GENETIC MARKERS IN PLANT BREEDING

UseUse

ClonalClonal identityidentity

ParentalParental analysisanalysis

FamilyFamily structurestructure

PopulationPopulation structurestructure

GeneGene flowflow

PhylogeographyPhylogeography

HybridisationHybridisation

PhylogenyPhylogeny

SC

AL

ES

CA

LE

MARKERS IN BIOLOGY

1. Phenotypic markers = Naked eye markers

P = E+G

Flower colors, shape of pods, etc..

Karl Von Linne (1707-1778)

Readily detectable sequence of protein or DNA whose inheritance can be monitored and associated with the trait inheritance independently from the environment:

a) protein polymorphismsb) DNA polymorphisms

2. Genotypic (molecular) markers

MolecularMolecular markersmarkersR

eso l

utio

nR

eso l

utio

n po

wer

pow

er

allozymes (protein-electrophoresis)allozymes (protein-electrophoresis)

chloroplastDNA PCR-RFLPchloroplastDNA PCR-RFLP

RAPDRAPD(random amplified polymorphic DNA)(random amplified polymorphic DNA)

AFLPAFLP(Amplified Fragment Length Polymorphism)(Amplified Fragment Length Polymorphism)

Multi-locus fingerprintsMulti-locus fingerprints

Microsatellites (SSRs)Microsatellites (SSRs)

SequencingSequencing (SNPs)(SNPs)

Seed storage proteins

Isozymes

Proteins Polymorphisms

Isozyme Isozyme

Starch gel of the isozyme malate dehydrogenase (MDH). The Starch gel of the isozyme malate dehydrogenase (MDH). The numbers indicate first the MDH locus, and next the allele present numbers indicate first the MDH locus, and next the allele present

(ie. 3-18 is locus 3 allele 18). Some bands are heterodimers (ie. 3-18 is locus 3 allele 18). Some bands are heterodimers (intralocus or interlocus).(intralocus or interlocus).

Isozyme Isozyme

Chromosome to DNA

DNA structure

1 ccacgcgtcc gtgaggactt gcaagcgccg cggatggtgg gctctgtggc tgggaacatg 61 ctgctgcgag ccgcttggag gcgggcgtcg ttggcggcta cctccttggc cctgggaagg 121 tcctcggtgc ccacccgggg actgcgcctg cgcgtgtaga tcatggcccc cattcgcctg 181 ttcactcaga ggcagaggca gtgctgcgac ctctctacat ggacgtacag gccaccactc 241 ctctggatcc cagagtgctt gatgccatgc tcccatacct tgtcaactac tatgggaacc 301 ctcattctcg gactcatgca tatggctggg agagcgaggc agccatggaa cgtgctcgcc 361 agcaagtagc atctctgatt ggagctgatc ctcgggagat cattttcact agtggagcta 421 ctgagtccaa caacatagca attaaggtag gaggagggat ggggatgttg tgtggccgac 481 agttgtgagg ggttgtggga agatggaagc cagaagcaaa aaagagggaa cctgacacta 541 tttctggctt cttgggttta gcgattagtg cccctctctc atttgaactc aactacccat 601 gtctccctag ttctttctct gcctttaaaa aaaaatgtgt ggaggacagc tttgtggagt 661 ctgaaatcac catctacctt tacttaggtt ctgagtgcca aacccaaggc accaggcatg 721 cgtccttgac tccggagcca tcaggcaggc tttcctcagc cttttgcagc caagtctttt 781 agcctattgg tctgagttca gtgtggcagt tggttaggaa agaaggtggt tcttcgacca 841 ctaacagttt ggatttttta ggatgctagt cctttaaaa ……….

