Genetic InformationGenetic InformationSem 1, 2013/2014Sem 1, 2013/2014

IntroductionIntroduction General outline of biological inheritance and information transfer.General outline of biological inheritance and information transfer.- Info encoded within DNA, directs the functioning of living cells Info encoded within DNA, directs the functioning of living cells

and is transmitted to offspring, consists of specific sequence of and is transmitted to offspring, consists of specific sequence of nitrogenous bases. DNA synthesis involves the complementary nitrogenous bases. DNA synthesis involves the complementary pairing of nucleotide bases on 2 strands of DNA.pairing of nucleotide bases on 2 strands of DNA.

- Mechanism by which genetic info is decoded and used to direct Mechanism by which genetic info is decoded and used to direct cellular processes begins with the synthesis of RNA. RNA cellular processes begins with the synthesis of RNA. RNA synthesis- complimentary pairing of ribonucleotide bases with synthesis- complimentary pairing of ribonucleotide bases with bases in DNA molecule. bases in DNA molecule.

- Several types of RNA involved in the synthesis of enzymes, Several types of RNA involved in the synthesis of enzymes, structural proteins and other types of polypeptides required for the structural proteins and other types of polypeptides required for the synthesis of biomolecules.synthesis of biomolecules.

Central dogma of molecular biologyCentral dogma of molecular biology

translationtranscription

replication

DNA RNA PROTEIN

Solid arrow indicate types of information transfers that occur in cells. DNA directs its own replication to produce new DNA molecule; DNA is transcribes into RNA; RNA is translated into protein. The dashed lines represent information transfers that occur in certain organisms.

Describe the flow of genetic information from DNA through RNA and eventually to protein

<------------------

DNA replication DNA replication

DNA replication is an anabolic polymerization DNA replication is an anabolic polymerization process, that process, that allows a cell to pass copies of its allows a cell to pass copies of its genome to its descendantsgenome to its descendants..

Must occur before every cell divisionMust occur before every cell division After two strands of DNA separate, each serves as After two strands of DNA separate, each serves as

template for the synthesis of a complementary strand.template for the synthesis of a complementary strand. Biologists say that DNA replication is Biologists say that DNA replication is

semiconservative replication semiconservative replication because each daughter because each daughter DNA molecule is composed of one original strand DNA molecule is composed of one original strand and one new strand.and one new strand.

PRINCIPAL OF DNA REPLICATION

Discovered by Matthew Meselson and Franklin Stahl, 1958.

• They observed that during replication, each parental strands serves as a template for DNA synthesis.

• After new strand is formed, it is hydrogen bonded to its parental strand.

• Each of the double helix contains one parent DNA strand and one newly synthesized daughter strand.

c) Synthesis of lagging strand

DNA REPLICATION PROCESS

Initial Processes in DNA ReplicationInitial Processes in DNA Replication

DNA replication begins at a specific sequence of DNA replication begins at a specific sequence of nucleotides called an nucleotides called an originorigin. .

First, a cell removes chromosomal proteins, exposing First, a cell removes chromosomal proteins, exposing the DNA helix. the DNA helix.

DNA unwindingDNA unwinding An enzyme called An enzyme called DNA helicase DNA helicase locally locally

"unzips/unwind" "unzips/unwind" the DNA molecule by breaking the the DNA molecule by breaking the hydrogen bonds between complementary nucleotide hydrogen bonds between complementary nucleotide bases, which exposes the bases in a bases, which exposes the bases in a replication forkreplication fork. . Other protein molecules stabilize the single strands so Other protein molecules stabilize the single strands so that they do not rejoin while replication proceedsthat they do not rejoin while replication proceeds

Primer synthesisPrimer synthesis

- Formation of short RNA segments called - Formation of short RNA segments called primersprimers- - required for the initiation of DNA replication required for the initiation of DNA replication (catalyzed by (catalyzed by primaseprimase, RNA polymerase). , RNA polymerase).

