GeneticDiversityandVirulenceFactorsof S.aureus Isolatedfrom … · 2020. 8. 27. ·...

Research ArticleGeneticDiversity andVirulence Factors of S aureus Isolated fromFood Humans and Animals

Roberto Adame-Gomez1 Natividad Castro-Alarcon2 Amalia Vences-Velazquez3

Jeiry Toribio-Jimenez4 Abigail Perez-Valdespino5 Marco- Antonio Leyva-Vazquez6

and Arturo Ramırez-Peralta 1

1Laboratorio de Investigacion en Patometabolismo Microbiano Universidad Autonoma de Guerrero ChilpancingoGuerrero Mexico2Laboratorio de Investigacion en Microbiologıa Universidad Autonoma de Guerrero Chilpancingo Guerrero Mexico3Laboratorio de Investigacion en Inmunobiologia y Diagnostico Molecular Universidad Autonoma de GuerreroChilpancingo Guerrero Mexico4Laboratorio de Investigacion en Microbiologıa Molecular y Biotecnologıa Ambiental Universidad Autonoma de GuerreroChilpancingo Guerrero Mexico5Laboratorio de Ingenieria Genetica Departamento de Bioquımica Escuela Nacional de Ciencias BiologicasInstituto Politecnico Nacional Ciudad de Mexico Mexico6Laboratorio de Investigacion en Biomedicina Molecular Universidad Autonoma de Guerrero Chilpancingo Guerrero Mexico

Correspondence should be addressed to Arturo Ramırez-Peralta ramirezperaltauagrogmailcom

Received 27 March 2020 Accepted 25 May 2020 Published 27 August 2020

Academic Editor Joseph Falkinham

Copyright copy 2020 Roberto Adame-Gomez et al +is is an open access article distributed under the Creative CommonsAttribution License which permits unrestricted use distribution and reproduction in anymedium provided the original work isproperly cited

Staphylococcus aureus is a commensal bacterium in humans and animals able to adapt to multiple environments +e aim of thisstudy was to compare the genetic diversity and virulence profiles of strains of S aureus isolated from food (29 strains) humans (43strains) and animals (8 strains) 80 lipase-producing strains belonging to a biobank of 360 isolates identified phenotypically asS aureus were selected Confirmation of the species was made by amplifying the spA gene and 80 (6480) of the strains wereconfirmed within this species +e virulence profile of each of the isolates was determined by PCR +e seA gene coding forenterotoxin A was found in 531 of the strains the saK gene which codes for Staphylokinase was amplified in 578 of thestrains and finally the hlB gene coding for β-Hemolysin was amplified in 172 +e profile of antimicrobial resistance wasdetermined by the Kirby Bauer method showing that the strains from food presented greater resistance to erythromycin (407)and ciprofloxacin (185) while in strains isolated from humans were to erythromycin (484) and clindamycin (212) Also instrains from animals a high resistance to erythromycin was observed (75) +e frequency of MRSA was 125 due to thepresence of themec gene and resistance to cefoxitin Of the total strains 687 were typed by PCR-RFLP of the coa gene using theAluI enzyme derived from this restriction 17 profiles were generated Profile 4 (490 bp 300 bp) was the most frequent containinga higher number of strains with a higher number of virulence factors and antimicrobial resistance which is associated with greateradaptation to different environments In this study a wide genetic diversity of strains of S aureus from different foods humansand animals was found +is demonstrates evolution genetic versatility and therefore the adaptation of this microorganism indifferent environments

1 Introduction

Staphylococcus aureus is a commensal bacterium that is partof the microbiota of the skin and mucous membranes of

humans and some animals However when the conditionsin the host are adequate for the proliferation of the mi-croorganism it causes pathologies in humans such aspneumonia endocarditis osteomyelitis impetigo skin

HindawiInternational Journal of MicrobiologyVolume 2020 Article ID 1048097 10 pageshttpsdoiorg10115520201048097

infections and healthcare-associated infections (HAI) [1] inanimals it is associated with infections in mammary glands[2] and in the case of food S aureus produces a greatdiversity of enterotoxins that generate food poisoning inhumans due to the consumption of these [3] being a mi-croorganism it also affects the quality of foods such as rawmeat products [4] and milk and dairy products [5]

+e successful colonization of S aureus in multipleenvironments different inanimate hosts or matrices ispossible due to the large number of virulence factors that thismicroorganism uses [6] S aureus produces a large numberof enzymes that promote the virulence of this microor-ganism including coagulase staphylokinase and β-lacta-mases [7] Among the virulence factors that have animportant role in pathogenicity are adhesins and surfaceproteins such as protein A and in the particular case oftoxins enterotoxins of S aureus (SE) and β-Hemolysin(Hlb) [8]

S aureus has the ability to control the expression ofvirulence factors according to the environmental conditionsin which it is found through a global regulation systemknown as accessory regulatory gene (Agr) [8] and the sigmafactor (σB) [9] In addition to gene regulation the adaptationof S aureus in different microenvironments with differentenvironmental nutritional and stress conditions couldgenerate the acquisition of genes coding for virulence factorsthat allow its survival [10] +e mobilization of several genesthat code for virulence factors in the same mobile geneticelement has been observed for example in the bacterio-phage βC-φs the staphylokinase gene and the complementinhibitor protein are mobilized with enterotoxin genes andPanton- Valentine leucocidin[11] Also in the Staphylo-coccus aureus pathogenicity islands (SaPIs) this phenom-enon has been observed mobilizing two genes ofenterotoxins along with the toxin gene of toxic shocksyndrome (tsst-1) and the adhesion protein Bap [12] An-other example is the catabolic mobile element of argininethat is transported together with the methicillin resistancecassette (SCCmec) due to its proximity and which has beenrelated to strains that have specific subtypes of SCCmec[1010] Transfer of antibiotic resistance genes is common inStaphylococcal species [13] Resistance against methicillinlincosamides macrolides aminoglycosides and a combi-nation of these antibiotics has been frequently reported instaphylococci [14]

For this reason it has been difficult to separate a group ofS aureus clones with certain virulence factors that generatedisease from those clones that are only commensals+erefore molecular typing techniques such as pulsed-fieldgel electrophoresis (PFGE) and multilocus sequencingtyping (MLST) [15] have been designed being the PFGEtechnique the gold standard for the typing of S aureusHowever due to the high costs other alternatives of mo-lecular biology have been proposed such as PCR-RFLPs ofthe coagulase gene (coa) or the protein A gene (spA) [16 17]genes conserved in genus and species respectively In thecase of typing by spA a 100 relationship was found withPFGE [18] Currently the restriction of these genes con-tinues to be used to typify strains of S aureus of different

origins [19 20] However the rapid transformation of thisbacterium generates the need for the study of virulencefactors which could provide information on their functionin the dissemination and adaptation of the same clone ofS aureus in multiple environments considering that moststudies evaluate genetic diversity in a particular environ-ment +erefore the objective of this study was to comparethe genetic diversity and virulence factor profiles of strains ofS aureus from food humans and animals

