Genomics and genome editing: New tools for developing desired … › aes › AES › RCConf ›...
Transcript of Genomics and genome editing: New tools for developing desired … › aes › AES › RCConf ›...
Dr. Karl Ravet & Prof. Stephen Pearce
Genomics and genome editing:
New tools for developing desired traitsin CO winter wheat.
AES Research Center Conference,January 10th, 2019.
What challenges does agriculture face today?
A growing population… … in a changing environment
elevate cereal production by 50 to 70 % by 2100.
Soil stress‐ Nutrient uptake‐ Contamination‐ Soil‐borne pathogens
Abiotic stress‐ Salinity‐ Drought‐ Heat‐ Frost
Biotic stress‐ Viruses‐Microbes‐ Herbivores‐Weeds
Quality‐ Protein content‐Micronutrients‐ Food Safety‐ Consumer preference
Productivity‐ Grain size‐ Grain number‐ Biomass
Crop improvement and food security
Develop novel genetic resources in crops to improve production of healthy food andto adapt to future environmental conditions.
Natural diversity Mutagenesis
Beneficial traits are driven by changes in genomes:
Drought susceptible
Drought resistant
Naturally‐occurring modifications in genome
Artificially‐induced randommodifications in genome
X
Beneficial traits and conventional crop breeding:
Drought susceptible
Drought resistant
Phenotypicselection
Ancestral
Breeding
X
Beneficial traits and conventional crop breeding:
Drought susceptible
Drought resistant
Phenotypicselection
Geneticselection
Ancestral
Breeding
Mod
ern
Breeding
The new era: genomics
2001
2009
2018
Genetic region responsible for trait
The new era: genomics
2001
2009
2018
2000
2002
Genetic region responsible for trait
…ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC…Genomic sequence responsible for trait‐ Presence/absence of a gene‐ Subtle modification in a gene sequence
The new tool for crop improvement:genome editing
Genome editing (genome engineering) is a type of genetic engineering in which DNA is inserted, deleted, modified or replaced in the genome of living organisms.
Unlike early genome engineering techniques (referred as techniques leading to the creation of Genetically Modified Organisms) that randomly insert genetic material into a host genome, genome editing targets DNA changes to specific location in the genome.
There is no stable incorporation of foreign DNA in the genome of the resulting edited plant.The result is similar to mutagenesis (subtle change), but specifically targeted (more efficient, less off‐target impacts)
Regulatory agencies consider genome edited plants as similar to mutagenized plants, therefore edited plants should not be subjected to GMO regulations.
The CRISPR-Cas9 system and its origin
2015
Bacterial immune system against virus
Cas genes
CRISPR‐associated (Cas) Clustered Regularly Interspersed Short Palindromic Repeats
Bacterial DNA
The CRISPR-Cas9 system and its origin
2015
Bacterial immune system against virus
Viral DNA
Cas genes
CRISPR‐associated (Cas) Clustered Regularly Interspersed Short Palindromic Repeats
Bacterial DNA
The CRISPR-Cas9 system and its origin
2015
Bacterial immune system against virus
Viral DNA
1. memory
Cas genes
CRISPR‐associated (Cas) Clustered Regularly Interspersed Short Palindromic Repeats
Bacterial DNA
The CRISPR-Cas9 system and its origin
2015
Bacterial immune system against virus
Viral DNA
1. memory2. recognition
Cas genes
CRISPR‐associated (Cas) Clustered Regularly Interspersed Short Palindromic Repeats
Bacterial DNA
The CRISPR-Cas9 system and its origin
2015
Cas genes
CRISPR‐associated (Cas) Clustered Regularly Interspersed Short Palindromic Repeats
Bacterial immune system against virus
Bacterial DNA
Viral DNA
1. memory3. degradation
2. recognition
The CRISPR-Cas9 system and its origin
2015
Cas genes
CRISPR‐associated (Cas) Clustered Regularly Interspersed Short Palindromic Repeats
Bacterial immune system against virus
Bacterial DNA
Viral DNA
1. memory
2. recognition
3. degradation
How can CRISPR be used in crop improvement?If we incorporate a CRISPR‐Cas system in plants, and ask plants to target their own DNA,we can specifically induce DNA changes at desired location in the plant genome.
bacterial Cas9
guide RNAs
Plant DNAGene of interest 1
1 2
Gene of interest 2
3 4 5
Examples of ongoing applications in bread wheat
Knocking‐out a gene
Cas 9guide RNAs
1 2 3 4 5 6
ASN2
ASN2
ASN2
Genome A
Genome B
Genome D
Non functional ASN2(low acrylamide content in grain)
‐‐‐deletion‐‐‐Expectedoutcome
Examples of ongoing applications in bread wheat
Knocking‐out a gene
Cas 9guide RNAs
1 2 3 4 5 6
ASN2
ASN2
ASN2
Genome A
Genome B
Genome D
Non functional ASN2(low acrylamide content in grain)
‐‐‐deletion‐‐‐Expectedoutcome
Allele replacement
Cas 9guide RNAs
1 2 resistant ACCase
susceptible ACCaseA/B/D genomes
A
T
resistant ACCaseA
Subtle change in ACCase to obtain a resistant isoform(tolerance to herbicides based on Fop and Dim chemistries)
Expectedoutcome
Aresistant ACCase
Replacement DNA
Delivery of the CRISPR components in wheat.
Transgenic approach
Transform wheat plants with a DNA construct which contains all required components (Cas9, guide RNAs, and alternative DNA template when allele replacement).
Transformation protocol for Chinese Spring (model cultivar) available.Transformation protocol for CO winter wheat under development.
Yields to transgenic plants (=GMO) but, transgenic part can be removed from the genome through breeding.
DNAchange
CRISPR‐Cassystem
chr.1 chr.2
Transient transgenic step
selection
DNAchange
chr.1 chr.2
Non‐GMO edited crop
Delivery of the CRISPR components in wheat.
Transgenic approach In vitro approach
Transform wheat plants with a DNA construct which contains all required components (Cas9, guide RNAs, and alternative DNA template when allele replacement).
Transformation protocol for Chinese Spring (model cultivar) available.Transformation protocol for CO winter wheat under development.
Yields to transgenic plants (=GMO) but, transgenic part can be removed from the genome through breeding.
DNAchange
CRISPR‐Cassystem
chr.1 chr.2
Transient transgenic step Wild‐type crop
selection
DNAchange
Incubate wheat plants (embryos) with all required components (Cas9, guide RNAs, and alternative DNA template when allele replacement), all directly synthesized in vitro.
No incorporation of foreign DNA in the plant genome.
Components will be progressively degraded in the plant cell. Does not yield to any GMO intermediate.
DNAchange
chr.1 chr.2
Non‐GMO edited crop Non‐GMO edited crop
A set of target genes for various desired traits
Herbicide tolerance
Nutritional quality
Flour color
ACCase genes
PPO genes
FRO‐HMA genes
Virus resistanceeIF genes
Drought toleranceERA genes
Plant/Grain sizeELA‐DWF genes
Acrylamide contentASN genes
Acknowledgments
Dr. Ing. Agro. Facundo TabbitaINTA, Argentina.
Andrew Katz(PhD Student)CSU
Elana BoltzUndergrad. StudentCSU
Genome editing
Patricia VailUndergrad. StudentCSU
Jack MentzerUndergrad. StudentCSU
Winter and spring wheat transformation
Funding