529

2. Ahluwalia G, Cooney DA, Mitsuya H, et al. Initial studies on the cellularpharmacology of 2’,3’-dideoxyinosine, an inhibitor of HIV infectivity.Biochem Pharmacol 1987; 36: 3797-800.

3. Mitsuya H, Jarrett RF, Matsukura M, et al. Long-term inhibition ofhuman T-lymphotropic virus type III/lymphadenopathy-associatedvirus (human immunodeficiency virus) DNA synthesis and RNAexpression in T cells protected by 2’,3’-dideoxynucleosides in vitro.Proc Natl Acad Sci USA 1987; 84: 2033-37.

4. Du DL, Volpe DA, Murphy MJ Jr, Grieshaber CK. Myelotoxicity ofnew anti-HIV drugs (2’,3’-dideoxynucleosides) on human

hematopoietic progenitor cells in vitro. Exp Hematol 1989; 17: 519.5. Molina J-M, Groopman JE. Bone marrow toxicity of dideoxyinosine.

N Engl J Med 1989; 321: 1478.6. Perno C-F, Yarchoan R, Cooney DA, et al. Replication of human

immunodeficiency virus in monocytes. Granulocyte/macrophagecolony-stimulating factor (GM-CSF) potentiates viral production yetenhances the antiviral effect mediated by 3’-azido-2’3’-

dideoxythymidine (AZT) and other dideoxynucleoside congeners ofthymidine. J Exp Med 1989; 169: 933-51.

7. Ahluwalia G, Johnson MA, Fridland A, Cooney DA, Broder S, JohnsDG. Cellular pharmacology of the anti-HIV agent 2’,3’-dideoxyadenosine. In: Proceedings of the American Association forCancer Research, New Orleans, May 25-28, 1988. 29. Baltimore:Waverly Press, 1988: 349.

8. Yarchoan R, Mitsuya H, Thomas RV, et al. In vivo activity against HIVand favorable toxicity profile of 2’,3’-dideoxyinosine. Science 1989; 245:412-15.

9. Yarchoan R, Mitsuya H, Pluda J, et al. The National Cancer Institutephase I study of ddI administration in adults with AIDS or

AIDS-related complex: analysis of activity and toxicity profiles. RevInfect Dis 1990; 12 (suppl 5): S522-33.

10. Yarchoan R, Thomas RV, Mitsuya H, et al. Initial clinical studies of2’,3’-dideoxyadenosine (ddA) and 2’,3’-dideoxyinosine (ddI) in

patients with AIDS or AIDS-related complex (ARC). J Cell Biochem1989; (Suppl 13B): 313.

11. Hartman NR, Yarchoan R, Pluda JM, et al. Pharmacokinetics of

2’,3’-dideoxyadenosine and 2’,3’-dideoxyinosine in patients withsevere HIV infection. Clin Pharmacol Ther 1990; 47: 647-54.

12. Kaplan EL, Meier P. Nonparametric estimation from incompleteobservations. J Am Statist Assoc 1958; 53: 457-81.

13. Lambert JS, Seidlin M, Reichman RC, et al. 2’,3’-Dideoxyinosine (ddI)in patients with the acquired immunodeficiency syndrome or theAIDS-related complex. A phase I trial. N Engl J Med 1990; 322:1333-40.

14. Cooley TP, Kunches LM, Saunders CA, et al. Once-daily administrationof 2’,3’-dideoxyinosine (ddI) in patients with the acquiredimmunodeficiency syndrome or AIDS-related complex. N Engl J Med1990; 322: 1430-35.

15. Butler K, Eddy J, Einloth M, et al. Dideoxyinosine (ddI) in children withsymptomatic HIV infection. A Phase I-II study. In: Program andAbstracts of the Twenty-Ninth Interscience Conference on

Antimicrobial Agents and Chemotherapy, Houston, Texas, Sept17-20, 1989. Washington, DC: American Society for Microbiology,1989: 106.

16. Present DH, Meltzer SJ, Krumholz MP, Wolke A, Korelitz BI.6-mercaptopurine in the management of inflammatory bowel disease:short and long-term toxicity. Ann Intern Med 1989; 111: 641-49.