2 Materials and Methods

21 Strains For this study 80 strains previously identified atgenus level were selected by primary isolation in BairdParker agar Gram stain fermentation of mannitol andtrehalose coagulase and positive catalase from a collectionof 360 strains of S aureus isolated from different sources(food humans and animals) which were stored at minus20degC in20 glycerol (Merck Millipore Cat 356352 Germany)brain heart infusion broth BHI (Oxoid Cat CM1135 USA)+e production of enterotoxin A had been previously de-termined by dot blot and methicillin resistance in 34 strains[21 22]+e lipase production was considered as a metaboliccharacteristic for the selection of the 80 strains for this studydue to their participation in infections in humans and an-imals as well as their survival and multiplication in con-taminated foods [23] Another important characteristic ofthis group of strains is that they were isolated from foodhumans and animals from the same city (Chilpancingosouthern Mexico) and nearby towns

Strains were cultured in BHI broth and incubated for24 h at 37degC +e control strains used in this study wereStaphylococcus aureus ATCC 29231 (sea) Staphylococcusaureus ATCC 14458 (seb) Staphylococcus aureus ATCC19095 (sec) Staphylococcus ATCC 13563 (sed) Staphylo-coccus ATCC 27664 (see) and Staphylococcus aureus ATCC25923 (coa spa hlB and sak)

22 DNAExtraction Total DNA were isolated from 1mL ofan 18 h broth culture from all the bacterial strains includingATCC strains Cells were pelleted from the cultures bycentrifugation at 10000 rpm for 10min resuspended in300 μL of lysis buffer (10mM Tris-HCl y 1mM EDTA pH80 lysozyme 1mgmL) and incubated at 37degC for 05 h oruntil viscous DNA from all preparations was subsequentlyextracted with phenol-chloroform and precipitated withethanol DNA samples were dissolved in TE buffer (10mMTris chloride-1mM EDTA [pH 80])

23 Molecular Identification of S aureus A final point PCRof the spA gene was performed to the selected strains for themolecular confirmation of S aureus with oligonucleotidesdescribed in Table 1 +e final mixture of each PCR reactioncontained 02mMof each dNTP 3mMMgCl2 02 μMof theoligonucleotides 1 U of Taq DNA polymerase (AmpliqonCat A112103 Denmark) 5 microL of 10X Buffer and 100 ng ofDNA as template +e PCR protocol started with an initialdenaturation of 5 minutes at 95degC followed by 30 cycles at

2 International Journal of Microbiology

94degC for 30 s at 52degC for 30 s and 72degC for 30 s and a finalelongation at 72degC for 5 minutes +e electrophoresis of theobtained PCR products was carried out in 2 agarose gels at80V for 60minutes+e gels were stained withMidori Green(Nippon Genetics Cat Mg04 Germany) and visualizedwith LED light (Nippon Genetics Germany)

24 Identification of Genes Coding for Virulence FactorsDetection of genes hlB mec saK pvL tsst-1 seA seB seCseD and seE coding for β-hemolysin methicillin resistanceregion staphylokinase Panton-Valentine toxin toxin of thesyndrome of the toxic shock and enterotoxins respectivelywas carried out by PCR in the final point with the oligo-nucleotides described in Table 1 +e final mixture of eachPCR reaction contained 02mM of each dNTP 3mMMgCl2 02 μM of the oligonucleotides 1 U of Taq DNApolymerase (Ampliqon Cat A112103 Denmark) 5 microL of10X Buffer and 100 ng of DNA as template In the case of theamplification of the mec gene a concentration of MgCl2 of5mM was used +e reaction mixtures were subjected to thefollowing amplification programs initial denaturation of 5minutes at 94degC followed by 30 cycles at 94degC for 30 s at52degC for 30 s and 72degC for 30 s and a final elongation at 72degCfor 5 minutes for the amplification of mec hlB pvL tsst-1seA and seE genes Initial denaturation of 5 minutes at 94degCfollowed by 30 cycles at 94degC for 30 s 52degC for 45 s and 72degCfor 45 s and a final elongation at 72degC for 5 minutes foramplification of saK seB seC and seD genes +e electro-phoresis of the obtained PCR products was carried out in 2agarose gels at 80V for 60 minutes +e gels were stainedwith Midori Green (Nippon Genetics Cat Mg04 Ger-many) and visualized with LED light (NipponGenetics CatFg05 Germany)

25 Expression of β Hemolysin To demonstrate the ex-pression of β hemolysin the strains were cultured by strikeon 5 cell blood agar incubating at 37degC under CO2 tensionfor 24 h +e strains that presented a halo of transparency inthe perimeter of the colonies were considered β-Hemolytic(hLB+) +e strains that presented α- and c-hemolysis wereconsidered hlBminus

26 Antibiotic Susceptibility Tests An inoculum of eachisolated strain equivalent to 05 McFarland scale wasswabbed onto the Muller Hinton agar plate (BD BioxonregCat PA-25403208 Mexico) and the antibiotic disc wasthen placed on the plate followed by overnight incubation at37degC +e inhibition zone was interpreted according to theClinical Laboratory Standards Institute (CLSI 2016) [27]guidelines (formerly known as the National Committee forClinical Laboratory Standards) +e tested antibiotics wereclindamycin (CC Oxoid Cat CT0064B USA) (2 μg)cefoxitin (FOX Oxoid Cat CT0119B USA) (30 μg) ri-fampicin (RA Oxoid Cat CT0207B USA) (5 μg) eryth-romycin (E Oxoid Cat CT0020B USA) (15 μg)tetracycline (TET Oxoid Cat CT0054B USA) (30 μg) andciprofloxacin (CIP Oxoid Cat CT0425B USA) (5 μg)

27 Test for Induction of Clindamycin Resistance An inoc-ulum of each isolated strain equivalent to 05 McFarlandscale was swabbed onto the Muller Hinton agar plate (BDBioxonreg Cat PA-25403208 Mexico) and the inductiontest was performed by manually placing a 2 μg clindamycin(CC Oxoid Cat CT0064B USA) disk approximately12mm from a 15 μg erythromycin (E Oxoid Cat CT0020BUSA) disk (measured edge to edge) Induction test resultswere read at 16 to 18 h using transmitted and reflected light

Table 1 Oligonucleotide primers used for molecular identification toxin gene detection and molecular typing

Gene (virulence factor) Sequence (5prime-3prime) Size of amplified product (bp) Reference

spA (protein A) spaF-CAAGCACCAAAAGAGGAA 180ndash450 [24]spaR-CACCAGGTTTAACGACAT

coa (coagulase) coaF-CGAGACCAAGATTCAACAAG 600ndash900 [16]coaR-AAAGAAAACCACTCACATCA

seA (enterotoxin A) seaF-TGCAGGGAACAGCTTTAGGC 250 [25]seaR-GTGTACCACCCGCACATTGA

seB (enterotoxin B) sebF-ATTCTATTAAGGACACTAAGTTAGGG 400 [25]sebR-ATCCCGTTTCATAAGGCGAGT

seC (enterotoxin C) secF-GTAAAGTTACAGGTGGCAAAACTTG 297 [25]secR-CATATCATACCAAAAAGTATTGCCGT

seD (enterotoxin D)sedF-

GAATTAAGTAGTACCGCGCTAAATAATATG 492 [25]sedR-GCTGTATTTTTCCTCCGAGAGT

seE (enterotoxin E) seeF-CAAAGAAATGCTTTAAGCAATCTTAGGC 480 [25]seeR-CACCTTACCGCCCAAAGCTG

hlB (hemolisin β) hlbF-GTGCACTTACTGACAATAGTGC 300 [25]hlbR-GTTGATGAGTAGCTACCTTCAGT

saK (staphylokinase) sakF-ATCCCGTTTCATAAGGCGAGT 260 +is worksakR-CACCTTACCGCCCAAAGCTG

mecA (methicillin resistant) mecaF-TCCAGATTACAACTTCACCAGG 180 [26]mecaR-CCACTTCATATCTTGTAACG

tsst-1 (toxic shock syndrome toxin) tsstF-CATCTACAAACGATAATATAAAGG 476 +is worktsstR-CATTGTTATTTTCCAATAACCACCCG

