatocytes.

Mitochondria play a vital role in the balance betweenpluripotency, cellular differentiation, and replication(Armstrong et al., 2010). TFAM, POLG and POLG2 are thekey genes in regulating mtDNA replication. All three genesare nuclear-encoded, but produce transcription factorswhich are translocated to the mitochondria. We observedthat the expression of POLG and POLG2 increased progressivelyin hiPSCs, HLCs, and primary hepatocytes; however, expressionof TFAM declined with maturity. Our data is consistent withreports that an increase in the number of TFAM moleculesabove the optimal mtDNA:TFAM stoichiometry has inhibitoryeffects on mtDNA transcription and replication (Garstka et al.,2003; Webb and Smith, 1977). Therefore, a reduction in levelsof TFAM protein may explain, in part, the increased transcrip-tion of mtDNA through the 4 stages of differentiation (Kanki etal., 2004).

Mammalian mitochondria are composed of approximately1000 different proteins, but only 13 proteins are encoded bythe mitochondrial genome. We selected Atp5g, Atp8 andUcp2 as protein markers of the mitochondrial genome. Weobserved progressively higher expression of Ucp2, Atp5g andAtp8 in hiPSCs, HLCs, and primary hepatocytes. It has hithertobeen believed that the ratio of mtDNA to nuclear DNA reflectsthe tissue concentration of mtDNA per cell. Control of mtDNAcopy number is crucial for successful differentiation of ESCs(Facucho-Oliveira et al., 2007), and presumably also of hiPSCs.With the hepatic differentiation of hiPSCs, we observed anincreased mtDNA copy number. MitoTracker staining alsorose to reflect the expanded number of mitochondria in thecytoplasm during hepatic differentiation.

Our hiPSCs were derived from human cardiac fibroblasts.These parental fibroblasts possessed a large supply of mito-chondria. However, reduction and dedifferentiation of mito-chondria was essential for proper energy production and forprevention of DNA damage by oxidative stress in their con-version to hiPSCs. In turn, re-differentiation of hiPSCs to HLCsinvolved resupplying mitochondrial mass to meet the elevatedATP requirements of differentiated hepatocytes (Brown, 1992).It is possible that the difference in maturity profile andfunctionality between our HLCs and primary hepatocytes canbe explained by our original source of somatic cells, the cardiacfibroblasts. Prior work with hiPSCs derived from fibroblastssuggests that mitochondrial numbers returned to their pre-reprogrammed state or lower levels after re-differentiation(Armstrong et al., 2010; Suhr et al., 2010). Whether the lowermitochondrial functionality of our HLCs was due to their cell oforigin is unknown. Alternatively, the mitochondrial comple-ment of HLCs may require more time and more replicativecycles to realize its full potential (Suhr et al., 2010). Furtherwork is needed to clarify the role of original somatic cell typeand other factors in re-programming iPSCs to new mature celltypes.

Conclusion

In conclusion, our results confirm that functional HLCs canbe generated from hiPSCs. However, our studies suggest thatHLCs produced in vitro are not sufficiently mature to serveas ex vivo cell therapies, such as an extracorporeal BAL. Our

206 Y. Yu et al.

results support those of Takayama et al. (2012), and suggestthat a more native milieu is needed to complete hepaticdifferentiation of HLCs. Other reports suggest that in vivotransplantation of HLCs derived from hiPSCs can rescuerodents from lethal drug-induced acute liver failure (Chen etal., 2012), reduce liver fibrosis in a mouse model (Asgari etal., in press), enhance liver regeneration in mice (Espejel etal., 2010), and stabilize chronic liver disease (Choi et al.,2011). These in vivo studies suggest that novel techniquesare still needed to complete hepatic differentiation of HLCsand expand them in numbers sufficient for human therapy.One possibility for expansion and maturation of HLCs is agenetically engineered large animal, similar but larger thanthe source of human hepatocytes in our study (Azuma et al.,2007), to serve as an in vivo hepatocyte incubator (Hickey etal., 2011). The future success of ex vivo cell therapiesdepends on novel techniques to provide an abundant, highquality supply of functionally normal hepatocytes.