17. Mallory A, Kern F Jr. Drug-induced pancreatitis: a critical review.Gastroenterology 1980; 78: 813-20.

18. Clas D, Falutz J, Rosenberg L. Acute pancreatitis associated with HIVinfection. Can Med Assoc J 1989; 140: 823.

19. Schwartz MS, Brandt LJ. The spectrum of pancreatic disorders inpatients with acquired immunodeficiency syndrome. Am JGastroenterol 1989; 84: 459-62.

20. Grunfeld C, Kotler DP, Hamadeh R, Tierney A, Pierson RN Jr.Hypertriglyceridemia in the acquired immunodeficiency syndrome.Am J Med 1989; 86: 27-31.

21. Fuller GN, Jacobs JM, Guiloff RJ. Association of painful peripheralneuropathy in AIDS with cytomegalovirus infection. Lancet 1989; ii:937-41.

22. Richman DD, Fischl MA, Frieco MH, et al. The toxicity of

azidothymidine (AZT) in the treatment of patients with AIDS andAIDS-related complex: a double-blind, placebo-controlled trial.

N Engl J Med 1987; 317: 192—97.23. Herer B, Chinet T, Labrune S, Collignon MA, Chretien J, Huchon G.

Pancreatitis associated with pentamidine by aerosol. Br Med J 1989;298: 605.

24. Fauci AS. ddI—a good start, but still phase I. N Engl J Med 1990; 322:1386-87.

Genotyping of poor metabolisers of debrisoquine byallele-specific PCR amplification

A method for genotyping poor metabolisers ofdebrisoquine is based on specific polymerase chainreaction (PCR) amplification of parts of mutantgenes for hepatic cytochrome P450IID6. Analysisby restriction fragment length polymorphismallowed identification of only 25% of poormetabolisers, but when it was combined with

allele-specific PCR over 95% of poor metaboliserscould be identified. The PCR method also allowedthe identification of heterozygous carriers ofmutant alleles.

Introduction

The discovery of the polymorphic oxidation of

debrisoquine1,2 caused a resurgence of interest in geneticfactors affecting the individual response to drugs.Debrisoquine polymorphism is probably one of the beststudied variations of drug metabolism. The so-calledpoor-metaboliser phenotype is inherited as an autosomal-recessive trait and occurs in 5-10% of European and NorthAmerican populations.3.4 It is associated with the inefficient

metabolism of over 25 drugs with a range of indications.3-8Clinical studies have shown that poor metabolisers are at

higher risk than extensive metabolisers of adverse reactionsto these drugs.4,5 Routine phenotyping has therefore beenrecommended, particularly for psychiatric patients9 and forvolunteers in clinical studies. 10 Other studies have suggesteda link between the debrisoquine phenotype and some formsof cancer.11,12At present the phenotype is determined by the

administration of a test drug (debrisoquine, sparteine, ordextromethorphan), collection of urine for several hours,and determination of the ratio between the parent drug andmetabolite (urinary metabolic ratio). This procedure haslimitations because of adverse drug reactions, druginteractions, and the confounding effect of diseases.Identification of the mutant genes causing the poor-metaboliser phenotype (ie, the genotype) would be a more

ADDRESS: Biocenter of the University of Basel, Department ofPharmacology, Basel, Switzerland (M. Heim, MD, Prof U. A. Meyer,MD). Correspondence to Prof U A. Meyer, Biocenter, Klingelbergstr 70,CH-4056 Basel, Switzerland.

530

STRUCTURE OF THE P4501ID6-8 GENE CLUSTER

Fig 1-Structure of CYP2D6-8 gene cluster and its mostabundant alleles.

Exons are numbered 1-9. Restriction sites for endonucleases aremarked as E=EcoRl; B =BamHl; H=HindIII; X=Xbal.29A and 29B alleles have point mutations in CYP2D6 gene." 11 5 kb

allele has lost the whole gene.19 44 kb allele has an additional unknowngene (D7) and a mutant CYP2D6 gene."

direct and unambiguous test. Here we report the

development of such a test system.The poor-metaboliser phenotype is caused by the absence

in the liver of a specific cytochrome isozyme calledP450IID613 or P450db1.14 Aberrant splicing of its pre-messenger RNA in the livers of poor metabolisers could

explain its absence. 15 By restriction fragment lengthpolymorphism (RFLP) analysis of leucocyte DNA weidentified several mutant alleles of the P450IID6 gene locus