International Journal of Microbiology 3

A blunted zone of clindamycin near the erythromycin disk(D-shaped) indicated a phenotype of inducible resistance(inducible MLSB) resistance to erythromycin and clinda-mycin indicated a constitutive resistance phenotype (con-stitutive MLSB) and sensitivity a clindamycin was defined bythe absence of induction of clindamycin resistance in thearea close to the erythromycin disk [27]

28 Molecular Typing of S aureus To the molecularlyconfirmed strains as S aureus the amplification of the coagene was performed by PCR in the final point with theoligonucleotides described in Table 1 +e final mixture ofeach PCR reaction contained 02mM of each dNTP 3mMMgCl2 02 μM of the oligonucleotides 1U of Taq DNApolymerase (Ampliqon Cat A112103 Denmark) 5 microL of10X Buffer and 100 ng of DNA as template +e PCRprotocol started with an initial denaturation of 5 minutes at94degC followed by 30 cycles at 94degC for 30 s 52degC for 30 s and72degC for 60 s and a final elongation at 72degC for 5 minutesPCR product was digested for 2 hours at 37degC with 10U ofthe restriction endonuclease AluI (+ermo Scientificreg CatIVGN0446 EEUU) according to the manufacturerrsquos rec-ommended protocol [16] +e restriction digest fragmentswere detected by electrophoresis in 2 agarose gels at 70Vfor 60 minutes +e gels were stained with Midori Green(Nippon Genetics Cat Mg04 Germany) and visualizedwith LED light (Nippon Genetics Germany)

29 Statistical Analysis +e statistical package STATA V 12(STATAreg USA) was used to calculate simple frequenciesand the Chi square statistical test was used for possiblerelationships between the frequencies of virulence and an-tibiotic resistance genes in relation to the origins of isolationof the strains values of ple 005 were considered as statis-tically significant A logistic regression analysis was per-formed to estimate differences and a statistically significantrelationship among the frequencies of positive strains forsaK hlB and seA To compare the frequencies of virulencefactors and resistance to antibiotics in MSSA and MRSAstrains Fisherrsquos exact test was used

+e identity coefficient for the PCR-RFLPs technique ofthe coa gene was calculated with the following equation

D 1 minus1

N(N minus 1)1113944

S

j1nj nj minus 11113872 1113873 (1)

where N is the total number of strains in the population ofthe sample s is the total number of types described and nj isthe number of strains that belong to the type

3 Results and Discussion

In this study oligonucleotides directed to the X region of thespA gene located between the binding domain membraneand the catalytic portion (binding to FC-IgG) of protein Awere used to determine the species of S aureus polymorphicby the insertion or depletion of repeated sequences intandem of 24 bp [28] Of the 80 selected strains 80 (6480)

were molecularly confirmed as S aureus from the amplifi-cation of the spA gene +e identified strains were isolatedfrom human nostrils (1919) milk formula (22) and sur-faces (55) +e lowest percentage was obtained in vaginalexudate (17) (Table 2)

Protein A is a unique surface protein of the species withevasion functions of the immune system [7] Other markersused to determine the species were the nuc gene (whichcodes for the stable thermonuclease) [29] and the region ofthe 16S rRNA gene [19] However the amplification of thespA gene allows the typing either by a PCR-RFLP techniqueor sequencing even from the size of the product generatedindicating differences to rule out clonality of the strains dueto the insertion or loss of sequences repeated in tandem inthe amplified region With this technique 80 of the strainswere molecularly confirmed making comparison difficultbecause most of the authors commonly use nuc amplifica-tion for identification However the nuc gene has beenfound in other Staphylococcus species both coagulasepositive (S hyicus S delphini S intermediusS pseudintermedius and S schleiferi) and negative (S capitisS caprae S epidermidis S warneri S simulans S carnosusS kloosii and S saprophyticus) [30]

In the strains confirmed as S aureus the seA gene codingfor enterotoxin A was amplified in 531 followed by tsst-1with 93 and seCwith 62 and with less frequency the seDseB and seE genes with 46 31 and 15 respectively Inthe case of other toxins the staphylokinase gene (saK)frequency was 578 and that of β-Hemolysin (hLB) was172 In the case of resistance to antibiotics the frequencyof the mec gene was 125 classifying the strains as MRSA(Table 3)

Regarding the virulence profiles the most frequentlydetermined enterotoxin gene was seA similar to that re-ported by Bayomi et al [31] and Hoque et al [32] On theother hand several studies have observed the epidemio-logical transition and an increase in the frequency of thegenes of the b (seB) [11 33] c (seC) [34] and e (seE) [35]enterotoxins However in this study the frequency of thethree was low considering the frequency of seC the closestto seA as reported by Rong et al [35] +e toxin genefrequency of toxic shock syndrome (tsst-1) was even higherthan enterotoxins other than seA In this sense an increase incases of toxic shock syndrome due to S aureus has beenreported in relation to those produced by Streptococcuspyogenes [36] In addition it is important to note that thehigher frequency of tsst-1 in relation to the enterotoxins ofS aureus has not been observed in other studies +e highestnumber of S aureus seA+ strains was found in the foodgroup (1834) In the case of positive strains to the otherenterotoxins (seB seC seD and seE) were found only in thehuman group In this study the most frequent virulencefactor gene was saK (578) with a higher number of strainscarrying this gene in the human group (p 0001)

It is important to demonstrate the circulation ofenterotoxigenic strains in multiple environments due to therole they play in food the production of enterotoxins isassociated with the development of food poisoning [2] inhumans if they prepare food they could transfer it to them


highlighting the importance of nasal carriers in the epide-miology of the microorganism [22 31] while in animalssuch as cows enterotoxigenic strains can be transferred frombovine udders by dragging and contaminating milk the rawmaterial for multiple foods of dairy origin [37]

In addition to the enterotoxins the genes coding forβ-hemolysin (hlB) and staphylokinase (saK) was searchedwhich in addition to contributing to virulence have beendescribed as mutually exclusive +e bacteriophage (βC-φs)that contains the sak and seA genes generates non-β-he-molytic (hlBminus) strains when inserted into the hlB gene [38]+erefore in this study in addition to determining thepresence of the hlB gene the functionality of β-hemolysinwas proved for the oligonucleotides are not designed todetermine the truncated or complete form of the gene+erefore the β-hemolysis in sheep blood was determined inthe hlB+ strains finding a statistically significant relation-ship between the nonhemolytic strains and the presence ofthe seA and saK genes determining that they have a highprobability of carrying the seA gene (p 0056) and the saKgene (p 0024) but not necessarily both genes (p 0739)In addition it has been described that the seA and sak genesare part of the cluster of evasion of the immune system

together with the hol lytA chp and scn genes [38] so it isproposed that in the seA-saK strains from this study thesearch for cluster genes is associated with immune evasionWhen demonstrating the expression of the hlB gene it wasfound that only 1718 (1164) of the strains were β-he-molytic and 8281 (5364) were α- or c-hemolytic Inaddition it was determined if there was a statistical rela-tionship between β- and c-hemolytic strains with the fre-quency of the saK and seA genes finding a high frequency ofpositive strains for the saK (p 0056) and seA (p 0024)genes in the group of nonhemolytic strains (hlBminus) (Table 4)

