Genomics & Biotechnology

of 40 /40
Genomics & Biotechnology Michael D. Kane, PhD Asst. Professor, Department of Computer & Information Technology Lead Genomic Scientist, Bindley Bioscience Center Purdue University Adjunct Asst. Professor of Pharmacology Ohio Northern University

Embed Size (px)

description

Genomics & Biotechnology. Michael D. Kane, PhD Asst. Professor, Department of Computer & Information Technology Lead Genomic Scientist, Bindley Bioscience Center Purdue University Adjunct Asst. Professor of Pharmacology Ohio Northern University. Genomics Review - PowerPoint PPT Presentation

Transcript of Genomics & Biotechnology

  • Genomics & BiotechnologyMichael D. Kane, PhD

    Asst. Professor, Department of Computer & Information TechnologyLead Genomic Scientist, Bindley Bioscience CenterPurdue University

    Adjunct Asst. Professor of PharmacologyOhio Northern University

  • Genomics ReviewSingle Nucleotide Polymorphisms (SNPs)Basics of DNA DetectionSNP DiscoverySNP DetectionBiotechnologiesData FormatsGenomic Data serving as Clinical Decision Support

  • Genomics ReviewDNA is Information Storage

  • Zipped FilesDecompressionExecutable FilesGenomics Review

  • DNA is Double Stranded One strand is the coding strand and the other strand is there to stabilize the DNA sequence when not in use. Double-stranded DNA is very durable in our environment.Genomics Review

  • DNA is Double Stranded

    Anti-parallel Configuration

    Top strand is ALWAYS written 5 to 3

    When DNA is written in file, top strand is represented and bottom strand is assumed.53355335AGTCGTGATCTGCTAAATGTCTCGAAGTTCGATGCTAG||||||||||||||||||||||||||||||||||||||TCAGCACTAGACGATTTACAGAGCTTCAAGATACGATCCourier font is preferred for writing sequence data since letter spacingis independent of character content.Genomics Review

