GMI: Global Microbial Identifier - Home: OIE · GMI: Global Microbial Identifier The future of...
-
Upload
truongkhuong -
Category
Documents
-
view
226 -
download
1
Transcript of GMI: Global Microbial Identifier - Home: OIE · GMI: Global Microbial Identifier The future of...
![Page 1: GMI: Global Microbial Identifier - Home: OIE · GMI: Global Microbial Identifier The future of microbiology: Identification and Surveillance will merge ... 3 DTU Management Engineering](https://reader031.fdocuments.net/reader031/viewer/2022021717/5b371d5c7f8b9a310e8bdae8/html5/thumbnails/1.jpg)
GMI: Global Microbial Identifier
The future of microbiology:
Identification and Surveillance will merge
through the use of Whole Genome Sequencing (WGS)
Jørgen Schlundt
Professor Technical University of Denmark
![Page 2: GMI: Global Microbial Identifier - Home: OIE · GMI: Global Microbial Identifier The future of microbiology: Identification and Surveillance will merge ... 3 DTU Management Engineering](https://reader031.fdocuments.net/reader031/viewer/2022021717/5b371d5c7f8b9a310e8bdae8/html5/thumbnails/2.jpg)
10. oktober 2014
Add Presentation Title in Footer via ”Insert”; ”Header & Footer”
"There is a pathway from good science to publication to evidence, and to programs that work.
In this way research becomes an inherent part of problem-solving and policy implementation"
Julio Frenk
Former Mexican Minister of Health
Dean, Harvard School of Public Health
DTU Management Engineering 2 15.10.2014
![Page 3: GMI: Global Microbial Identifier - Home: OIE · GMI: Global Microbial Identifier The future of microbiology: Identification and Surveillance will merge ... 3 DTU Management Engineering](https://reader031.fdocuments.net/reader031/viewer/2022021717/5b371d5c7f8b9a310e8bdae8/html5/thumbnails/3.jpg)
10. oktober 2014
Add Presentation Title in Footer via ”Insert”; ”Header & Footer”
Detection and surveillance forms the backbone of systems to control, treat and prevent infectious diseases - in animal and man - worldwide
However, surveillance is still typically targeted at a limited number of specified diseases
- and there is a very significant global disparity in national disease detection systems and methodology between nations
Animal and public health efforts (and animal and food export from developing countries) are hampered by lack of diagnostic capacities
Thus, we have a HEALTH, ANIMAL HEALTH and ECONOMIC problem
Do we have problems to solve
DTU Management Engineering 3 15.10.2014
![Page 4: GMI: Global Microbial Identifier - Home: OIE · GMI: Global Microbial Identifier The future of microbiology: Identification and Surveillance will merge ... 3 DTU Management Engineering](https://reader031.fdocuments.net/reader031/viewer/2022021717/5b371d5c7f8b9a310e8bdae8/html5/thumbnails/4.jpg)
10. oktober 2014
Add Presentation Title in Footer via ”Insert”; ”Header & Footer”
History
1977 2003 1953 1970
1980
1990 2004
454 starts the next generation
sequencing era
New Opportunities ?
DTU Management Engineering 4 15.10.2014
![Page 5: GMI: Global Microbial Identifier - Home: OIE · GMI: Global Microbial Identifier The future of microbiology: Identification and Surveillance will merge ... 3 DTU Management Engineering](https://reader031.fdocuments.net/reader031/viewer/2022021717/5b371d5c7f8b9a310e8bdae8/html5/thumbnails/5.jpg)
10. oktober 2014
Add Presentation Title in Footer via ”Insert”; ”Header & Footer”
History 2004
Next Generation Sequencing
454 Life Sciences: Parallelized pyrosequencing
Reduced costs 6 fold at the time – now much cheaper DTU Management Engineering 5 15.10.2014
![Page 6: GMI: Global Microbial Identifier - Home: OIE · GMI: Global Microbial Identifier The future of microbiology: Identification and Surveillance will merge ... 3 DTU Management Engineering](https://reader031.fdocuments.net/reader031/viewer/2022021717/5b371d5c7f8b9a310e8bdae8/html5/thumbnails/6.jpg)
10. oktober 2014
Add Presentation Title in Footer via ”Insert”; ”Header & Footer”
History
2004
Next Generation Sequencing
DTU Management Engineering 6 15.10.2014
![Page 7: GMI: Global Microbial Identifier - Home: OIE · GMI: Global Microbial Identifier The future of microbiology: Identification and Surveillance will merge ... 3 DTU Management Engineering](https://reader031.fdocuments.net/reader031/viewer/2022021717/5b371d5c7f8b9a310e8bdae8/html5/thumbnails/7.jpg)
10. oktober 2014
Add Presentation Title in Footer via ”Insert”; ”Header & Footer”
Paradigm Shift from Pasteur to Watson
“It is likely that in 5 to 10 years all clinical microbiological laboratories will have a DNA sequencer in use - the costs for a complete bacterial genome sequence might be less than 50 EURO (or US$).