+e profiles of antimicrobial resistance showed that thestrains from food showed greater resistance to erythromycin(407) and ciprofloxacin (185) followed by tetracyclineand clindamycin (148 and 111 respectively) the lowestfrequency was observed in rifampicin (37) In strains ofS aureus from humans a greater resistance was observed toerythromycin (484) followed by clindamycin (212) andrifampicin (121) A lower resistance was observed totetracycline (122) and ciprofloxacin (91) Resistance tocefoxitin in both groups was similar (148 and 121 infood and humans respectively) Strains from animalsshowed greater resistance to erythromycin (75) this is

Table 3 Virulence factors of strains of S aureus from different environments

Virulence factor Total N 64 n () Humans N 33 Foods N 27 Animals N 4 p+

EnterotoxinslowastseA 34 (531) 16 16 2 0702seB 2 (31) 2 0 0 0379seC 4 (62) 4 0 0 0135seD 3 (46) 3 0 0 0228seE 1 (15) 1 0 0 0621tsst-1 6 (93) 3 3 0 0774

Toxinslowast 0hlB 11 (172) 2 7 2 0025saK 37 (578) 27 8 2 0000

Antibiotic resistancemec 8 (125) 4 4 0 0702

lowastDetermined by end point PCR +Determined by Fisherrsquos exact test and square Chi Values of plt 005 were considered statistically significant and are markedin table

Table 2 Source of isolation and molecular confirmation of strains of S aureus used in the study

Source S aureus sub-aureus spA+AnimalsBovine mastitis 8 4

Humansamp

Vagina 7 1Nostrilslowast 19 19Nasopharynx 8 8Hands 9 5

FoodsCheeses$ 15 14Eggshell 7 6Food infant 2 2Surfaces 5 5

ampSamples were obtained by swabbing or exudate lowastPreviously isolated on [20] $Previously isolated on [19]


even greater than the other two study groups no MRSA wasfound in these strains (Figure 1)

When observing a high resistance to erythromycin theinducible clindamycin effect was found with a frequency of156 which corresponds to a strain isolated from the nasal(human) nostrils Regarding resistance to antibiotics ofS aureus a greater resistance to erythromycin and clinda-mycin was found in humans+is trend has been reported inclinical isolation [39ndash41] hands of food handlers [31 42]and in foods such as chicken [31] fish and shrimp [35] Asfor tetracycline the frequency of resistant strains was low inboth groups which is contrary to that described byMekonnen et al [43] and Asiimwe et al [34] +is could beexplained for the isolates came from animals (cattle) andmilk in this study there were only 4 strains from cowudders +e frequency of MRSA in this study per group was148 and 121 for food and humans respectively which issimilar to that reported in the hands of chicken handlers(10) chicken (8) [31] ready-to-eat food rich in starch(8) [33] shrimp and fish (8) [35] +e highest fre-quencies are usually from hospital isolates ranging from 35to 814 [11 40 41] justifying that in the study the isolatesof S aureus were not of hospital origin

+e study of antimicrobial resistance in S aureus hasdifferent approaches in the medical and veterinary area it isrelated to therapeutic failure to resolve infections by thismicroorganism [14 44] In the area of food its participationin the resolution of food poisoning is still under discussionbecause it is related to the presence of toxins and not themicroorganism but it has raised food as a vehicle for thetransmission of resistant strains [45] which occurs and hasbeen evidenced between animals and humans [46 47] Inaddition it is important to evaluate resistance profiles sincethey change between geographical areas types of food andthe origin of the strain (whether community or hospital) asobserved in what was previously described

Of the 64 strains confirmed by spA it was possible totypify 687 of the strains (4564) by PCR-RFLP of the coagene finding 17 restriction profiles (restriction) based on therestriction products generated by the AluI enzyme com-monly determined from 2 to 3 fragments of different mo-lecular weight +e product of amplification of the coa genewithout any cut (profile 1) was considered as a restriction+e most common restriction profile was 4 (490 bp 300 bp)grouping 7 strains followed by profiles 2 (400 bp 300 bp)and 8 (500 bp 320 bp and 180 bp) with 5 strains eachAccording to the origin of the strains profiles 1 and 2 wereonly determined in strains of human origin 14 in strains ofanimal origin and profiles 3 5 8 10 11 12 15 and 17 only

in strains isolated from food Profiles 4 6 7 13 and 16 instrains were isolated from both humans and food (Table 5)

A method for the typing of S aureus is the PCR-RFLPtechnique of the gene that codes for coagulase (coa) +isenzyme has the function of generating fibrin clots and thusparticipates in the evasion and invasion of the microor-ganism in the host [7]+e gene is divided into three regionsone cell membrane binding one polymorphic and one fi-brinogen binding In the polymorphic region there may beinsertion or loss of tandem repeats of 81 bp+e latter allowstypifying the strains generating different sizes of geneamplification and therefore the restriction of the same [16]+e percentages of typing of this gene range from 40 to 100[16 19 28 43 48ndash53] +ese typing rates are related to theyears in which the isolations were taken where the per-centage is lower (40 and 51) in studies conducted in recentyears [19 29 54] compared to those made in the previoustwo decades where the percentage was 100 [16 49ndash53]+is may be due to the evolution of the strains and theincorporation of mutations in the 3rsquo region of the genedecreasing the specificity of the used primers highlightingthat the primers described by Goh et al [16] were used in thisstudy Another important point is that the study onlyconsidered the strains with the amplification of a singleproduct and not the allelic forms as reported in other studies[16 19 48 53] +e restriction products were generated inthis study ranged from 80 bp to 500 bp which is consistentwith has been previously reported [16 19 48ndash53] It was alsoconsidered as a different profile to the PCR product wherethere was no cut by the enzyme restriction AluI which wasalso included in several studies [50ndash52] We obtained 17restriction profiles of 45 unrelated strains which is similar tothat reported by Schwarkopf and Karch [46 53] the numberof profiles decreases when the strains are isolated from thesame origin or environment [29 54] or have a commoncharacteristic for example being MRSA [16 52] +e di-versity of these could be explained by the evolution andadaptation of S aureus to different environments geo-graphic zones and even hosts [51] Even when the numberof restrictions is diverse in most of these studies one of

Table 4 Frequency of the saK and seA genes in beta (hlb+) andgamma (hlbminus) hemolytic S aureus strains

Virulence factorhlb

pPositives n 11 Negatives n 53

seA 3 (2727) 31 (5849) 0056saK 3 (2727) 34 (6415) 0024Values of plt 005 were considered as statistically significant and are markedin the table +e statistical analysis was performed with Fisherrsquos exact test

Antibiotics

Freq

uenc

y (

)