Acknowledgements

This work was supported by grant(s) from the Optical Microscopy Coreof the Mayo Clinic Center for Cell Signaling in Gastroenterology (NIHP30DK084567), Marriott Foundation, Wallace H. Coulter Foundation,Nature and Science Foundation of Jiangsu Province (10KJB320006 toY. Yu), the National Natural Science Foundation of China (81070361 toY. Yu) and Jiangsu Province's Outstanding Medical Academic keyprogram (RC2011067 to Y. Yu).

References

Armstrong, L., Tilgner, K., Saretzki, G., Atkinson, S.P., Stojkovic,M., Moreno, R., Przyborski, S., Lako, M., 2010. Human inducedpluripotent stem cell lines show stress defense mechanisms andmitochondrial regulation similar to those of human embryonicstem cells. Stem Cells 28, 661–673.

Asgari, S., Moslem, M., Bagheri-Lankarani, K., Pournasr, B.,Miryounesi, M., and Baharvand, H. (in press). Differentiationand transplantation of human induced pluripotent stem cell-derived hepatocyte-like cells. Stem Cell Rev. http://dx.doi.org/10.1007/s12015-011-9330-y.

Azuma, H., Paulk, N., Ranade, A., Dorrell, C., Al-Dhalimy, M., Ellis,E., Strom, S., Kay, M.A., Finegold, M., Grompe, M., 2007. Robustexpansion of human hepatocytes in Fah−/−/Rag2−/−/Il2rg−/−mice. Nat. Biotechnol. 25, 903–910.

Azuma, H., Isaka, Y., Nomi, H., Inamoto, T., Li, X.K., Hounig, T.,Takabatake, Y., Ichimaru, N., Ibuki, N., Matsumoto, K., et al.,2010. Induction of donor-specific tolerance using superagonisticCD28 antibody in rat renal allografts: regulatory T-cell expansionbefore engraftment may be important. Transplantation 90,1328–1335.

Baskin-Bey, E.S., Canbay, A., Bronk, S.F., Werneburg, N.,Guicciardi, M.E., Nyberg, S.L., Gores, G.J., 2005. Cathepsin Binactivation attenuates hepatocyte apoptosis and liver damagein steatotic livers after cold ischemia-warm reperfusion injury.Am. J. Physiol. Gastrointest. Liver Physiol. 288, G396–402.

Basma, H., Soto-Gutierrez, A., Yannam, G.R., Liu, L., Ito, R.,Yamamoto, T., Ellis, E., Carson, S.D., Sato, S., Chen, Y., et al.,2009. Differentiation and transplantation of human embryonicstem cell-derived hepatocytes. Gastroenterology 136, 990–999.

Brown, G.C., 1992. Control of respiration and ATP synthesis inmammalian mitochondria and cells. Biochem. J. 284 (Pt 1), 1–13.

Cai, J., Zhao, Y., Liu, Y., Ye, F., Song, Z., Qin, H., Meng, S., Chen, Y.,Zhou, R., Song, X., et al., 2007. Directed differentiation of human

embryonic stem cells into functional hepatic cells. Hepatology 45,1229–1239.

Chen, C.T., Shih, Y.R., Kuo, T.K., Lee, O.K., Wei, Y.H., 2008.Coordinated changes of mitochondrial biogenesis and antioxidantenzymes during osteogenic differentiation of human mesenchymalstem cells. Stem Cells 26, 960–968.

Chen, Y.F., Tseng, C.Y., Wang, H.W., Kuo, H.C., Yang, V.W., Lee, O.K.,2012. Rapid generation of mature hepatocyte-like cells fromhuman induced pluripotent stem cells by an efficient three-stepprotocol. Hepatology 55, 1193–1203.

Cho, Y.M., Kwon, S., Pak, Y.K., Seol, H.W., Choi, Y.M., Park do, J.,Park, K.S., Lee, H.K., 2006. Dynamic changes in mitochondrialbiogenesis and antioxidant enzymes during the spontaneousdifferentiation of human embryonic stem cells. Biochem. Biophys.Res. Commun. 348, 1472–1478.

Choi, S.M., Kim, Y., Liu, H., Chaudhari, P., Ye, Z., Jang, Y.Y., 2011.Liver engraftment potential of hepatic cells derived frompatient-specific induced pluripotent stem cells. Cell Cycle 10,2423–2427.

