Hardisty roberts 190313_opt
-
Upload
vibrantmanager -
Category
Real Estate
-
view
98 -
download
0
description
Transcript of Hardisty roberts 190313_opt
![Page 1: Hardisty roberts 190313_opt](https://reader033.fdocuments.net/reader033/viewer/2022051818/54ba78644a795938568b460d/html5/thumbnails/1.jpg)
Virtual BiodiversityViBRANT
-infrastructureSEVENTH FRAMEWORK PROGRAMME
A decadal view of biodiversity informatics: challenges and priorities Alex Hardisty, Dave Roberts, and the
biodiversity informatics community*
* 80 people took part in the open debate that led to this paper
![Page 2: Hardisty roberts 190313_opt](https://reader033.fdocuments.net/reader033/viewer/2022051818/54ba78644a795938568b460d/html5/thumbnails/2.jpg)
Virtual BiodiversityViBRANT
-infrastructureSEVENTH FRAMEWORK PROGRAMME
A decadal view of biodiversity informatics: challenges and priorities Alex Hardisty, Dave Roberts, and the
biodiversity informatics community*
* 80 people took part in the open debate that led to this paper
“We are drowning in information, while starving for wisdom. The world henceforth will be run by synthesizers, people able to put together the right information at the right time, think critically about it, and make important choices” E. O. Wilson, Harvard
![Page 3: Hardisty roberts 190313_opt](https://reader033.fdocuments.net/reader033/viewer/2022051818/54ba78644a795938568b460d/html5/thumbnails/3.jpg)
Virtual BiodiversityViBRANT
-infrastructureSEVENTH FRAMEWORK PROGRAMME
A decadal view of biodiversity informatics: challenges and priorities Alex Hardisty, Dave Roberts, and the
biodiversity informatics community*
* 80 people took part in the open debate that led to this paper
“We are drowning in information, while starving for wisdom. The world henceforth will be run by synthesizers, people able to put together the right information at the right time, think critically about it, and make important choices” E. O. Wilson, Harvard
Time to model all
life on Earth.
Purves et. al. (2013) Nature, 493: 295-297
![Page 4: Hardisty roberts 190313_opt](https://reader033.fdocuments.net/reader033/viewer/2022051818/54ba78644a795938568b460d/html5/thumbnails/4.jpg)
Virtual BiodiversityViBRANT
-infrastructureSEVENTH FRAMEWORK PROGRAMME
An infrastructure to allow the available data to be brought into a coordinated coupled modelling environment, capable of addressing questions relating to our use of the natural environment, that captures the variety, distinctiveness and complexity of all life on Earth
A decadal view of biodiversity informatics: challenges and priorities Alex Hardisty, Dave Roberts, and the
biodiversity informatics community*
* 80 people took part in the open debate that led to this paper
The Grand Challenge for Biodiversity Informatics
To achieve it we need:To build user confidenceIntegrative flexible e-Science environmentsPredictive models across multiple scales, coupled
![Page 5: Hardisty roberts 190313_opt](https://reader033.fdocuments.net/reader033/viewer/2022051818/54ba78644a795938568b460d/html5/thumbnails/5.jpg)
Virtual BiodiversityViBRANT
-infrastructureSEVENTH FRAMEWORK PROGRAMME
1. Open Data should be normal practice;
![Page 6: Hardisty roberts 190313_opt](https://reader033.fdocuments.net/reader033/viewer/2022051818/54ba78644a795938568b460d/html5/thumbnails/6.jpg)
Virtual BiodiversityViBRANT
-infrastructureSEVENTH FRAMEWORK PROGRAMME
1. Open Data should be normal practice;2. Data encoding should
allow analysis across multiple scales;
![Page 7: Hardisty roberts 190313_opt](https://reader033.fdocuments.net/reader033/viewer/2022051818/54ba78644a795938568b460d/html5/thumbnails/7.jpg)
Virtual BiodiversityViBRANT
-infrastructureSEVENTH FRAMEWORK PROGRAMME
1. Open Data should be normal practice;2. Data encoding should
allow analysis across multiple scales;
3. Infrastructure projects should devote significant resources to market the service they develop;
![Page 8: Hardisty roberts 190313_opt](https://reader033.fdocuments.net/reader033/viewer/2022051818/54ba78644a795938568b460d/html5/thumbnails/8.jpg)
Virtual BiodiversityViBRANT
-infrastructureSEVENTH FRAMEWORK PROGRAMME
Courtesy of ‘Linking Global Names and Pro-iBiosphere’, 2013, D. J. Patterson
AAAAAGCTCGTAGTTGGATTTGTGATGGAATTTGAATACTTTTAAAGTGTTCTAGAAACTGTCATCCGTGGGTGGAATTTGTTTGGCATTAGGTTGTCAGRCAGAGGATGCCTATMCTTTACTGTGAAAAAATCAGTGCGTTCAAAGCAGACTTACGTCGATGAATGTATTAGCATGGAA
Didimosphenia geminata
TGTATTTATTTA AGTTAGTT
didymo
Gomphonema vulgare Bréb.