CIP E TE RA CC FOX0

20

40

60

80

HumansFoodAnimals

Figure 1 Antibiotic resistance in S aureus strains from humansfood and animals


these restrictions is always the most common which can berelated as the restriction best adapted to the geographicalarea [29] and even to the guests of the same area in thissense it has been described that the restrictotypes the mostcommon of the studied region present a greater resistance toopsonization by neutrophils than the less common re-strictions [51] By relating the virulence factors with therestriction profiles it was found that profile 4 had strainswith a higher number of enterotoxin genes In profiles 7 11and 15 strains did not present enterotoxin genes while inprofiles 3 6 12 and 13 strains presented the tsst-1 gene In

profile 5 there were no strains with the hlB or saK genes Inprofile 4 strains resistant to cefoxitin clindamycin cipro-floxacin erythromycin and rifampin were found Also inprofiles 1 4 5 9 13 and 17 there were strains resistant tocefoxitin In this study the most common restriction was 4(490 bpndash300 bp) and it had the most virulence factors suchas seA seB seC seD hlB saK andmec with strains resistantto all antibiotics except tetracycline and of combined originbetween humans and food which are associated with agreater adaptation of the strains due to the greater acqui-sition of virulence factors

Table 5 Restriction profiles of the coa gene virulence factors and resistance profile of strains of S aureus from different environments

Profile AluI restriction Strains Virulence factor (gen) Resistance profile Source

1 800 4

hlB saK (1) Cc (1)Susceptible (2)Fox E (1)

HumanshlB seA seC (1)saK (1)

saK mec seA (1)

2 400 300 5

saK seA (1)

HumanssaK (2) Cip E (2)hlB seA seC (1) Susceptible (3)hlB saK seA (1)

3 400 150 80 1 hlB saK seA tsst-1 (1) Susceptible (1) Foods

4 490 300 7

saK seB (1) E (2)Cc (1)

Cc E Ra (1)Cip E (1)Fox (1)

Susceptible (1)

Foodshumans

saK seA seC (1)hlB saK seB seC seD (1)

hlB (1)hlB saK (1)saK (1)

saK mec seA (1)

5 450 220 2 mec seA (1) Fox (1) Foods--- Susceptible (1)

6 400 220 3saK (1) Cc E (1)

FoodshumanshlB saK seA (1) Te Cip E (1)saK seA seE tsst-1 (1) Susceptible (1)

7 500 220 2 hlB saK (1) Susceptible (2) FoodshumanshlB (1)

8 500 320 180 5hlB seA (3) Te (1)

FoodshlB (1) E (1)--- Susceptible (3)

9 550 400 180 1 saK mec seA (1) Fox E (1) Humans10 400 230 80 1 hlB saK seA (1) E (1) Foods11 500 320 80 1 hlB (1) E (1) Foods12 400 180 80 1 saK tsst-1 (1) Susceptible (1) Foods

13 400 200 4

hlB saK seA (1) E (2)Fox E Ra (1)Susceptible (1)

FoodshumanssaK seA (1)saK seA tsst-1 (1)

saK mec (1)14 400 290 180 1 hlB saK seA (1) E (1) Animals

15 400 320 80 2 saK (1) Susceptible (2) FoodshlB (1)

16 400 320 3seA (1) Te (1)

FoodshumanshlB seA (1) Susceptible (1)--- E (1)

17 490 210 2 saK (1) E (1) FoodshlB mec seA (1) Fox Cip E (1)--- does not present any virulence gene CC clindamycin RA rifampin E erythromycin FOX cefoxitin TE tetracycline and CIP ciprofloxacin


+e PCR-RFLP technique of the coa gene could becomplemented with the amplification data of the spA genehowever it was determined that the power of discriminationof the technique was 093 considered within the acceptancerange (above 08) In other studies in which this techniquehas been used the power of reported discrimination was081 099 and 080 the first two with strains isolated frommilk of cattle with mastitis [48 49] and the last one of bovinemilk [19] It has been reported that by combining twotechniques for example PCR-RFLPs of the coa gene withribotyping the discrimination power is increased from 081to 089 [49] however in this study the power of unmatcheddiscrimination was still above that reported +is confirmsthat the technique of the coa gene is easy and reproducibleand that it can be used for the typing of strains from differentenvironments

By grouping the strains according to methicillin resis-tance it was observed that strains containing 0 to 2 virulencegenes were more frequent in the group of methicillin-sen-sitive S aureus (MSSA) (839) compared to methicillin-resistant S aureus group (MRSA) (375) Strains carrying 3or more virulence genes were more frequent with 625 inthe MRSA group compared to the MSSA with 16(p 0003) Regarding antibiotic resistance in the MRSAstrains the antibiotics to which resistance was the highestwere erythromycin and ciprofloxacin with 75 and 375(p 0054) respectively while in the MSSA strains theantibiotics to which there was higher resistance wereerythromycin and clindamycin with 429 and 10 cor-respondingly (Table 6)

4 Conclusions

In this study a wide genetic diversity of strains of S aureusfrom different foods humans and animals was foundevidenced by the restriction of the polymorphic region of thegene coding for coagulase as well as virulence and resistanceprofiles obtained by PCR at the endpoint and by the KirbyBauer method respectively +is demonstrates evolutiongenetic versatility and therefore the adaptation of thismicroorganism in different environments Remark the

importance of its study in different dietary matrices ascontaminant and pathogen in animals and humans as partof the microbiota of the skin and mucous membranes orpathogen in these same sites

Data Availability

+e data used in the study are available on request

Conflicts of Interest

+e authors declare that there are no conflicts of interestregarding the publication of this paper

Acknowledgments

+is work was supported by the Secretaria de EducacionPublica Roberto Adame Gomez had a student scholarship[829282] granted by ConsejoNacional de Ciencia y Tecnologıa

References

[1] S Y C Tong J S Davis E Eichenberger T L Holland andV G Fowler Jr ldquoStaphylococcus aureus infections epide-miology pathophysiology clinical manifestations andmanagementrdquo Clinical Microbiology Reviews vol 28 no 3pp 603ndash661 2015

[2] J-A Hennekinne M-L D Buyser and S DragaccildquoStaphylococcus aureus and its food poisoning toxins char-acterization and outbreak investigationrdquo FEMS MicrobiologyReviews vol 36 no 4 pp 815ndash836 2012

[3] J Schelin N Wallin-Carlquist M T Cohn R Lindqvist andG C Barker ldquo+e formation of Staphylococcus aureus en-terotoxin in food environments and advances in risk as-sessmentrdquo Virulence vol 2 no 6 pp 580ndash592 2011

[4] J Kadariya T C Smith and D +apaliya ldquoStaphylococcusaureus and staphylococcal food-borne disease an ongoingchallenge in public healthrdquo Biomed Research Internationalvol 2014 Article ID 827965 9 pages 2014

[5] M-L D Buyser B Dufour M Maire and V LafargeldquoImplication of milk and milk products in food-borne dis-eases in France and in different industrialised countriesrdquoInternational Journal of Food Microbiology vol 67 no 1-2pp 1ndash17 2001

[6] D Balasubramanian L Harper B Shopsin and V J TorresldquoStaphylococcus aureus pathogenesis in diverse host envi-ronmentsrdquo Pathogens and Disease vol 75 2017

[7] M Dominique and S Olaf ldquoStaphylococcus aureus vaccinesdeviating from the carolrdquo Journal of Experimental Medicinevol 213 no 9 pp 1645ndash1653 2016

[8] C Kong H-M Neoh and S Nathan ldquoTargeting Staphylo-coccus aureus toxins a potential form of anti-virulencetherapyrdquo Toxins vol 8 no 3 p E72 2016

[9] W V Schaik and T Abee ldquo+e role of σB in the stress re-sponse of gram-positive bacteriandashtargets for food preservationand safetyrdquo Current Opinion in Biotechnology vol 16 no 2pp 218ndash224 2005

