Glucocorticoid receptor signaling activates TEAD4 to ......1 Glucocorticoid receptor signaling...

1

Glucocorticoid receptor signaling activates TEAD4 to promote breast cancer progression

Lingli He1, Liang Yuan2, Yang Sun1, Pingyang Wang1, Hailin Zhang3, Xue Feng1, Zuoyun Wang1, Wenxiang Zhang1, Chuanyu Yang3, Yi Arial Zeng1, Yun Zhao1,2, Ceshi Chen3,4,5* & Lei Zhang1,2,*

Author affiliations� 1State Key Laboratory of Cell Biology, CAS Center for Excellence in Molecular Cell Science, Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences, University of Chinese Academy of Sciences, 320 Yueyang Road, Shanghai, 200031, People's Republic of China 2School of Life Science and Technology, ShanghaiTech University, Shanghai, 201210, People’s Republic of China 3Key Laboratory of Animal Models and Human Disease Mechanisms of Chinese Academy of Sciences & Yunnan Province, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, 650223, People’s Republic of China 4Institute of Stem Cell and Reproductive Biology, Chinese Academy of Sciences, Beijing, 100101, People’s Republic of China 5KIZ-CUHK Joint Laboratory of Bioresources and Molecular Research in Common Diseases, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, 650223, People’s Republic of China *Corresponding author

Running title: GCs-activated TEAD4 contributes to breast cancer progression

Corresponding author: Lei Zhang or Ceshi Chen Phone: +8602145921336 Fax: +8602145921336 Address: 320 Yue Yang Road, New building Room 505, Shanghai 200031, China Email: [email protected] or [email protected]

Conflict of interest statement: The authors declare no potential conflicts of interest

Research. on August 2, 2020. © 2019 American Association for Cancercancerres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012

http://cancerres.aacrjournals.org/

2

Abstract Hippo pathway plays a critical role in cell growth and tumorigenesis. The activity of

TEA domain transcription factor 4 (TEAD4) determines the output of Hippo signaling,

however, the regulation and function of TEAD4 has not been explored extensively.

Here, we identified glucocorticoids (GCs) as novel activators of TEAD4. GC treatment

facilitated glucocorticoid receptor (GR)-dependent nuclear accumulation and

transcriptional activation of TEAD4. TEAD4 positively correlated with GR expression

in human breast cancer, and high expression of TEAD4 predicted poor survival of

breast cancer patients. Mechanistically, GC activation promoted GR interaction with

TEAD4, forming a complex that was recruited to the TEAD4 promoter to boost its own

expression. Functionally, the activation of TEAD4 by GC promoted breast cancer stem

cells maintenance, cell survival, metastasis and chemo-resistance both in vitro and in

vivo. Pharmacological inhibition of TEAD4 inhibited GC-induced breast cancer

chemo-resistance. In conclusion, our study reveals a novel regulation and functional

role of TEAD4 in breast cancer and proposes a potential new strategy for breast cancer

therapy.

Significance : This study provides new insight into the role of glucocorticoid signaling

in breast cancer with potential for clinical translation.

Introduction

The Hippo signaling pathway, originally discovered in Drosophila melanogaster and

highly conserved in mammals, plays key roles in cell proliferation, cell fate

determination, organ size control, and tumor suppression (1-3). Hippo pathway mainly

contains upstream kinase complex, transcriptional cofactor Yes associated-protein

(YAP) and its paralog WW domain containing transcription regulator 1 (TAZ), and

TEA domain transcription factors (TEAD1-4). Upstream core MST-LATS kinase

cascade phosphorylates YAP/TAZ and restricts their localization in the cytoplasm,

while unphosphorylated YAP/TAZ translocate into nucleus and binds with TEADs to




3

activate TEADs transcriptional activity (4,5). Activated TEADs stimulates the

expression of genes involved in cell proliferation and metastasis (CYR61, CTGF,

BIRC5, ANKRD1, Vimentin and N-cadherin) and then promote tumorigenesis and

progression (2,6). Regulators, such as energy/osmotic stress (7,8), cell

contact/mechanical force (9,10) and hormones (11) trigger Hippo pathway by

controlling YAP/TAZ activity, while YAP/TAZ require TEADs binding to regulate

target genes (12). Thus, it is of importance to understand the regulation and function of

TEADs.

TEADs have been reported to be phosphorylated by protein kinase A (PKA) and

protein kinase C (PKC), which impairs TEADs DNA binding ability (13,14). TEAD4

is also palmitoylated to enhance its association with YAP/TAZ and transcriptional

activity (15). RBM4-facilitated alternative splicing of TEAD4 generates a TEAD4-

shorter form to suppress cancer cell proliferation and migration (16). In addition, It has

been studied that p38 regulates TEADs nuclear–cytoplasmic shuttling in response to

osmotic stress (8). Moreover, TEAD4 nuclear localization is critical for establishing the

trophectoderm (TE)-specific transcriptional program and segregating TE from the inner

cell mass (ICM) (17). More importantly, TEAD4 nuclear localization positively auto-

regulates its own transcription and increases its protein level in the TE lineage, and the

high TEAD4 concentration facilitates its nuclear localization as a positive feedback

response (17). Recently, it has been reported that GR binds to the promoter of TEAD4

to regulate TEAD4 transcription during adipogenesis (18). The activity of TEADs is

also regulated by its cofactors. Besides the most well-known co-activators YAP/TAZ,

some other Hippo-independent cofactors have been also identified as TEADs-binding

partners, such as the vestigial-like protein family (VGLL1–4) (19), C-terminal binding

protein 2 (CtBP2) (20), transcription factor 4 (TCF4) (21), Krüppel-like factor 5 (KLF5)

(22) and activator protein-1 (AP-1) (23). Together with their cofactors, TEADs bind to

the conserved MCAT motif to regulate transcriptional activity involved in cancer

initiation and progression (24,25).




4

Glucocorticoids (GCs), as a kind of steroid hormones, function through

glucocorticoid receptor (GR) and play important roles in various biological processes,

such as cell growth, metabolism, immune and inflammatory reactions (26,27). Due to

its anti-proliferative and pro-apoptotic roles, GCs have been used in various diseases

therapies, such as acute lymphoblastic leukemia and multiple myeloma (27).

Nevertheless, GCs treatment has side effect for the emergence of GCs-induced

apoptosis resistance (28). It has been shown that GCs promote cancer cells survival and

protect cells from chemotherapy-induced apoptosis (29,30). For example,

Dexamethasone (Dex) treatment inhibits paclitaxel-induced apoptosis especially in

breast cancer (11,31,32). Consistently, high expression of GCs-related GR correlates

with poor survival and poor prognosis in breast cancer patients (11,33). However, the

molecular mechanism and the key mediators that respond to GCs-GR signaling and

induce cell growth, remain unclear.

Breast cancer is the most common malignancy in women. In clinical diagnosis, breast

cancers are divided into four subtypes based on the expression of the markers: oestrogen

receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor

2 (HER2). Among the different subtypes, patients with triple negative breast cancer

(TNBC), characterized by ER/HER2/PR negative, have the highest frequency of lymph

node metastasis and poorest prognosis (34). TNBC has a relatively good response to

chemotherapy, however, chemo-resistance is an alarming issue following treatment

(34). The Hippo signaling pathway has been linked to breast cancer progression. The

high expression of YAP and TAZ contribute to breast cancer cell survival and

metastasis dependent on TEAD4 interaction (35,36). Besides, TEAD4 also acts as an

oncogene in breast cancer (22).

In this study, we identify glucocorticoids as new regulators of TEAD4 in breast

cancer. GCs promote TEAD4 transcriptional levels, nuclear accumulation and TEAD4

transcriptional activity. These actions of GCs depend on glucocorticoid receptor (GR).