The capacity to exchange – and manage - large data quantities over web-based systems has likewise increased dramatically over recent years
Enabling the potential creation of global databases consisting of DNA-codes of all relevant microbiological strains”
Statement from international expert meeting on microbiological genomic identification systems 1-2 September 2011 in Bruxelles, Belgium.
DTU Management Engineering 7 15.10.2014
![Page 8: GMI: Global Microbial Identifier - Home: OIE · GMI: Global Microbial Identifier The future of microbiology: Identification and Surveillance will merge ... 3 DTU Management Engineering](https://reader031.fdocuments.net/reader031/viewer/2022021717/5b371d5c7f8b9a310e8bdae8/html5/thumbnails/8.jpg)
10. oktober 2014
Add Presentation Title in Footer via ”Insert”; ”Header & Footer”
Passing Past Pasteur
•Old school
–One to several weeks to perform full typing
–Very different typing systems for microorganisms
–Very specialized knowledge base for different microorganisms
•New school
–Hours (presently 12-24) to perform full sequencing – minutes to get typing result
–One test fits all (virus, bacteria, fungi,parasites)
–Same-Same for all microbiology (human, animal, environment)
DTU Management Engineering 8 15.10.2014
![Page 9: GMI: Global Microbial Identifier - Home: OIE · GMI: Global Microbial Identifier The future of microbiology: Identification and Surveillance will merge ... 3 DTU Management Engineering](https://reader031.fdocuments.net/reader031/viewer/2022021717/5b371d5c7f8b9a310e8bdae8/html5/thumbnails/9.jpg)
10. oktober 2014
Add Presentation Title in Footer via ”Insert”; ”Header & Footer”
Whole Genome Sequencing advantages:
A single technique simplifying and facilitating collaboration and data comparison
between animals, food and humans (One Health)
between countries
between fields of research
A generic outcome (sequence) enabling comparisons where not possible before
DTU Management Engineering 9 15.10.2014
![Page 10: GMI: Global Microbial Identifier - Home: OIE · GMI: Global Microbial Identifier The future of microbiology: Identification and Surveillance will merge ... 3 DTU Management Engineering](https://reader031.fdocuments.net/reader031/viewer/2022021717/5b371d5c7f8b9a310e8bdae8/html5/thumbnails/10.jpg)
10. oktober 2014
Add Presentation Title in Footer via ”Insert”; ”Header & Footer”
Whole Genome Sequencing advantages:
Diagnosis and Treatment of infectious diseases will be dramatically improved
Outbreak investigation will improve
Surveillance and Prevention will improve
Microbiological Research improved
DTU Management Engineering 10 15.10.2014
![Page 11: GMI: Global Microbial Identifier - Home: OIE · GMI: Global Microbial Identifier The future of microbiology: Identification and Surveillance will merge ... 3 DTU Management Engineering](https://reader031.fdocuments.net/reader031/viewer/2022021717/5b371d5c7f8b9a310e8bdae8/html5/thumbnails/11.jpg)
10. oktober 2014
Add Presentation Title in Footer via ”Insert”; ”Header & Footer”
Global Microbial Identifier
A global system enables two lines of action:
•Simple identification of all microorganisms (and resistance), enabling reduction in time and cost for a more correct characterization
•A DNA database of all microbiological strains globally, enabling real-time global (and national) surveillance of disease and pathogen developments as well as AMR
DTU Management Engineering 11 15.10.2014
![Page 12: GMI: Global Microbial Identifier - Home: OIE · GMI: Global Microbial Identifier The future of microbiology: Identification and Surveillance will merge ... 3 DTU Management Engineering](https://reader031.fdocuments.net/reader031/viewer/2022021717/5b371d5c7f8b9a310e8bdae8/html5/thumbnails/12.jpg)
10. oktober 2014
Add Presentation Title in Footer via ”Insert”; ”Header & Footer”
Describing Landscape Creating Roadmap
Growing
the
network
agtcagtcacagtacaagtcagtcacagtacaagtca gtcaca gtaca
I ---
-
Database(s) in the Cloud
Diagnosis
Whole Genome Sequencing
Patient
, Food & Disease Surveillance
Global Prevention
GMI – The idea
DTU Management Engineering 12 15.10.2014
![Page 13: GMI: Global Microbial Identifier - Home: OIE · GMI: Global Microbial Identifier The future of microbiology: Identification and Surveillance will merge ... 3 DTU Management Engineering](https://reader031.fdocuments.net/reader031/viewer/2022021717/5b371d5c7f8b9a310e8bdae8/html5/thumbnails/13.jpg)
10. oktober 2014
Add Presentation Title in Footer via ”Insert”; ”Header & Footer”
America
(NCBI)
Europe
(EBI)
Asia
(DDBJ)
4 TeraBytes
Inbound Daily
Is something happening already?