Echinella geminata
Didymosphenia geminata (Lyngbye) Schmidt 1899
D. geminata
Didymosphenia geminata
Didymosphenia geminata (Lyngbye)
didymo
Rock Snot
![Page 9: Hardisty roberts 190313_opt](https://reader033.fdocuments.net/reader033/viewer/2022051818/54ba78644a795938568b460d/html5/thumbnails/9.jpg)
Virtual BiodiversityViBRANT
-infrastructureSEVENTH FRAMEWORK PROGRAMME
Actinobacillus actimomycetemcomitansActinobacillus actimycetemcomitansActinobacillus actinmycetemcomitansActinobacillus actinomicetemcomitansActinobacillus actinomyActinobacillus actinomyceActinobacillus actinomycemcomitansActinobacillus actinomyceremcomitansActinobacillus actinomycetamActinobacillus actinomycetamcomitansActinobacillus actinomycetecomitansActinobacillus actinomycetemcmitansActinobacillus actinomycetemcomintansActinobacillus actinomycetemcomitanceActinobacillus actinomycetemcomitansActinobacillus actinomycetemcomitants
Actinobacillus actinomycetemcommitansActinobacillus actinomycetemocimitansActinobacillus actinomycetencomitansActinobacillus actinomycetumActinobacillus actinomyctemcomitansActinobacillus actinomyectomcomitansActinobacillus actinomyetemcomitansActinobacillus actinonmycetemcomitansActinobacillus actionomycetemcomitansActinobacillus actynomicetemcomitansActinobacillus antinomycetemcomitans
Difficulties with Latinized NamesTranscription errors
Nomenclator provides correct spelling. Indexing infrastructure resolves to it.
Courtesy of Dave Remsen, GBIF
Names as strings of characters…4. A list of taxon names
![Page 10: Hardisty roberts 190313_opt](https://reader033.fdocuments.net/reader033/viewer/2022051818/54ba78644a795938568b460d/html5/thumbnails/10.jpg)
Virtual BiodiversityViBRANT
-infrastructureSEVENTH FRAMEWORK PROGRAMME
Actinobacillus actimomycetemcomitansActinobacillus actimycetemcomitansActinobacillus actinmycetemcomitansActinobacillus actinomicetemcomitansActinobacillus actinomyActinobacillus actinomyceActinobacillus actinomycemcomitansActinobacillus actinomyceremcomitansActinobacillus actinomycetamActinobacillus actinomycetamcomitansActinobacillus actinomycetecomitansActinobacillus actinomycetemcmitansActinobacillus actinomycetemcomintansActinobacillus actinomycetemcomitanceActinobacillus actinomycetemcomitansActinobacillus actinomycetemcomitants
Actinobacillus actinomycetemcommitansActinobacillus actinomycetemocimitansActinobacillus actinomycetencomitansActinobacillus actinomycetumActinobacillus actinomyctemcomitansActinobacillus actinomyectomcomitansActinobacillus actinomyetemcomitansActinobacillus actinonmycetemcomitansActinobacillus actionomycetemcomitansActinobacillus actynomicetemcomitansActinobacillus antinomycetemcomitans
Difficulties with Latinized NamesTranscription errors
Nomenclator provides correct spelling. Indexing infrastructure resolves to it.