5

Specifically, GCs-activated GR is recruited to the promoter of TEAD4 and forms a

complex with TEAD4 to regulate TEAD4 transcription and auto-activation. The

activity of TEAD4 positively correlates with GR expression in clinical breast cancer

samples. Furthermore, high expression of TEAD4 and GR predicts poor survival in

patients with breast cancer. GCs-GR induced TEAD4 activity is involved in breast

cancer cells survival, metastasis and chemo-resistance in vitro and in vivo.

Pharmacological inhibition of TEAD4 transcriptional activity by niflumic acid

inhibited GCs-induced breast cancer drug resistance. Our data identify a new GCs-GR-

TEAD4 axis and a novel mechanism of TEAD4 regulation in breast cancer, suggesting

a new strategy for breast cancer therapy.

Materials and Methods

Reagents and plasmids. The compounds and drugs were shown in Table S1. TEAD4,

TEAD4-VP16, GR and GR-2C2A were cloned to the pLEX-HA vector for stable

expression in cells. TEAD1/2/3/4, TEAD4-N, TEAD4-C and YAP were cloned to

vector pcDNA3.1. GR, GR-DBD, GR-△DBD and GR-2C2A were cloned to vector

pGEX-4T1-GST, and TEAD4 was cloned to pET28a-His-Sumo for protein purification

in E. coli. All constructs for short hairpin RNA (shRNA) were constructed in a modified

pLKO.1 vector. The shRNA target sequences as followings.

YAP-1: GACATCTTCTGGTCAGAGA;

TEAD4-1: GAGACAGAGTATGCTCGCTAT;

TEAD4-2: CCTTTCTCTCAGCAAACCTAT;

GR-1: TGGATAAGACCATGAGTATTG;

GR-2: CACAGGCTTCAGGTATCTTAT.

Scramble DNA duplex was also designed as a control: TTCTCCGAACGTGTCACGT.

Cell culture. HEK293T cells, MDA-MB-231, MDA-MB-453 and BT-549 were

cultured in DMEM (Invitrogen, Carlsbad, CA) supplemented with 10% FBS and




6

antibiotics at 37 °C with 5% CO2 in a humidified incubator (Thermo, Waltham, MA),

NIH/3T3 cells were cultured in DMEM with 10% NCS and antibiotics. MCF10A cells

were maintained in DMEM/F12 medium (Sigma D6421) containing 5% Horse Serum

(Sigma H1270), 10 µg/mL Insulin (Sigma I6634), 20 ng/mL hEGF (Sigma E4269), 100

ng/mL Cholera toxin (Sigma C8052), 0.5 µg/mL Hydrocortisone (Sigma H4001), and

antibiotics. Cells were obtained from Shanghai Life Academy of Sciences cell library

(Shanghai, China) in June 2016, then the short tandem repeat analysis was performed

to authenticate the cell lines. Multiple aliquots were frozen within 10 days when the

cells were purchased and thawed. For experimental use, aliquots were resuscitated and

cultured for about 20 passages (every two days for 6 weeks) before being discarded.

All cell lines were ensured to be negative for mycoplasma contamination.

Small interference RNAs (siRNAs). Duplexes of siRNA targeting TEAD4, GR, YAP,

TAZ and negative control were synthesized by Genepharma (Shanghai, China). The

siRNA target sequences in human are as followings:

GR-1: AAGTCAAGTTGTCATCTCC;

YAP-1: CCCAGTTAAATGTTCACCAAT;

TAZ: CAGCCAAATCTCGTGATGAA.

The siRNA target sequences in mouse:

YAP-1: GAAGCGCTGAGTTCCGAAAT;

TAZ-1: CAGCCGAATCTCGCAATGAAT;

TAZ-2: CCATGAGCACAGATATGAGAT;

For negative control: UUCUCCGAACGUGUCACGU.

DNA preparation for TEAD4 promoter luciferase reporter. The downstream

sequence of TEAD4 gene containing TEAD4 and GR binding site was amplified by

PCR. Target DNA was detected by agarose gel and purified by Gel Extraction Kit




7

(Tiangen). The primers used for PCR were as followings: TEAD4-F:

CGAGGTGCCGGTGGC; TEAD4-R: CTCTCACCTGGCGGGACG.

Chromatin immunoprecipitation (ChIP). Protocol of ChIP assay was previous

described in detail (20), Chromatin was immunoprecipitated with 2µg antibody of GR

(SC-8992, Cell Signaling), normal rabbit IgG (sc-2027, Santa Cruz), TEAD4 (58310,

Abcam) or normal mouse IgG (sc-2025, Santa Cruz). The immunoprecipitated DNA

was collected with QIAQIUCK PCR Purification Kit (250). Purified DNA was

performed with ChIP-PCR. The primers used were shown in Table S1.

Mammosphere formation assay. MDA-MB-231 cells were cultured with

MammoCult Human Medium Kit (05620, STEMCELL Technologies) supplemented

with 4 µg/mL Heparin (07980, STEMCELL Technologies) in 6-well ultralow

attachment plates (3471, Corning), 3×105 cells per well for 10 days. Fresh complete

medium was added into each well every 3 days. After culture, sphere number was

counted.

Immunohistochemistry. Tissues were embedded in paraffin before cutting into 5µm

sections. Immunohistochemistry (IHC) signals were developed using monoclonal

antibodies against human TAZ (1:200, 4883), GR (1:200, 12041) and Cleaved

Caspase3 (1:200, 9661) which were purchased from Cell Signaling Technology,

TEAD4 (1:100, sc-101184) and YAP (1:200, sc-15407) were purchased from Santa

Cruz Biotechnology. Ki67 (PA5-19462) was a product of Thermo Fisher.

Xenograft tumor formation and Lung seeding assay. Six-week-old healthy female

nude mice (BALB/cA-nu/nu) were obtained from the Shanghai Experimental Animal

Center and maintained in pathogen-free conditions. One million MDA-MB-231 cells

in 100µl of PBS was injected into the mammary fat pad of female nude mice for

xenograft tumor formation or injected into tail vein for metastatic analysis of lung.

Tumor growth at the injection site was monitored by caliper measurements 2 times a




8

week and tumor volume was calculated using the formula: Tumor volume (mm3)

=0.52*D*d2, where D and d is the longest and the shortest diameters, respectively. Mice

were killed after four weeks and tumor weight were then weighted. For lung seeding

assay, Lung of nude mice were analyzed after 40 days of tail vein injection. All animals

were used in accordance with the guidelines of the Institutional Animal Care and Use

Committee of the Institute of Biochemistry and Cell Biology.

Human breast cancer sample collection. All the human breast cancer samples were

collected from Yunnan Cancer Hospital and The First Affiliated Hospital of Kunming

Medical University, with patient written informed consent and the approval from the

Institute Research Ethics Committee. The patient studies were conducted according to

International Ethical Guidelines for Biomedical Research Involving Human Subjects

(CIOMS) ethical guidelines.

Statistical analysis. Statistical parameters including the definitions and exact values of

n, statistical test and statistical significance are reported in the Figures and Figure

Legends. Comparisons between groups were analyzed using an unpaired Student’s t-

test in less than three groups, and One-way ANOVA followed by Tukey’s multiple

comparison test in more than two groups by GraphPad Prism. SPSS 13.0 (SPSS, inc.,

Chicago, IL) was used to analyze the Pearson correlation between GR and TEAD4.

Survival curves were calculated according to the Kaplan-Meier method, and survival

analysis was performed using the logrank test. Differences are considered statistically

significant at *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001. ns means no

significance. All data were presented as mean ± SD.

Results

Glucocorticoids up-regulate TEAD4 transcriptional levels in breast cancer cells

To study the regulation of GCs on Hippo signaling, we treated breast cancer cells

MDA-MB-231 with 1µM Dexamethasone (Dex) for different time. Consistent with




9

earlier findings (11), the total YAP protein levels were increased and phosphorylated

YAP protein levels were decreased at 8 hours and 12 hours. Surprisingly, the protein

level of TEAD4 were also up-regulated dramatically with the increase of treatment time

(Fig. 1a). The expression of TEAD4 and YAP were monitored after Dex treatment (Fig.