All publicly available DNA sequence data
deposited in the International Collaboration
24 Hour
Exchange
DTU Management Engineering 13 15.10.2014
![Page 14: GMI: Global Microbial Identifier - Home: OIE · GMI: Global Microbial Identifier The future of microbiology: Identification and Surveillance will merge ... 3 DTU Management Engineering](https://reader031.fdocuments.net/reader031/viewer/2022021717/5b371d5c7f8b9a310e8bdae8/html5/thumbnails/14.jpg)
10. oktober 2014
Add Presentation Title in Footer via ”Insert”; ”Header & Footer”
Go Global •The necessary research will contribute to the shift from traditional biological characterization systems to “Bio- Informatics” where genetic characteristics can be viewed holistically
•This will likely contribute to build bridges between separate research areas (clinical microbiology, lab science, epidemiology, risk assessment, systemic and food microbiology)
And we have the potential to go global
DTU Management Engineering 14 15.10.2014
![Page 15: GMI: Global Microbial Identifier - Home: OIE · GMI: Global Microbial Identifier The future of microbiology: Identification and Surveillance will merge ... 3 DTU Management Engineering](https://reader031.fdocuments.net/reader031/viewer/2022021717/5b371d5c7f8b9a310e8bdae8/html5/thumbnails/15.jpg)
10. oktober 2014
Add Presentation Title in Footer via ”Insert”; ”Header & Footer”
And why soon ?
•Different researchers and different sectors are already starting to build separate databases with separate interphases and algorithms
•If too many separate / different systems are built it will be increasingly difficult to agree to common format and common understanding
•And we will – again –
leave developing countries behind
DTU Management Engineering 15 15.10.2014
![Page 16: GMI: Global Microbial Identifier - Home: OIE · GMI: Global Microbial Identifier The future of microbiology: Identification and Surveillance will merge ... 3 DTU Management Engineering](https://reader031.fdocuments.net/reader031/viewer/2022021717/5b371d5c7f8b9a310e8bdae8/html5/thumbnails/16.jpg)
10. oktober 2014
Add Presentation Title in Footer via ”Insert”; ”Header & Footer”
NGS leap-frog potential
in developing countries:
A dramatic potential to improve animal & public health in developing countries
Current diagnostic methods are diverse and require specialized training
NGS is a simple one-size-fits-all tool for diagnosis of all infectious diseases
New Lab systems need not be separate
Microbio- and Epidemiologist work together
DTU Management Engineering 16 15.10.2014
![Page 17: GMI: Global Microbial Identifier - Home: OIE · GMI: Global Microbial Identifier The future of microbiology: Identification and Surveillance will merge ... 3 DTU Management Engineering](https://reader031.fdocuments.net/reader031/viewer/2022021717/5b371d5c7f8b9a310e8bdae8/html5/thumbnails/17.jpg)
10. oktober 2014
Add Presentation Title in Footer via ”Insert”; ”Header & Footer”
NGS leap-frog potential
in developing countries:
At the systemic level use of NGS enable uniform lab-, reporting- and surveillance- systems
Same detection systems for microorganisms from humans & animals - a true ‘One Health’
Developing new diagnostic systems simplified
-with real-time char. of microorganisms
-in decentralized labs with sequencers + internet
(did you say mobile phones would not work in Africa?) DTU Management Engineering 17 15.10.2014
![Page 18: GMI: Global Microbial Identifier - Home: OIE · GMI: Global Microbial Identifier The future of microbiology: Identification and Surveillance will merge ... 3 DTU Management Engineering](https://reader031.fdocuments.net/reader031/viewer/2022021717/5b371d5c7f8b9a310e8bdae8/html5/thumbnails/18.jpg)
10. oktober 2014
Add Presentation Title in Footer via ”Insert”; ”Header & Footer”
Virus – Bacteria – Parasites Same - Same
www.globalmicrobialidentifier.org
DTU Management Engineering 18 15.10.2014
![Page 19: GMI: Global Microbial Identifier - Home: OIE · GMI: Global Microbial Identifier The future of microbiology: Identification and Surveillance will merge ... 3 DTU Management Engineering](https://reader031.fdocuments.net/reader031/viewer/2022021717/5b371d5c7f8b9a310e8bdae8/html5/thumbnails/19.jpg)
10. oktober 2014
Add Presentation Title in Footer via ”Insert”; ”Header & Footer”
Open source – with problems
Building a global system sharing often sensitive data will create barriers, …. willingness of sharing sequence data and metadata. Sequence data-bases need to have open access to serve as an early warning system…
It should be realized that sequence data might also be attractive for any industry – However, important privacy issues concerning data mining potential clearly exist.