  • >gi|1924939|emb|X98411.1|HSMYOSIE Homo sapiens partial mRNA for myosin-IF CAGGAGAAGCTGACCAGCCGCAAGATGGACAGCCGCTGGGGCGGGCGCAGCGAGTCCATCAATGTGACCC TCAACGTGGAGCAGGCAGCCTACACCCGTGATGCCCTGGCCAAGGGGCTCTATGCCCGCCTCTTCGACTT CCTCGTGGAGGCCATCAACCGTGCTATGCAGAAACCCCAGGAAGAGTACAGCATCGGTGTGCTGGACATT TACGGCTTCGAGATCTTCCAGAAAAATGGCTTCGAGCAGTTTTGCATCAACTTCGTCAATGAGAAGCTGC AGCAAATCTTTATCGAACTTACCCTGAAGGCCGAGCAGGAGGAGTATGTGCAGGAAGGCATCCGCTGGAC TCCAATCCAGTACTTCAACAACAAGGTCGTCTGTGACCTCATCGAAAACAAGCTGAGCCCCCCAGGCATC ATGAGCGTCTTGGACGACGTGTGCGCCACCATGCACGCCACGGGCGGGGGAGCAGACCAGACACTGCTGC AGAAGCTGCAGGCGGCTGTGGGGACCCACGAGCATTTCAACAGCTGGAGCGCCGGCTTCGTCATCCACCA CTACGCTGGCAAGGTCTCCTACGACGTCAGCGGCTTCTGCGAGAGGAACCGAGACGTTCTCTTCTCCGAC CTCATAGAGCTGATGCAGTCCAGTGACCAGGCCTTCCTCCGGATGCTCTTCCCCGAGAAGCTGGATGGAG ACAAGAAGGGGCGCCCCAGCACCGCCGGCTCCAAGATCAAGAAACAAGCCAACGACCTGGTGGCCACACT GATGAGGTGCACACCCCACTACATCCGCTGCATCAAACCCAACGAGACCAAGCACGCCCGAGACTGGGAG GAGAACAGAGTCCAGCACCAGGTGGAATACCTGGGCCTGAAGGAAAACATCAGGGTGCGCAGAGCCGGCT TCGCCTACCGCCGCCAGTTCGCCAAATTCCTGCAGAGGTATGCCATTCTGACCCCCGAGACGTGGCCGCG GTGGCGTGGGGACGAACGCCAGGGCGTCCAGCACCTGCTTCGGGCGGTCAACATGGAGCCCGACCAGTAC CAGATGGGGAGCACCAAGGTCTTTGTCAAGAACCCAGAGTCGCTTTTCCTCCTGGAGGAGGTGCGAGAGC GAAAGTTCGATGGCTTTGCCCGAACCATCCAGAAGGCCTGGCGGCGCCACGTGGCTGTCCGGAAGTACGA GGAGATGCGGGAGGAAGCTTCCAACATCCTGCTGAACAAGAAGGAGCGGAGGCGCAACAGCATCAATCGG AACTTCGTCGGGGACTACCTGGGGCTGGAGGAGCGGCCCGAGCTGCGTCAGTTCCTGGGCAAGAAGGAGC GGGTGGACTTCGCCGATTCGGTCACCAAGTACGACCGCCGCTTCAAGCCCATCAAGCGGGACTTGATCCT GACGCCCAAGTGTGTGTATGTGATTGGGCGAGAGAAGATGAAGAAGGGACCTGAGAAAGGTCCAGTGTGT GAAATCTTGAAGAAGAAATTGGACATCCAGGCTCTGCGGGGGGTCTCCCTCAGCACGCGACAGGACGACT TCTTCATCCTCCAAGAGGATGCCGCCGACAGCTTCCTGGAGAGCGTCTTCAAGACCGAGTTTGTCAGCCT TCTGTGCAAGCGCTTCGAGGAGGCGACGCGGAGGCCCCTGCCCCTCACCTTCAGCGACACACTACAGTTT CGGGTGAAGAAGGAGGGCTGGGGCGGTGGCGGCACCCGCAGCGTCACCTTCTCCCGCGGCTTCGGCGACT TGGCAGTGCTCAAGGTTGGCGGTCGGACCCTCACGGTCAGCGTGGGCGATGGGCTGCCCAAGAACTCCAA GCCTACCGGAAAGGGATTGGCCAAGGGTAAACCTCGGAGGTCGTCCCAAGCCCCTACCCGGGCGGCCCCT GGCGCCCCCCAAGGCATGGATCGAAATGGGGCCCCCCTCTGCCCACAGGGGGGGGCCCCCTGCCCCCTGG AGAAATTCATTTGGCCCAGGGGGCACCCACAGGCCTCCCCGGCCCTCCGTCCACATCCCTGGGATGCCAG CAGACGACCCCGGGCACGTCCGCCCTCAGAGCACAACACAGAATTCCTCAACGTGCCTGACCAGGGGATG GCCGGCATGCAGAGGAAGCGCAGCGTGGGGCAACGGCCAGTGCCTGTGGGCCGACCCAAGCCCCAGCCTC GGACACATGGTCCCAGGTGCCGGGCCCTATACCAGTACGTGGGCCAAGATGTGGACGAGCTGAGCTTCAA CGTGAACGAGGTCATTGAGATCCTCATGGAAGATCCCTCGGGCTGGTGGAAGGGCCGGCTTCACGGCCAG GAGGGCCTTTTCCCAGGAAACTACGTGGAGAAGATCTGAGCTGGGCCCTGGGATACTGCCTTCTCTTTCG CCCGCCTATCTGCCTGCCGGCCTGGTGGGGAGCCAGGCCCTGCCAATGAAAGCCTCGTTTACCTGGGCTG CAATAGCCTAAAAGTCCAATCCTTTGGCCTCCAGTCCTTGCCCAGGCCCTGGGTCACCAGGTCACTGGTG CAGCCCCCGCCCCTGGGCCCTGGTTTTCCTCCAACATCACACCTGCTGCCCATTGTCCAAAACTGTGTGT GTCAAAGGGGACTAACAGCAGAATTTACCTCCCAACTGCCATGTGATTAAGAAATGGGTCTTGAGTCCTG TGCTGTTGGCAAAGTTCCAGGCACAGTTGGGGAGGGGGGGCCGGAATCCGC FASTAFileFormat

    This is how genomic information is stored in the computer world.