1b). However, TEAD4 and YAP were not concurrently activated, and TEAD4 was

activated soon after Dex treatment, as well as Hippo target genes CYR61 and ANKRD1.

TEAD1 and TEAD2 showed no significant change, and TEAD3 expression was also

up-regulated but in a time-independent manner (Supplementary Fig. 1a). To confirm

the up-regulation of TEAD4 was triggered by GCs but not only Dex, 1µg/ml

Hydrocortisone (HC) was used in MDA-MB-231 cells. Consistently, HC also activated

TEAD4 in a time-dependent manner (Supplementary Fig. 1b). Regardless the change

in YAP/TAZ expression, TEAD4 was also activated in BT-549 and MDA-MB-453

cells (Fig. 1c), implying that the GCs-related regulation of TEAD4 is a general

phenomenon in breast cancer cells. In addition, we found that TEAD4 also responded

to GCs in NIH/3T3 cells, a mouse embryo fibroblast (MEF) cell line (Supplementary

Fig. 1c). Consistent with their protein results, TEAD4 and target genes mRNA levels

were also increased after GCs treatment in MDA-MB-231 (Fig. 1d) and BT-549 cells

(Fig. 1e), whereas the mRNA levels of YAP did not change (Fig. 1d,e). The lowest dose

that TEAD4 responded to Dex was 0.01µM (Supplementary Fig. 1d), and the GLIZ

was a GR-regulated gene as positive control (Supplementary Fig. 1e). Again, the

mRNAs of TEAD1/2/3 did not show a consistent change (Supplementary Fig. 1f).

Glucocorticoids promote TEAD4 nuclear accumulation

Since localization of TEAD is a critical determinant of Hippo signaling output (8),

we then investigated the regulation of TEAD4 localization by GCs. TEAD4 was mainly

located in cytoplasm in a normal control culture conditions in MDA-MB-231 (Fig. 1f),

MCF10A (Supplementary Fig. 2a), and NIH/3T3 cells (Supplementary Fig. 2b), and

GCs treatment induced obvious TEAD4 nuclear accumulation (Fig. 1f and

Supplementary Fig. 1a,b). Nuclear and cytoplasmic fraction extraction also confirmed




10

TEAD4 nuclear accumulation in MDA-MB-231 cells (Fig. 1g), MDA-MB-453 cells

(Fig. 1h), MCF10A cells (Supplementary Fig. 2c) and NIH/3T3 cells (Supplementary

Fig. 2d). Interestingly, the regulation was specific to TEAD4 rather than any other

TEADs. TEAD1/2/3 were always located in the nucleus with or without GCs treatment

(Supplementary Fig. 2e,f). 3×SD luciferase reporter was used to evaluate TEAD4

transcriptional activity (5). GC up-regulated the reporter activity both in MDA-MB-

231 cells (Fig. 1i) and MDA-MB-453 cells (Fig. 1j), and knockdown of TEAD4 almost

blocked the GC-induced reporter activity (Supplementary Fig. 2g). Taken together,

Glucocorticoids regulate TEAD4 not only by promoting its expression, but also nuclear

accumulation and transcriptional activity in breast cancer cells.

GCs-GR axis regulates TEAD4 independent of YAP/TAZ

GCs regulates the expression of target genes by binding to GR and activating its

transcriptional activity (37). To investigate the role of GR in regulating TEAD4, we

interfered GR expression by small interfering RNA (siRNA) in MDA-MB-231 cells.

Knockdown of GR totally blocked the nuclear up-regulation of TEAD4 triggered by

Dex or HC at both protein (Fig. 2a) and mRNA levels (Fig. 2b). While, GR mainly

located in nucleus in the absence of ligand treatment, which could be explained that

besides ligand, the nuclear localization of GR also appears to be dependent in large part

on nuclear retention mediated through the binding of the receptors to DNA(38). The

protein levels of GR in the nucleus were reduced as a negative feedback by GCs

treatment (39). Knockdown of GR also blocked the mRNA level up-regulation of GLIZ

(Supplementary Fig. 3a). These results were confirmed in NIH/3T3 cells. Knockdown

of GR totally blocked the TEAD4 cytoplasmic-nuclear shuttling and at the same time

decreased TEAD4 protein levels (Supplementary Fig. 3b,c) in NIH/3T3 cells. The

activation of TEAD4 induced by GCs was also completely blocked by co-treatment

with RU486 (GR antagonist) compared with only GCs treatment in MDA-MB-231

cells (Fig. 2c,d). Furthermore, GR silencing inhibited TEAD4 transcriptional activity

stimulated by GCs treatment in MDA-MB-231 cells (Fig. 2e) and MDA-MB-453 cells




11

(Supplementary Fig. 3d). Thus, our results indicate a critical role of GR in GC-induced

TEAD4 nuclear accumulation and transactivation.

TEAD4 exerts its function mainly by binding with YAP/TAZ (5,40). Since GCs-

GR axis also activates YAP in breast cancer cells (11), we then examined if there was

a correlation between YAP and TEAD4 in GCs-dependent regulation. Silencing of

YAP/TAZ was incapable of blocking the up-regulation of TEAD4 induced by GCs

treatment at both protein and mRNA levels in MDA-MB-231 cells (Fig. 2f,g) and

NIH/3T cells (Supplementary Fig. 3e). Moreover, we also disrupted TEAD4 and

YAP/TAZ binding by Verteporfin (VP) treatment, and there was no obvious influence

on GCs-regulated TEAD4 expression (Fig. 2h). To further exclude the effect of YAP

to TEAD4, we tested whether YAP influence the TEAD4 protein stability.

Overexpression of YAP or knockdown of YAP/TAZ did not change TEAD4 protein

stability followed by cyclohexane (CHX) treatment (Supplementary Fig. 3f,g). These

results indicate that YAP/TAZ are not responsible for GCs-triggered TEAD4 activation.

Altogether, our data demonstrate that GCs-GR axis regulates TEAD4 independent of

YAP/TAZ.

TEAD4 is a direct target of GR in response to GCs

The previous reported regulation of TEAD4 contains phosphorylation (13,14),

palmitoylation(15), nucleocytoplasmic shuttling (8), and nuclear transport in the inner

blastomere (ICM) (17). Our data showed that GCs-GR axis regulates TEAD4 at the

transcriptional levels (Fig. 2b,d). As GR regulates genes mainly by binding to their

promoters (26), and GR regulates TEAD4 transcription during adipogenesis(18). We

hypothesized that TEAD4 is also a direct target of GR during breast tumorigenesis.

There are three repeated CATTCC sequences in TEAD4 promoter region which

matched with the reported GR binding sites (41,42). The schematic diagram of TEAD4

promoter was shown in Fig. 3a. We then performed Chromatin immunoprecipitation

(ChIP) assay to detect the binding of GR on TEAD4 promoter in GCs-treated MDA-




12

MB-231 cells and MBA-MB-453 cells. Our results confirmed that GR bound to the

promoter region of TEAD4 (Fig. 3b and Supplementary Fig. 4a). A region without the

CATTCC sequences serves as a negative control (Fig. 3b). The wild type and core

base pair mutant of TEAD4 promoter luciferase reporters were both generated (Fig. 3a).

TEAD4 promoter luciferase activity was increased after GCs treatment, and decreased

after RU486 co-treatment with GCs (Fig. 3c). In contrast, GCs failed to activate the

mutant form of TEAD4 promoter luciferase reporter (Fig. 3c). Knockdown of GR

completely blocked the up-regulation of TEAD4 promoter luciferase activity triggered

by GCs (Fig. 3d). Still, knockdown of YAP/TAZ had no effect to the TEAD4

transcriptional activity (Supplementary Fig. 4b). These data suggest that TEAD4 is a

direct target of GR in response to GCs.