[10] N Malachowa and F R DeLeo ldquoMobile genetic elements ofStaphylococcus aureusrdquo Cellular and Molecular Life Sciencesvol 67 no 18 pp 3057ndash3071 2010

[11] C He S Xu H Zhao et al ldquoLeukotoxin and pyrogenic toxinSuperantigen gene backgrounds in bloodstream and wound

Table 6 Virulence factors and antibiotic resistance in MSSA andMRSA strains

MSSA MRSA plowast

Virulence factor0ndash2 virulence genes 47 (839) 3 (375) 0003ge3 virulence genes 9 (16) 5 (625)

AntibioticsClindamycin 9 (16) 2 (25) 0617Ciprofloxacin 5 (89) 3 (375) 0054Erythromycin 24 (429) 6 (75) 0133Rifampicin 5 (89) 1 (125) 0567Tetracycline 6 (107) 2 (25) 0260

lowastCalculated from Fisherrsquos exact test MSSA Staphylococcus aureus sensitiveto methicillin MRSA Staphylococcus aureus resistant to methicillin Valuesof plt 005 were considered statistically significant and are marked in thetable


Staphylococcus aureus isolates from eastern region of ChinardquoBMC Infectious Diseases vol 18 no 1 p 395 2018

[12] R P Novick G E Christie and J R Penades ldquo+e phage-related chromosomal islands of gram-positive bacteriardquoNature Reviews Microbiology vol 8 no 8 pp 541ndash551 2010

[13] A K Shamila-Syuhada G Rusul W A Wan-Nadiah andL O Chuah ldquoPrevalence and antibiotics resistance ofStaphylococcus aureus isolates isolated from raw milk ob-tained from small-scale dairy farms in penang MalaysiardquoPakistan Veterinary Journal vol 36 pp 98ndash102 2016

[14] S Khanam J A Haq S Shamsuzzaman M M Rahman andK Z Mamun ldquoEmergence of vancomycin resistant Staphy-lococcus aureus during hospital admission at a tertiary carehospital in Bangladeshrdquo Bangladesh Journal of InfectiousDiseases vol 3 no 1 pp 11ndash16 2016

[15] R H Deurenberg C Vink S Kalenic A W FriedrichC A Bruggeman and E E Stobberingh ldquo+e molecular evo-lution of methicillin-resistant Staphylococcus aureusrdquo ClinicalMicrobiology and Infection vol 13 no 3 pp 222ndash235 2007

[16] S H Goh S K Byrne J L Zhang and A W ChowldquoMolecular typing of Staphylococcus aureus on the basis ofcoagulase gene polymorphismsrdquo Journal of Clinical Micro-biology vol 30 no 7 pp 1642ndash1645 1992

[17] F C Tenover R Arbeit G Archer et al ldquoComparison oftraditional and molecular methods of typing isolates ofStaphylococcus aureusrdquo Journal of Clinical Microbiologyvol 32 no 2 pp 407ndash415 1994

[18] A Vindel O Cuevas E Cercenado et al ldquoSpanish group forthe study of Staphylococcus Methicillin-resistant Staphylo-coccus aureus in Spain molecular epidemiology and utility ofdifferent typing methodsrdquo Journal of Clinical Microbiologyvol 47 no 6 pp 1620ndash1627 2009

[19] V Sharma S Sharma D K Dahiya A Khan MMathur andA Sharma ldquoCoagulase gene polymorphism enter-otoxigenecity biofilm production and antibiotic resistance inStaphylococcus aureus isolated from bovine raw milk in NorthWest Indiardquo Annals of Clinical Microbiology and Antimi-crobials vol 16 no 1 p 65 2017

[20] A Salehzadeh H Zamani M K Langeroudi and A MirzaieldquoMolecular typing of nosocomial Staphylococcus aureusstrains associated to biofilm based on the coagulase andprotein A gene polymorphismsrdquo Iranian Journal of BasicMedical Sciences vol 19 pp 1325ndash1330 2016

[21] R Adame-Gomez J Toribio-Jimenez A Vences-Velazquezet al ldquoMethicillin-resistant Staphylococcus aureus (MRSA) inartisanal cheeses in mexicordquo International Journal of Mi-crobiology vol 2018 no 6 Article ID 8760357 2018

[22] R Adame-Gomez A Vences-Velazquez I Parra-RojasE Rodrıguez-Bataz S Muntildeoz-Barrios and A Ramırez-Peralta ldquoStaphylococcus aureus resistentes a meticilina(SARM) y productores de enterotoxina a aislados de porta-dores nasales asintomaticos entre estudiantes universitariosde Mexicordquo Kasmera vol 47 pp 14ndash20 2019

[23] J B D S Rodrigues T S Pinto C P D Oliveira et alldquoLipolytic activity of Staphylococcus aureus from humanwounds animals foods and food-contact surfaces in BrazilrdquoEe Journal of Infection in Developing Countries vol 8 no 8pp 1055ndash1058 2014

[24] C Lange M Cardoso D Senczek and S Schwarz ldquoMolecularsubtyping of Staphylococcus aureus isolates from cases ofbovine mastitis in Brazilrdquo Veterinary Microbiology vol 67no 2 pp 127ndash141 1999

[25] S Jarraud C Mougel J +ioulouse et al ldquoRelationshipsbetween Staphylococcus aureus genetic background virulence

factors agr groups (alleles) and human diseaserdquo Infection andImmunity vol 70 no 2 pp 631ndash641 2002

[26] C Milheiriccedilo D C Oliveira and H D Lencastre ldquoUpdate tothe multiplex PCR strategy for assignment of mec elementtypes in Staphylococcus aureusrdquo Antimicrobial Agents andChemotherapy vol 51 no 12 p 4537 2007

[27] Clinical Laboratory Standards Institute Performance Stan-dards for Antimicrobial Susceptibility Testing 26th Informa-tional Supplement (M100-S16) CLSI Wayne PA USA 2016

[28] H M Frenay J P +eelen L M Schouls et al ldquoDiscrimi-nation of epidemic and nonepidemic methicillin-resistantStaphylococcus aureus strains on the basis of protein A genepolymorphismrdquo Journal of Clinical Microbiology vol 32no 3 pp 846-847 1994

[29] F Javid A Taku M A Bhat G A Badroo M Mudasir andT A Sofi ldquoMolecular typing of Staphylococcus aureus basedon coagulase generdquo Veterinary World vol 11 no 4pp 423ndash430 2018

[30] S Hirotaki T Sasaki K Kuwahara-Arai and K HiramatsuldquoRapid and accurate identification of human-associatedstaphylococci by use of multiplex PCRrdquo Journal of ClinicalMicrobiology vol 49 no 10 pp 3627ndash3631 2011

[31] R M E Bayomi H A Ahmed M A I AwadallahR A Mohsen A E A El-Ghafar and M A AbdelrahmanldquoOccurrence virulence factors antimicrobial resistance andgenotyping of Staphylococcus aureus strains isolated fromchicken products and humansrdquo Vector-Borne and ZoonoticDiseases vol 16 no 3 pp 157ndash164 2016

[32] M N Hoque Z C Das A N M A Rahman M G Haiderand M A I Islam ldquoMolecular characterization of Staphy-lococcus aureus strains in bovine mastitis milk in BangladeshrdquoInternational Journal of Veterinary Science and Medicinevol 6 no 1 pp 53ndash60 2018