DNA synthesisDNA synthesis

- The synthesis of a complementary DNA strand by - The synthesis of a complementary DNA strand by forming phosphodiester linkages between forming phosphodiester linkages between nucleotides base-paired to a template strand is nucleotides base-paired to a template strand is catalyzed by an enzyme catalyzed by an enzyme DNA polymeraseDNA polymerase..

DNA polymerases III DNA polymerases III replicate DNA in only one replicate DNA in only one direction - 5' to 3' - like a jeweler stringing direction - 5' to 3' - like a jeweler stringing pearls to make a necklace, adding them one at a pearls to make a necklace, adding them one at a time, always moving from one end of the string time, always moving from one end of the string to the other. to the other.

Besides DNA polymerase III, DNA polymerase I Besides DNA polymerase III, DNA polymerase I and DNA polymerase II. and DNA polymerase II.

DNA polymerase I- DNA repair enzyme and DNA polymerase I- DNA repair enzyme and removing RNA primer during replication. removing RNA primer during replication.

DNA polymerase II- similar to DNA pol II. DNA polymerase II- similar to DNA pol II.

Because the two original (template) strands are Because the two original (template) strands are antiparallel cells synthesize new strands in antiparallel cells synthesize new strands in two two different ways:different ways:1) One new strand, called the 1) One new strand, called the leading strandleading strand, is , is synthesized continuously as a single long synthesized continuously as a single long chain of nucleotides. chain of nucleotides. 2)The other new strand, called the 2)The other new strand, called the lagging lagging strandstrand, is synthesized in short segments that , is synthesized in short segments that are later joined by DNA ligase (Okazaki are later joined by DNA ligase (Okazaki fragments). fragments).

Synthesis of the Lagging StrandSynthesis of the Lagging Strand The steps in the synthesis of a lagging strand are as The steps in the synthesis of a lagging strand are as

follows : follows : The discontinuous synthesis on the lagging strand The discontinuous synthesis on the lagging strand

requires primer synthesis for each of the Okazaki requires primer synthesis for each of the Okazaki fragments. fragments.

The primosome travels along the lagging strand and stops The primosome travels along the lagging strand and stops and reverses direction at intervals to synthesize a short and reverses direction at intervals to synthesize a short RNA primer. RNA primer.

Nucleotides pair up with their complements in the Nucleotides pair up with their complements in the template-adenine with thyamine, and cytosine with template-adenine with thyamine, and cytosine with guanine. guanine.

DNA polymerase III joins neighboring nucleotides and DNA polymerase III joins neighboring nucleotides and proofreads. Each Okazaki fragment requires a new RNA proofreads. Each Okazaki fragment requires a new RNA primer and consists of 1000 to 2000 nucleotides. primer and consists of 1000 to 2000 nucleotides.

DNA polymerase I replaces the RNA primers of Okazaki DNA polymerase I replaces the RNA primers of Okazaki fragments with DNA and further proofreads the daughter fragments with DNA and further proofreads the daughter strand. strand.

DNA ligase DNA ligase seals the gaps between adjacent Okazaki seals the gaps between adjacent Okazaki fragments to form a continuous DNA strand. fragments to form a continuous DNA strand.

TranscriptionTranscription

TRANSCRIPTION is the synthesis of RNA TRANSCRIPTION is the synthesis of RNA under the direction of DNAunder the direction of DNA

DNA strand provide a template for assembling DNA strand provide a template for assembling a sequence of RNA nucleotidesa sequence of RNA nucleotides

The resulting RNA molecule is the transcript The resulting RNA molecule is the transcript of the gene’s protein-building instructionof the gene’s protein-building instruction

Called mRNA (messenger RNA) – carry Called mRNA (messenger RNA) – carry genetic message from DNAgenetic message from DNA