(CYP2D) associated with the poor-metaboliserphenotype. 16 Digestion of genomic DNA with therestriction enzyme Xbal produced characteristic fragmentsof 11 5 kb and 44 kb, respectively, from these two alleles.However, only the genotypes 44/44 kb, 44/11.5 kb, or11-5/11-5 kb predicted the poor-metaboliser phenotype, andthese were observed in only 25% of poor metabolisers.16 Allthe extensive metabolisers and the other 75% of poormetabolisers had one or two 29 kb fragments which canrepresent either an active (wild-type) allele or a defectiveallele; their RFLP patterns are non-informative as regardsphenotype. To account for all mutant alleles, those

represented by Xbal 29 kb fragments have therefore beenfurther characterised.17 Two mutant 29 kb alleles (29A and29B), were cloned, partially sequenced, and their mutationsidentified.The structure of the CYP2D6 gene cluster on

chromosome 2217 and a summary of mutant alleles at theCYP2D6 locus associated with the poor-metaboliserphenotype are shown in fig 1. In this study allele-specificamplification by the polymerase chain reaction (PCR) wasused to identify the 29wt (wild-type) and the mutant 29A

CYP2D6 SPECIFIC AMPLIFICATIONOF DNA FRAGMENTS

Fig 2-Principles of allele-specific amplification.

Example given is for 29B allele. Common primer is primer 1 The two

specific primers are complementary to sequence at mtron 3-exon 4junction. Wild-type-specific primer 7 generates an amplification productfrom template DNA without mutation, whereas mutation-specific pnmer8 binds only to complementary sequence of 29B allele.

and 29B alleles in genomic DNA of 38 subjects of knownphenotypes.

Subjects and methodsWe studied leucocyte DNA from the subjects described in ourprevious study16 whose phenotypes were determined with

debrisoquine, sparteine, or dextromethorphan. 32 DNA sampleswith a 29/29 kb Xbal pattern were used for allele-specific PCRamplification; 9 of these subjects were poor metabolisers, 23extensive metabolisers. The oligonucleotide primers were

synthesised on a Applied Biosystems DNA synthesiser.The CYP2D gene cluster on chromosome 22 (fig 1) contains

three closely related genes, the functional CYP2D6 gene coding forP450IID6 and two non-functional genes.18 Some of the mutationsof the CYP2D6 (D6) gene in the defective 29A and 29B alleles arealso present in the non-functional genes of the wild-type allele.17,18 ’*

To exclude false-positive detection of mutations in the

pseudogenes, the DNA fragments of the D6 gene containingmutations of the 29A and 29B allele were specifically amplified.This amplification was achieved by means of 18 bp or 20 bpoligonucleotide primers complementary to CYP2D6-uniqueintronic sequences on either side of the mutations of interest (fig 2).These primers are complementary to the following stretches of theCYP2D6 sequence (the numbering corresponds to that used byKimura et al:19 primer 1 (ATTTCCCAGCTGGAATCC) 1385-1402 ; primer 2 (GAGACTCCTCGGTCTCTC) 2105-2122;primer 3 (GCGGAGCGAGAGACCGAGGA) 2098-2117, andprimer 4 (CCGGCCCTGACACTCCTTCT) 3181-3200. Thereaction was carried out in a total volume of 50 pl in the presence of0-8 mmol/1 magnesium chloride, 10 mmol/1 "tris"-hydrochloric

531

acid, pH 83, 50 mmol/1 potassium chloride, 0-01% (weight/volume) gelatin, 0-2 mmol/1 of each dNTP, 0.25 nmol/1 of eachprimer, 400-600 ng genomic DNA as template, and 1.5 U Taqpolymerase (Bethesda Research Laboratories). After an initial

denaturation at 94°C for 90 s, thirty to thirty-five cycles of 60 s at94°C, 90 s at 52°C, 90s at 72°C, and a final extension period of 7 minat 72’C were done. 10 µl of each sample was then analysed on a 1 -2%agarose gel. DNA of an individual homozygous for the 11 -5 kb allelewas used as a negative control, since this allele lacks the CYP2D6gene. 19