GR-TEAD4 complex is required for TEAD4 transcriptional activation

TEAD4 positively auto-regulates its own transcription by binding to the promoter of

itself in the trophectoderm (TE) lineage, and high TEAD4 concentration facilitates its

nuclear localization (17). Interestingly, the DNA regions where TEAD4 binding

overlaps with the GR binding regions in the promoter of TEAD4. We speculated that

TEAD4 may bind with GR to regulate its own transcription in response to GCs. We

first detected the binding of TEAD4 to its own promoter by ChIP assay in GCs-treated

MDA-MB-231 cells. Our results showed that TEAD4 bound to its own promoter region

(Fig. 3e) and overexpression of wild type TEAD4 or TEAD4 active form (TEAD4-

VP16) (43) up-regulated TEAD4 promoter luciferase activity (Supplementary Fig. 4c),

which indicated an auto-regulation of TEAD4 upon GCs treatment.

We next examined the physical association between GR and TEAD4. TEAD4

contains an N-terminal TEA domain responsible for DNA binding, and a C-terminal

YAP-binding domain (YBD) responsible for YAP/TAZ binding. GR generates two

main isoforms: GR-α and GR-β. The longer isoform GR-α contains three distinct

domains: transaction domain in the N-terminal, ligand binding domain (LBD) in the C-




13

terminal and DNA binding domain (DBD) in the middle region responsible for specific

DNA sequence recognition and binding (44). The schematic diagram of TEAD4 and

GR main domains were shown in Fig. 3f. GST pull-down assay showed that GST-

tagged GR pulled down TEAD4, and the interaction was mediated by N-terminal TEA

domain but not the C-terminal YBD domain (Fig. 3g). Since the TEA domain of

TEADs proteins were conserved, GR could also pull-down TEAD1/2/3

(Supplementary Fig. 4d). GR full-length and DBD bind to TEAD4 but not the

truncation form GR-�DBD (Fig. 3h), suggesting a specific interaction between the

DNA binding domains of TEAD4 and GR. Purified protein-protein pull-down assay

also confirmed the direct interaction of GR-DBD and TEAD4 (Supplementary Fig. 4e).

While, YAP did not bind to GR in pull-down analysis (Supplementary Fig. 4f). Biotin-

labelled DNA from TEAD4 promoter region could pull down both TEAD4 and GR-

DBD protein (Supplementary Fig. 4g). Moreover, adding DNase in the pull-down

system decreased the interaction of TEAD4 and GR (Fig. 3i), indicating that the

interaction between TEAD4 and GR was enhanced by DNA again. ChIP-reChIP further

proved that TEAD4 and GR genetically interacted on TEAD4 and CYR61/CTGF

promoter (Fig. 3j).

We then asked whether TEAD4-GR interaction is required for GCs-induced TEAD4

transcriptional activation. We made GR-2C2A mutant (C463A and C473A) which was

unable to bind with TEAD4 (Supplementary Fig. 4h) but did not influence its ability of

DNA binding (Supplementary Fig. 4i). Overexpression of GR-2C2A mutant lost the

ability of enhancing the GCs-induced TEAD4 promoter luciferase activity compared

with GR-WT (Fig. 3k). Notably, knockdown of GR completely abolished GCs-induced

auto-binding of TEAD4 to its own promoter and also blocked TEAD4’s binding to the

promoter of CYR61 and CTGF (Fig. 3l). Taken together, these results suggest that GCs-

activated GR facilitates TEAD4 transcription by co-binding with TEAD4 to the

TEAD4 promoter, which further promotes TEAD4-GR transactivation.




14

The activity of TEAD4 positively correlates with GR expression in clinical breast

cancer

To investigate whether the expression of TEAD4 correlates with GR, we performed

immunohistochemistry (IHC) staining of TEAD4 and GR in human TNBC samples.

There were 9 GR positive and 9 TEAD4 positive samples in 30 total samples, and 8 of

these GR or TEAD4 positive samples were GR and TEAD4 double positive (Table S2).

The results showed that TEAD4 expression positively correlated with the expression of

GR (Fig. 4a,b). We also checked their correlation in Her2 positive�Her2+�and ERα

positive (ER+) human breast cancer samples, and found that no expression of TEAD4

was detected (Supplementary Fig. 5a,b), which was consistent with the previous study

(22). As TEAD4 and GR paly their function mainly in the nucleus, we then examined

the percentage of TEAD4 and GR nuclear localization in human TNBC samples,

respectively. The results showed that almost all of GR and TEAD4 had nuclear

expression (Fig. 4c). These results suggest that the activity of TEAD4 positively

correlate with GR in human breast cancer samples.

High expression of GR contributes to breast cancer progression and poor survival of

patients (33,45). Consistently, TEAD4 had higher expression in breast tumor compared

with normal tissue (Fig. 4d). We analyzed 3951 samples from 35 datasets and found

high TEAD4 mRNA levels were associated with poor survival of patients with breast

cancer (Fig. 4e). To further investigate the role of TEAD4 and GR in breast cancer, we

made shTEAD4 and shGR stable cell lines in MDA-MB-231 cells (Supplementary Fig.

5c,d). Knockdown of TEAD4 or GR, respectively, inhibited MDA-MB-231 cell

proliferation (Fig. 4f,g) and migration (Fig. 4h). TEAD4 re-expression based on

knockdown rescued the proliferation inhibition induced by TEAD4 knocking down

(Supplementary Fig. 5e,f). More importantly, knockdown of TEAD4 or GR repressed

cancer stem cells (CSCs) trait which is considered a major driver for cell proliferation,

migration and chemo-resistance (Fig. 4i). Subcutaneous xenotransplant in nude mice

was performed to study the function of TEAD4 and GR in vivo. The results showed




15

shTEAD4 or shGR significantly repressed tumor growth (Fig. 4j-l) and metastasis (Fig.

4l).

GR-TEAD4 mediates GCs-triggered CSCs trait, as well as cell survival and

metastasis in vitro and in vivo

GCs treatment promotes cancer cell growth and anti-apoptosis (11,30). We then

investigated the role of TEAD4 in GCs-induced tumor growth. Knockdown of TEAD4

blocked GCs-induced up-regulation of proliferation-related genes BIRC5/ANKRD1

and EMT-related genes N-cadherin/Vimentin (Fig. 5a), which consequently suppressed

the GCs-induced cell proliferation (Fig. 5b) and tumor growth (Fig. 5c-e). GCs

treatment also promoted metastasis from primary solid tumors, and knockdown of

TEAD4 inhibited GCs-induced metastasis (Fig. 5e). In line with this, the GCs treatment

increased the expression of Ki67 in a TEAD4-dependent manner in xenograft tumors

(Fig. 5f). Overexpression of TEAD4-mNLS (nuclear localization signal mutant)

blocked the function of GC in promoting proliferation (Supplementary Fig. 6a,b).

Additionally, TEAD4-VP16 overexpression completely mimicked the function of GCs

in promoting TEAD4 promoter luciferase activity (Supplementary Fig. 6c) and cell

migration (Supplementary Fig. 6d). To further dissect the function of TEAD4 in

promoting tumor progression, wound healing assay was performed. Knockdown of

TEAD4 resulted in suppression of GCs-induced cell migration (Supplementary Fig. 6e).

GR knockdown also blocked the GCs-induced up-regulation of CYR61, ANKRD1 and

Vimentin (Supplementary Fig. 6f), as well as promotion of cell proliferation

(Supplementary Fig. 6g) and cell migration (Supplementary Fig. 6h). Because of the

importance of CSCs trait, we tested whether GC triggered CSCs feature depends on

TEAD4 and GR. Knocking down TEAD4, as well as GR blocked GC treatment induced

CSCs marker Slug�Nanog and Oct4 expression (Fig. 5g, Supplementary Fig. 6i), and

blocked GC treatment induced tumorsphere formation (Fig. 5h). Lung seeding assay

assessing tumor migration ability in vivo showed that knockdown of TEAD4 or GR

blocked GCs-induced increase of the ratio of lung in the whole-body weight (Fig. 5i)




16

and the number of metastatic tumors (Fig. 5j,k). Besides the contribution of TEAD4

and GR, it is noticeable that YAP also contributed to the growth promotion function of

GCs (Supplementary Fig. 6j). It may be a synergistic result of TEAD4/YAP, and the

function of YAP/TEAD4 still depends on the transcriptional activity of TEAD4.