  • Single Nucleotide Polymorphisms (SNPs)MutationSNPChange in the base sequence of DNA

    Inherited or spontaneous

    Primary Cause of a Disease or Disorder

    Predisposes Carrier to Disease/Disorder

    Confers Disease Resistance to Carrier

    Effect of Base Change is UnknownAn ontological perspective

  • Single Nucleotide Polymorphisms (SNPs)Typically, a SNP in a gene that encodes a drug metabolism enzyme will decrease the activity of the enzyme, thereby altering how well the body clears the drug.The Area Under the Curve (AUC) is a common representation of drug metabolism kinetics A normal (mock) patients AUC (solid line, lower left) following a standard warfarin oral dose shows the changes in drug plasma concentration over time. Warfarin is metabolized to 7-hydroxywarfarin by the oxidative metabolism enzyme 2C9, which is primary mechanism for warfarin clearance. There are two variant alleles that have a reduced capability for metabolizing warfarin, with 11% and 7% frequency in the Caucasian population for variants CYP2C9*2 and CYP2C9*3, respectively. Patients who are homozygous for these variant alleles (i.e. patients have two variant copies of the 2C9 gene) experience a 65% decrease in drug clearance rate 29 (dotted line, lower left). Note that the presence of a variant allele leads to increased drug plasma concentrations above the minimum toxic concentration and markedly increases the risk of an adverse drug response.

  • Single Nucleotide Polymorphisms (SNPs)There are examples of SNPs in CYP genes (genes that encode P450 enzymes) that:SNPs in the genes promoter region can increase or decrease gene expression levels, thereby altering the total amount of P450 enzyme in the liver.

    SNPs in the CYP gene that do NOT have any effect on clearance rates for a particular drug.

  • Single Nucleotide Polymorphisms (SNPs)Discovering SNPs and linking these to altered metabolism effects.Biotechnology: DNA sequencing of cohort of people (ethnicity is important).SNP in CYP gene is discovered (i.e. an altered DNA sequence is found).New SNP population frequency is determined.3 cohorts of people are evaluated (normals, heterozygous, and homozygous for allelic variant), dosed with a known drug (substrate) in a classic pharmacokinetic study.Effect of SNP is reported, and utilized as rationale for additional studies in other known substrates. In this case, this may involve DNA studies in a cohort of patients already taking the drug that are experiencing altered efficacy or toxicity profiles.Molecular Biology methods are utilized to express the altered P450 in a non-clinical model.Effect of SNP on enzyme activity is studied (in the test tube). Note that this is only useful for non-synonymous SNPs.

  • Where do we get DNA sequence information?

    DNA Sequencing Methods-conversion of biological/bioanalytical data into sequence information

    NOTE: There are automated, high-throughput sequencing centers that COMPLETELY automate (robotics and information systems) DNA sequencing, preliminary identification and publishing.

  • 5-AAACCAGGCCGATAAGGTACTACACGAAAAAAA-3Step 1. Extend complementary sequence using free nucleotides with limiting amounts of radioactive terminating nucleotides.

    Step 2. Run product out on a electrophoresis gel.

    Step 3. Place gel against radiographic film, develop.TTTTTTTAAACCAGGCCGATAAGGTACTACACGAAAAA | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | DNA Sequencing (old method)

  • http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/D/DNAsequencing.htmlDNA Sequencing new method

  • DNA Sequencing SNP DiscoveryIUPAC = International Union of Pure and Applied Chemistry

    IUPAC codeMeaningAACCGGTTMA or CRA or GWA or TSC or GYC or TKG or TVA or C or GHA or C or TDA or G or TBC or G or TNG or A or T or C

  • DNA Sequencing can be used for the Detection of known SNPs, but other more efficient, cost-effective, high-throughput biotechnology methods have been developed (and continue to be developed).

  • The Key to DNA Detection is Sequence-Specific Affinity GC content (base paring) generally dictates thermodynamics of complementary binding. Tm = Melting TemperatureBasics of DNA Detection

  • PROBE is DNA attached to a fixed positionBasics of DNA Detection

  • Basics of DNA DetectionThree Major Methods of SNP Detection:

    RFLPHybridizationSingle-Base Extension

    These biotechnology assays concatenate (A) a DNA sample preparation step, and (B) an analytical-instrument detection step.