Stretch of nitrogen fixation gene in soybean

DNA

Gene A Gene B

AACCTGAAAAGTTACCCTTTAAAGGCTTAAGGAAAAAGGGTTTAACCAAGGAATTCCATCGGGAATTCCG

MFG

1 ccacgcgtcc gtgaggactt gcaagcgccg cggatggtgg gctctgtggc tgggaacatg 61 ctgctgcgag ccgcttggag gcgggcgtcg ttggcggcta cctccttggc cctgggaagg 121 tcctcggtgc ccacccgggg actgcgcctg cgcgtgtaga tcatggcccc cattcgcctg 181 ttcactcaga ggcagaggca gtgctgcgac ctctctacat ggacgtacag gccaccactc 241 ctctggatcc cagagtgctt gatgccatgc tcccatacct tgtcaactac tatgggaacc 301 ctcattctcg gactcatgca tatggctggg agagcgaggc agccatggaa cgtgctcgcc 361 agcaagtagc atctctgatt ggagctgatc ctcgggagat cattttcact agtggagcta 421 ctgagtccaa caacatagca attaaggtag gaggagggat ggggatgttg tgtggccgac 481 agttgtgagg ggttgtggga agatggaagc cagaagcaaa aaagagggaa cctgacacta 541 tttctggctt cttgggttta gcgattagtg cccctctctc atttgaactc aactacccat 601 gtctccctag ttctttctct gcctttaaaa aaaaatgtgt ggaggacagc tttgtggag

MFG

molecular marker?

M1 M2

readily detectable sequence of DNA whose inheritance can be monitored and associated with the trait inheritance

Image from UV light table

Image from computer screen

Polymorphism-Parent 1 : one band-Parent 2 : a smaller band-Offspring 1 : heterozygote

= both bands-Offspring 2 : homozygote

parent 1

Polymorphism

Parent 1 : one band

-Parent 2 : no band

-Offspring 1 : homozygote parent 1

-Offspring 2 : ????

P 2P 1 O 2O 1

Gel configuration

Co-dominant marker

P 2

Gel configurationP 1 O 1 O 2

Dominant marker

Dominant Dominant versusversus Co-dominant Co-dominant

Dominant:Dominant:

No distinction between homo- and heterozygotes No distinction between homo- and heterozygotes possiblepossible

No allele frequencies availableNo allele frequencies available

AFLP, RAPDAFLP, RAPD

Co-dominant:Co-dominant:

homozygotes can be distinguished from homozygotes can be distinguished from heterozygotes; allele frequencies can be calculatedheterozygotes; allele frequencies can be calculated

microsatellites, SNP, RFLPsmicrosatellites, SNP, RFLPs

* Polymorphic

* Occurs throughout the genome

* Co-dominant inheritance

* Easy, fast and cheap to detect

* Reproducible

Desirable properties for a good molecular marker

* Selectivity neutral

* High resolution with large number of samples

Basis for DNA marker technology

•Restriction Endonucleases

•DNA-DNA hybridization

•Polymerase chain reaction (PCR)

•DNA sequencing

RFLP based markers

*Examine differences in size of specific DNA restriction fragments

*Usually performed on total cellular genome

*Require pure, high molecular weight DNA

Nameof theenzyme

Taq I MboI Alu I Dde I Rsa I Scrf I Msp I HaeIII

Ssp I

Numberofcuttingsites

639 623 341 309 286 239 214 196 137

Cuttingsites

TCGA GATC AG CT C TNAG GT AC CC NGG CC GG GGCC

AAT ATT

Note: N represent any base : A, T, C or G

Endonucleases and restriction sequences

AAATCGGGACCTAATGGGCC ATTTAGGGCAATTCCAAGGAYFG

Ind 1 Ind 2

RFLP techniques

3

6

2

61 2 43 5

4

5

1MFG

RFLP Polymorphisms interpretation

Advantages and disadvantages of RFLP

• Advantages– Reproducible– Co-dominant– Simple

• Disadvantages– Time consuming– Expensive– Use of

radioactive probes

DNA/DNA Hybridization

Denaturation

Elevated temperature

Known DNA sequence

Polymerase Chain Reaction

•Powerful technique for amplifying DNA•Amplified DNA are then

separated by gel electrophoresis

PCR based methods

1. Reactions conditions

*Target DNA ( or template)