Moreover, TEAD4 activated form TEAD4-VP16 overexpression satisfied metastasis

phenotype (Fig. 5l-n). Thus, several lines of evidence indicate that GR-TEAD4 is

essential for GCs induced CSCs feature, cell survival and metastasis in vitro and in vivo.

GR-TEAD4 pathway is involved in GCs-induced chemo-resistance

Breast cancer is sensitive to cytotoxic compounds like taxanes, and GCs promote

breast cancer cell drug resistance during cancer therapy (33,46). We then assessed

whether TEAD4 was involved in GCs-induced chemo-resistance. We monitored

proliferation in cells treated with vehicle, Paclitaxel (PX), or PX combined with Dex.

Dex treatment inhibited the cleaved PARP and cleaved caspase8 expressions and

protected the cells from apoptosis caused by PX treatment, but lost its function in

TEAD4 knockdown cells (Fig. 6a,b), suggesting that TEAD4 mediates GCs-induced

chemo-resistance. To further gain insight into the role of TEAD4 in GCs-triggered

chemo-resistance, we inhibited TEAD-dependent transcriptional activity using

niflumic acid (NA), a non-steroidal anti-inflammatory drug (NSAID) (47). PX

treatment promoted the expression of apoptosis marker cleaved PARP and inhibited

cell growth (Fig. 6c,d). Co-treatment PX with Dex inhibited the function of PX (Fig.

6c,d). NA co-treatment abolished Dex-induced expression changes of ANKRD1 and

cleaved PARP (Fig. 6c), also repressed Dex-induced cell proliferation (Fig. 6d). NA

lost its function in TEAD4 knockdown cells (Fig. 6e). These results indicate that

transcriptional activity of TEAD4 is required for GCs-induced chemo-resistance in

breast cancer cells. To investigate whether NA works in vivo, we intraperitoneally

injected different combined drugs after cells were subcutaneously transplanted into

nude mice. PX treatment dramatically repressed tumor growth as shown by reduced




17

tumor volume (Fig. 6f), decreased tumor weight and metastasis (Fig. 6g,h), reduced

Ki67 expression and elevated cleaved caspase3 expression (Fig. 6i) compared with

control group. Co-injection of Dex with PX inhibited the tumor suppression function

of PX, while NA treatment reversed Dex-induced tumor chemo-resistance (Fig. 6f-i).

Our data suggest that activity of TEAD4 is responsible for GCs-induced chemo-

resistance in vitro and in vivo.

Discussion

The Hippo signaling pathway plays critical roles in many biological processes. While

much has been learned about the regulation and function of the cofactors YAP/TAZ,

less is known about the transcription factors TEADs. In this report, we provided

evidence that GCs-GR positively regulated TEAD4. YAP/TAZ deletion was not able

to block the transcription regulation of TEAD4 induced by GCs, and overexpression of

YAP was not able to stabilize TEAD4. Besides, GR directly interacted with TEAD4

independent of YAP. These results revealed a YAP/TAZ-independent regulation of

TEAD4 by GCs-GR signaling. Even though, YAP still contributes to the function of

GCs. GCs-activated YAP-TEAD4 may bind with each other and play their function

synergistically in breast cancer.

Several genes have been identified as TEAD4 co-factors and involved in the function

of TEAD4. We previously reported that KLF5 forms a complex with TEAD4 and

promotes breast cancer progression (22), and GCs also induces KLF5 through GR, and

KLF5 partially mediated the GC-induced docetaxel and cisplatin resistance in TNBC

(32). In this study, we demonstrated that GR binds to TEAD4 to promote TEAD4

transcription and is involved in tumor growth and drug resistance. It is plausible that

GCs-stimulated GR form a ternary complex with TEAD4-KLF5 and play its function

through TEAD4-KLF5. Interestingly, it is reported that GCs-liganded GR regulates

target gene expression through binding to GC response elements (GREs), or tethering




18

to other transcription factors such as TEAD or AP1(41,42). These cues also suggest

that GR may be involved in the regulation of Hippo signaling.

Recently, several alternative splicing events were reporter to modulate Hippo

signaling activity. RBM4-facilitated TEAD4 alternative splicing produces a truncated

isoform: TEAD4 shorter isoform (TEAD4-S) (16). TEAD4-S lacks an N-terminal DNA

binding domain whereas maintains C-terminal YAP binding domain. Exogenous

TEAD4-S is located in both nucleus and cytoplasm, while TEAD4-FL is mainly located

in nucleus. TEAD4-FL functions as a tumor promoter, while TEAD4-S as a tumor

suppressor (16). Our data demonstrated that GCs trigger TEAD4-FL nuclear

accumulation in breast cancer cells. Endogenous TEAD4-FL was mainly located in

nucleus, and endogenous TEAD4-S was mainly located in cytoplasm by extraction of

nuclear and cytoplasmic fraction. GCs trigger nuclear TEAD4-FL accumulation, but

cytoplasmic TEAD4-S does not show obvious change in MDA-MB-231 and MDA-

MB-453 cells. The increased ratio of TEAD4-FL/TEAD4-S suggests that GCs could

also regulate TEAD4 alternative splicing and help TEAD4 produce more nuclear

TEAD4-FL to promote tumor progression.

TNBC is the most aggressive breast cancer subtype. Our work demonstrated the

oncogenic role and positive correlation of TEAD4 and GR in breast cancer. GCs-GR-

TEAD4 axis was involved in the tumor initiation, progression and drug resistance in

breast cancer especially in TNBC. Our findings illustrated a new molecular mechanism

in TNBC regulation, and shed insights in developing new breast cancer therapy.

Acknowledgments

We thank Xiaorui Zhang and Liping Kuai for the animal care. We acknowledge

Gaoxiang Ge, Zhenfei Li and Lijian Hui for the providing reagents and helpful

comments. This work was supported by National Key Research and Development

Program of China (2017YFA0103601 to L. Z.), National Natural Science Foundation




19

of China (No. 31530043 and 31625017 to L. Z. and U1602221 and 81830087,

31771516 to C. C.), “Strategic Priority Research Program” of Chinese Academy of

Sciences (XDB19000000 to L. Z. and XDA16010405 to C. C), “Shanghai Leading

Talents Program” to L. Z., Science and Technology Commission of Shanghai

Municipality (19ZR1466300 to Z. W.), and Youth Innovation Promotion Association

of the Chinese Academy of Sciences to Z. W..

References

1. WuS,HuangJ,DongJ,PanD.hippoencodesaSte-20familyproteinkinasethat

restrictscellproliferationandpromotesapoptosisinconjunctionwithsalvador

andwarts.Cell2003;114:445-56

2. YinMX,ZhangL.Hipposignaling inepithelial stemcells.Actabiochimicaet

biophysicaSinica2015;47:39-45

3. Yu FX, Zhao B, Guan KL. Hippo Pathway in Organ Size Control, Tissue

Homeostasis,andCancer.Cell2015;163:811-28

4. Hao Y, Chun A, Cheung K, Rashidi B, Yang X. Tumor suppressor LATS1 is a

negative regulator of oncogene YAP. The Journal of biological chemistry

2008;283:5496-509

5. Zhang L, Ren F, ZhangQ, Chen Y,Wang B, Jiang J. The TEAD/TEF family of

transcriptionfactorScallopedmediatesHipposignalinginorgansizecontrol.

