GomUnarmoured dinoflagellates with a small hyposome: Torodinium and Lebouridinium gen. nov. for...

8/18/2019 GomUnarmoured dinoflagellates with a small hyposome: Torodinium and Lebouridinium gen. nov. for Katodinium …

1/17

Full Terms & Conditions of access and use can be found athttp://www.tandfonline.com/action/journalInformation?journalCode=tejp20

European Journal of Phycology

ISSN: 0967-0262 (Print) 1469-4433 (Online) Journal homepage: http://www.tandfonline.com/loi/tejp20

Unarmoured dinoflagellates with a smallhyposome: Torodinium and Lebouridinium gen.nov. for Katodinium glaucum (Gymnodiniales,Dinophyceae)

Fernando Gómez, Haruyoshi Takayama, David Moreira & Purificación López-García

To cite this article: Fernando Gómez, Haruyoshi Takayama, David Moreira & PurificaciónLópez-García (2016) Unarmoured dinoflagellates with a small hyposome: Torodinium andLebouridini um gen. nov. for Katod inium glaucum (Gymnodiniales, Dinophyceae), European

Journal of Phycology, 51:2, 226-241, DOI: 10.1080/09670262.2015.1126767

To link to this article: http://dx.doi.org/10.1080/09670262.2015.1126767

Published online: 04 Mar 2016.

Submit your article to this journal

Article views: 14

View related articles

View Crossmark data

http://crossmark.crossref.org/dialog/?doi=10.1080/09670262.2015.1126767&domain=pdf&date_stamp=2016-03-04http://www.tandfonline.com/doi/mlt/10.1080/09670262.2015.1126767http://crossmark.crossref.org/dialog/?doi=10.1080/09670262.2015.1126767&domain=pdf&date_stamp=2016-03-04http://crossmark.crossref.org/dialog/?doi=10.1080/09670262.2015.1126767&domain=pdf&date_stamp=2016-03-04http://www.tandfonline.com/doi/mlt/10.1080/09670262.2015.1126767http://www.tandfonline.com/doi/mlt/10.1080/09670262.2015.1126767http://www.tandfonline.com/action/authorSubmission?journalCode=tejp20&page=instructionshttp://www.tandfonline.com/action/authorSubmission?journalCode=tejp20&page=instructionshttp://dx.doi.org/10.1080/09670262.2015.1126767http://www.tandfonline.com/action/showCitFormats?doi=10.1080/09670262.2015.1126767http://www.tandfonline.com/loi/tejp20http://www.tandfonline.com/action/journalInformation?journalCode=tejp20


2/17

Unarmoured dino agellates with a small hyposome:Torodinium and Lebouridinium gen. nov. for Katodinium glaucum (Gymnodiniales, Dinophyceae)

FERNANDO GÓMEZ1 , HARUYOSHI TAKAYAMA2 , DAVID MOREIRA3 AND PURIFICACIÓNLÓPEZ-GARCÍA3

1 Laboratory of Plankton Systems, Oceanographic Institute, University of São Paulo, São Paulo 05508 – 900, Brazil 2 Hatami 5 – 20 – 13, Ondo-cho, Kure, Hiroshima 737 – 1207, Japan3 Unité d ’ Ecologie, Systématique et Evolution, CNRS UMR 8079, Université Paris-Sud, 91405 Orsay Cedex, France

(Received 13 August 2015; revised 23 September 2015; accepted 12 October 2015)

We investigated the morphology and evolutionary relationships of Torodinium spp. and Katodinium glaucum , unar-moured dinoagellates characterized by a small hyposome. An emended generic description of Torodinium was proposed based on light and scanning electron microscopy. Torodinium exhibited a unique combination of morpholo-gical features including a minute hyposome, a long episome with longitudinal ribs and a canal of unknown function onthe dextro-lateral side. Unlike any known dinoagellate both cingulum and sulcus extended in the episome. The apexsurface showed ribs that converged in a bill-like projection. The shape of the apical groove was a circular spiral that extended around the apex running in 2.5 turns in an anticlockwise direction. The type species T. teredo was usuallylonger than T. robustum . The longitudinal outline of T. teredo was linear, with almost parallel margins, a circular transversal section, a relatively large hyposome and a conspicuous bill-like projection. The longitudinal outline of T. robustum was oblong, widened in the middle, with an ellipsoidal transversal section, a small hyposome and a less prominent bill-like projection. Several morphological features of Katodinium glaucum (=Gyrodinium glaucum )

resembled Gyrodinium , such as the cingular displacement, longitudinal ribs, trichocysts, rod-shaped and refractile bodies and a capsule that surrounded the spherical nucleus. Distinctive features of K. glaucum were the horseshoe-shaped apical groove under a tongue-shaped notch pointed towards the dorsal side, and a bifurcated proximal end of thecingulum. Phylogenetic analysis revealed that Torodinium spp. and K. glaucum formed two independent lineages withno close relationships with other known dinoagellates. The morphology of K. glaucum was distant from the typespecies of Katodinium . We propose the new genus and combination Lebouridinium glaucum gen. nov., comb. nov. for the species Katodinium glaucum .

Key words: acrobase, apical groove, athecate Dinoagellata, Gymnodinium , Gyrodinium , molecular phylogeny, nakeddino agellate, new genus, taxonomy

INTRODUCTIONTwo major groups of dinoagellates can be distin-guished based on morphological criteria: thecate or armoured species with discernible thecal plates andathecate, unarmoured or ‘ naked’ species without plates or with plates that are barely visible under thelight microscope. Unarmoured dinoagellates,especially gymnodinioid forms, tend to be delicate,easily damaged by net sampling and often too dis-torted by xation to be identied. Live specimens can be easily deformed when they are examined under themicroscope (Kofoid & Swezy, 1921).

Gymnodinium teredo C.H.G. Pouchet wasdescribed as a fusiform unarmoured dinoagellatewith a very large episome that occupied most of thecell body, a posterior cingulum and a much reducedhyposome (Pouchet, 1885). Schütt (1895) illustratedG. teredo in more detail, including the cell shapevariability, particularly the length of the episome, aslater remarked by Lebour (1917). Kofoid & Swezy(1921) used the marked torsion of the sulcus, amount-ing to 0.5 turns, to support the erection of TorodiniumKof. & Swezy as a genus independent from

Gymnodinium F. Stein. Kofoid & Swezy proposedthe type, Torodinium teredo (C.H.G. Pouchet) Kof.& Swezy, and the new species Torodinium robustumKof. & Swezy based on their own observations andsome of the illustrations of G. teredo from Schütt Correspondence to: Fernando Gómez. (e-mail: fernando.gomez@ toplancton.com).

Eur. J. Phycol. (2016), 51: 226 – 241

ISSN 0967-0262 (print)/ISSN 1469-4433 (online)/16/020226-241 © 2016 British Phycological Societyhttp://dx.doi.org/10.1080/09670262.2015.1126767

http://www.tandfonline.com/


3/17

(1895). Apparently Kofoid & Swezy (1921) did not observe any specimens of T. teredo . However, theyconsidered that the apex of T. teredo lacked the apicalgroove (which they called reversed terminal anterior loop of the sulcus). This feature, together with therelative ratio between the length and the transdia-

meter, with a stouter episome in T. robustum , wasused for species distinction.The two Torodinium species have been commonly

reported in the literature and further authors agreedwith the diagnosis given by Kofoid & Swezy, withno new taxonomic information (Elbrächter, 1979;Dodge, 1982; Sournia, 1986; Hansen & Larsen,1992; Steidinger & Tangen, 1997; Gárate-Lizárraga& Muciño-Márquez, 2013). Gómez (2009) reportedthat some specimens of Torodinium showed a bodyextension that protrudes from the hyposome andaccumulation bodies (tentative food vacuoles).These features supported the mixotrophic character of Torodinium .