    Keep in mind that these SNP assays are aimed at KNOWN SNPs, and are developed to determine if the patients DNA sample is one of three states:

    Homozygous normalHeterozygous (one normal, one altered base)Homozygous abnormal (both bases are altered)

  • Basics of DNA DetectionAGATGCTCGATAATGATCGCTATCTACGAGCTATTACTAGCGATAGATGCTCGATAATGATCGCTATCTACGAGCTATTACTAGCGATHomozygous (NORMAL)HeterozygousHomozygous (ABNORMAL)AGATGCTCGATAATGATCGCTATCTACGAGCTATTACTAGCGATAGATGCTCGAGAATGATCGCTATCTACGAGCTCTTACTAGCGATAGATGCTCGAGAATGATCGCTATCTACGAGCTCTTACTAGCGATAGATGCTCGAGAATGATCGCTATCTACGAGCTCTTACTAGCGAT2 copies of every CYP gene

  • >gi|13699817|ref|NM_000771.2| Homo sapiens cytochrome P450, family 2, subfamily C, polypeptide 9 (CYP2C9), mRNA ATGGATTCTCTTGTGGTCCTTGTGCTCTGTCTCTCATGTTTGCTTCTCCTTTCACTCTGGAGACAGAGCT CTGGGAGAGGAAAACTCCCTCCTGGCCCCACTCCTCTCCCAGTGATTGGAAATATCCTACAGATAGGTAT TAAGGACATCAGCAAATCCTTAACCAATCTCTCAAAGGTCTATGGCCCGGTGTTCACTCTGTATTTTGGC CTGAAACCCATAGTGGTGCTGCATGGATATGAAGCAGTGAAGGAAGCCCTGATTGATCTTGGAGAGGAGT TTTCTGGAAGAGGCATTTTCCCACTGGCTGAAAGAGCTAACAGAGGATTTGGAATTGTTTTCAGCAATGG AAAGAAATGGAAGGAGATCCGGCGTTTCTCCCTCATGACGCTGCGGAATTTTGGGATGGGGAAGAGGAGC ATTGAGGACCGTGTTCAAGAGGAAGCCCGCTGCCTTGTGGAGGAGTTGAGAAAAACCAAGGCCTCACCCT GTGATCCCACTTTCATCCTGGGCTGTGCTCCCTGCAATGTGATCTGCTCCATTATTTTCCATAAACGTTT TGATTATAAAGATCAGCAATTTCTTAACTTAATGGAAAAGTTGAATGAAAACATCAAGATTTTGAGCAGC CCCTGGATCCAGATCTGCAATAATTTTTCTCCTATCATTGATTACTTCCCGGGAACTCACAACAAATTAC TTAAAAACGTTGCTTTTATGAAAAGTTATATTTTGGAAAAAGTAAAAGAACACCAAGAATCAATGGACAT GAACAACCCTCAGGACTTTATTGATTGCTTCCTGATGAAAATGGAGAAGGAAAAGCACAACCAACCATCT GAATTTACTATTGAAAGCTTGGAAAACACTGCAGTTGACTTGTTTGGAGCTGGGACAGAGACGACAAGCA CAACCCTGAGATATGCTCTCCTTCTCCTGCTGAAGCACCCAGAGGTCACAGCTAAAGTCCAGGAAGAGAT TGAACGTGTGATTGGCAGAAACCGGAGCCCCTGCATGCAAGACAGGAGCCACATGCCCTACACAGATGCT GTGGTGCACGAGGTCCAGAGGTACATTGACCTTCTCCCCACCAGCCTGCCCCATGCAGTGACCTGTGACA TTAAATTCAGAAACTATCTCATTCCCAAGGGCACAACCATATTAATTTCCCTGACTTCTGTGCTACATGA CAACAAAGAATTTCCCAACCCAGAGATGTTTGACCCTCATCACTTTCTGGATGAAGGTGGCAATTTTAAG AAAAGTAAATACTTCATGCCTTTCTCAGCAGGAAAACGGATTTGTGTGGGAGAAGCCCTGGCCGGCATGG AGCTGTTTTTATTCCTGACCTCCATTTTACAGAACTTTAACCTGAAATCTCTGGTTGACCCAAAGAACCT TGACACCACTCCAGTTGTCAATGGATTTGCCTCTGTGCCGCCCTTCTACCAGCTGTGCTTCATTCCTGTC TGAAGAAGAGCAGATGGCCTGGCTGCTGCTGTGCAGTCCCTGCAGCTCTCTTTCCTCTGGGGCATTATCC ATCTTTGCACTATCTGTAATGCCTTTTCTCACCTGTCATCTCACATTTTCCCTTCCCTGAAGATCTAGTG AACATTCGACCTCCATTACGGAGAGTTTCCTATGTTTCACTGTGCAAATATATCTGCTATTCTCCATACT CTGTAACAGTTGCATTGACTGTCACATAATGCTCATACTTATCTAATGTAGAGTATTAATATGTTATTAT TAAATAGAGAAATATGATTTGTGTATTATAATTCAAAGGCATTTCTTTTCTGCATGATCTAAATAAAAAG CATTATTATTTGCTG We will use CYP2C9*3 (7% frequency in Caucasian population) for our examplesWhat does a population frequency of 7% mean?How many people (out of 1,000) would be heterozygous for CYP2C9*3?How many people (out of 1,000) would be homozygous for CYP2C9*3?705How many people (out of 1,000) would be at risk for decreased CYP2C9 activity (*2 = 11%;*3 =7%)?