Developmentalcell2008;14:377-87

6. Zhou Y, Huang T, Cheng AS, Yu J, KangW, To KF. The TEAD Family and Its

OncogenicRoleinPromotingTumorigenesis.Internationaljournalofmolecular

sciences2016;17

7. WangW,XiaoZD,LiX,AzizKE,GanB,JohnsonRL,etal.AMPKmodulatesHippo

pathway activity to regulate energy homeostasis. Nature cell biology

2015;17:490-9

8. LinKC,MoroishiT,MengZ,JeongHS,PlouffeSW,SekidoY,etal.Regulationof




20

Hippopathwaytranscription factorTEADbyp38MAPK-inducedcytoplasmic

translocation.Naturecellbiology2017;19:996-1002

9. Zhao B, Wei X, Li W, Udan RS, Yang Q, Kim J, et al. Inactivation of YAP

oncoproteinby theHippopathway is involved in cell contact inhibitionand

tissuegrowthcontrol.Genes&development2007;21:2747-61

10. GaoJ,HeL,ShiY,CaiM,XuH,JiangJ,etal.Cellcontactandpressurecontrol

of YAP localization and clustering revealed by super-resolution imaging.

Nanoscale2017;9:16993-7003

11. SorrentinoG,RuggeriN, ZanniniA, Ingallina E, BertolioR,MarottaC, et al.

Glucocorticoid receptor signalling activates YAP in breast cancer. Nature

communications2017;8:14073

12. ChenL,ChanSW,ZhangX,WalshM,LimCJ,HongW,etal.Structuralbasisof

YAP recognition by TEAD4 in the hippo pathway. Genes & development

2010;24:290-300

13. GuptaMP,KogutP,GuptaM.Proteinkinase-Adependentphosphorylationof

transcription enhancer factor-1 represses its DNA-binding activity but

enhancesitsgeneactivationability.Nucleicacidsresearch2000;28:3168-77

14. Jiang SW, Dong M, Trujillo MA, Miller LJ, Eberhardt NL. DNA binding of

TEA/ATTSdomainfactorsisregulatedbyproteinkinaseCphosphorylationin

human choriocarcinoma cells. The Journal of biological chemistry

2001;276:23464-70

15. Noland CL, Gierke S, Schnier PD,Murray J, SandovalWN, SagollaM, et al.

PalmitoylationofTEADTranscriptionFactorsIsRequiredforTheirStabilityand

FunctioninHippoPathwaySignaling.Structure2016;24:179-86

16. Qi Y, Yu J, HanW, Fan X,QianH,WeiH, et al. A splicing isoformof TEAD4

attenuates the Hippo-YAP signalling to inhibit tumour proliferation. Nature

communications2016;7:ncomms11840

17. HomeP,SahaB,RayS,DuttaD,GunewardenaS,YooB,etal.Alteredsubcellular




21

localization of transcription factor TEAD4 regulates first mammalian cell

lineagecommitment.ProceedingsoftheNationalAcademyofSciencesofthe

UnitedStatesofAmerica2012;109:7362-7

18. ParkB,ChangS, LeeGJ,KangB,Kim JK,ParkH.Wnt3adisruptsGR-TEAD4-

PPARgamma2 positive circuits and cytoskeletal rearrangement in a beta-

catenin-dependent manner during early adipogenesis. Cell Death Dis

2019;10:16

19. JiaoS,WangH,ShiZ,DongA,ZhangW,SongX,etal.Apeptidemimicking

VGLL4functionactsasaYAPantagonisttherapyagainstgastriccancer.Cancer

cell2014;25:166-80

20. Zhang W, Xu J, Li J, Guo T, Jiang D, Feng X, et al. The TEA domain family

transcription factor TEAD4 represses murine adipogenesis by recruiting

cofactors VGLL4 and CtBP2 into a transcriptional complex. The Journal of

biologicalchemistry2018

21. JiaoS,LiC,HaoQ,MiaoH,ZhangL,LiL,etal.VGLL4targetsaTCF4-TEAD4

complextocoregulateWntandHipposignalling incolorectalcancer.Nature


22. WangC,NieZ,ZhouZ,ZhangH,LiuR,WuJ,etal.TheinterplaybetweenTEAD4

andKLF5promotesbreastcancerpartiallythroughinhibitingthetranscription

ofp27Kip1.Oncotarget2015;6:17685-97

23. ZanconatoF, ForcatoM,BattilanaG,Azzolin L,QuarantaE,BodegaB, etal.

Genome-wide association between YAP/TAZ/TEAD and AP-1 at enhancers

drivesoncogenicgrowth.Naturecellbiology2015;17:1218-27

24. AnbanandamA,AlbaradoDC,NguyenCT,HalderG,GaoX,VeeraraghavanS.

Insightsintotranscriptionenhancerfactor1(TEF-1)activityfromthesolution

structureoftheTEAdomain.ProceedingsoftheNationalAcademyofSciences

oftheUnitedStatesofAmerica2006;103:17225-30

25. ShiZ,HeF,ChenM,HuaL,WangW,JiaoS,etal.DNA-bindingmechanismof




22

theHippopathwaytranscriptionfactorTEAD4.Oncogene2017;36:4362-9

26. ButtgereitF,ScheffoldA.Rapidglucocorticoideffectsonimmunecells.Steroids

2002;67:529-34

27. Smith LK, Cidlowski JA. Glucocorticoid-induced apoptosis of healthy and

malignantlymphocytes.Progressinbrainresearch2010;182:1-30

28. KoflerR,SchmidtS,KoflerA,AusserlechnerMJ.Resistancetoglucocorticoid-

induced apoptosis in lymphoblastic leukemia. The Journal of endocrinology

2003;178:19-27

29. MoranTJ,GrayS,MikoszCA,ConzenSD.Theglucocorticoidreceptormediates

a survival signal in human mammary epithelial cells. Cancer research

2000;60:867-72

30. Zhang C, Beckermann B, Kallifatidis G, Liu Z, Rittgen W, Edler L, et al.

Corticosteroidsinducechemotherapyresistanceinthemajorityoftumourcells

frombone,brain,breast,cervix,melanomaandneuroblastoma.International

journalofoncology2006;29:1295-301

31. Skor MN, Wonder EL, Kocherginsky M, Goyal A, Hall BA, Cai Y, et al.

Glucocorticoid receptor antagonism as a novel therapy for triple-negative

breast cancer. Clinical cancer research : an official journal of the American

AssociationforCancerResearch2013;19:6163-72

32. LiZ,DongJ,ZouT,DuC,LiS,ChenC,etal.Dexamethasoneinducesdocetaxel

andcisplatinresistancepartiallythroughup-regulatingKruppel-likefactor5in

triple-negativebreastcancer.Oncotarget2017;8:11555-65

33. ChenZ,LanX,WuD,SunkelB,YeZ,HuangJ,etal.Ligand-dependentgenomic

function of glucocorticoid receptor in triple-negative breast cancer. Nature


34. JamdadeVS,SethiN,MundheNA,KumarP,LahkarM,SinhaN.Therapeutic

targets of triple-negative breast cancer: a review. Br J Pharmacol

2015;172:4228-37




23

35. LamarJM,SternP,LiuH,SchindlerJW,JiangZG,HynesRO.TheHippopathway

target, YAP, promotes metastasis through its TEAD-interaction domain.