Kofoid & Swezy (1921, p. 390) reported a link between Torodinium and Spirodinium glaucum M.Lebour. The latter species was further reported asGyrodinium glaucum (M. Lebour) Kof. & Swezy, Massartia glauca (M. Lebour) J. Schiller and Katodinium glaucum (M. Lebour) A.R. Loebl. Katodinium glaucum is devoid of plastids, with a postmedian cingulum, marked cingular displace-ment, apex with a tongue-shaped notch, and thecell surface is covered with longitudinal ribs(Takayama, 1985, 1998). Daugbjerg et al . (2000) placed K. glaucum again into the genusGyrodinium Kof. & Swezy. Kim & Kim (2007)retained the name Katodinium glaucum becausethey did not nd a close relationship withGyrodinium or other dinoagellates in their LSUrDNA phylogenetic analysis. More than 40 specieshave been described or transferred into the genus Katodinium Fott. The type species, K. nieuportense(W. Conrad) Loebl. & A.R. Loebl., only knownfrom the original description, is an unarmoured

dino agellate with two to four plate-like, yellowishchloroplasts and numerous, minute oil droplets. Itsapex is rounded and the cell surface smooth(Conrad, 1926). Further studies have revealed that Katodinium was a polyphyletic group that evenincluded thecate species (Hansen, 1995; Murrayet al ., 2007; Calado, 2011; Kang et al ., 2015).Reñé et al . (2015) provided new sequences of Torodinium and K. glaucum . In their SSU rDNA phylogeny, T. robustum and K. glaucum branchedtogether with very low support (Reñé et al ., 2015).In this study, we provide a detailed study of the

morphology of the two species of Torodinium and Katodinium glaucum . We re-examined the molecu-lar phylogeny of these taxa with new sequences of Torodinium spp.

MATERIALS AND METHODSSampling and isolation of materialIn the Mediterranean Sea, the specimens of Torodinium spp.were collected from October 2007 to September 2008 byslowly ltering surface seawater taken from the pier of theStation Marine d’ Endoume at Marseille (43°16′ 48.05″ N, 5°20′ 56.22″ E, bottom depth 3 m). A strainer of 20 µm meshsize was used to collect planktonic organisms from water volumes ranging between 10and100l, dependingon particleconcentration. The plankton concentrate was scanned in set-tling chambers at 100× magnication with an inverted micro-scope (Nikon Eclipse TE200, Nikon Inc., Tokyo, Japan).Cells were photographedalive at 200× or 400× magnicationwith a Nikon Coolpix E995 digital camera. During the sampling on 17 – 21 December 2007, the distinction betweenspecies was not dened and we pooled a total of 20 speci-mens of Torodinium spp. into a single sample for PCR ampli-

cation and cloning (isolated cells FG21 – 2, FG21 – 3, FG21 – 4, GenBank accession numbers KR139781, KR139782,KR139783). Sporadic samplings were carried out in theBay of Marseille at the SOMLIT (Service d’ Observation enMilieu LITtoral) site (43º14′ 52.8″ N, 5º17′ 52.8″ E). Sampleswere collected with Niskin bottles at the surface and 55 mdepth and analysed following the procedure described above.In this case, a single specimen (#FG187) was analysed bysingle-cell PCR (GenBank accession number KR139784).

Further specimens were collected using the same methodfrom October 2008 to August 2009 in the surface waters(depth of 2 m) of the port of Banyuls-sur-Mer, France(42º28′ 50″ N, 3º08′ 09″ E). The concentrated sample wasexamined in Utermöhl chambers with an inverted micro-

scope (Olympus IX51, Olympus Inc., Tokyo, Japan) and photographed with an Olympus DP71 digital camera.Sampling continued from September 2009 to February2010 in the Bay of Villefranche-sur-Mer, Ligurian Sea. For this location, sampling was performed at the long-term mon-itoring site Point B (43º41′ 10″ N, 7º19′ 00′′ E, water columndepth ~80 m). Water column samples (0 – 80 m) wereobtained using a phytoplankton net (53 µm mesh size,54 cm diameter, 280 cm length). Samples were preparedaccording to the same procedure as described above andspecimens were observed with an inverted microscope(Olympus IX51) and photographed with an Olympus DP71digital camera. Sampling continued from May 2012 toFebruary 2013 in the port of Valencia, Spain (39°27′ 38.13″ N, 0°19′ 21.29″ W, water column depth of 4 m). Specimenswere obtained using a phytoplankton net (20 µm mesh size).Samples were prepared according to the same procedure asdescribed above and specimens were observed with aninverted microscope (Nikon Eclipse T2000) and photo-graphed with an Olympus DP71 digital camera.

In addition, samples were collected during the BOUM(Biogeochemistry from the Oligotrophic to the Ultra-oligo-trophic Mediterranean) cruise on board R/V L’ Atalante fromthe south of France to the south of Cyprus (20 June – 18 July2008). Seawater samples were collected with Niskin bottlesfrom 30 stations. At each station 6 depths were sampled between 5 and 125 m, with an additional sample at 250 mdepth. These samples were preserved with acid Lugol’ s solu-tion and stored at 5ºC. Samples of 500 ml were concentratedvia sedimentation in glass cylinders. The top 450 ml of

Torodinium and Lebouridinium gen. nov. 227


4/17

sample was slowly siphoned off with small-bore tubing over 6 days. The remaining 50 ml of concentrate, representing 500ml whole water, was then settled in composite settling chambers. The sample was examined in Utermöhl chambers at 100× magnication with a Nikon inverted microscope(Nikon Eclipse TE200) and the specimens were photo-graphed with a digital camera (Nikon Coolpix E995).

In the North Pacic Ocean, samples were collected with a planktonnet (30 µm mesh size) from the coastal InlandSea of Japan at Kure (34°10′ 30″ N, 132°33′ 21.6″ E). The living con-centrated samples were observed at 400× and 1000× magni-

cation with an upright microscope (Olympus BH2), and photographed with a digital camera (Canon EOS Kiss F.,Canon Inc., Tokyo, Japan).

Scanning electron microscopySeawater samples were collected with a bucket from thecoastal areas of the Inland Sea of Japan along Hiroshima

Prefecture in 1980 – 1985 as described in Takayama (1998).For scanning electron microscopy, dinoagellate cells were pipetted individually, rinsed three times in ltered seawater and placed on poly-lysine coated coverslips. They werexedin 2% osmium tetroxide in seawater for 20 min. After wash-ing in distilled water for 30 min, cells were dehydrated in anethanol series, 10 min in each change of 30%, 50%, 70%,90% and 95%, followed by two 30 min changes in absoluteethanol, and nally transferred to amyl acetate. The cellswere critical-point dried using liquid carbon dioxide andion sputter-coated with gold. They were observed using ascanning electron microscope (Hitachi S – 430, Hitachi Ltd,Tokyo, Japan) operated at 15 kV. The method is explained indetail in Takayama (1998). Pictures were scanned and pre-sented on a black background using Adobe Photoshop CS3(Adobe Systems Inc., San José, California, USA).

PCR amplicationof small subunit rRNA genes (SSUrDNAs) and sequencingFor molecular analysis, each specimen was photographed andthen micropipetted individually with a ne capillary into aclean chamber and washed several times in a series of dropsof 0.2 µm-ltered and sterilized seawater. Finally, the speci-men was placed in a 0.2 ml tube (ABgene; Thermo Fisher

Scienti c Inc., Courtaboeuf, France) lled with several dropsof absolute ethanol. The sample was kept at room temperatureand in darkness until the molecular analysis could be per-formed. The specimens xed in ethanol were centrifuged for 5 min at504 × g.The ethanol was thenevaporated ina vacuumdesiccator and single cells were resuspended directly in 25 µlof Ex TaKaRa buffer (TaKaRa, distributed by Lonza,Levallois-Perret, France). PCRs were done in a volume of 30 – 50 µl reaction mix containing 10 – 20 pmol of the eukar-yotic-specic SSU rDNA primers EK-42F (5′– CTCAARGAYTAAGCCATGCA – 3′ ) and EK-1520R (5′– CYGCAGGTTCACCTAC – 3′ ) (López-García et al ., 2001).PCRs were performed under the following conditions: 2 mindenaturation at 94ºC; 10 cycles of ‘ touch-down’ PCR (dena-turation at 94ºC for 15 s; a 30 s annealing step at decreasing temperature from 65 down to 55ºC, employinga 1ºC decrease with each cycle, extension at 72ºC for 2min); 20 additional cycles at 55ºC annealing temperature;

and a nal elongation step of 7 min at 72ºC. A nestedPCR was then carried out using 2 – 5 µl of the rst PCR products in a GoTaq (Promega, Lyon, France) polymerasereaction mix containing the eukaryotic-specic primersEK-82F (5′– GAAACTGCGAATGGCTC – 3′ ) and EK-1498R (5′– CACCTACGGAAACCTTGTTA – 3′ ) (López-García e t al ., 2001) and similar PCR conditions asdescribed above. Negative controls without templateDNA were used at all amplication steps. Amplicons of the expected size (~1700 base pairs) were then sequenced bi-directionally using primers EK-82F and EK-1498R using an automated 96-capillary ABI PRISM 3730xlsequencer (BC Genomics, Takeley, UK). In other samples, the amplied product was subsequently clonedusing the Topo TA Cloning system (Invitrogen, LifeTechnologies, Saint Aubin, France) following the instruc-tions provided by the manufacturers. Three clones were picked and the corresponding insert amplied using vec-tor primers. Amplicons of the expected size were fullysequenced (Cogenics, Meylan, France) with vector pri-mers using the same automated sequencer.