Names as strings of characters… 4. A list of taxon names
DOI: 10.4289/0013-8797.115.1.75
5. Persistent Identifiers
![Page 11: Hardisty roberts 190313_opt](https://reader033.fdocuments.net/reader033/viewer/2022051818/54ba78644a795938568b460d/html5/thumbnails/11.jpg)
Virtual BiodiversityViBRANT
-infrastructureSEVENTH FRAMEWORK PROGRAMME
Actinobacillus actimomycetemcomitansActinobacillus actimycetemcomitansActinobacillus actinmycetemcomitansActinobacillus actinomicetemcomitansActinobacillus actinomyActinobacillus actinomyceActinobacillus actinomycemcomitansActinobacillus actinomyceremcomitansActinobacillus actinomycetamActinobacillus actinomycetamcomitansActinobacillus actinomycetecomitansActinobacillus actinomycetemcmitansActinobacillus actinomycetemcomintansActinobacillus actinomycetemcomitanceActinobacillus actinomycetemcomitansActinobacillus actinomycetemcomitants
Actinobacillus actinomycetemcommitansActinobacillus actinomycetemocimitansActinobacillus actinomycetencomitansActinobacillus actinomycetumActinobacillus actinomyctemcomitansActinobacillus actinomyectomcomitansActinobacillus actinomyetemcomitansActinobacillus actinonmycetemcomitansActinobacillus actionomycetemcomitansActinobacillus actynomicetemcomitansActinobacillus antinomycetemcomitans
Difficulties with Latinized NamesTranscription errors
Nomenclator provides correct spelling. Indexing infrastructure resolves to it.
Names as strings of characters… 4. A list of taxon names
DOI: 10.4289/0013-8797.115.1.75
5. Persistent Identifiers
6. Author identifiers
![Page 12: Hardisty roberts 190313_opt](https://reader033.fdocuments.net/reader033/viewer/2022051818/54ba78644a795938568b460d/html5/thumbnails/12.jpg)
Virtual BiodiversityViBRANT
-infrastructureSEVENTH FRAMEWORK PROGRAMME
7. 3rd party authentication
![Page 13: Hardisty roberts 190313_opt](https://reader033.fdocuments.net/reader033/viewer/2022051818/54ba78644a795938568b460d/html5/thumbnails/13.jpg)
Virtual BiodiversityViBRANT
-infrastructureSEVENTH FRAMEWORK PROGRAMME
8. Classification Bank
Embley & Stackebrandt (1994) Bergey’s Manual, 2nd Edition (2012)
Actinomycetes: the antibiotic factories
Atopobium minutumSphaerobacter thermophilus
strain TH3
Bifidobacteriaceae
Actinomycetaceae
Arthrobacteriaceae, Cellomonadaceae, Microbacteriaceae, Dermatophilaceae and realtives
Propionibacteriaceae
Nocardioidaceae
Frankiaceae
Corynebacteriaceae, Mycobacteriaceae, Nocardiaceae and realtives
Actinoplanaceae
Pseudonocardiaceae
Streptomycetaceae, Streptosporangiaceae and relatives
Insertion element in 23S rRNA
![Page 14: Hardisty roberts 190313_opt](https://reader033.fdocuments.net/reader033/viewer/2022051818/54ba78644a795938568b460d/html5/thumbnails/14.jpg)
Virtual BiodiversityViBRANT
-infrastructureSEVENTH FRAMEWORK PROGRAMME
9. Accepted names
AnnualChecklist
DynamicEditionHome
© 2013, Species 2000 at University of Reading | Disclaimer
Latest on Twitter
Overview
About the Catalogue of LifeContributors & partnersContact us
User Guide
Getting startedVersions of the CatalogueContributing your dataGlossary
Additional Services
DownloadsAdvanced services
'The most comprehensive andauthoritative global index ofspecies currently available, theCatalogue of Life consists of asingle integrated checklist andtaxonomic hierarchy for all theworld's species.'
Welcome to the Catalogue of Life website: gateway to ourdatabase of the world's known species of animals, plants, fungiand micro-organisms
Explore »
This Dynamic Edition is a constantly evolving version of the Catalogue ofLife.
Now tracking 70% of species known to science
1,315,754 species
Annual Checklist »The Annual Checklist is a snapshot of the entireCatalogue of Life: a fixed imprint.
Why two versions?