Initiation of TranscriptionInitiation of Transcription

RNA polymerasesRNA polymerases - the enzymes that synthesize RNA - the enzymes that synthesize RNA RNA polymerase bind to specific nucleotide sequences RNA polymerase bind to specific nucleotide sequences

called called promoter - promoter - include the transcription startpoint (the include the transcription startpoint (the nucleotides where RNA synthesis begin)nucleotides where RNA synthesis begin)

Initiation of TranscriptionInitiation of Transcription Prokaryotic promoters- variable in size (from 20bp – Prokaryotic promoters- variable in size (from 20bp –

200 bp), 2 short sequences at positions about 10 and 200 bp), 2 short sequences at positions about 10 and 35 bp upstream of the transcription initiation site are 35 bp upstream of the transcription initiation site are remarkably similar among bacterial species remarkably similar among bacterial species (consensus sequences). (consensus sequences).

-10 region- Pribnow box. -10 region- Pribnow box. RNA polymerase slides along the DNA until it RNA polymerase slides along the DNA until it

reaches a promoter sequence. reaches a promoter sequence. Once it bind to the promoter sequence, RNA Once it bind to the promoter sequence, RNA

polymerase unwinds and unzips the DNA molecule in polymerase unwinds and unzips the DNA molecule in the promoter regionthe promoter region

After unzip, RNA polymerase initiate RNA synthesis After unzip, RNA polymerase initiate RNA synthesis at the promoter on the template strandat the promoter on the template strand

When the transcribed sequence reaches a When the transcribed sequence reaches a length of about 10 nucleotides, the length of about 10 nucleotides, the conformation of the RNA complex changes: conformation of the RNA complex changes: for e.g the for e.g the σσ factor is released- initiation phase factor is released- initiation phase ends.ends.

Elongation of the RNA TranscriptElongation of the RNA Transcript

Once the factor detaches, the affinity of the RNA polymerase Once the factor detaches, the affinity of the RNA polymerase complex for the promoter site decreases- the elongation phase begins.complex for the promoter site decreases- the elongation phase begins.

As RNA polymerase moves along the DNA, it continues to untwist As RNA polymerase moves along the DNA, it continues to untwist the double helix for pairing with RNA nucleotidesthe double helix for pairing with RNA nucleotides

The enzyme add nucleotides to the 3’ end of the growing RNA The enzyme add nucleotides to the 3’ end of the growing RNA molecule as it continues along the double helixmolecule as it continues along the double helix

Elongation of the RNA TranscriptElongation of the RNA Transcript In the wake of transcription, the DNA strands In the wake of transcription, the DNA strands

re-form the double helix and the new RNA re-form the double helix and the new RNA molecule peels away from its DNA.molecule peels away from its DNA.

The incorporation of the ribonucleotides The incorporation of the ribonucleotides continues until a termination signal is reached.continues until a termination signal is reached.

Termination of TranscriptionTermination of Transcription

Transcription proceeds until shortly after the RNA Transcription proceeds until shortly after the RNA polymerase transcribes a DNA sequence called a terminatorpolymerase transcribes a DNA sequence called a terminator

Termination sequences contain palindromes. Termination sequences contain palindromes. The RNA transcript of the DNA palindrome forms a stable The RNA transcript of the DNA palindrome forms a stable

hairpin turn- this structure disrupts the RNA-DNA hybrid hairpin turn- this structure disrupts the RNA-DNA hybrid structure.structure.

After the RNA is released, the polymerase dissociate from After the RNA is released, the polymerase dissociate from the DNAthe DNA

TRANSLATIONTRANSLATION

Translation is the process whereby ribosomes Translation is the process whereby ribosomes use the genetic information of nucleotide use the genetic information of nucleotide sequences to synthesize polypeptides sequences to synthesize polypeptides composed of specific amino acid sequences. composed of specific amino acid sequences.