Phylogenetic analysesThe new SSU rDNA sequences were aligned to a large multiple sequence alignment containing ~1500 publicly availablecomplete or nearly complete (>1300 base pairs) dinoagel-late sequences using the prole alignment option of MUSCLE 3.7 (Edgar, 2004). The resulting alignment wasmanually inspected using the program ED of the MUST package (Philippe, 1993). Ambiguously aligned regions andgaps were excluded in phylogenetic analyses. Preliminary phylogenetic trees with all sequences were constructedusing the Neighbour joining method (Saitou & Nei, 1987)implemented in the MUST package (Philippe, 1993). Thesetrees allowed identication of the closest relatives of our sequences together with a sample of other dinoagellatespecies, which were selected to carry out more computation-ally intensive Bayesian inference analyses. These analyseswere done with the program MrBayes 3.2.3 (Ronquist et al .,2012) applying a GTR +Γ 4 model of nucleotide substitution,taking into account a Γ -shaped distribution of substitutionrates with four rate categories. Four chains (three heated andone cold) were run for 2 million generations with treessampled every 100 generations. The rst 5000 trees werediscarded as burn-in and a majority-rule consensus tree wasconstructed with the remaining trees. Our sequences weredeposited in DDBJ/EMBL/GenBank under accession numbers KR139781 – KR139784.

RESULTSLight microscopy of Torodinium spp.The observations of Torodinium , with more or lessslender co-existing specimens, were sporadic in thesampling areas. The separation of the two species of Torodinium in the literature has traditionally been based on morphometric parameters: T. teredo for lar-ger slender specimens [length more than 3.5 – 4 depths(=transdiameter sensu Kofoid & Swezy)] and T.robustum for shorter and stouter specimens. We

F. Gómez et al. 228


5/17

propose the separation of both species based on celllength, with Torodinium teredo (55 – 100 µm long)usually longer than T. robustum (40 – 75 µm long),and outline of the cells. The outline of T. teredo waslinear, with almost parallel margins, while the outlineof T. robustum was oblong, widened in the middle

(Figs 1 –

24). The hyposome and the bill-like projec-tion, the latter further described in detail, were moreconspicuous inT. teredo than inT. robustum . Fromthe pier of the Marine Station of Endoume, some recordscorresponded to larger and more slender specimens inagreement with the denition of T. teredo (Figs 1 – 6).Otherobservations corresponded to shorter specimenswith an oblong shape in agreement with our denitionof T. robustum (Figs7 – 11).One of the specimens of T.teredo showed an interesting morphological featurewith a kind of edging of crenate margin (with roundedteeth) that extended longitudinally in the episome(Fig. 1). Numerousspecimens were observed in Lugol-xedsamples collected from the open Mediterranean Sea,from Cyprus to the Gulf of Lions in summer 2008.Torodinium reachedanabundanceofupto64cellsl−1 .Several of these xed specimens showed posterior body extension in samples collected in the openwaters of the Sicily Strait, Algerian Basin and Gulf of Lions (Fig. 12).

One specimen was isolated from a sample collectedoff the Bay of Marseille at 55 m depth in July 2008(Fig. 13). This specimen, ascribed to T. robustum ,showed a prominent vacuole and a stouter cell body(Fig. 13). It was isolated for single-cell PCR analysis(isolated cell FG187, GenBank accession number KR139784).

Other specimens were observed in live samplesfrom Banyuls-sur-Mer (Figs 14 – 17). The presence of chlorophyll a was conrmed with epiuorescencemicroscopy (Fig. 16). The cell showed longitudinalchloroplasts along the antero-posterior axis in the dor-sal side. The chloroplasts were oblique or transversal inthe apex and the cingulum (Fig. 16). All the observed

specimens of Torodinium showed slow swimming andthe length of the longitudinal agellum was similar tothe cell length (Fig. 17; see video S1 as supplementaryinformation, https://youtu.be/Y7RPT-UdqeE). Fewspecimens were observed from samples collected at Villefranche-sur-Mer (Fig. 18). This was very likelydue to the inappropriate sampling using a coarse plank-ton net (53 µm mesh size) (Fig. 18). Torodinium teredoand T. robustum co-existed in the samples from the port of Valencia, with more frequent observations of T.robustum . Under light microscopy the episomes of T.robustum (Figs 19 – 23) and T. teredo (Fig. 24) were

covered by longitudinal ribs between the cingulum andthe basis of the apex. Both species showed an apicalgroove (named reversed terminal anterior loop of thesulcus sensu Kofoid & Swezy) that was hardly visiblein LM (Figs 23 – 24).

Emended generic description of Torodinium based onscanning electron microscopyThe detailed morphology was examined from speci-mens of Torodinium spp. collected from the south of Japan (Figs 25 – 50). We rst established the orienta-tion of the cells, whose ventral side was denedby the position of the sulcus and the pore of the longitudinal

agellum. The hyposome was small and conical. Theventral side of the hyposome was concave and occupied by the posterior end of the sulcus below the poreof the longitudinal agellum (Figs 25 – 28).

The sulcus extended for almost the entire ventralside of the hyposome, occupying about 1/3 of thecontour of the hyposome (Figs 28 – 29). The pore of the longitudinal agellum was located in the sulcus between the transversal agellar pore and the pos-terior end of the cingulum (Figs 25 – 30). The poster-ior end of the sulcus, directed posteriorly from thelongitudinal agellar pore, was placed in a wideconcave area surrounded by the cingulum and thehyposome in the left and right margins, respectively(Figs 26 – 27). The texture of the sulcus surface wasrugose, similar to the surface of the rest of the cell.Towards the episome and after the longitudinal

agellar pore, the sulcus became thinner andextended anteriorly describing a loop of about 1/6of the cell contour towards the dextral side(Figs 26 – 32). Anteriorly, from the longitudinal a-gellar pore, the anterior margin of the sulcus

showed an overhanging tube-like structure that separated it from the anterior extension of the cin-gulum (Figs 26 – 28, 33). We named this structurethe sulcal lip. The sulcus extended along the epi-some to end below the beginning of the apicalgroove (Fig. 34).

The transversal and longitudinal agellar poreswere separated by the sulcal lip (Fig. 26). The pore of the transversal agellum delimited the twosections of the cingulum. The transversal agellumencircled the posterior section of the cingulumabove the hyposome and the posterior end of thesulcus (Fig. 34). In contrast to the sulcus, the sur-face of the posterior cingulum was smooth andlacked any ornamentation (Figs 28, 34). The ante-rior section of the cingulum was thinner than the posterior one. The anterior cingulum continued par-allel to the anterior (left) margin of the sulcus,describing the same looping (Figs 28, 34). Theanterior extensions of the sulcus and cingulumwere separated by the sulcal lip from the agellar pore to the convex basis of the episome. The ante-rior cingulum diverged from the sulcal lip andshortly ended (Fig. 34).

Based on these observations, we established that the cell of T. teredo showed a circular transversalsection, whereas T. robustum was laterally compressed instead of dorsoventrally compressed as


https://youtu.be/Y7RPT-UdqeEhttps://youtu.be/Y7RPT-UdqeE


6/17

Figs 1 – 24. Light microscopy (LM) images of Torodinium teredo and T. robustum . Bright eld optics, except Fig. 16 by epi uor-escence microscopy. Figs 1 – 11. Specimens from Endoume, Marseille, France. Figs 1 – 6. T. teredo . Figs 7 – 11. T. robustum . Fig. 12.