Proceedings of the National Academy of Sciences of the United States of

America2012;109:E2441-50

36. Shi P, Feng J, Chen C. Hippo pathway inmammary gland development and

breastcancer.ActabiochimicaetbiophysicaSinica2015;47:53-9

37. Biddie SC, Conway-Campbell BL, Lightman SL. Dynamic regulation of

glucocorticoidsignallinginhealthanddisease.Rheumatology2012;51:403-12

38. HacheRJ,TseR,ReichT,SavoryJG,LefebvreYA.Nucleocytoplasmictrafficking

of steroid-free glucocorticoid receptor. The Journal of biological chemistry

1999;274:1432-9

39. Kadmiel M, Cidlowski JA. Glucocorticoid receptor signaling in health and

disease.TrendsPharmacolSci2013;34:518-30

40. ZhaoB,YeX,YuJ,LiL,LiW,LiS,etal.TEADmediatesYAP-dependentgene

inductionandgrowthcontrol.Genes&development2008;22:1962-71

41. Biddie SC, John S, Sabo PJ, Thurman RE, Johnson TA, Schiltz RL, et al.

TranscriptionfactorAP1potentiateschromatinaccessibilityandglucocorticoid

receptorbinding.Molecularcell2011;43:145-55

42. StarickSR,Ibn-SalemJ,JurkM,HernandezC,LoveMI,ChungHR,etal.ChIP-

exo signal associated with DNA-binding motifs provides insight into the

genomicbindingoftheglucocorticoidreceptorandcooperatingtranscription

factors.Genomeresearch2015;25:825-35

43. NishiokaN,InoueK,AdachiK,KiyonariH,OtaM,RalstonA,etal.TheHippo

signaling pathway components Lats and Yap pattern Tead4 activity to

distinguishmouse trophectoderm from inner cellmass. Developmental cell

2009;16:398-410

44. Gruver-Yates AL, Cidlowski JA. Tissue-specific actions of glucocorticoids on

apoptosis:adouble-edgedsword.Cells2013;2:202-23




24

45. PanD,KocherginskyM,ConzenSD.Activationoftheglucocorticoidreceptoris

associatedwithpoorprognosis in estrogen receptor-negativebreast cancer.

Cancerresearch2011;71:6360-70

46. Herr I, Pfitzenmaier J.Glucocorticoiduse inprostate cancer andother solid

tumours:implicationsforeffectivenessofcytotoxictreatmentandmetastases.

TheLancetOncology2006;7:425-30

47. PobbatiAV,HanX,HungAW,WeiguangS,HudaN,ChenGY,etal.Targetingthe

Central Pocket in Human Transcription Factor TEAD as a Potential Cancer

TherapeuticStrategy.Structure2015;23:2076-86

Figure Legends

Figure 1. Glucocorticoids up-regulate TEAD4 transcriptional level and promote

TEAD4 nuclear accumulation in breast cancer cells. (a) Western blotting analysis

of the protein levels of Hippo components with indicated antibodies. MDA-MB-231

cells were treated with Dexamethasone (Dex) 1µM for 0h, 1h, 4h, 8h or 12 hours (h).

(b) Quantification of YAP and TEAD4 protein levels. The protein levels were

quantized by Image J. (c) Protein levels of Hippo signaling components. MDA-MB-

453 and BT-549 cells were treated with Dex 1µM for 0h, 4h or 12h. (d,e) Quantitative

PCR with reverse transcription (qRT–PCR) analysis of Hippo components message

RNA (mRNA) levels. MDA-MB-231 and BT-549 cells were treated with Dex 1µM for

4h or 12 h. Tow biological repeats per group. (f) Representative confocal

immunofluorescence images (left) of TEAD4 in MDA-MB-231 cells treated with Dex

1µM or Hydrocortisone (HC) 1µg/mL for 12h, Ethanol (Etha) was used as a control.

TEAD4 and DAPI were stained. Quantification of TEAD4 nuclear localization (N) and

cytoplasmic localization (C) was provided (right). Scale bar =10µm. (g,h) Nuclear and

cytoplasmic fraction analysis of TEAD4 expression. MDA-MB-231 or MDA-MB-453

cells were treated same with f. Subcellular fractionation was performed with NE-

PERTM nuclear and cytoplasmic extraction reagent (Thermo Fisher) according to the




25

instructions of the manufacturer. Both fractions were analyzed by western blotting with

indicated antibodies. (i,j) 3×SD luciferase reporter activity analysis of TEAD4

transcriptional activity. MDA-MB-231 and MDA-MB-453 cells were transfected with

vector of 3×SD luciferase reporter, and 24h later, cells were treated with Etha, Dex

1µM or HC 1µg/mL for 12h. The relative luciferase activities were determined by

calculating the ratio of firefly luciferase activities over Renilla luciferase activities.

Data was normalized to Etha. 3 biological repeats per group. Data in d-f, i and j

represent the mean±s.d.. One-way ANOVA were used to compare the difference

between groups. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001, and ns means no

statistics significance. Significance was relative to control of each group.

Figure 2. GCs-GR axis regulates TEAD4 independent of YAP/TAZ. (a,b) Analysis

of TEAD4 subcellular localization and mRNA level in MDA-MB-231 cells transfected

with indicated siRNA for 36h and treated with Dex 1µM or HC 1µg/mL for 12h. siNC

was used as negative control. Nuclear and cytoplasmic extraction was analyzed by

western blotting (a) and mRNA level was analyzed by qRT–PCR (b). (c,d) Analysis of

TEAD4 subcellular localization and mRNA level in MDA-MB-231 cells treated with

Dex 1µM or HC 1ug/mL alone or in combination with RU486 1µM for 12 h.

Representative blots (c) and relative mRNA level (d) were shown. (e) Analysis of

transcriptional activity of TEAD4 by 3xSD luciferase reporter. MDA-MB-231cells

were transfected with 3×SD luciferase reporter and siRNA. After 24h, cells were treated

with Dex 1µM or HC 1µg/mL alone or in combination with RU486 1µM for 12h. Data

were normalized to Etha. (f) Analysis of protein levels with indicated antibodies in

YAP/TAZ deletion cells. MDA-MB-231 cells stably expressing shYAP were

transfected with siTAZ for 36h and treated with Dex 1µM or HC 1µg/mL for 12h. (g)

Analysis of mRNA levels with indicated RT-PCR primers in YAP/TAZ knockdown

cells. MDA-MB-231 cells were transfected with siTAZ and siYAP for 36 h and treated

with Dex 1µM or HC 1µg/mL for 12h. (h) MDA-MB-231were treated with VP

combined with Dex 1µM or HC 1µg/mL for 12h. Data in b, d, e and g represent the




26

mean±s.d. from two biological repeats. One-way ANOVA was used to compare the

difference between groups. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001, and ns

means no statistics significance. Significance was relative to control of each group.

Figure 3. GR, forming a novel complex with TEAD4 is required for TEAD4

transcriptional activation. (a) Schematic diagram of TEAD4 promoter region with

conserved TEAD4 and GR binding sites. (b) Chromatin immunoprecipitation (ChIP)

analysis showed the binding of GR to the TEAD4 promoter. MDA-MB-231 cells were

treated with Dex 1µM for 12h. Protein-bound chromatin was immunoprecipitated with

the GR antibody, and IgG was used as a control. The immunoprecipitated DNA was

analyzed by Quantitative PCR (q-PCR) using primers of TEAD4 binding sequence, and

TEAD4-NC was as a negative control. (c) Luciferase reporter driven by wild-type or

mutant TEAD4 promoter (as shown in a) was transfected in the presence or absence of

Dex or Dex/RU486. (d) Luciferase reporter analysis of the TEAD4 transcriptional

activity with or without GR expression. Luciferase activity from TEAD4 promoter in

MDA-MB-231 cells was measured following treatment with Dex 1µM for 12h on the

background of siGR transfection. (e) ChIP analysis of the binding of TEAD4 to the

TEAD4 promoter. MDA-MB-231 cells were treated with Dex 1µM. (f) Schematic

diagram of main domains and sites of TEAD4 and GR. (g) GST pull-down assay to

detect the interaction of TEAD4 and GR. Purified GST-tagged GR recombinant

proteins were incubated with cell lysates overexpressed Flag-tagged TEAD4, TEAD4-

N or TEAD4-C. GST protein was used as a negative control. (h) GST pull-down assay

to detect the main domain of GR mediating the interaction of TEAD4 and GR. Purified

GST-tagged GR full length and truncations recombinant proteins were incubated with

cell lysates overexpressed Flag-tagged TEAD4. (i) GST pull-down assay to determine

the interaction of TEAD4 and GR with or without DNase. Digestion of DNA was

detected by agarose gel. (j) Two step ChIP-PCR analysis of the TEAD4 binding to the

TEAD4/CYR61/CTGF promoters with or without siGR transfection. MDA-MB-231

cells were treated with Dex. (k) Luciferase reporter analysis of TEAD4-GR complex to




27

enhance TEAD4 transcription. Luciferase reporter driven by TEAD4 promoter was

transfected with GR or GR-2C2A overexpression, then MDA-MB-231 cells were

treated with Etha or Dex. (l) ChIP analysis of the binding of TEAD4 to the

TEAD4/CYR61/CTGF promoter with or without siGR transfection. MDA-MB-231

cells were treated with Dex 1µM. Data in b-e and j-l represent the mean±s.d from three

biological repeats. One-way ANOVA was used to compare the difference between

groups. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001, and ns means no statistics

significance. Significance was relative to control of each group.