    CYP FamilyAlleleNucleotide ChangeEnzyme Activity ChangeAssociated Drug Concentration Change1A2CYP1A2*1C-3860 G>CDecreasesIncreases2C9CYP2C9*3A1075 A>CDecreasesIncreases3A4CYP3A4*18A878 T>CIncreasesDecreases

  • Nonsynonymous mutations in CYP2C9 with functional effects Non-synonymous mutations with functional activity are listed. Those that functional activity has not been examined were not listed.

    AllelesNucleotide change in cDNAAmino acid changeEnzymatic activityCYP2C9 * 2430C>TArg144CysDecrease: an approximately 50% decrease of the maximum rate of metabolism (Vmax) and 3050% lower turnover (kcat) of S-warfarinCYP2C9 * 31075A>CIle359LeuDecrease: a markedly higher Km and lower intrinsic clearance with an approximately 90% decrease of S-warfarinCYP2C9 * 41076T>CIle359ThrDecrease: 7281% reduction of intrinsic clearance of diclofenacCYP2C9 * 51080C>GAsp360GluDecrease: intrinsic clearance of warfarin approximately 10% of wild typeCYP2C9 * 6del818AFrame shiftNullCYP2C9 * 8449G>AArg150HisIncrease: more than two-fold increase in the intrinsic clearance of tolbutamideCYP2C9 * 111003C>TArg335TrpDecrease: a three-fold increase in the Km and more than a two-fold decrease in the intrinsic clearance of tolbutamideCYP2C9 * 121465C>TPro489SerDecrease: a modest decrease in the Vmax and the intrinsic clearance of tolbutamideCYP2C9 * 13269T>CLeu90ProDecrease: decreased activity toward all studied CYP2C9 substratesCYP2C9 * 14374G>AArg125HisDecrease: 8090% lower catalytic activity toward tolbutamideCYP2C9 * 15485C>ASer162XNullCYP2C9 * 16895A>GThr299AlaDecrease: 8090% lower catalytic activity toward tolbutamideCYP2C9 * 171144C>TPro382SerDecrease: modest 30 to 40% decreases in caltalytic activity toward tolbutamideCYP2C9 * 191362G>CGln454HisDecrease: modest 30 to 40% decreases in caltalytic activity toward tolbutamide

  • Missense mutations with functional effects mapped in the crystal structure of human CYP2C9 protein bound with warfarin (PDB: 10G5). S-warfarin and heme are shown in the skeleton model with pink and red, respectively. Amino acid residues are shown in the sphere mode with colors.