(continued )



7/17

previously reported (Fig.28). Thetransdiameter sensuKofoid & Swezy corresponded to the cell depth (ven-tral to dorsal distance). Theepisome occupied about 9/ 10 of the cell length and ended in a hemispheric bonnet-shapedapex (Figs 27, 35 – 50). The cell surfaceof the episome was covered by well-marked longitu-

dinal ribs. There were 12 –

14 longitudinal ribs (~0.35µm wide) that were equidistant and separated by 3 – 4µm (Figs 35 – 50). In addition to the ribs, at least on thedextro-lateral side, the episome surface was coveredin ne longitudinal striae (Fig. 36). In addition to theanterior extensions of the sulcus and cingulum, theepisome showed a third groove. This deep grooveappeared in the middle of a concave area on thedextro-lateral side (Figs 33, 35, 38, 41). This concavearea was not observed in live cells and it could not beruled out that the depression of the deep groove wasdue to a sample preparation artefact. The anterior and posterior ends of this groove were different (Figs 33,35). The anterior one ended in a straight line betweentwo longitudinal ribs that converged at their anterior ends (Fig. 35). The posterior end of the groove waslocated above the distal end of the anterior cingulumand showed a short loop towards the left side(Figs28 – 33, 35). We were unable tond an analogousstructure in anyother dinoagellate.This straight deepgroove was named a ‘ slender canal, anterior pusule’ by Kofoid & Swezy (1921, p. 391). Following thisterminology, we named this groove the lateral canal.

The hemispherical apex showed unique morpholo-gical structures such as a spiral-shaped apical grooveand ribs that converged in a pointed projection(Figs 37 – 50). The posterior end of the apical groove began above the anterior end of the sulcus (Figs 39,55, 58). The apical groove continued below the basisof the pointed projection and took2.5 turns describingan anticlockwise spiral that ended in the dextro-lateralside, pointing to the lateral canal inT. teredo (Figs 42 – 45, 53).

The hemispherical apex showed a pointed projec-tion oriented towards the sinistro-lateral or dorsal

sides in T. teredo and T. robustum , respectively(Figs 27, 42 – 50, 53, 57). This structure was herenamed ‘ bill-like projection’ . Six or seven ribs comingfrom the basis of the apical groove converged fromeach side into the bill-like projection (Figs 27, 42 – 50).These transversal or oblique apical ribs were thinner and they were not connected with the prominent long-itudinal ribs on the episome. The most posterior apicalrib was placed above the apical groove (Figs 48 – 50,

53, 57). The rst apical rib emerged in the dextro-lateral side fromthe base of the apical groove. Eachribemerged at each side of the basis of the apical grooveand converged between the sinistro-lateral and dorsalsides. The last pair of apical ribs joined in a triangular structure (Figs 48, 53, 57).

Differences between T. teredo and T. robustumAs reported above, under light microscopy T. ter-edo was usually longer than T. robustum . Thelongitudinal outline of T. teredo was linear, withalmost parallel margins, a circular transversal sec-tion, a relatively large hyposome and a conspicu-ous bill-like projection. The longitudinal outline of T. robustum was oblong, widened in the middle,with an ellipsoidal transversal section, a smallhyposome and a less prominent bill-like projec-tion. Based on SEM, the transversal section wascircular (Figs 53 – 54) and ellipsoidal (Figs 57 – 58)in T. teredo and T. robustum , respectively.Torodinium teredo (Figs 27 – 29, 46 – 47, 51 – 52,54) showed a larger hyposome than T. robustum(Figs 28 – 34, 35, 38, 41, 55 – 56, 58). In T. teredo ,the proximal part of the anterior extension of thesulcus and cingulum extended transversallytowards the dextral side and then described amarked loop (Figs 52, 54). In contrast, in T. robus-tum the proximal part of the anterior extension of the sulcus and cingulum extended obliquelytowards the episome (Figs 55, 58). The anterior extension of the sulcus and cingulum was moredisplaced towards the dextral side in T. teredo thanin T. robustum (Figs 52, 54, 55, 58). Consequently,the proximal part of the anterior extension of thecingulum and sulcus were visible in ventral viewin T. robustum (Fig. 55) and in dorsal view in T.teredo (Fig. 52). In the apex of T. teredo , the bill-like projection was more conspicuous, overlyingthe episome, and oriented between the ventraland sinistro-lateral sides (Figs 45 – 50, 53). The

bill-like projection of T. robustum was morereduced, and oriented between the sinistro-lateraland dorsal sides (Figs 40 – 41, 57).

Morphology of Katodinium glaucumCells were spindle-shaped, tapering at both the apexand the antapex, and about 35 – 40 µm long andabout 14 – 22 µm wide (Figs 59 – 63). The cells

Lugol- xed specimen of T. robustum from the open Algerian Basin, western Mediterranean Sea (BOUM cruise, station #21). Thearrow points to the body extension. Fig. 13. T. robustum from the Gulf of Lions, isolated cell #FG187 (GenBank accession number KR139784). Figs 14 – 16. T. teredo from Gulf of Lions. Note the chloroplasts in epiuorescence microscopy. Fig. 17. T. robustumfrom Banyuls-sur-Mer. The arrow points to the longitudinalagellum.Fig. 18. Torodinium sp. from the Bay of Villefranche-sur-Mer,France.Figs 19 – 23. T. robustum from theport of Valencia, Spain.The arrowspoint to the longitudinal ribs.Fig. 24. T. teredo from the port of Valencia. The arrow indicates the apical groove. ag = apical groove. bp = bill-like projection. lf = longitudinal agellum. lr =longitudinal rib. Scale bars: 10 µm.

Figs 1 – 24. Continued



8/17

Figs 25 – 34. Scanning electron microscopy (SEM) images focused on the hyposome of ve specimens of Torodinium . Figs 25 – 27.Three specimens of T. teredo . Figs 28 – 34. Two specimens of T. robustum . The micrographs 29 – 34 correspond to the same specimen(also Figs 36 – 44). Fig. 25. Ventral view. Fig. 26. Ventro-antapical view. Fig. 27. Ventral view. Fig. 28. Antapical view. Fig. 29.Ventro-antapical view. Figs 30 – 31. Ventral view. Fig. 32. Dorsal view. Fig. 33. Dextro-lateral view. Fig. 34. Ventral-dextro-lateralview. ac = anterior cingulum. as = anterior sulcus. bp = bill-like projection. ci = cingulum. lc = lateral canal. lf = longitudinalagellum. lfp= longitudinalagellarpore. sl = sulcal lip. su = sulcus. tf = transversalagellum. tfp= transversalagellum pore. Scale

bar: 5 µm.



9/17

under division reached 55 –

60 µm long (Figs 64 –

66).The hyposome was about 1/4 of the cell length. Thedescending cingulum was displaced by three to four cingular widths (Figs 59 – 63). Cells lacked chloroplasts. Vacuoles and refractile bodies were observed

in the upper episome (Figs 59 –

62). Groups of tri-chocysts and some rod-shaped bodies were situatedalong the cell margin in the episome and the hypo-some (Figs 60 – 61). The nucleus was spherical andlocated in the posterior part of the episome at the

Figs 35 – 50. SEM focused on the hyposome of ve specimens of Torodinium . Figs 35 – 44. T. robustum . Micrographs 35 – 43correspond to the same specimen (also Figs 29 – 34). Figs 44 – 50. T. teredo . Fig. 35. Dextro-lateral view. Fig. 36. The arrows point to the longitudinal striae. Fig. 37. Apex. Fig. 38. Ventral view. Fig. 39. Apex. Figs 40 – 41. Dextro-lateral dorsal view. Figs 42 – 43.Apex. Fig. 44. Another specimen of T. robustum in apical view. Fig. 45. T. teredo in apical-dorsal view. Figs 46 – 48. Another specimen in dorsal view.Fig. 49. Another specimen in sinistro-lateral view.Fig. 50. Dorsal view. ag= apical groove. ar = apical rib.as= anterior sulcus. bp = bill-like projection. lc = lateral canal. lr = longitudinal rib. sl = sulcal lip. su = sulcus. Scale bar: 5 µm.