In translation process, cell interprets a genetic In translation process, cell interprets a genetic message and builds a proteinmessage and builds a protein

Message = is a series of codons along an Message = is a series of codons along an mRNA moleculemRNA molecule

Interpreter = transfer RNA (tRNA)Interpreter = transfer RNA (tRNA) tRNA = transfer amino acids from cytoplasm’s tRNA = transfer amino acids from cytoplasm’s

amino acid pool to ribosomeamino acid pool to ribosome The ribosome adds each amino acid brought to The ribosome adds each amino acid brought to

it by tRNA to the growing end of a it by tRNA to the growing end of a polypeptide chainpolypeptide chain

As a tRNA molecule arrives at a ribosome, it As a tRNA molecule arrives at a ribosome, it bears a specific amino acid at one end.bears a specific amino acid at one end.

At the other end is a nucleotide triplet called At the other end is a nucleotide triplet called an anticodon, which binds according to base-an anticodon, which binds according to base-pairing rules to a complementary codon on pairing rules to a complementary codon on mRNA.mRNA.

The genetic codeThe genetic code During protein synthesis, nucleic acid base sequence During protein synthesis, nucleic acid base sequence

is converted to amino acid sequence- translationis converted to amino acid sequence- translation Is a coding dictionary that specifies a meaning for a Is a coding dictionary that specifies a meaning for a

base sequencebase sequence the genetic code define as triplets of mRNA the genetic code define as triplets of mRNA

nucleotides called nucleotides called codonscodons that code for specific that code for specific amino acids.amino acids.

64 possible arrangements - more than enough to 64 possible arrangements - more than enough to specify 21 amino acids.specify 21 amino acids.

61 codons specify amino acids and 3 codons61 codons specify amino acids and 3 codons

-UAA, UAG, and UGA-to stop translating-UAA, UAG, and UGA-to stop translating UGA codes for the 21st amino acid, selenocysteine.UGA codes for the 21st amino acid, selenocysteine. Codon AUG also has a dual function, acting as both a Codon AUG also has a dual function, acting as both a

start signal and coding for an amino acid – start signal and coding for an amino acid – methionine.methionine.

Genetic code possess the Genetic code possess the following properties:following properties:

DegenerateDegenerate- Several signals have the same meaning. Several signals have the same meaning. - The genetic code is partially degenerate The genetic code is partially degenerate

because most amino acids are coded for by because most amino acids are coded for by several codons.several codons.

- For eg: Leu is coded by 6 different codons.For eg: Leu is coded by 6 different codons.

SpecificSpecific- Each codon is a signal for a specific amino acid.Each codon is a signal for a specific amino acid.- Majority of codons that code for the same amino Majority of codons that code for the same amino

acid possess similar sequences. acid possess similar sequences. - For eg: serine (UCU, UCC, UCA and UCG)- the For eg: serine (UCU, UCC, UCA and UCG)- the

first and second bases are identical. first and second bases are identical. - Consequently, a point mutation in the third base Consequently, a point mutation in the third base

of a serine codon would not be deleterious.of a serine codon would not be deleterious.

Nonoverlapping and without punctuationNonoverlapping and without punctuation- mRNA coding sequence is read by a ribosome mRNA coding sequence is read by a ribosome

starting from the initiating codon (AUG) as a starting from the initiating codon (AUG) as a continuous sequence taken 3 bases at a time continuous sequence taken 3 bases at a time until a stop codon is reached.until a stop codon is reached.

- A set of contiguous triplet codons in an mRNA A set of contiguous triplet codons in an mRNA is called a reading frame.is called a reading frame.

UniversalUniversal

- Coding signals for amino acids are always the - Coding signals for amino acids are always the same. same.

AUG = start codon

Protein SynthesisProtein Synthesis

The translation of a genetic message into the The translation of a genetic message into the primary sequence of a polypeptide can be primary sequence of a polypeptide can be divided into 3 phases.divided into 3 phases.