1 pl of the products of the first reaction was used as the template intwo parallel allele-specific reactions, one with a wild-type-specificprimer and the other with a mutation-specific primer. The secondprimer in both cases was the common primer already used in thefirst PCR reaction. Fragment A (fig 2) was therefore amplified oncewith primers 4 and 5(GCTAACTGAGCACA) and once withprimers 4 and 6(GCTAACTGAGCACG), and fragment B oncewith primers 1 and 7(CGAAAGGGGCGTCC) and once withprimers 1 and 8(CGAAAGGGGCGTCT). The reactionconditions were chosen to allow amplification only when there was aperfect match between primer and template DNA. They were thesame as for the first amplification except that only 1 0 U Taqpolymerase was used. Fifteen cycles of 60 s at 94°C, 60 s at 50°C, and60 s at 72°C were carried out. 10 ul of each sample was analysed on a12% agarose gel. DNA from 3 poor metabolisers with previouslysequenced CYP2D6 alleles served as the control for this secondPCR reaction.The frequency of alleles was determined according to Nei.2O

Results

The first PCR reaction yielded a 739 bp fragment (fragmentB) with the primer pair 1/2 and a 1123 bp fragment(fragment A) with the primer pair 3/4 (fig 2). No fragmentswere amplified from the control samples with DNA from asubject with the 11 ’5/11 ’5 kb genotype.

In the allele-specific amplification the primer pair 4/5amplified a 588 bp fragment from fragment A for both 29wtand 29B alleles, which lack the frameshift mutation in exon5. The primer pair 4/6 amplified a fragment of the samelength from 29A alleles only. The 29B allele was

unambiguously identified by amplification of a 564 bpfragment from fragment B with the primer pair 1 /8, whereasamplification from the 29wt and 29A alleles occurred onlywith the primer pair 1/7 (fig 2). The combined results of allfour reactions allowed the determination of both alleles in

subjects with the 29/29 kb genotype and of the 29 kb allele insubjects with the 11 ’5/29 kb or 44/29 kb genotype. The threepossible results for each mutation are shown for the

splice-site mutation of the 29B allele in fig 3. Subject 18 has

Fig 3--Allele-specific PCR amplification products of 3 subjectswith 29/29 kb RFLP pattern.

EM=extensive metaboliser, PM = poor metaboliser

TABLE I-FREQUENCY OF ALLELES IN SUBJECTS WITH

29/29 kb Xbal RFLP PATTERN

TABLE II-ESTIMATED ALLELE FREQUENCIES OF CYP2D6GENE INPOOR (PM) AND EXTENSIVE METABOLISERS (EM)

I i I I I i

*Frequency of Xbal 29 kb allele in RFLP studies was multiplied by relative

frequencies of 3 identified alleles 29wt, 29A, and 29B as m table I.

no 29B allele, subject 37 has one 29B allele, and subject 13one or two 29B alleles. From the 29A allele-specificamplification, subjects 18 and 13 had no 29A allele andsubject 37 had one. Combined, these data show the

following genotypes: 29wt/29wt for subject 18, 29A/29B forsubject 37, and 29B/29B for subject 13, consistent with theirphenotypes (fig 3). No false-positive or false-negative resultsoccurred with the DNA of three poor metabolisers withknown sequences of both CYP2D6 alleles and of 7 subjectsof known phenotype with informative 11 5/29 kb genotypes,in whom the 29 kb allele must correspond to the phenotype.Of 9 poor metabolisers with the 29/29 kb pattern, 6 werehomozygous for the 29B allele, and 3 were heterozygous29A/29B (table I). 5 of the 6 poor metabolisers with the29/11 ’5 kb pattern had a 29B allele, and 1 had a 29A allele. Of22 extensive metabolisers (29/29 kb) 10 were homozygousfor the 29wt allele, 9 were heterozygous for the 29wt/29Balleles, and 3 heterozygous for the 29wt/29A alleles (table 1).Subjects with the 44 kb allele consistently showed

amplification with the 29B-allele-specific primers.Moreover, 2 poor metabolisers homozygous for the 44 kballele were also homozygous for this splice-site mutation.Table II gives estimates of frequencies of all alleles in theCYP2D6 gene.