Chung, S., Dzeja, P.P., Faustino, R.S., Perez-Terzic, C., Behfar, A.,Terzic, A., 2007. Mitochondrial oxidative metabolism is requiredfor the cardiac differentiation of stem cells. Nat. Clin. Pract.Cardiovasc. Med. 4 (Suppl. 1), S60–67.

DeLaForest, A., Nagaoka, M., Si-Tayeb, K., Noto, F.K., Konopka, G.,Battle, M.A., Duncan, S.A., 2011. HNF4A is essential for specifica-tion of hepatic progenitors from human pluripotent stem cells.Development 138, 4143–4153.

Denis, J., Delorme, M.L., Boschat, M., Nordlinger, B., Opolon, P.,1983. Respective roles of ammonia, amino acids, and medium-sized molecules in the pathogenesis of experimentally inducedacute hepatic encephalopathy. J. Neurochem. 40, 10–19.

Dunn, J.C., Tompkins, R.G., Yarmush, M.L., 1991. Long-term in vitrofunction of adult hepatocytes in a collagen sandwich configura-tion. Biotechnol. Prog. 7, 237–245.

Espejel, S., Roll, G.R., McLaughlin, K.J., Lee, A.Y., Zhang, J.Y.,Laird, D.J., Okita, K., Yamanaka, S., Willenbring, H., 2010. Inducedpluripotent stem cell-derived hepatocytes have the functional andproliferative capabilities needed for liver regeneration in mice.J. Clin. Invest. 120, 3120–3126.

Facucho-Oliveira, J.M., Alderson, J., Spikings, E.C., Egginton, S.,St John, J.C., 2007. Mitochondrial DNA replication duringdifferentiation of murine embryonic stem cells. J. Cell Sci. 120,4025–4034.

Garstka, H.L., Schmitt, W.E., Schultz, J., Sogl, B., Silakowski, B.,Perez-Martos, A., Montoya, J., Wiesner, R.J., 2003. Import ofmitochondrial transcription factor A (TFAM) into rat liver mitochon-dria stimulates transcription of mitochondrial DNA. Nucleic AcidsRes. 31, 5039–5047.

Haussinger, D., Lamers, W., Moorman, A., 1992. Hepatocyte heteroge-neity in the metabolism of amino acids and ammonia. Enzyme 46,72–93.

Hickey, R., Lillegard, J., Fisher, J., McKenzie, T., Hofherr, S.,Finegold, M., Nyberg, S., Grompe, M., 2011. Efficient productionof Fah-null heterozygote pigs by chimeric adeno-associated virus-mediated gene knockout and somatic cell nuclear transfer.Hepatology 54, 1351–1359.

Kanki, T., Ohgaki, K., Gaspari, M., Gustafsson, C.M., Fukuoh, A.,Sasaki, N., Hamasaki, N., Kang, D., 2004. Architectural role ofmitochondrial transcription factor A in maintenance of humanmitochondrial DNA. Mol. Cell. Biol. 24, 9823–9834.

Koike, M., Matsushita, M., Taguchi, K., Uchino, J., 1996. Function ofculturing monolayer hepatocytes by collagen gel coating andcoculture with nonparenchymal cells. Artif. Organs 20, 186–192.

Lillegard, J.B., Fisher, J.E., Nedredal, G., Luebke-Wheeler, J.,Bao, J., Wang, W., Amoit, B., Nyberg, S.L., 2011. Normalatmospheric oxygen tension and the use of antioxidantsimprove hepatocyte spheroid viability and function. J. Cell.Physiol. 226, 2987–2996.

207Human Hepatocyte-Like Cells for Cell Therapy

Mandrioli, R., Mercolini, L., Raggi, M.A., 2008. Benzodiazepinemetabolism: an analytical perspective. Curr. Drug Metab. 9,827–844.

Nahmias, Y., Berthiaume, F., Yarmush, M.L., 2007. Integration oftechnologies for hepatic tissue engineering. Adv. Biochem. Eng.Biotechnol. 103, 309–329.

Parker, G.C., Acsadi, G., Brenner, C.A., 2009. Mitochondria: de-terminants of stem cell fate? Stem Cells Dev. 18, 803–806.