10/17

middle of the cell (Figs 59 – 62). A capsule sur-rounded the nucleus (Figs 60, 62). The proximalend of the cingulum was bifurcated, with a short anterior extension almost parallel to the cingulum

(Fig. 63). The cell surface showed longitudinal ribs,hard to see on the hyposome (Figs 63, 65). Under SEM, the proximal end of the cingulum was bifur-cated (Figs 71 – 72). The transverse agellumemerged from the posterior end of the bifurcation(Fig. 71). The anterior end of the bifurcationextended parallel to the cingulum. This structurecould be interpreted as an anterior extension of thecingulum. However, it could also be interpreted as anotch that invaded and dissected the proximal end of the cingulum (Fig. 71). The apex showed a tongue-shaped notch (Figs 69, 70 – 73). It was bordered bytwo longitudinal ribs, and contained ve other long-itudinal ribs that converged towards a pointed end inthe dorsal side (Figs 67 – 69, 73). From the ve long-itudinal ribs, the three central ones extended poster-iorly along the episome (Figs 69, 73 – 77). Thistongue-shaped notch extended over a horseshoe-shaped apical groove with the ends oriented towardsthe ventral side (Figs 69, 73). The cell surface of theepisome contained 24 equidistant longitudinal ribs(Figs 73, 77). Those longitudinal ribs ended at the basis of the apical groove, with the exception of three ribs that extended towards the pointed end of the tongue-shaped notch (Figs 73 – 74). The textureof the surface between the ribs was rugose, with twoor three transversal granules between each two ribs(Figs 73 – 74).

Molecular phylogenyWe obtained sequences of Torodinium from twosamples. One sample (#FG21) contained a mix of 20 specimens of T. teredo and T. robustum , col-lected from a pier at Marseille over ve days inDecember 2007 (Figs 1 – 11). PCR amplicationand cloning provided three almost complete SSUrDNA sequences (GenBank accession numbersKR139781, KR139782, KR139783). Thesesequences differed by 4 – 9 base pairs. The secondsample (#FG187) corresponded to a single speci-men of T. robustum collected from offshoreMarseille at 55 m depth (Fig. 13). Sample#FG187 was analysed by single-cell PCR and pro-vided an almost complete SSU rDNA sequence(GenBank accession number KR139784). Thesequences of T. robustum and the clones of Torodinium spp. were 99% identical and differed by 11 base pairs. The three clones of sample#FG21 have been assigned to T. teredo .

We examined the phylogenetic position of Torodinium spp. and Katodinium glaucum using adata set including a variety of dinoagellate SSUrDNA sequences. The Bayesian tree showed that allTorodinium spp. sequences branched in a well-supported clade [posterior probability (PP) of 0.99]together with several environmental sequences

(Fig. 78). The new sequence of T. robustum wasvery similar to two sequences of T. robustum fromthe NW Mediterranean Sea available in GenBank(KP790166 – 7) and an environmental clone(KJ762990) retrieved from California off San

51 52 53

54

55 56 57

58

lc

a c a s

b p

lc

a c

a s

c i

a g

a s

lc

ac

a s

lc

lc

bp

acas

s l

sl

ag

l c ci

su s u

ac

Figs 51 – 58. Line drawings of different views of Torodinium teredo (Figs 51 – 54) and T. robustum (Figs 55 – 58). Figs 51, 55. Ventralview.Figs 52, 56. Dorsal view.Figs 53, 57. Apical view.Figs 54, 58. Antapical view. ac = anterior cingulum. ag = apical groove; as =anterior sulcus. bp = bill-like projection. ci = cingulum. lc = lateral canal. sl = sulcal lip. su = sulcus.



11/17


12/17

Diego. The three clones assigned to T. teredo werecloser to an environmental clone (KJ759393) retrievedfromthe GulfStreamand formedthe sistergroup of thesequences of T. robustum . Two environmentalsequences retrieved from the under-ice waters of the North Pole (HQ438140, HQ438165) were basal to the

whole clade of Torodinium spp. All these sequencesformed a strongly supported clade (PP = 1) that wassister group of an environmental clone (KJ758208)retrieved from the Ross Sea, Antarctica (PP = 0.98).The three sequences of Katodinium glaucum availablein GenBank (KP790160 – 2) formed a lineage not clo-sely related to Torodinium spp. or to any other dino-agellate group. The sequences of Torodinium and

Katodinium glaucum branched within the large lineagecomprisingGymnodiniales, Peridiniales, Dinophysalesand Prorocentrales but with poor support, making it dif cult to infer the phylogenetic af nities of theseorders (Fig. 78).

75 76

77

n

v

ag

rsb

lf tf

tf

lr

Figs 75 – 77. Line drawings of different views of Katodinium glaucum . Fig. 75. Ventral view. Fig. 76. Sinistro-lateral view.Fig. 77. Apical view. ag = apical groove. lf = longitudinalagellum. lr = longitudinal rib. n = nucleus. rsb = rod-shaped

body. tf = transversal agellum. v = food vacuole.

Lebouridinium gen. nov.

Torodinium0.02

Katodinium glaucum KP790160

Akashiwo sanguinea AY421770

Chytriodinium roseum FJ663049

Uncultured marine dinoflagellate EF527103

Uncultured eukaryote KJ762990

Ankistrodinium semilunatum JQ179859

Pheopolykrikos beauchampii DQ371294

Azadinium spinosum FJ217814

Karenia bidigitata HM067002

Levanderina fissa AY421786

Woloszynskia pascheri EF058253

Gyrodinium fusiforme AB120002

Warnowia sp. FJ467492

Torodinium teredo FG21-2 KR139781

Gyrodinium dominans FN669510

Uncultured marine dinoflagellate JQ956286

Akashiwo sanguinea DQ779987

Polykrikos kofoidii DQ371291

Akashiwo sanguinea AJ415513

Gymnodinium sp. AF274260


Aduncodinium glandula LK934662

Togula britannica AY443010

Gymnodinium fuscum AF022194

Lepidodinium viride AF022199

Uncultured marine dinoflagellate AY664920

Uncultured marine dinoflagellate HQ438140

Pelagodinium bei U41087

Uncultured marine dinoflagellate HQ438165

Karenia brevis AF352818

Takayama cf. pulchellum AY800130

Woloszynskia halophila EF058252Polarella glacialis AY179607

Karenia papilionacea HM067005

Brachidinium capitatum HM066998

Gymnodinium dorsalisulcum LC054930

Gymnodinium aureolum AY999082

Ankistrodinium semilunatum AF274256

Bispinodinium angelaceum AB762397

Torodinium robustum FG187 KR139784


Gyrodinium helveticum AB120004

Prorocentrum micans AY585526

Azadinium trinitatum KJ481803


Dissodinium pseudolunula FJ473378

Levanderina fissa AF274261

Amphidinium herdmanii AF274253

Uncultured marine dinoflagellate KJ763303

Gymnodinium dorsalisulcum DQ837534


Apicoporus glaber EU293235

Cochlodinium polykrikoides EU418944

Karlodinium veneficum AF274262

Prorocentrum minimum DQ336072

Gymnodinium impudicum DQ779993

Uncultured marine dinoflagellate HM581765

Balechina pachydermata KR139791

Symbiodinium microadriaticum M88521

Takayama acrotrocha HM067010

Cucumeridinium lira KR139787

Cochlodinium sp. DQ915170

Torodinium robustum KP790166

Cucumeridinium coeruleum KR139785


Amphidinium corpulentum AF274252

Chytriodinium affine FJ473380

Torodinium robustum KP790167

Apicoporus parvidiaboli EU293238

Gyrodinium spirale AB120001

Polykrikos herdmaniae DQ975470

Ceratoperidinium falcatum KP790150

Karlodinium veneficum JN986577

Polykrikos hartmannii AY421789


0.98

0.76

0.970.89

0.89

1

0.98

0.86

0.64

0.98

1

0.94

1

0.84

0.98

1

0.97

0.9

0.97

0.99

0.9

0.92

0.76

1

0.73

0.73

0.96

0.8

0.98

0.83

0.74

1

0.96

0.79

0.85

1

0.85

1

0.98

0.71

0.9

0.88

0.94

0.76

0.93

0.77

1

0.89

0.74

0.99

1

0.97

0.95

0.78

0.54

0.88

0.88

Fig. 78. Bayesian phylogenetic tree of dinoagellate SSU rDNA sequences, based on 1584 aligned positions. Names in boldrepresent sequences obtained in this study. Numbers at nodes are posterior probabilities (values


13/17

Taxonomic descriptionDetailed study of the morphology of Katodinium glau-cum con rmedthat thisspecies is not related to the typespeciesof Katodinium, K. nieuportense . Molecular andmorphological data did not support a close relationshipof K. glaucum with Torodinium, Gyrodinium or anyother known dinoagellate genus. Therefore, a newgenus is proposed here for K. glaucum .