Discussion

Many people with the debrisoquine poor-metaboliserphenotype experience exaggerated pharmacological or toxicresponses when they are treated with usual doses of variousdrugs.4,5 The debrisoquine polymorphism is important notonly to the affected individual but also for the developmentof new drugs and for drug regulatory authorities. There washope that RFLP analysis would allow genotyping of poormetabolisers, but only 25% could be predicted after testswith many restriction endonucleases. Our method in

combination with the previously described RFLP analysis16allows the prediction from a small sample of DNA of thephenotype of over 95% of individuals tested. In fact, PCR

532

amplification of DNA from single hair-roots, buccal

epithelial cells, blood spots, and urinary sediments21,22 hasbeen reported. DNA could also be isolated from tissues ofpatients who have died of adverse drug reactions. Theadvantage of this approach is that no probe drug has to begiven, no urine has to be collected, and there is nointerference with concurrent drug treatment, which limitsthe usual phenotyping procedure.5 We believe therefore thatgenotyping by our method is an attractive and less

ambiguous alternative to phenotyping by means of theurinary metabolic ratio.

Allele-specific amplification would in principle be

possible by a single PCR reaction instead of the twoconsecutive reactions reported here. We chose this approachbecause the CYP2D6 gene sequence is highly (97%)homologous to the neighbouring CYP2D7 suspectedpseudogenel7 which contains some of the same mutations asthe CYP2D6 of the 29B allele.18 Although we selectedmutations for amplifications which are unique to the 29A or29B allele, we cannot, from the single CYP2D7 sequencereported.,18 exclude the possibility that there are variations ofCYP2D7, and therefore we chose to exclude the CYP2D7gene as a potential source of incorrect results.

Genotyping can identify, as well as the poor-metaboliserphenotype, heterozygous carriers of a mutant allele. Thisidentification has previously been possible only by pedigreestudies. Genotyping will allow a more thorough evaluationof the apparent linkage between mutations in the CYP2D6gene and the predisposition to various diseases.3 A lowfrequency of poor-metaboliser phenotypes has been

reported in patients with certain cancers."’" The relationbetween these cancer studies and the mutations of theCYP2D6 gene is unclear, because P450IID6 does notmetabolise known environmental carcinogens. However, itmay activate as yet undescribed carcinogens, or theassociations may represent linkage to another gene.The estimates of the allele frequencies summarised in

table II are based on only 38 individuals and must beconfirmed in a larger population sample. The 5 alleles of theCYP2D6 locus now identifiable seem to account for over95% of all haplotypes in European populations. RFLPanalysis by Gaedigk and colleagues 19 has confirmed thefrequencies of the 44 kb and 11-5 kb alleles of our initialstudy .16 We have not so far found an individual with a 29 kballele who could not be classified as 29wt, 29A, or 29B.Another apparently rare, mutant allele is characterised byXbal 16 + 9 kb fragment.16,19 This and so far undetected rarealleles may be the causative allele in a few percent of poormetabolisers and could bring the proportion of individualsthat can be genotyped close to 100%.

This study was supported by grant 3.817.87 from the SwissNational Science Foundation. We thank Prof D. J. Birkett forreviewing the manuscript.

REFERENCES

1. Mahgoub A, Idle JR, Dring LG, Lancester R, Smith RL. Polymorphichydroxylation of debrisoquine in man. Lancet 1977; ii: 584-86.

2. Tucker GT, Silas JH, Iyun AO, Lennard MS, Smith AJ. Polymorphichydroxylation of debrisoquine. Lancet 1977; ii: 718.

3. Meyer UA, Zanger UM, Grant D, Blum M. Genetic polymorphisms ofdrug metabolism. In: Testa B, ed. Advances in drug research. London:Academic Press, 1989; vol 19: 197-241.

4. Eichelbaum M. Genetic polymorphism of sparteine-debrisoquineoxidation. ISI Atlas of Science 1988; 243-251.

5. Brøsen K, Gram LF. Clinical significance of the sparteine/debrisoquineoxidation polymorphism. Eur J Clin Pharmacol 1989; 36: 537-47.

6. Dahl-Puustinen M-J, Lidén A, Aim C, Nordin C, Bertilsson L.

Disposition of perphenazine is related to polymorphic debrisoquinhydroxylation in human beings. Clin Pharmacol Ther 1989; 46: 78-81.

7. von Bahr C, Guengerich FP, Morin G, Nordin C. The use of human liverbanks in pharmacogenetic research. In: Dahl SG, Gram LF, eds.Clinical pharmacology in psychiatry. Berlin: Springer-Verlag, 1985:163-71.