Rinaldo, P., 2008. Organic acids. In: Blau, N., Duran, N., Gibson, K.(Eds.), Laboratory guide to the methods in Biochemical Genet-ics. Springer-Heidelberg, pp. 137–170.

Sancho-Bru, P., Roelandt, P., Narain, N., Pauwelyn, K., Notelaers,T., Shimizu, T., Ott, M., Verfaillie, C., 2011. Directed differen-tiation of murine-induced pluripotent stem cells to functionalhepatocyte-like cells. J. Hepatol. 54, 98–107.

Schieke, S.M., Ma, M., Cao, L., McCoy Jr., J.P., Liu, C., Hensel,N.F., Barrett, A.J., Boehm, M., Finkel, T., 2008. Mitochondrialmetabolism modulates differentiation and teratoma formationcapacity in mouse embryonic stem cells. J. Biol. Chem. 283,28506–28512.

Si-Tayeb, K., Noto, F.K., Nagaoka, M., Li, J., Battle, M.A., Duris, C.,North, P.E., Dalton, S., Duncan, S.A., 2010. Highly efficientgeneration of human hepatocyte-like cells from induced plurip-otent stem cells. Hepatology 51, 297–305.

Song, Z., Cai, J., Liu, Y., Zhao, D., Yong, J., Duo, S., Song, X., Guo, Y.,Zhao, Y., Qin, H., et al., 2009. Efficient generation of hepatocyte-like cells from human induced pluripotent stem cells. Cell Res. 19,1233–1242.

Soto-Gutierrez, A., Kobayashi, N., Rivas-Carrillo, J.D., Navarro-Alvarez,N., Zhao, D., Okitsu, T., Noguchi, H., Basma, H., Tabata, Y., Chen,Y., et al., 2006. Reversal of mouse hepatic failure using an

implanted liver-assist device containing ES cell-derived hepato-cytes. Nat. Biotechnol. 24, 1412–1419.

Suhr, S.T., Chang, E.A., Tjong, J., Alcasid, N., Perkins, G.A., Goissis,M.D., Ellisman, M.H., Perez, G.I., Cibelli, J.B., 2010. Mitochondrialrejuvenation after induced pluripotency. PLoS One 5, e14095.

Takayama, K., Inamura, M., Kawabata, K., Katayama, K., Higuchi,M., Tashiro, K., Nonaka, A., Sakurai, F., Hayakawa, T., Furue,M.K., et al., 2012. Efficient generation of functional hepatocytesfrom human embryonic stem cells and induced pluripotent stemcells by HNF4alpha transduction. Mol. Ther. 20, 127–137.

Thatava, T., Nelson, T.J., Edukulla, R., Sakuma, T., Ohmine, S.,Tonne, J.M., Yamada, S., Kudva, Y., Terzic, A., Ikeda, Y., 2011.Indolactam V/GLP-1-mediated differentiation of human iPS cellsinto glucose-responsive insulin-secreting progeny. Gene Ther.18, 283–293.

Wang, Y., Cui, C.B., Yamauchi, M., Miguez, P., Roach, M.,Malavarca, R., Costello, M.J., Cardinale, V., Wauthier, E.,Barbier, C., et al., 2011. Lineage restriction of human hepaticstem cells to mature fates is made efficient by tissue-specificbiomatrix scaffolds. Hepatology 53, 293–305.

Webb, A.C., Smith, L.D., 1977. Accumulation of mitochondrial DNAduring oogenesis in Xenopus laevis. Dev. Biol. 56, 219–225.

Ytrebo, L.M., Kristiansen, R.G., Maehre, H., Fuskevag, O.M.,Kalstad, T., Revhaug, A., Cobos, M.J., Jalan, R., Rose, C.F.,2009. L-ornithine phenylacetate attenuates increased arterial andextracellular brain ammonia and prevents intracranial hyperten-sion in pigs with acute liver failure. Hepatology 50, 165–174.

Yu, J., Vodyanik, M.A., Smuga-Otto, K., Antosiewicz-Bourget, J.,Frane, J.L., Tian, S., Nie, J., Jonsdottir, G.A., Ruotti, V.,Stewart, R., et al., 2007. Induced pluripotent stem cell linesderived from human somatic cells. Science 318, 1917–1920.