  • Biotechnologies - PCREssentially all SNP detection methods utilize PCR (Polymerase Chain Reaction) as a sample preparation step to DRAMATICALLY INCREASE or AMPLIFY the small DNA region under investigation.

    PCR is by far the most common DNA molecular biology technique utilized, and is used for gene cloning, gene sequencing, most DNA analysis methods, BUT can ONLY be used in known genomic regions and models (i.e. the DNA sequence under investigation must have already been sequenced to utilize PCR).

  • PCR Concept: Amplification of a relatively short piece of DNA for manipulation or sequencing.

    Driving phenomena of PCR: Heating and Cooling

    Heating: Double-stranded DNA comes apart when heated to near boiling. This is also called denaturing or melting.

    Cooling: Complementary DNA comes together when cooled. This is also called renaturing, annealing or hybridizing.HEATINGCOOLINGDouble-Stranded DNASingle-Stranded DNA

  • Molecular Basis of PCR: Polymerase Activity

    A Polymerase is an enzyme that synthesizes DNA.1) DNA can ONLY be synthesized using the complementary strand!2) Polymerases synthesize DNA in the 5 3 direction!5-GTCGATGTCTGATCAATTGGGCTGATCATGTCGATGATGCTAGAAT-3 3CTACGATCTTA-55-GTCGATGTCTGATCAATTGGGCTGATCATGTCGATGATGCTAGAAT-3 ACTAGTACAGCTACTACGATCTTA-5

  • PCR uses the following reagents to AMPLIFY sections of DNA

    DNA templatePolymeraseFree Nucleotides (which are incorporated during DNA synthesis)PCR Primers

    Primers are two short pieces of DNA (each with a unique sequence) that are complementary to the two different strands of the DNA template.

    In line diagrams, the primers are designated as arrows, where the arrows point in the direction of 3 DNA synthesis.

  • HEATINGDouble-Stranded DNASingle-Stranded DNA5

    33

    5PCR Primers

  • 5-GGATGGAACACTGGGGGGAGCCGATACCCAGGACAGGGCAGTCCTGGAGGCAACCGTTATCCACCTCAGGGAGGGGGTGGCTGGGGT-33-CCTACCTTGTGACCCCCCTCGGCTATGGGTCCTGTCCCGTCAGGACCTCCGTTGGCAATAGGTGGAGTCCCTCCCCCACCGACCCCA-5Double-Stranded DNA5-GGATGGAACACTGGGGGGAGCCGATACCCAGGACAGGGCAGTCCTGGAGGCAACCGTTATCCACCTCAGGGAGGGGGTGGCTGGGGT-3

    3-CCTACCTTGTGACCCCCCTCGGCTATGGGTCCTGTCCCGTCAGGACCTCCGTTGGCAATAGGTGGAGTCCCTCCCCCACCGACCCCA-5HEAT (95C, 30 seconds)Single-Stranded DNACOOL (60C, 30 seconds)5-GGATGGAACACTGGGGGGAGCCGATACCCAGGACAGGGCAGTCCTGGAGGCAACCGTTATCCACCTCAGGGAGGGGGTGGCTGGGGT-3 3-CCCTCCCCCACCGACCCCA-5

    5-GGATGGAACACTGGGGGGA-33-CCTACCTTGTGACCCCCCTCGGCTATGGGTCCTGTCCCGTCAGGACCTCCGTTGGCAATAGGTGGAGTCCCTCCCCCACCGACCCCA-5PCR Primer Annealing

  • 5-GGATGGAACACTGGGGGGAGCCGATACCCAGGACAGGGCAGTCCTGGAGGCAACCGTTATCCACCTCAGGGAGGGGGTGGCTGGGGT-3 CTCGGCTATGGGTCCTGTCCCGTCAGGACCTCCGTTGGCAATAGGTGGAGTCCCTCCCCCACCGACCCCA-5