8. Broly F, Libersa C, Lhermitte M, Dupuis B. Inhibitory studies ofmexiletine and dextrometorphan oxidation in human liver microsomes.Biochem Pharmacol 1990; 39: 1045-53.

9. Gram LF, Brøsen K. Conditions under which genetic polymorphisms areclinically relevant. In: Alvan G, Balant LP, Bechtel PR, Boobis AR,Gram LF, Pithan K, eds. European consensus conference on

pharmacogenetics. Luxembourg: Commission of the EuropeanCommunities, 1990: 87-96.

10. Balant LP, Gundet-Remy U, Boobis AR, von Bahr C. Relevance ofgenetic polymorphism in drug metabolism in the development of newdrugs. Eur J Clin Pharmacol 1989; 36: 551-54.

11. Ayesh R, Idle JR, Ritschie JC, Crothers MJ, Hetzel MR. Metabolicoxidation phenotypes as markers for susceptibility to lung cancer.Nature 1984; 312: 169-70.

12. Caporaso N,, Hayes RB, Dosemeci M, Hoover R, Ayesh R, Hetzel M,Idle J. Lung cancer risk, occupational exposure and the debrisoquinemetabolic phenotype. Cancer Res 1989; 49: 3675-79.

13. Nebert DW, Nelson DR, Adesnik M, et al. The P450 gene superfamily:update on listing of all genes and recommended nomenclature ofchromosomal loci. DNA 1989; 8: 1-13.

14. Zanger UM, Vilbois F, Hardwick J, Meyer UA. Absence of hepaticcytochrome P450bufl causes genetically deficient debrisoquineoxidation in man. Biochemistry 1988; 27: 5447-54.

15. Gonzalez FJ, Skoda RC, Kimura S, et al. Characterization of the commongenetic defect in humans deficient in debrisoquine metabolism. Nature1988; 331: 442-46.

16. Skoda RC, Gonzalez FJ, Demierre A, Meyer UA. Two mutant alleles ofthe human cytochrome P450db1 gene (P45011D1) associated withgenetically deficient metabolism of debrisoquine and other drugs. ProcNatl Acad Sci USA 1988; 85: 5240-43.

17. Kagimoto M, Heim M, Kagimoto K, Zeugin T, Meyer UA. Multiplemutations of the human cytochrome P450IID6 gene in poormetabolisers of debrisoquine: study of the functional significance ofindividual mutations by expression of chimeric genes. J Biol Chem (inpress).

18. Kimura S, Umeno M, Skoda RC, Meyer UA, Gonzalez F. The humandebrisoquine 4-hydroxylase (CYP2D) locus: sequence andidentification of the polymorphic CYP2D6 gene, a related gene, and apseudogene. Am J Hum Genet 1989; 45: 889-904.

19. Gaedigk A, Blum M, Meyer UA, Eichelbaum M. Sparteine/debrisoquine polymorphism of drug oxidation: the 11·5 kb allele is theresult of a deletion of the 11D6 gene on chromosome 22. Naunyn-Schmiedeberg’s Arch Pharmacol 1990; 341 (suppl): abstr 435.

20. Nei M., Molecular evolutionary genetics. New York: Columbia

University Press, 1987: 151.21. Gasparini P, Savoia A, Pignatti PF, Dallapiccolas B, Novelli G.

Amplification of DNA from epithelial cells in urine. N Engl J Med1989; 320: 809.

22. Eisenstein BI. The polymerase chain reaction. N Engl J Med 1990; 322:178-83.

From The Lancet

Athletes at school

The tendency to multiply lectures, which some medical teachersdeplore, may be very usefully compensated by the encouragementand multiplication of athletic exercises in our medical schools. Thehours spent in sitting on the benches will be likely to be the moreprofitable to the mind in the proportion that the body is broughtnearer to the perfection of health and strength. The atmosphere ofthe dissecting-room is not the best medium which the student canbreathe, and the emanations of the sick-ward have their owndangers. He must bend for long hours over his books, and mustconsume the evening oil or gas. If he find relaxation from thesedepressing labours in dissipation, he will but sharpen the edge of thephysical danger to which his studies expose him. We earnestlycounsel avoidance of all forms of dissipation, and a resort to healthyactive exertion in the open air.

(Oct 28, 1865)