Lebouridinium F. Gómez, H. Takayama, D.Moreira & P. López- García, gen. nov. (Figs 59 – 77)DIAGNOSIS: Unarmoured spindle-shaped cells withthe hyposome about 1/4 of the cell length. The des-cending cingulum was displaced by three to four cingular widths. The cells were devoid of plastidsand the cell surface was covered with longitudinalribs. The apex contained a tongue-shaped notch pointed towards the dorsal side. The apical groovewas horseshoe-shaped and extended below the border of the tongue-shaped notch. The proximal end of thecingulum showed a bifurcation, alternatively interpreted as a short leftwards notch that transversallydivided the cingulum.ETYMOLOGY: In honour of M.V. Lebour who rst described the type species. The suf x ‘– dinium’ ,meaning ‘ vortex’ is commonly applied to dinoagel-lates. The gender is neuter.

TYPE SPECIES: Lebouridinium glaucum (M. Lebour) F.Gómez, H. Takayama, D. Moreira & P. López-García,gen. & comb. nov. See description above.BASIONYM: Spirodinium glaucum M. Lebour 1917 ( J. Mar. Biol. Ass. U.K . ser. 2, 11: 196, g. 13).SYNONYMS: Gyrodinium glaucum (M. Lebour) Kof. &Swezy 1921, p. 308, g. DD16, plate 9, g. 94; Massartia glauca (M. Lebour) J. Schiller 1933, p. 436,

g. 462; Katodinium glaucum (M. Lebour) A.R. Loebl.1965, p. 16 (non Gymnodinium glaucum W. Conrad1926, nec Gymnodinium glaucum J. Schiller 1955).

EPITYPE: Fig. 72.

DISCUSSIONComparison of Torodinium with previous descriptionsOur knowledge on the morphology of Torodinium hasremained almost unchanged since the original genericdescription. Kofoid & Swezy (1921) contributedgreatly to the understanding of the unarmoured dino-agellates from specimens collected in the summer of

1917 off San Diego, California. However, in numer-

ous cases Kofoid & Swezy proposed new species based on the observation of single or few specimens,consequently ignoring the potential intraspecic morphological variability. In addition, sometimes theyerroneously described life stages as new species

based exclusively on the illustrations from other authors (i.e. Gymnodinium fulgens Kof. & Swezy,Gyrodinium falcatum Kof. & Swezy). In the case of Torodinium , Kofoid & Swezy (1921, p. 390) reported‘ we have found only the stouter of these two species,Torodinium robustum , in which we include the rst

two of Schütt ’

s gures (1895, pl. 23, gs 74, 1 –

3)’

.Kofoid & Swezy (1921) described the genusTorodinium with T. teredo as type species, based onthe illustrations of Gymnodinium teredo in Schütt (1895). However, it is questionable to propose a newgenus and species with no personal observations of the type species. In that case, Kofoid & Swezy wereright and the SSU rDNA molecular phylogeny con-

rms that T. robustum and T. teredo are independent species (Fig. 78).

Unarmoured dinoagellates tend to showhighmor- phological variability, especially in the extension of the cell body (Gómez et al ., 2004, 2005). Thus, therelative elongation is a poor diagnostic criterion for species separation. Kofoid & Swezy (1921) estab-lished T. teredo for specimens with a length greater than 4 transdiameters, andless than 3.5 transdiametersfor T. robustum . The rst problem of this diagnosticcriterion is the discrimination of specimens with ratios between 3.5 and 4 length-transdiameter. In most recent literature, this has been solved by assigning toT. teredo specimens with cell length > 3× width(Steidinger & Tangen, 1997). The dif culty is toestablish where the dorsoventral or lateral sides are.Kofoid & Swezy (1921) erroneously used the termtransdiameter (= width) for the cell depth [i.e. thelength along the lateral sides (ventral to dorsaldistance)].

The distinction between the two species proposed by Kofoid & Swezy was not restricted toonly one morphometric character (length-depthratio). They added that T. robustum possessed anapex with the apical groove – reversed terminal api-cal loop of the sulcus, which was absent in T.teredo . It should be noted that apparently Kofoid

& Swezy (1921) did not examine specimens of T.teredo and this was based on Schütt ’ s illustrations.Kofoid & Swezy and later authors represented theapical groove of T. robustum as a looping of thesulcus in the apex, while the type species lackedthe apical groove (Figs 79 – 90). Elbrächter (1979)illustrated T. robustum with the apical groove as ananterior extension of the sulcus (Fig. 86), whichwas absent in T. teredo (Fig. 85). Torodiniumteredo and T. robustum are closely related in theSSU rDNA molecular phylogeny, so that theabsence of the apical groove in one of the species

would be very unusual. In contrast to previousstudies exclusively based on LM observations, wehave to consider that both Torodinium species may possess an apical groove which is independent of the sulcus (Figs 39, 44).



14/17

Kofoid & Swezy (1921) reported also that bothspecies of Torodinium lacked striae on the cellsurface. However, the surface of the episome iscovered with prominent longitudinal ribs as iseven revealed by light microscopy (Fig. 23).Some micrographs in the literature also showedthe ribs in the episome (Sournia, 1986; Gárate-Lizárraga & Muciño-Márquez, 2013). The pigmen-tation of Torodinium is another controversial mat-ter. Elbrächter (1979) reported that the chloroplasts

were greenish-yellow to pale brown for T. teredo ,and brown for T. robustum . In contrast, Steidinger & Tangen (1997) reported that the pigmentationwas brown and green for T. teredo and T. robus-tum , respectively. In our observations, some

specimens showed scarce pigmentation (Figs 2, 6,25), while it was greenish in others (Fig. 18). The

rst micrograph of Torodinium under epiuores-cence microscopy showed a specimen with fewlong longitudinal plastids restricted to the ventralside of the cell (Fig. 16).

The occurrence of three grooves in the episomeof Torodinium was not reported in previous stu-dies. The anterior extension of the cingulum isshort and it very probably went unnoticed in

studies based on light microscopy. An anterior extension of the cingulum has been reported insome species of Gymnodinium, Cochlodinium F.Schütt and Warnowia Lindemann (Takayama,1985, 1998). To the best of our knowledge,

tr. fl.gir.

hyp.long. fl.

gir.hyp.

sulc.

n.

rod.

epi.

hyp.gir.

sulc.

pus.

rod.

Cp

c

Rh

qF qG

79 82 8380

81

84

85 86 87 88

gir.

9089

Figs 79 – 90. Line drawings of Torodinium teredo and T. robustum in the literature. Fig. 79. Gymnodinium teredo redrawn fromPaulsen (1908). Figs 80 – 82. T. robustum redrawn from Kofoid & Swezy (1921). Fig. 80. Ventral view. Fig. 81. Dextro-lateral view.Fig. 82. Sinistro-lateral view. Fig. 83. T. teredo redrawn from Kofoid & Swezy (1921). Fig. 84. T. robustum redrawn from Lebour (1925). Fig. 85. T. teredo redrawn from Elbrächter (1979). Fig. 86. T. robustum redrawn from Elbrächter (1979). Fig. 87. T. robustumredrawn from Dodge (1982). Fig. 88. T. robustum redrawn from Sournia (1986).Fig. 89. T. robustum redrawn from Hansen& Larsen(1992). Fig. 90. T. teredo redrawn from Steidinger & Tangen (1997).