*Reaction buffer containing the co-factor MgCl2*One or more primers

*Thermostable DNA polymerase

 

*Four nucleotides (dATP, dCTP, dGTP, dTTP)

2. Use of DNA polymerase

= an enzyme that can synthesize DNA at

elevated temperature

ex : Taq = enzyme purified from hot spring bacterium : Thermus

aquaticus3. Thermal cycle

*Denaturing step - one to several min at 94-96 º C

*Annealing step - one to several min at 50-65 º C

*Elongation step - one to several min at 72 º C

4. Repetition–typically 20 to 50 times average 35 times

AFLP MarkersAFLP Markers

Most complex of marker technologiesMost complex of marker technologies Involves cleavage of DNA with two Involves cleavage of DNA with two

different enzymesdifferent enzymes Involves ligation of specific linker Involves ligation of specific linker

pairs to the digested DNApairs to the digested DNA Subsets of the DNA are then Subsets of the DNA are then

amplified by PCRamplified by PCR

AFLP MarkersAFLP Markers

The PCR products are then separated The PCR products are then separated on acrylamide gelon acrylamide gel

128 linker combinations are readily 128 linker combinations are readily availableavailable

Therefore 128 subsets can be amplifiedTherefore 128 subsets can be amplified Patented technologyPatented technology

AFLP MarkersAFLP Markers

Technically demandingTechnically demanding Reliable and stableReliable and stable Moderate costModerate cost Need to use different kits adapted to Need to use different kits adapted to

the size of the genome being the size of the genome being analyzed.analyzed.

Like RAPD markers need to be Like RAPD markers need to be converted to quick and easy PCR converted to quick and easy PCR based markerbased marker

RAPD MarkersRAPD Markers

There are other problems with RAPD There are other problems with RAPD markers associated with reliabilitymarkers associated with reliability

Because small changes in any Because small changes in any variable can change the result, they variable can change the result, they are unstable as markersare unstable as markers

RAPD markers need to be converted RAPD markers need to be converted to stable PCR markers. to stable PCR markers.

How?How?

RAPD MarkersRAPD Markers

The polymorphic RAPD marker band The polymorphic RAPD marker band is isolated from the gelis isolated from the gel

It is used a template and re-PCRed It is used a template and re-PCRed The new PCR product is cloned and The new PCR product is cloned and

sequencedsequenced Once the sequence is determined, Once the sequence is determined,

new longer and specific primers can new longer and specific primers can be designedbe designed

RAPD

• Domimant markers• Reproducibility

problems

• Amplifies anonymous stretches of DNA using arbitrary primers

• Fast and easy method for detecting polymorphisms

RAPD Polymorphisms among landraces of sorghum

M

Sequences of 10-mer RAPD primers

Name Sequence

OP A08 5’ –GTGACGTAGG- 3’OP A15 5’ –TTCCGAACCC- 3’OP A 17 5’ –GACCGCTTGT- 3’OP A19 5’ –CAAACGTCGG- 3’OP D02 5’ –GGACCCAACC- 3’

RAPD gel configuration

Sequence

GCGCCGAGTTCTAGGGTTTCGGAATTTGAACCGTC

ATTGGGCGTCGGTGAAGAAGTCGCTTCCGTCGTTTGATTCCGGTCGTCAGAATCAGAATCAGAATCGATATGGTGGCAGTGGTGGTGGTGGTGGTGGTTTTGGTGGTGGTGAATCTAAGGCGGATGGAGTGGATAATTGGGCGGTTGGTAAGAAACCTCTTCCTGTTAG

ATTCTGGAATGGAACCAGATCGCTGGTCTAGAGGTTCTGCTGTGGAACCA…..