[33] X Yang S Yu Q Wu J Zhang S Wu and D RongldquoMultilocus sequence typing and virulence-associated geneprofile Analysis of Staphylococcus aureus isolates from retailready-to-eat food in Chinardquo Frontiers in Microbiology vol 9p 197 2018

[34] B B Asiimwe R Baldan A Trovato and D M CirilloldquoPrevalence and molecular characteristics of Staphylococcusaureus including methicillin resistant strains isolated frombulk can milk and raw milk products in pastoral communitiesof South-West Ugandardquo BMC Infectious Diseases vol 17no 1 p 422 2017

[35] D Rong Q Wu M Xu J Zhang and S Yu ldquoPrevalencevirulence genes antimicrobial susceptibility and genetic di-versity of Staphylococcus aureus from retail aquatic productsin Chinardquo Frontiers in Microbiology vol 8 p 714 2017

[36] M A Smit A-C Nyquist and J K Todd ldquoInfectious shockand toxic shock sındrome diagnoses in hospitals ColoradoUSArdquo Emerging Infectious Diseases vol 19 no 11pp 1855ndash1858 2013

[37] R Piccinini L Cesaris V Dapra et al ldquo+e role of teat skincontamination in the epidemiology of Staphylococcus aureusintramammary infectionsrdquo Ee Journal of Dairy Researchvol 76 no 1 pp 36ndash41 2009

[38] W J VWamel S H Rooijakkers M Ruyken K P V Kesseland J A V Strijp ldquo+e innate immune modulators staph-ylococcal complement inhibitor and chemotaxis inhibitoryprotein of Staphylococcus aureus are located on beta-hemo-lysin-converting bacteriophagesrdquo Journal of Bacteriologyvol 188 no 4 pp 1310ndash1315 2006

[39] S Ansari R Gautam S Shrestha S R Ansari S N Subediand M R Chhetri ldquoRisk factors assessment for nasal


colonization of Staphylococcus aureus and its methicillinresistant strains among pre-clinical medical students ofNepalrdquo BMC Research Notes vol 9 no 1 2016

[40] S Manandhar A Singh A Varma S Pandey andN Shrivastava ldquoBiofilm producing clinical Staphylococcusaureus isolates augmented prevalence of antibiotic resistantcases in tertiary care hospitals of Nepalrdquo Frontiers in Mi-crobiology vol 9 p 2749 2018

[41] B Liang J Mai Y Liu et al ldquoPrevalence and characterizationof Staphylococcus aureus isolated fromwomen and children inguangzhou Chinardquo Frontiers in Microbiology vol 9 p 27902018

[42] A Castro C Santos HMeireles J Silva and P Teixeira ldquoFoodhandlers as potential sources of dissemination of virulentstrains of Staphylococcus aureus in the communityrdquo Journal ofInfection and Public Health vol 9 no 2 pp 153ndash160 2016

[43] S A Mekonnen T J G M Lam J Hoekstra et al ldquoChar-acterization of Staphylococcus aureus isolated from milksamples of dairy cows in small holder farms of North-WesternEthiopiardquo BMCVeterinary Research vol 14 no 1 p 246 2018

[44] V Peton and Y L Loir ldquoStaphylococcus aureus in veterinarymedicinerdquo Infection Genetics and Evolution vol 21pp 602ndash615 2014

[45] D Sergelidis and A S Angelidis ldquoMethicillin-resistantStaphylococcus aureus a controversial food-borne pathogenrdquoLetters in Applied Microbiology vol 64 no 6 pp 409ndash4182017

[46] N Balaban and A Rasooly ldquoStaphylococcal enterotoxinsrdquoInternational Journal of Food Microbiology vol 61 no 1pp 1ndash10 2000

[47] A L Honeyman Staphylococcus aureus Infection and DiseaseKluwer AcademicPlenum Publishers New York NY USA2001

[48] E R D Silva and N D Silva ldquoCoagulase gene typing ofStaphylococcus aureus isolated from cows with mastitis insoutheastern Brazilrdquo Canadian Journal of Veterinary Re-search vol 69 pp 260ndash264 2005

[49] F M Aarestrup C A Dangler and L M Sordillo ldquoPreva-lence of coagulase gene polymorphism in Staphylococcusaureus isolates causing bovine mastitisrdquo Canadian Journal ofVeterinary Research vol 59 pp 124ndash128 1995

[50] J Schlegelova M Dendis J Benedık V Babak andD Rysanek ldquoStaphylococcus aureus isolates from dairy cowsand humans on a farm differ in coagulase genotyperdquo Vet-erinary Microbiology vol 92 no 4 pp 327ndash334 2003

[51] C Su C Herbelin N Frieze O Skardova and L M SordilloldquoCoagulase gene polymorphism of Staphylococcus aureusisolates from dairy cattle in different geographical areasrdquoEpidemiology and Infection vol 122 no 2 pp 329ndash336 1999

[52] J V Hookey J F Richardson and B D Cookson ldquoMoleculartyping of Staphylococcus aureus based on PCR restrictionfragment length polymorphism and DNA sequence analysisof the coagulase generdquo Journal of Clinical Microbiologyvol 36 no 4 pp 1083ndash1089 1998

[53] A Schwarzkopf and H Karch ldquoGenetic variation in Staph-ylococcus aureus coagulase genes potential and limits for useas epidemiological markerrdquo Journal of Clinical Microbiologyvol 32 no 10 pp 2407ndash2412 1994

[54] H Momtaz E Tajbakhsh E Rahimi and M MomenildquoCoagulase gene polymorphism of Staphylococcus aureusisolated from clinical and sub-clinical bovine mastitis inIsfahan and Chaharmahal va Bakhtiari provinces of IranrdquoComparative Clinical Pathology vol 20 no 5 pp 519ndash5222011


infections and healthcare-associated infections (HAI) [1] inanimals it is associated with infections in mammary glands[2] and in the case of food S aureus produces a greatdiversity of enterotoxins that generate food poisoning inhumans due to the consumption of these [3] being a mi-croorganism it also affects the quality of foods such as rawmeat products [4] and milk and dairy products [5]

+e successful colonization of S aureus in multipleenvironments different inanimate hosts or matrices ispossible due to the large number of virulence factors that thismicroorganism uses [6] S aureus produces a large numberof enzymes that promote the virulence of this microor-ganism including coagulase staphylokinase and β-lacta-mases [7] Among the virulence factors that have animportant role in pathogenicity are adhesins and surfaceproteins such as protein A and in the particular case oftoxins enterotoxins of S aureus (SE) and β-Hemolysin(Hlb) [8]

S aureus has the ability to control the expression ofvirulence factors according to the environmental conditionsin which it is found through a global regulation systemknown as accessory regulatory gene (Agr) [8] and the sigmafactor (σB) [9] In addition to gene regulation the adaptationof S aureus in different microenvironments with differentenvironmental nutritional and stress conditions couldgenerate the acquisition of genes coding for virulence factorsthat allow its survival [10] +e mobilization of several genesthat code for virulence factors in the same mobile geneticelement has been observed for example in the bacterio-phage βC-φs the staphylokinase gene and the complementinhibitor protein are mobilized with enterotoxin genes andPanton- Valentine leucocidin[11] Also in the Staphylo-coccus aureus pathogenicity islands (SaPIs) this phenom-enon has been observed mobilizing two genes ofenterotoxins along with the toxin gene of toxic shocksyndrome (tsst-1) and the adhesion protein Bap [12] An-other example is the catabolic mobile element of argininethat is transported together with the methicillin resistancecassette (SCCmec) due to its proximity and which has beenrelated to strains that have specific subtypes of SCCmec[1010] Transfer of antibiotic resistance genes is common inStaphylococcal species [13] Resistance against methicillinlincosamides macrolides aminoglycosides and a combi-nation of these antibiotics has been frequently reported instaphylococci [14]