Design: Chris Turnbull | Content: Simon Thornton-Wood
Catalogue of Lifecatalogueoflife
Join the conversation
catalogueoflife Catalogue of Life,11th March 2013 is now online atcatalogueoflife.org/col6 days ago · reply · retweet · favorite
catalogueoflife Catalogue of Life,08th February 2013 is now online atcatalogueoflife.org/col37 days ago · reply · retweet · favorite
I . P . N . I
![Page 15: Hardisty roberts 190313_opt](https://reader033.fdocuments.net/reader033/viewer/2022051818/54ba78644a795938568b460d/html5/thumbnails/15.jpg)
Virtual BiodiversityViBRANT
-infrastructureSEVENTH FRAMEWORK PROGRAMME
10. Tools to make LOD
Implicit semantics“Compound 2a melted at 119oC”
Humans are good at interpreting this:
Explicit semantics CML Schema<cml:molecule ref=“2a”> <cml:property> <cml:scalar dictRef=“prop:mpt” units=“units:celsius” dataType=“xds:float” >119</cml:scalar> </cml:property></cml:molecule>
Molecules in CML/InChl
propertyDictionaryunitsDictionary
W3CSchema
4 namespaces, 3 dictionaries
Machines need this:
![Page 16: Hardisty roberts 190313_opt](https://reader033.fdocuments.net/reader033/viewer/2022051818/54ba78644a795938568b460d/html5/thumbnails/16.jpg)
Virtual BiodiversityViBRANT
-infrastructureSEVENTH FRAMEWORK PROGRAMME
Most textbooks will tell you that, in 1610, Galileo Galilei became the first person to observe Saturn's rings.
But what did he really see?
GBIF/GBIC – 2-4 Jul 2012 – Copenhagen, © 2012, R. J. Robbins
![Page 17: Hardisty roberts 190313_opt](https://reader033.fdocuments.net/reader033/viewer/2022051818/54ba78644a795938568b460d/html5/thumbnails/17.jpg)
Virtual BiodiversityViBRANT
-infrastructureSEVENTH FRAMEWORK PROGRAMME
GBIF/GBIC – 2-4 Jul 2012 – Copenhagen, © 2012, R. J. Robbins
This?
![Page 18: Hardisty roberts 190313_opt](https://reader033.fdocuments.net/reader033/viewer/2022051818/54ba78644a795938568b460d/html5/thumbnails/18.jpg)
Virtual BiodiversityViBRANT
-infrastructureSEVENTH FRAMEWORK PROGRAMME
GBIF/GBIC – 2-4 Jul 2012 – Copenhagen, © 2012, R. J. Robbins
Or this?
![Page 19: Hardisty roberts 190313_opt](https://reader033.fdocuments.net/reader033/viewer/2022051818/54ba78644a795938568b460d/html5/thumbnails/19.jpg)
Virtual BiodiversityViBRANT
-infrastructureSEVENTH FRAMEWORK PROGRAMME
GBIF/GBIC – 2-4 Jul 2012 – Copenhagen, © 2012, R. J. Robbins
The generation of important new insights while handicapped with limited technology, indirect measurement, and fuzzy data is the mark of scientific greatness.
![Page 20: Hardisty roberts 190313_opt](https://reader033.fdocuments.net/reader033/viewer/2022051818/54ba78644a795938568b460d/html5/thumbnails/20.jpg)
Virtual BiodiversityViBRANT
-infrastructureSEVENTH FRAMEWORK PROGRAMME
11. Data fit for purposeData are received at face-value, examined and tested. If the user is satisfied, then the data will be applied.