    5-GGATGGAACACTGGGGGGAGCCGATACCCAGGACAGGGCAGTCCTGGAGGCAACCGTTATCCACCTCAGGGA3-CCTACCTTGTGACCCCCCTCGGCTATGGGTCCTGTCCCGTCAGGACCTCCGTTGGCAATAGGTGGAGTCCCTCCCCCACCGACCCCA-5Polymerase ElongationHEAT (72C, 30 seconds)5-GGATGGAACACTGGGGGGAGCCGATACCCAGGACAGGGCAGTCCTGGAGGCAACCGTTATCCACCTCAGGGAGGGGGTGGCTGGGGT-33-CCTACCTTGTGACCCCCCTCGGCTATGGGTCCTGTCCCGTCAGGACCTCCGTTGGCAATAGGTGGAGTCCCTCCCCCACCGACCCCA-5

    5-GGATGGAACACTGGGGGGAGCCGATACCCAGGACAGGGCAGTCCTGGAGGCAACCGTTATCCACCTCAGGGAGGGGGTGGCTGGGGT-33-CCTACCTTGTGACCCCCCTCGGCTATGGGTCCTGTCCCGTCAGGACCTCCGTTGGCAATAGGTGGAGTCCCTCCCCCACCGACCCCA-5DNA Synthesis after 1 cycle of PCR = 1 double stranded DNA is now 2 copies

  • 95C30 Sec.60C30 Sec.72C30 Sec.Denaturing StepPrimer Annealing StepElongation StepTimeTemperature

  • Most PCR applications use 30 cycles (230 = 1.07 billion), representing an amplification of about 1 billion fold.

  • Basics of DNA DetectionThree Major Methods of SNP Detection:

    RFLPHybridizationSingle-Base Extension

    These biotechnology assays concatenate (A) a DNA sample preparation step, and (B) an analytical-instrument detection step.

    Keep in mind that these SNP assays are aimed at KNOWN SNPs, and are developed to determine if the patients DNA sample is one of three states:

    Homozygous normalHeterozygous (one normal, one altered base)Homozygous abnormal (both bases are altered)

  • Biotechnologies - RFLPRestriction Fragment Length Polymorphism (RFLP, or sometimes called PCR-RFLP) is used to assay DNA sequences arising from their differing nucleotide sequences.

    1) The DNA region that harbors the known SNP is amplified using PCR.2) The PCR product (short double-stranded DNA) is treated (digested or cut) with a restriction enzyme, which cuts DNA at specific sequence sites.3) The results of the restriction enzyme digestion is analyzed to determine the number and/or size of the resulting DNA strands.RestrictionEnzymeDigestion12