Repeat

GGT(5)

SSR repeats and primers

GAGGGCTGATGAGGTGGATA

ATCTTATGGCGGTTCTCGTG

AATCCGGACTAGCTTCTTCTTCTTCTTCTTTAGCGAATTAGGP1

AAGGTTATTTCTTCTTCTTCTTCTTCTTCTTCTTAGGCTAGGCGP2

P1 P2

SSR polymorphisms

Gel configuration

Linkage groups

M

SSR scoring for F 5:6 pop from the cross Anand x N97-3708-13

Ana

ndN

97

4. SNPs (Single Nucleotide Polymorphisms)

•Any two unrelated individuals differ by one base pair every 1,000 or so, referred to as SNPs.•Many SNPs have no effect on cell function and therefore can be used as molecular markers.

Hybridization using fluorescent dyesSNPs on a DNA strand

DNA sequencing

Sequencing gel

Sequencer

Sequencing graph

Single gene trait: seed shape Multigenic trait; ex: plant growth =Quantitative Trait Loci

Types of traits =types of markers

MFG MFG

USES OF MOLECULAR MARKER

Measure genetic diversityMeasure genetic diversity

Mapping Mapping TaggingTagging

Genetic DiversityGenetic Diversity

Define appropriate geographical scales for Define appropriate geographical scales for monitoring and management (epidemology)monitoring and management (epidemology)

Establish gene flow mechanismEstablish gene flow mechanism identify the origin of individual (mutation identify the origin of individual (mutation

detection)detection) Monitor the effect of management practicesMonitor the effect of management practices

manage small number of individual in ex situ manage small number of individual in ex situ collectioncollection

Establish of identity in cultivar and clones Establish of identity in cultivar and clones (fingerprint)(fingerprint)

paternity analysis and forensicpaternity analysis and forensic

Genetic DiversityGenetic Diversity

early selectionearly selectionof the good alleleof the good allele

seeds,plantlets

fingerprints

Gotcha!

MappingMapping

The determination of the position The determination of the position and relative distances of gene on and relative distances of gene on chromosome by means of their chromosome by means of their

linkage linkage

Genetic mapGenetic mapA linear arrangement of genes or genetic markers A linear arrangement of genes or genetic markers

obtained based on recombinationobtained based on recombination Physical mapPhysical map

A linear order of genes or DNA fragmentsA linear order of genes or DNA fragments

Physical MappingPhysical Mapping

It contains ordered overlapping It contains ordered overlapping cloned DNA fragmentcloned DNA fragment

The cloned DNA fragments are The cloned DNA fragments are usually obtained using restriction usually obtained using restriction

enzyme digestion enzyme digestion

QTL MappingQTL Mapping

A set of procedures for detecting A set of procedures for detecting genes controlling quantitative traits genes controlling quantitative traits (QTL) and estimating their genetics (QTL) and estimating their genetics

effects and locationeffects and location

To assist selectionTo assist selection

Marker Assisted SelectionMarker Assisted Selection

Breeding for specific traits in plants Breeding for specific traits in plants and animals is expensive and time and animals is expensive and time consumingconsuming

The progeny often need to reach The progeny often need to reach maturity before a determination of maturity before a determination of the success of the cross can be madethe success of the cross can be made

The greater the complexity of the The greater the complexity of the trait, the more time and effort trait, the more time and effort needed to achieve a desirable result.needed to achieve a desirable result.

MASMAS

The goal to MAS is to reduce the time The goal to MAS is to reduce the time needed to determine if the progeny needed to determine if the progeny have traithave trait

The second goal is to reduce costs The second goal is to reduce costs associated with screening for traitsassociated with screening for traits

If you can detect the distinguishing If you can detect the distinguishing trait at the DNA level you can trait at the DNA level you can identify positive selection very early. identify positive selection very early.