![Page 21: Hardisty roberts 190313_opt](https://reader033.fdocuments.net/reader033/viewer/2022051818/54ba78644a795938568b460d/html5/thumbnails/21.jpg)
Virtual BiodiversityViBRANT
-infrastructureSEVENTH FRAMEWORK PROGRAMME
12. Observational data infrastructure
Agriculture Systems
Climate Change
Forest Management
Invasion Biology
Urban Ecosystems
http://www.teamnetwork.org
http://www.earthobservations.org/geobon.shtml
http://www.eubon.eu
http://www.neoninc.org
http://mooreabiocode.org/
Moorea Biocode Project
http://www.ilternet.edu
![Page 22: Hardisty roberts 190313_opt](https://reader033.fdocuments.net/reader033/viewer/2022051818/54ba78644a795938568b460d/html5/thumbnails/22.jpg)
Virtual BiodiversityViBRANT
-infrastructureSEVENTH FRAMEWORK PROGRAMME
To build user confidence
Thus far, all projects share a common problem of keeping services running after project funding ended
New models are needed
To create translational pipelines to industry adoption
To encourage institutional adoption for care and maintenance
For recognition of contribution other than through publication of academic papers
Stronger marketing and outreach
Invest more in up-skilling and hand-holding
![Page 23: Hardisty roberts 190313_opt](https://reader033.fdocuments.net/reader033/viewer/2022051818/54ba78644a795938568b460d/html5/thumbnails/23.jpg)
Virtual BiodiversityViBRANT
-infrastructureSEVENTH FRAMEWORK PROGRAMME
Integrative flexible e-Science environmentsUsing standardised building blocks and workflows
Interoperable components
With access to data from multiple sources
Recognise different kinds of VRE
General-purpose / specialised / single scientific objective
- cf. chemistry laboratory vs forensics lab vs HIV vaccine lab
- BioVeL / AquaMaps and iMarine / CarbonWaterCloud
Must generate immediate benefit for users
Science driven, with scientists as active participants in creation of infrastructure
Functions people find useful: simple and intuitive
Technology invisible (disappears into background)
![Page 24: Hardisty roberts 190313_opt](https://reader033.fdocuments.net/reader033/viewer/2022051818/54ba78644a795938568b460d/html5/thumbnails/24.jpg)
Virtual BiodiversityViBRANT
-infrastructureSEVENTH FRAMEWORK PROGRAMME
Predictive models across multiple scales
A new framework of methods, techniques, standards to bring about interoperability of data and models across different biological scales
From Genetic through species and ecosystem to landscape
Learn from Virtual Physiological Human and from Numerical weather prediction and climatology Edwards (2010). A Vast Machine
“General Ecological Models” Purves et al. (2013). doi:10.1038/493295a
Evolvable to incorporate new scientific insights
Re-analysis models
Making data we have global
Implies ‘inversion’ of existing infrastructure
‘inversion’ of existing infrastructure is about re-examining every element of data we have to re-construct the past biodiversity, as a guide and calibrator of models that can predict the future
![Page 25: Hardisty roberts 190313_opt](https://reader033.fdocuments.net/reader033/viewer/2022051818/54ba78644a795938568b460d/html5/thumbnails/25.jpg)
Virtual BiodiversityViBRANT
-infrastructureSEVENTH FRAMEWORK PROGRAMME
Section 1: The fundamental backbone (getting the basics right)
Section 2: The next steps
Section 3: New tools
Section 4: The human interface
1. Why are names important? 2. How are names organised? 3. Which is the right name? 4. What is the name of that organism? 5. Can biodiversity studies be done without names? 6. Biodiversity data beyond names 7. To link resources we need identifiers 8. Centralised or networked services?
15. Data Sharing 16. Why do we need vocabularies and ontologies? 17. How would Knowledge Organising Systems help? 18. How easy is it to integrate data?
27. How do you aggregate the data you need? 28. How complete are the data? 29. How can we encourage virtual research
environments? 30. What can you do with your data in the future?
9. How to balance professional and non-professional contributions
10. Engagement of users 11. Who's who? 12. User identification 13. How do we ensure the right metadata are created
at the point of data generation? 14. Sustaining the physical infrastructure
19. Beyond Sharing and Re-use: the problem of scale 20. How reliable are the data? 21. What will the physical infrastructure look like?
22. How much of the legacy collections can be digitised? 23. How to generate more targeted and reliable data? 24. What role do mobile devices play? 25. How do you find the data you need? 26. How do you extract the data you need?
31. How can we give users confidence? 32. Who owns what? 33. What benefits come to contributors?
![Page 26: Hardisty roberts 190313_opt](https://reader033.fdocuments.net/reader033/viewer/2022051818/54ba78644a795938568b460d/html5/thumbnails/26.jpg)
Virtual BiodiversityViBRANT
-infrastructureSEVENTH FRAMEWORK PROGRAMME
Thank you for your attention.
Any questionsAlex Hardisty <[email protected]>Dave Roberts <[email protected]>
http://www.biovel.eu http://vbrant.eu
Hardisty et al. (2013) A decadal view of biodiversity informatics: challenges and priorities. BMC Ecology (in press)
http://www.slideshare.net/vibrantmanager/hardisty-roberts-190313opt