From: 1st international expert meeting on microbiological genomic identification systems Sep. 2011 Brussels, Belgium.
GMI 1 Meeting
DTU Management Engineering 19 15.10.2014
![Page 20: GMI: Global Microbial Identifier - Home: OIE · GMI: Global Microbial Identifier The future of microbiology: Identification and Surveillance will merge ... 3 DTU Management Engineering](https://reader031.fdocuments.net/reader031/viewer/2022021717/5b371d5c7f8b9a310e8bdae8/html5/thumbnails/20.jpg)
10. oktober 2014
Add Presentation Title in Footer via ”Insert”; ”Header & Footer”
Refusing global sharing – why?
• Concerns about national security and safety
• Institutional and management barriers
• Economic risks and IP-rights; financial barriers
• Socio-cultural and normative differences between populations
• Restrictive national regulations and laws
• Commercial confidentiality and Corporate protection
• Outbreak situation, data not public because potential for prosecution
• Who is the owner of the data – company, authority, laboratory?
• How to share when only part of the data (food / human / animal / ?)
• Potential for misuse by competitors (trade)
• Potential for misuse by others (drugs, diagnostic methods, vaccines)
• Fears of sharing with countries with different legal frameworks
• Freedom of information act (USA) – or similar legislation
GMI 7 Meeting
DTU Management Engineering 20 15.10.2014
![Page 21: GMI: Global Microbial Identifier - Home: OIE · GMI: Global Microbial Identifier The future of microbiology: Identification and Surveillance will merge ... 3 DTU Management Engineering](https://reader031.fdocuments.net/reader031/viewer/2022021717/5b371d5c7f8b9a310e8bdae8/html5/thumbnails/21.jpg)
10. oktober 2014
Add Presentation Title in Footer via ”Insert”; ”Header & Footer”
Moving on: GMI 5, Copenhagen, Feb 2013 Preparing a Road Map GMI 6, California, Sep 2013 Agreeing a Charter GMI 7, York UK, Sep 2014 Constructing an Organization GMI 8, Beijing, May 2015 ? Analyzing the Landscape
DTU Management Engineering 21 15.10.2014
![Page 22: GMI: Global Microbial Identifier - Home: OIE · GMI: Global Microbial Identifier The future of microbiology: Identification and Surveillance will merge ... 3 DTU Management Engineering](https://reader031.fdocuments.net/reader031/viewer/2022021717/5b371d5c7f8b9a310e8bdae8/html5/thumbnails/22.jpg)
10. oktober 2014
Add Presentation Title in Footer via ”Insert”; ”Header & Footer”
GMI Structure
Steering Committee
Five Working Groups:
WG1: Polical challenges, outreach, network
WG2: Repository of sequences and meta-data
WG3: Analytical approaches
WG4: Ring trials and quality assurance
WG5: Pilot Projects DTU Management Engineering 22 15.10.2014
![Page 23: GMI: Global Microbial Identifier - Home: OIE · GMI: Global Microbial Identifier The future of microbiology: Identification and Surveillance will merge ... 3 DTU Management Engineering](https://reader031.fdocuments.net/reader031/viewer/2022021717/5b371d5c7f8b9a310e8bdae8/html5/thumbnails/23.jpg)
10. oktober 2014
Add Presentation Title in Footer via ”Insert”; ”Header & Footer”
Political acceptance – will be key!
A dramatic opportunity to start this up globally
Local diagnostics and Global surveillance
Cheaper, better, faster Microbiology
and Epidemiology
First Global Machine with Local use
- if we can move forward together ??
DTU Management Engineering 23 15.10.2014