15/17

Torodinium is the only known genus with exten-sions of both sulcus and cingulum in the episome(Figs 35, 52). Another distinctive character of Torodinium is the sulcal lip (Figs 26 – 27). A ten-tatively analogous feature has been reported as atube-like structure in the genus Takayama deSalas, Bolch, L. Botes & Hallegr. (de Salaset al ., 2003).

Kofoid & Swezy (1921, p. 391) reported that ‘ From the anterior agellar pore there runs ante-riorly at the left of the nucleus a slender canal,the anterior pusule’ . The lateral canal was erro-

neously reported in further literature as reachingthe cingulum, reaching the anterior agellar poreor being confused with the sulcus (Figs 64 – 70).All previous studies have illustrated the lateralcanal in contact with the cingulum (Lebour, 1925;

Elbrächter, 1979; Dodge, 1982; Sournia, 1986).Kofoid & Swezy denoted the lateral canal as a pusule (Fig. 63). Several functions have been attrib-uted to the dinoagellate pusule, including theincorporation of particles (Klut et al ., 1987). Thedistribution of Torodinium in oligotrophic surfaceoceanic waters, the scarce chloroplasts, the presenceof food vacuoles and the body extension suggest that Torodinium is indeed able to ingest particulatematter (Gómez, 2009). We have not yet observedthe mechanism of prey capture and ingestion. The body extension was noticed only in specimens that

were

xed immediately after collection (Gómez,2009; Fig. 12). During observations of live speci-mens the body extension could be retracted due tomanipulation stress. The projection of a body exten-sion from the hyposome is a feature known in other

9491 92 95

96

98 99 100

97

93

Figs 91 – 100. Line drawings of Katodinium nieuportense, Lebouridinium glaucum, Gymnodinium vesti cii and Amphidiniumextensum . Fig. 91. Katodinium nieuportense redrawn from Conrad (1926). Fig. 92. Spirodinium glaucum redrawn from Lebour (1917). Fig. 93. Gyrodinium glaucum redrawn from Lebour (1925). Fig. 94. G. glaucum redrawn from Kofoid & Swezy (1921).Fig. 95. K. glaucum redrawn fromElbrächter (1979).Fig. 96. Gyrodinium glaucum redrawn from Dodge (1982).Fig. 97. K. glaucumredrawn from Steidinger & Tangen (1997). Fig. 98. Gymnodinium vesti cii redrawn from Paulsen (1908). Fig. 99. G. vesti ciiredrawn from Kofoid & Swezy (1921). Fig. 100. Amphidinium extensum redrawn from Lebour (1925).



16/17

gymnodinioid dinoagellates (Persson et al ., 2013).Gymnodinioid dinoagellates typically ingest their prey by direct engulfment through the sulcal area inthe hyposome [e.g. Gyrodinium spirale (Bergh)Kof. & Swezy; Hansen, 1992]. However,Torodinium has a minute hyposome and posterior

sulcus, probably insuf cient for the ingestion of large prey. The lateral canal is a structure unknownin any other dinoagellate and its function remainsuncertain. It can be hypothesized that the bodyextension that emerged from the hyposome mayfacilitate prey capture and the subsequent ingestionthrough the lateral canal (Figs 33, 35).

The apex of Torodinium is also highly distinctive.Schütt (1895) illustrated a group of plastids around acentral plastid or oil globule forming a star of eight or nine rays, further re-drawn by other authors (Figs 60,63 – 65). This unusual star-shaped distribution of the plastids coincides with the apical ribs that form the bill-like projection (Fig. 48). In one of the earliest dino agellate studies, Schütt (1895) was probablyconfusing the apical ribs with plastids. The functionof the bill-like projection is unknown.

Previous observations of LebouridiniumOur observations of Lebouridinium glaucum unequi-vocally correspond to the taxon described asSpirodinium glaucum by Lebour (1917, 1925)(Figs 92 – 93). However, L. glaucum have beenreportedearlier in the literature because it is a commonspecies (Lebour, 1917). Schütt (1895) describedGymnodinium vesti cii F. Schütt with a larger epi-some, lacking the surface striae and with an intrusionof the sulcus into the episome (Fig. 98). Later, Kofoid& Swezy (1921), in the absence of personal observa-tions, added surface striations to the illustration of G.vesti cii (Fig.99).Lebour (1925, p.50) reportedonG.vesti cii ‘ This species is not suf ciently dened, but bears so strong a resemblance toGyrodinium glaucumif turnedupsidedownthat one does not feel justiedin

regarding it as a Gymnodinium until the

agella have been described’ . Even assuming that the orientation of G. vesti cii was turned upside down and it is coveredwith surface striations, the prominent anterior exten-sion of the sulcus and the low cingular displacement do not indicate L. glaucum. Amphidinium extensum A.Wulff was described from four illustrations in dorsalview, lacking information on the sulcus or agella(Lebour, 1925) (Fig. 100). Due to the poor descrip-tions,itisdif cult to determine whether G. vesti cii or A. extensum corresponded to the earlier observationsof L. glaucum and, consequently, if any of these taxa

have priority versus Spirodinium glaucum .Kofoid & Swezy (1921) and Elbrächter (1979)illustrated Lebouridinium glaucum with an intrusionof the sulcus in the episome (Figs 94 – 95). However,we did not observe that feature (Figs 75 – 76). We

observed by light and scanning electron microscopy(Figs 63, 71 – 72) that the proximal end of the cingu-lum showed a short bifurcation or, alternatively, aleftwards notch that transversally divided the cingu-lum (Figs 75 – 76). This feature was not reported in theliterature. The tongue-shaped notch (Figs 94 – 95) was

rst reported by Takayama (1985, 1998; Fig. 97).

Evolutionary af nities of LebouridiniumThe morphology of Lebouridinium glaucum is verydifferent from the type of Katodinium, K. nieupor-tense (Fig. 91), an insuf ciently described speciesthat is only known from the original description(Conrad, 1926). Some morphological features suchas the cingular displacement, longitudinal ribs, tricho-cysts, rod-shaped and refractile bodies and a capsulethat surrounded the spherical nucleus resemble thetype of Gyrodinium (Hansen & Daugbjerg, 2004;Takano & Horiguchi, 2004). However, other featuressuch as the apical groove, tongue-shaped notch or thecingular structure, as well as the molecular data, donot support a relationship between Lebouridinium andGyrodinium (Fig. 78; Kim & Kim, 2007). Since theearlier studies, the small hyposome of L. glaucuminvited consideration of a relationship withTorodinium (Lebour, 1917; Kofoid & Swezy, 1921).Reñé et al . (2015) reported that Torodinium robustumand L. glaucum branched together in the SSU rDNA

phylogenetic analysis, although with weak statisticalsupport (bootstrap value < 80%). In our SSU rDNA phylogeny, including more sequences of Torodiniumand environmental clones, we did not nd a relation-ship between Torodinium spp. and L. glaucum(Fig. 78). The detailed study of the morphology of Torodinium and Lebouridinium does not reveal simi-larities in the distinctive diagnostic characters between the two genera. Morphological featuressuch as the reduced hyposome or the cell surfacecovered with longitudinal ribs are common charactersin the unarmoured dinoagellates (Takano &

Horiguchi, 2004; Gómez et al ., 2015).

DISCLOSURE STATEMENT No potential conict of interest was reported by theauthor(s).

FUNDINGF.G. is supported by the Brazilian Conselho Nacional deDesenvolvimento Cientíco e Tecnológico (grant number BJT 370646/2013 – 14). We acknowledgenancial support from the French CNRS, the European Research Councilunder the European Union’ s Seventh Framework ProgramERC Grant Agreement 322669 ‘ ProtistWorld’ , and Ile deFrance (SESAME project 13016398 ‘ Unicell’ ).



17/17

AUTHOR CONTRIBUTIONSF. Gómez: collection, isolation, light microscopy and drafting;H. Takayama: collection, isolation, light and electron micro-scopy; P. López-García: molecular analysis; D. Moreira: phy-logenetic analysis.

REFERENCESCalado, A.J. (2011). On the identity of the freshwater dinoagellate

Glenodinium edax , witha discussiononthe generaTyrannodiniumand Katodinium , and the description of Opisthoaulax gen. nov. Phycologia , 50: 641 – 649.

Conrad, W. (1926). Recherches sur les agellates de nos eauxsaumâtres. 1e partie: dinoagellates. Archiv für Protistenkunde ,55: 63 – 100.