- InitiationInitiation- ElongationElongation- TerminationTermination

INITIATIONINITIATION

Initiation- Small ribosomal Initiation- Small ribosomal subunit binds an mRNAsubunit binds an mRNA

The anticodon of a specific The anticodon of a specific tRNA (initiator tRNA) base tRNA (initiator tRNA) base pairs with the initiation codon pairs with the initiation codon AUG.AUG.

Iniation ends as the large Iniation ends as the large ribosomal subunit combines ribosomal subunit combines with small subunit.with small subunit.

There are 2 sites on the There are 2 sites on the complete ribosome for codon-complete ribosome for codon-anticodon interactionsanticodon interactions

There are 2 sites on the complete ribosome for There are 2 sites on the complete ribosome for codon-anticodon interactions:codon-anticodon interactions:

- The P (peptidyl) site- now occupied with The P (peptidyl) site- now occupied with initiatorinitiator

- The A (aminoacyl) siteThe A (aminoacyl) site

ELONGATIONELONGATION

During elongation- polypeptide is synthesized During elongation- polypeptide is synthesized according to the genetic message.according to the genetic message.

The message is read from 5’-3’ direction- The message is read from 5’-3’ direction- polypeptide synthesis proceeds from the N-polypeptide synthesis proceeds from the N-terminal to C-terminal. terminal to C-terminal.

Elongation begins- as a second aminoacyl-Elongation begins- as a second aminoacyl-tRNA becomes bound to the ribosome in A tRNA becomes bound to the ribosome in A site becoz of codon-aticodon base pairing. site becoz of codon-aticodon base pairing.

Peptide bond formation is Peptide bond formation is catalyzed by peptidyl catalyzed by peptidyl transferase- the amino group transferase- the amino group of A site amino acid attacks of A site amino acid attacks the carbonyl group of P site the carbonyl group of P site a.a. both a.a are attached to a.a. both a.a are attached to the A site tRNA.the A site tRNA.

The uncharged tRNA at P site The uncharged tRNA at P site moves to E site.moves to E site.

Next step- translocation- the Next step- translocation- the ribosome moved along ribosome moved along mRNA.mRNA.

As the mRNA moves, the next As the mRNA moves, the next codon enters A site, and the codon enters A site, and the tRNA bearing the growing tRNA bearing the growing polypeptide chain moves to P polypeptide chain moves to P site. site.

The ribosome releases the The ribosome releases the ““empty" tRNA from the E empty" tRNA from the E site. In the cytosol, the site. In the cytosol, the appropriate enzyme appropriate enzyme recharges it with another recharges it with another molecule of its specific molecule of its specific amino acid. amino acid.

The cycle repeats, each time The cycle repeats, each time adding another amino acid adding another amino acid (in this case, threonine, then (in this case, threonine, then alanine, and then glutamine) alanine, and then glutamine) until a stop codon enters the until a stop codon enters the A site. A site.

TERMINATIONTERMINATION During termination the polypeptide chain is released from the During termination the polypeptide chain is released from the

ribosome.ribosome. Translation terminates because a stop codon cannot bind an Translation terminates because a stop codon cannot bind an

aminoacyl-tRNA.aminoacyl-tRNA. Instead, a protein releasing factor binds to the A site. Instead, a protein releasing factor binds to the A site. Subsequently, a peptidyl transferase hydrolyses the bond connecting Subsequently, a peptidyl transferase hydrolyses the bond connecting

the now-completed polypeptide and the tRNA in the P site.the now-completed polypeptide and the tRNA in the P site. translation ends as the ribosome releases mRNA and dissociates into translation ends as the ribosome releases mRNA and dissociates into

small and large subunits. small and large subunits.

Mutations of Genes:Mutations of Genes: Types of mutation Types of mutation

Mutations range from large changes in an Mutations range from large changes in an organism's genome, such as the loss or gain of an organism's genome, such as the loss or gain of an entire chromosome, to the most common type of entire chromosome, to the most common type of mutation - mutation - point mutationspoint mutations - in which just one - in which just one nucleotide base pair is affected. nucleotide base pair is affected.