Developing a MarkerDeveloping a Marker

Best marker is DNA sequence Best marker is DNA sequence responsible for phenotype i.e. gene responsible for phenotype i.e. gene

If you know the gene responsible and If you know the gene responsible and has been isolated, compare has been isolated, compare sequence of wild-type and mutant sequence of wild-type and mutant DNADNA

Develop specific primers to gene that Develop specific primers to gene that will distinguish the two forms will distinguish the two forms

Developing a MarkerDeveloping a Marker

If gene is unknown, screen contrasting If gene is unknown, screen contrasting populations populations

Use populations rather than individualsUse populations rather than individuals Need to “blend” genetic differences Need to “blend” genetic differences

between individual other than trait of between individual other than trait of interestinterest

Developing MarkersDeveloping Markers

Cross individual differing in trait you Cross individual differing in trait you wish to develop a markerwish to develop a marker

Collect progeny and self or polycross Collect progeny and self or polycross the progenythe progeny

Collect and select the F2 generation Collect and select the F2 generation for the trait you are interested infor the trait you are interested in

Select 5 - 10 individuals in the F2 Select 5 - 10 individuals in the F2 showing each traitshowing each trait

Developing MarkersDeveloping Markers

Extract DNA from selected F2sExtract DNA from selected F2s Pool equal amounts of DNA from each Pool equal amounts of DNA from each

individual into two samples - one for individual into two samples - one for each traiteach trait

Screen pooled or “bulked” DNA with Screen pooled or “bulked” DNA with what method of marker method you what method of marker method you wish to usewish to use

Method is called “Bulked Segregant Method is called “Bulked Segregant Analysis”Analysis”

Marker DevelopmentMarker Development

Other methods to develop population Other methods to develop population for markers exist but are more for markers exist but are more expensive and slower to developexpensive and slower to develop

Near Isogenic Lines, Recombinant Near Isogenic Lines, Recombinant Inbreeds, Single Seed Decent Inbreeds, Single Seed Decent

What is the advantage to markers in What is the advantage to markers in breeding?breeding?

Reducing Costs via MASReducing Costs via MAS

Example disease resistance Example disease resistance • 10000 plants 10000 plants

Greenhouse space or field plots Greenhouse space or field plots • $5000 - $10000 $5000 - $10000

Time 4 months (salary) Time 4 months (salary) • $10 - $15000 $10 - $15000 • total cost = $15 - $25,000total cost = $15 - $25,000

Reducing Costs via MASReducing Costs via MAS

PCR-based testing @ $5 sample PCR-based testing @ $5 sample $50,000 - costs more? $50,000 - costs more? Analysis of trait not easily phenotypedAnalysis of trait not easily phenotyped E.g: Cadmium in Durum wheatE.g: Cadmium in Durum wheat 10000 plants need to reach maturity10000 plants need to reach maturity Cadmium accumulates in seedCadmium accumulates in seed

Reducing costs via MASReducing costs via MAS

$15 - 25 growing costs + analysis$15 - 25 growing costs + analysis Atomic Absorption @ $15 per sampleAtomic Absorption @ $15 per sample $150,000 + growing costs$150,000 + growing costs PCR analysis still $50000PCR analysis still $50000 Savings in time and money increase Savings in time and money increase

as more traits are analyzed as more traits are analyzed Many biochemical tests cost >$50 Many biochemical tests cost >$50

samplesample

Marker Assisted BreedingMarker Assisted Breeding

MAS allows for gene pyramiding - MAS allows for gene pyramiding - incorporation of multiple genes for a incorporation of multiple genes for a traittrait

Prevents development of biological Prevents development of biological resistance to a generesistance to a gene

Reduces space requirements - Reduces space requirements - dispose of unwanted plants and dispose of unwanted plants and animal early animal early

Trait2.58.47.12.54.52.3

P.1P.2I.1I.2I.3I.4

M. 1133221

M. 2131131

M. 3131123

QTL study

Statistical programs used in molecular marker studies* SAS* ANOVA* Mapmaker* Cartographer

Types of population used for molecular markers studies: F2, RILs, Backcrosses (MILs), DH.

QTL MappingQTL Mapping