Daugbjerg, N., Hansen, G., Larsen, J. & Moestrup, Ø. (2000).Phylogeny of some of the major genera of dinoagellates basedon ultrastructure and partial LSU rDNA sequence data, includingthe erection of three new genera of unarmoured dinoagellates. Phycologia , 39: 302 – 317.

De Salas, M.F., Bolch, C.J.S., Botes, L., Nash, G., Wright, S.W. &Hallegraeff, G.M. (2003). Takayama gen. nov. (Gymnodiniales,

Dinophyceae), a new genus of unarmoured dinoagellates withsigmoid apical grooves, including the description of two newspecies. Journal of Phycology , 39: 1233 – 1246.

Dodge, J.D. (1982). Marine dino agellates of the British Isles . Her Majesty’ s Stationery Of ce, London.

Edgar, R.C. (2004). MUSCLE: multiple sequence alignment withhigh accuracy and high throughput. Nucleic Acids Research , 32:1792 – 1797.

Elbrächter, M. (1979). On the taxonomy of unarmoured dinophytes(Dinophyta) from the Northwest African upwelling region.“ Meteor ” Forschungs-Ergebnisse , Reihe D , 31: 1 – 22.

Gárate-Lizárraga, I. & Muciño-Márquez, R.E. (2013). New data onthe distribution of Torodinium robustum and T. teredo(Dinophyceae: Gymnodiniales) in the Gulf of California. Check List , 9: 809 – 812.

Gómez, F. (2009). Torodinium and Pavillardia (Gymnodiniales,Dinophyceae): two unarmoured dinoagellates with a body exten-sion, collectedfrom theopenPacic Ocean. Protistology , 6:131 – 135.

Gómez, F., Nagahama, Y., Fukuyo, Y. & Furuya, K. (2004).Observations on Ceratoperidinium (Dinophyceae). Phycologia ,43: 416 – 421.

Gómez, F., Nagahama, Y., Takayama, H. & Furuya, K. (2005). Is Karenia a synonym of Asterodinium – Brachidinium ? (Gymno-diniales, Dinophyceae). Acta Botanica Croatica , 64: 263 – 274.

Gómez, F., López-García, P., Takayama, H. & Moreira, D. (2015). Balechina and the new genus Cucumeridinium gen. nov.(Dinophyceae), unarmoured dinoagellates with thick cell cover-ings. Journal of Phycology 51: 1088 – 1105.

Hansen, G. (1995). Analysis of the thecal plate pattern in the dino-

agellate Heterocapsa rotundata (Lohmann) comb. nov.(= Katodinium rotundatum (Lohmann) Loeblich). Phycologia ,34: 166 – 170.

Hansen, G.& Larsen, J. (1992). Dino agellateri danskefarvande. In Plankton i de indre danske farvande (Thomsen, H.A., editor), 45 – 155. Havforskning fra Miljøstyrelsen, n. 11, Copenhagen.

Hansen, G. & Daugbjerg, N. (2004). Ultrastructure of Gyrodinium spirale , the type species of Gyrodinium (Dinophyceae), includinga phylogeny of G. dominans, G. rubrum and G. spirale deducedfrom partial LSU rDNA sequences. Protist , 155: 271 – 294.

Hansen, P.J. (1992). Prey size selection, feeding rates and growthdynamics of heterotrophic dinoagellates with special emphasison Gyrodinium spirale . Marine Biology , 114: 327 – 334.

Kang, N.S., Jeong, H.J., Moestrup, Ø., Jang, T.Y., Lee, S.Y. & Lee,M.J. (2015). Aduncodinium gen. nov. and A. glandula comb. nov.

(Dinophyceae, Pesteriaceae), from coastal waters off Korea: morphology and molecular characterization. Harmful Algae , 41: 25 – 37.

Kim, K.-Y. & Kim, C.-H. (2007). Phylogenetic relationships amongdiverse dinoagellate species occurring in coastal waters off Koreainferred from large subunit ribosomal DNA sequence data. Algae ,22: 57 – 67.

Klut, M.E., Bisalputra, T. & Antia, N.J. (1987). Some observationson the structure and function of the dinoagellate pusule.Canadian Journal of Botany , 65: 736 – 744.

Kofoid, C.A. & Swezy, O. (1921). The free-living unarmouredDino agellata. Memoirs of the University of California , 5: 1 – 562.

Lebour, M.V. (1917). The Peridiniales of Plymouth Sound from theregion beyond the breakwater. Journal of the Marine Biological Association, Plymouth , 11: 183 – 200.

Lebour, M.V. (1925). The Dino agellates of Northern Seas . MarineBiological Association of the United Kingdom, Plymouth.

López-García, P., Rodríguez-Valera, F., Pedrós-Alió, C. & Moreira,D. (2001). Unexpected diversity of small eukaryotes in deep-seaAntarctic plankton. Nature , 409: 603 – 607.

Murray, S., de Salas, M., Luong-Van, J. & Hallegraeff, G. (2007).Phylogenetic study of Gymnodinium dorsalisulcum comb. nov.from tropical Australian coastal waters (Dinophyceae). Phycological Research , 55: 176 – 184.

Paulsen, O. (1908). Peridiniales. In Nordisches Plankton (Brandt,K. & Apstein, C., editors), 1 – 124. Lepsius & Tischer, Leipzig.

Persson, A., Smith, B.C., Morton, S., Shuler A. & Wikfors, G.H. (2013). Sexual life stages and temperature dependent morpho-logical changes allow cryptic occurrence of the Florida red tidedino agellate Karenia brevis . Harmful Algae , 30: 1 – 9.

Philippe, H. (1993). MUST, a computer package of management utilities for sequences and trees. Nucleic Acids Research , 21:5264 – 5272.

Pouchet, G. (1885). Nouvelle contribution á l´histoire desPéridiniens marins. Journal de l´Anatomie et de la Physiologie Normale et Pathologique de l´Homme et des Animaux, Paris ,21: 28 – 88.

Reñé, A., Camp, J. & Garcés, E. (2015). Diversity and phylogeny of

Gymnodiniales (Dinophyceae) from the NW Mediterranean Searevealed by a morphological and molecular approach. Protist , 166:234 – 263.

Ronquist, F., Teslenko, M., van der Mark, P., Ayres, D.L., Darling,A., Höhna, S., Larget, B., Liu, L., Suchard, M.A. & Huelsenbeck,J.P. (2012). MrBayes 3.2: ef cient Bayesian phylogenetic infer-ence and model choice across a large model space. Systematics Biology, 61: 539 – 542.

Saitou, N. & Nei, M. (1987). The neighbor-joining method: a newmethod for reconstructing phylogenetic trees. Molecular Biologyand Evolution , 4: 406 – 425.

Schütt, F. (1895). Die Peridinien der Plankton-Expedition. Ergebnisse der Plankton-Expedition der Humboldt-Stiftung , 4:1 – 170.

Sournia, A. (1986). Atlas du phytoplancton marin . Volume I:Cyanophycées, Dictyophycées, Dinophycées, Raphidophycées .Éditions du CNRS, Paris.

Steidinger, K.A. & Tangen, K. (1997). Dino agellates. In Identifying Marine Phytoplankton (Tomas, C.R., editor), 387 – 598. Academic Press, San Diego, CA.

Takano, Y. & Horiguchi, T. (2004). Surface ultrastructure and mole-cular phylogenetics of four unarmored heterotrophic dinoagel-lates, including the type species of the genus Gyrodinium(Dinophyceae). Phycological Research , 52: 107 – 116.

Takayama, H. (1985). Apical grooves of unarmored dinoagellates. Bulletin of the Plankton Society of Japan , 32: 129 – 137.

Takayama, H. (1998). Morphological and taxonomical studies onthe free-living unarmored dino agellates occurring in the Seto Inland Sea and adjacent waters . Ph.D. dissertation, TheUniversity of Tokyo, Tokyo.

http://-/?-http://-/?-

GomUnarmoured dinoflagellates with a small hyposome: Torodinium and Lebouridinium gen. nov. for...

Documents

Transcript of GomUnarmoured dinoflagellates with a small hyposome: Torodinium and Lebouridinium gen. nov. for...