  • Using CYP2C9*3 (7% frequency in Caucasian population)Biotechnologies - RFLP>gi|13699817|ref|NM_000771.2| Homo sapiens cytochrome P450, family 2, subfamily C, polypeptide 9 (CYP2C9), mRNA ATGGATTCTCTTGTGGTCCTTGTGCTCTGTCTCTCATGTTTGCTTCTCCTTTCACTCTGGAGACAGAGCT CTGGGAGAGGAAAACTCCCTCCTGGCCCCACTCCTCTCCCAGTGATTGGAAATATCCTACAGATAGGTAT TAAGGACATCAGCAAATCCTTAACCAATCTCTCAAAGGTCTATGGCCCGGTGTTCACTCTGTATTTTGGC CTGAAACCCATAGTGGTGCTGCATGGATATGAAGCAGTGAAGGAAGCCCTGATTGATCTTGGAGAGGAGT TTTCTGGAAGAGGCATTTTCCCACTGGCTGAAAGAGCTAACAGAGGATTTGGAATTGTTTTCAGCAATGG AAAGAAATGGAAGGAGATCCGGCGTTTCTCCCTCATGACGCTGCGGAATTTTGGGATGGGGAAGAGGAGC ATTGAGGACCGTGTTCAAGAGGAAGCCCGCTGCCTTGTGGAGGAGTTGAGAAAAACCAAGGCCTCACCCT GTGATCCCACTTTCATCCTGGGCTGTGCTCCCTGCAATGTGATCTGCTCCATTATTTTCCATAAACGTTT TGATTATAAAGATCAGCAATTTCTTAACTTAATGGAAAAGTTGAATGAAAACATCAAGATTTTGAGCAGC CCCTGGATCCAGATCTGCAATAATTTTTCTCCTATCATTGATTACTTCCCGGGAACTCACAACAAATTAC TTAAAAACGTTGCTTTTATGAAAAGTTATATTTTGGAAAAAGTAAAAGAACACCAAGAATCAATGGACAT GAACAACCCTCAGGACTTTATTGATTGCTTCCTGATGAAAATGGAGAAGGAAAAGCACAACCAACCATCT GAATTTACTATTGAAAGCTTGGAAAACACTGCAGTTGACTTGTTTGGAGCTGGGACAGAGACGACAAGCA CAACCCTGAGATATGCTCTCCTTCTCCTGCTGAAGCACCCAGAGGTCACAGCTAAAGTCCAGGAAGAGAT TGAACGTGTGATTGGCAGAAACCGGAGCCCCTGCATGCAAGACAGGAGCCACATGCCCTACACAGATGCT GTGGTGCACGAGGTCCAGAGGTACATTGACCTTCTCCCCACCAGCCTGCCCCATGCAGTGACCTGTGACA TTAAATTCAGAAACTATCTCATTCCCAAGGGCACAACCATATTAATTTCCCTGACTTCTGTGCTACATGA CAACAAAGAATTTCCCAACCCAGAGATGTTTGACCCTCATCACTTTCTGGATGAAGGTGGCAATTTTAAG AAAAGTAAATACTTCATGCCTTTCTCAGCAGGAAAACGGATTTGTGTGGGAGAAGCCCTGGCCGGCATGG AGCTGTTTTTATTCCTGACCTCCATTTTACAGAACTTTAACCTGAAATCTCTGGTTGACCCAAAGAACCT TGACACCACTCCAGTTGTCAATGGATTTGCCTCTGTGCCGCCCTTCTACCAGCTGTGCTTCATTCCTGTC TGAAGAAGAGCAGATGGCCTGGCTGCTGCTGTGCAGTCCCTGCAGCTCTCTTTCCTCTGGGGCATTATCC ATCTTTGCACTATCTGTAATGCCTTTTCTCACCTGTCATCTCACATTTTCCCTTCCCTGAAGATCTAGTG AACATTCGACCTCCATTACGGAGAGTTTCCTATGTTTCACTGTGCAAATATATCTGCTATTCTCCATACT CTGTAACAGTTGCATTGACTGTCACATAATGCTCATACTTATCTAATGTAGAGTATTAATATGTTATTAT TAAATAGAGAAATATGATTTGTGTATTATAATTCAAAGGCATTTCTTTTCTGCATGATCTAAATAAAAAG CATTATTATTTGCTG

  • GAGGTCCAGAGGTACATTGACCTTCTCCCCACBiotechnologies - RFLPGAGGTCCAGAGGTACCTTGACCTTCTCCCCACCYP2C9*1CYP2C9*3Restriction Enzyme: Kpn I, which cuts at GGTACC

  • Biotechnologies - RFLPCYP2C9*1/*1PCR product = 105 base pairs, which spans the variant site.

    After KpnI digestions105 bpCYP2C9*1/*3CYP2C9*3/*3# of DNAFragments1

    3

    2+85 bp20 bp85 bp20 bp

  • Biotechnologies - HybridizationIn a hybridization-based SNP assay, the difference in DNA sequence is sufficient to disrupt natural double-stranded re-naturing / annealing / hybridization. This is accomplished by using relatively short DNA capture probes.

    In long strands of DNA, a single mismatched base pair is NOT sufficient to disrupt the formation of a double-stranded DNA hybrid.>30 bpTAGTCGCTAGATGATCGATCAGCGAGCTACTAGCNote: This is NOT a SNP!!!, it is just an example of double-stranded DNA with a mismatched base pair!!!

  • Biotechnologies Hybridization

    DNA Microarray TechnologyPCR used to generate short DNA strand that harbors the variant position.PCR uses a primer with a fluorescent tag for detection.PCR products are hybridized to the microarray surface, then analyzed.5

    33

    5PCR Primers

  • Biotechnologies Hybridization

    DNA Microarray TechnologyFluoro-PCR productSNP locationMicroarray = 1x3 glass slideThese 2 spots contain a different short DNA strand that is complementary to CYP2C9*1 or CYP2C9*2