For this reason it has been difficult to separate a group ofS aureus clones with certain virulence factors that generatedisease from those clones that are only commensals+erefore molecular typing techniques such as pulsed-fieldgel electrophoresis (PFGE) and multilocus sequencingtyping (MLST) [15] have been designed being the PFGEtechnique the gold standard for the typing of S aureusHowever due to the high costs other alternatives of mo-lecular biology have been proposed such as PCR-RFLPs ofthe coagulase gene (coa) or the protein A gene (spA) [16 17]genes conserved in genus and species respectively In thecase of typing by spA a 100 relationship was found withPFGE [18] Currently the restriction of these genes con-tinues to be used to typify strains of S aureus of different

origins [19 20] However the rapid transformation of thisbacterium generates the need for the study of virulencefactors which could provide information on their functionin the dissemination and adaptation of the same clone ofS aureus in multiple environments considering that moststudies evaluate genetic diversity in a particular environ-ment +erefore the objective of this study was to comparethe genetic diversity and virulence factor profiles of strains ofS aureus from food humans and animals

2 Materials and Methods

21 Strains For this study 80 strains previously identified atgenus level were selected by primary isolation in BairdParker agar Gram stain fermentation of mannitol andtrehalose coagulase and positive catalase from a collectionof 360 strains of S aureus isolated from different sources(food humans and animals) which were stored at minus20degC in20 glycerol (Merck Millipore Cat 356352 Germany)brain heart infusion broth BHI (Oxoid Cat CM1135 USA)+e production of enterotoxin A had been previously de-termined by dot blot and methicillin resistance in 34 strains[21 22]+e lipase production was considered as a metaboliccharacteristic for the selection of the 80 strains for this studydue to their participation in infections in humans and an-imals as well as their survival and multiplication in con-taminated foods [23] Another important characteristic ofthis group of strains is that they were isolated from foodhumans and animals from the same city (Chilpancingosouthern Mexico) and nearby towns

Strains were cultured in BHI broth and incubated for24 h at 37degC +e control strains used in this study wereStaphylococcus aureus ATCC 29231 (sea) Staphylococcusaureus ATCC 14458 (seb) Staphylococcus aureus ATCC19095 (sec) Staphylococcus ATCC 13563 (sed) Staphylo-coccus ATCC 27664 (see) and Staphylococcus aureus ATCC25923 (coa spa hlB and sak)

22 DNAExtraction Total DNA were isolated from 1mL ofan 18 h broth culture from all the bacterial strains includingATCC strains Cells were pelleted from the cultures bycentrifugation at 10000 rpm for 10min resuspended in300 μL of lysis buffer (10mM Tris-HCl y 1mM EDTA pH80 lysozyme 1mgmL) and incubated at 37degC for 05 h oruntil viscous DNA from all preparations was subsequentlyextracted with phenol-chloroform and precipitated withethanol DNA samples were dissolved in TE buffer (10mMTris chloride-1mM EDTA [pH 80])

23 Molecular Identification of S aureus A final point PCRof the spA gene was performed to the selected strains for themolecular confirmation of S aureus with oligonucleotidesdescribed in Table 1 +e final mixture of each PCR reactioncontained 02mMof each dNTP 3mMMgCl2 02 μMof theoligonucleotides 1 U of Taq DNA polymerase (AmpliqonCat A112103 Denmark) 5 microL of 10X Buffer and 100 ng ofDNA as template +e PCR protocol started with an initialdenaturation of 5 minutes at 95degC followed by 30 cycles at


























D 1 minus1

N(N minus 1)1113944

S

j1nj nj minus 11113872 1113873 (1)






















Humansamp












Virulence factorhlb



Antibiotics

Freq

uenc

y (

)

CIP E TE RA CC FOX0

20

40

60

80

HumansFoodAnimals







1 800 4



saK mec seA (1)

2 400 300 5

saK seA (1)



4 490 300 7

saK seB (1) E (2)Cc (1)


Susceptible (1)

Foodshumans



saK mec seA (1)


6 400 220 3saK (1) Cc E (1)



8 500 320 180 5hlB seA (3) Te (1)



13 400 200 4





16 400 320 3seA (1) Te (1)






4 Conclusions



Data Availability




Acknowledgments


References













MSSA MRSA plowast













































































D 1 minus1

N(N minus 1)1113944

S

j1nj nj minus 11113872 1113873 (1)






















Humansamp












Virulence factorhlb



Antibiotics

Freq

uenc

y (

)

CIP E TE RA CC FOX0

20

40

60

80

HumansFoodAnimals







1 800 4



saK mec seA (1)

2 400 300 5

saK seA (1)



4 490 300 7

saK seB (1) E (2)Cc (1)


Susceptible (1)

Foodshumans



saK mec seA (1)


6 400 220 3saK (1) Cc E (1)



8 500 320 180 5hlB seA (3) Te (1)



13 400 200 4





16 400 320 3seA (1) Te (1)






4 Conclusions



Data Availability




Acknowledgments


References













MSSA MRSA plowast

































































Humansamp












Virulence factorhlb



Antibiotics

Freq

uenc

y (

)

CIP E TE RA CC FOX0

20

40

60

80

HumansFoodAnimals







1 800 4



saK mec seA (1)

2 400 300 5

saK seA (1)



4 490 300 7

saK seB (1) E (2)Cc (1)


Susceptible (1)

Foodshumans



saK mec seA (1)


6 400 220 3saK (1) Cc E (1)



8 500 320 180 5hlB seA (3) Te (1)



13 400 200 4





16 400 320 3seA (1) Te (1)






4 Conclusions



Data Availability




Acknowledgments


References













MSSA MRSA plowast




























































Virulence factorhlb



Antibiotics

Freq

uenc

y (

)

CIP E TE RA CC FOX0

20

40

60

80

HumansFoodAnimals







1 800 4



saK mec seA (1)

2 400 300 5

saK seA (1)



4 490 300 7

saK seB (1) E (2)Cc (1)


Susceptible (1)

Foodshumans



saK mec seA (1)


6 400 220 3saK (1) Cc E (1)



8 500 320 180 5hlB seA (3) Te (1)



13 400 200 4





16 400 320 3seA (1) Te (1)






4 Conclusions



Data Availability




Acknowledgments


References













MSSA MRSA plowast

























































1 800 4



saK mec seA (1)

2 400 300 5

saK seA (1)



4 490 300 7

saK seB (1) E (2)Cc (1)


Susceptible (1)

Foodshumans



saK mec seA (1)


6 400 220 3saK (1) Cc E (1)



8 500 320 180 5hlB seA (3) Te (1)



13 400 200 4





16 400 320 3seA (1) Te (1)






4 Conclusions



Data Availability




Acknowledgments


References













MSSA MRSA plowast























































4 Conclusions



Data Availability




Acknowledgments


References













MSSA MRSA plowast





















































GeneticDiversityandVirulenceFactorsof S.aureus Isolatedfrom … · 2020. 8. 27. ·...

Documents

Transcript of GeneticDiversityandVirulenceFactorsof S.aureus Isolatedfrom … · 2020. 8. 27. ·...