Figure 4. The activity of TEAD4 positively correlates with GR expression in

human breast cancer. (a) Representative IHC images of GR and TEAD4 staining in

the human triple negative breast cancer (TNBC) samples. Scale bar =100/25µm. (b)

Pearson correlation analysis of the expression correlation of GR and TEAD4 in 30

TNBC samples. (c) Percentage statistic of TEAD4 and GR nuclear expression in the

human TNBC samples. (d) TEAD4 mRNA expression in breast cancer and normal

tissue. The data was obtained from TCGA database. (e) Kaplan-Meier survival analysis

of TEAD4 mRNA levels with 3951 samples of 35 datasets from Kaplan-Meier Plotter

website using the logrank test. Survival curve were calculated according to the Kaplan-

Meier method. (f,g) MTT analysis of cell proliferation. MDA-MB-231 cells were stably

expressed shLuc, shTEAD4 or shGR and were performed the MTT assay daily for 6

days. Five biological repeats per group. (h) Transwell analysis of cell migration. MDA-

MB-231 cells stably express shLuc, shTEAD4 or shGR were serum starved. The

representative pictures of migrated cells were shown. Scale bar =500µm. (i)

Tumorsphere formation assay was conducted with shLuc, shTEAD4 or shGR in 3×105

MDA-MB-231 cells. Representative images were shown. Scale bars= 400µm based on

randomly selected 5 fields. (j) Xenograft assay of tumor growth. MDA-MB-231 cells

were stably expressed shLuc, shTEAD4 or shGR, and implanted subcutaneously in

nude mice. The average sizes of xenograft tumors were measured twice a week. Each

group contained eight biological replicates of four mice. (k) Weights of the tumors in




28

g removed after 24 days. (l) Representative images of removed tumors and the ratios of

metastatic mice were shown. Scale bar =1cm. Data in f-k represent the mean±s.d.. One-

way ANOVA was used to compare the difference between groups. *P<0.05, **P<0.01,

***P<0.001, ****P<0.0001, and ns means no statistics significance. Significance was

relative to control of each group.

Figure 5. GR-TEAD4 mediates GCs-triggered CSCs trait, as well as cell survival

and metastasis in vitro and in vivo. (a) Protein levels of GCs-induced genes with

shLuc or shTEAD4 transfection. MDA-MB-231 cells were treated with Dex 1 µM for

12h with shLuc or shTEAD4 expression. (b) MTT analysis of GCs-triggered cell

proliferation. MDA-MB-231 cells stably expressing shLuc or shTEAD4 were treated

with Etha, Dex 1µM or HC 1µg/mL when seeding cells. Five biological replicates per

group. (c) Xenograft analysis of GCs-promoted tumor growth. MDA-MB-231 cells

stably expressed shLuc or shTEAD4 were pre-treated with Etha or Dex 1µM for 24h,

and were implanted subcutaneously in nude mice. The average sizes of xenograft

tumors were measured twice a week. Each group contained eight biological replicates

of four mice. (d,e) Weights and pictures of the tumors in c removed after 22 days were

shown. Scale bar =1cm. (f) Statistics of Ki67 positive cells in e. (g) Protein level of

GCs-induced CSCs marker. (h) Tumorsphere formation assay was conducted with

shLuc, shTEAD4 or shGR in 3×105 MDA-MB-231 cells with or without GCs treatment.

Representative images were shown. Scale bars = 400µm based on randomly selected 5

fields. (i) Lung seeding assay of tumor metastasis in vivo. The ratio of lung in whole

body weight was shown. One million cells stably expressing shLuc, shTEAD4 or shGR

were pre-treated as c and injected into nude mice via tail vein. Mice were sacrificed

after 40 days. More than five mice per group. (j) Representative images of lung were

shown. Scale bar =1cm. (k) Statistical graph of tumor numbers in lung. (l-n) The

function of TEAD4 activation in tumor metastasis in vivo. One million MDA-MB-231

cells stably expressing Control or TEAD-VP16 were injected into nude mice via tail

vein, and the mice were analyzed as i-k. Data in b-d, f, h, i, k, l and n represent the




29

mean±s.d.. Unpaired t tests and One-way ANOVA were used to compare the difference

between groups. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001, and ns means no

statistics significance. Significance was relative to control of each group.

Figure 6. TEAD4 activation is involved in GCs-induced chemo-resistance. (a)

Knockdown of TEAD4 blocked GCs-induced expression of apoptosis marker. MDA-

MB-231 cells were treated with control, paclitaxel (PX) 0.1µM or Dex 1µM as labelled

with shLuc or shTEAD4 transfection. (b) Inhibition of TEAD4 activity blocked GCs-

induced chemo-resistance. MDA-MB-231 cells were treated as a. Cell viability was

detected after 4 days. Five repeats each group. (c,d) MDA-MB-231 cells were treated

with DMSO, niflumic acid (NA) 100 µM or PX 1µM combined with Etha or Dex 1µM

and then analyzed of protein levels (c) and cell survival (d). (e) MDA-MB-231 cells

were treated with DMSO or 100µM NA combined with 1µM PX and 1µM Dex

treatment with or without shTEAD4 expression, and then analyzed of cell survival. (f)

Xenograft assay analysis the function of TEAD4 transcriptional activity in GC-induced

drug resistance. One million MDA-MB-231 cells were implanted subcutaneously in

nude mice, and PX combined with Dex or NA was intraperitoneally injected to the nude

mice when the tumor volume was up to 50mm3. The average sizes of xenograft tumors

were measured twice a week. The tumor growth curves were shown. Each group

contained six biological replicates. (g,h) Tumor weight (g) and pictures (h) removed

after 33 days were shown. Scale bar =1cm. (i) IHC analysis of Ki67 and Cleaved

Caspase3 expression in tumor of g. Representative images were shown. Scar bar =20µm.

Data in b and d-g represent the mean±s.d.. One-way ANOVA was used to compare the

difference between groups. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001, and ns

means no statistics significance. Significance was relative to control of each group.




30




31




32




33




34




35




Published OnlineFirst July 9, 2019.Cancer Res Lingli He, Liang Yuan, Yang Sun, et al. breast cancer progressionGlucocorticoid receptor signaling activates TEAD4 to promote

Updated version

10.1158/0008-5472.CAN-19-0012doi:

Access the most recent version of this article at:

Material

Supplementary

http://cancerres.aacrjournals.org/content/suppl/2019/07/09/0008-5472.CAN-19-0012.DC1

Access the most recent supplemental material at:

Manuscript

Authorbeen edited. Author manuscripts have been peer reviewed and accepted for publication but have not yet

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/early/2019/07/09/0008-5472.CAN-19-0012To request permission to re-use all or part of this article, use this link



http://cancerres.aacrjournals.org/lookup/doi/10.1158/0008-5472.CAN-19-0012

http://cancerres.aacrjournals.org/content/suppl/2019/07/09/0008-5472.CAN-19-0012.DC1

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://cancerres.aacrjournals.org/content/early/2019/07/09/0008-5472.CAN-19-0012


Glucocorticoid receptor signaling activates TEAD4 to ......1 Glucocorticoid receptor signaling...

Documents

Transcript of Glucocorticoid receptor signaling activates TEAD4 to ......1 Glucocorticoid receptor signaling...