Mutations include Mutations include base pair insertionsbase pair insertions, , deletionsdeletions, and , and substitutionssubstitutions. .

Effects of MutationsEffects of Mutations Some base-pair substitutions Some base-pair substitutions

produce produce silent mutationssilent mutations because the substitution does because the substitution does not change the amino acid not change the amino acid sequence because of the sequence because of the redundancy of the genetic redundancy of the genetic code.code.

For example, when the DNA For example, when the DNA triplet AAA " is changed to triplet AAA " is changed to AAG, the mRNA codon will AAG, the mRNA codon will be changed from UUU to be changed from UUU to UUC; however, because both UUC; however, because both codons specify the amino acid codons specify the amino acid phenylalanine, there is no phenylalanine, there is no change in the phenotype - the change in the phenotype - the mutation is silent because it mutation is silent because it affects the genotype only. affects the genotype only.

Of greater concern are substitutions that Of greater concern are substitutions that change a codon for one amino acid into a change a codon for one amino acid into a codon for a different amino acid. codon for a different amino acid.

A change in a nucleotide sequence A change in a nucleotide sequence resulting in a codon that specifies a resulting in a codon that specifies a different amino acid is called a different amino acid is called a missense missense mutationmutation; what gets transcribed and ; what gets transcribed and translated makes sense, but not the right translated makes sense, but not the right sense. sense.

The effect of missense mutations depends The effect of missense mutations depends on where in the protein the different on where in the protein the different amino acid occurs. amino acid occurs.

When the different amino is in a critical When the different amino is in a critical region of a protein, the protein becomes region of a protein, the protein becomes nonfunctional; however, when the nonfunctional; however, when the different amino acid is in a less important different amino acid is in a less important region, the mutation has no adverse effect. region, the mutation has no adverse effect.

A third type of mutation A third type of mutation occurs when a base-pair occurs when a base-pair substitution changes an substitution changes an amino acid codon into a amino acid codon into a stop codon. stop codon.

This is called a This is called a nonsense nonsense mutationmutation. Nearly all . Nearly all nonsense mutations result nonsense mutations result in nonfunctional proteins. in nonfunctional proteins.

Frameshift mutationsFrameshift mutations (that is, insertions or (that is, insertions or deletions) typically deletions) typically result in drastic result in drastic missense and nonsense missense and nonsense mutations, except when mutations, except when the insertion or deletion the insertion or deletion is very close to the end is very close to the end of a gene of a gene

ExerciseExercise

The following synthetic mRNA sequence The following synthetic mRNA sequence codes for the beginning of a polypeptide:codes for the beginning of a polypeptide:

5’AUGUCUCCUACUGCUGACGAGGGAAG5’AUGUCUCCUACUGCUGACGAGGGAAGGAGGUGGCUUAUCAUGUUU- 3’GAGGUGGCUUAUCAUGUUU- 3’

Determine the amino acid sequence of the Determine the amino acid sequence of the polypeptide.polypeptide.

TECHNIQUES IN TECHNIQUES IN MOLECULAR MOLECULAR

BIOLOGYBIOLOGY

Recombinant DNA technologyRecombinant DNA technology

In molecular cloning, a piece of DNA isolated In molecular cloning, a piece of DNA isolated from donor cell is splice into a vector.from donor cell is splice into a vector.

Forming a recombinant DNA requires a restriction Forming a recombinant DNA requires a restriction enzyme which cut the vector/DNA open. enzyme which cut the vector/DNA open.

After sticky ends of the vector have annealed with After sticky ends of the vector have annealed with those of the donor DNA, a DNA ligase joins this 2 those of the donor DNA, a DNA ligase joins this 2 moleculesmolecules

Then, the recombinant molecules is inserted into a Then, the recombinant molecules is inserted into a host.host.

Genomic librariesGenomic libraries

How do you identify and clone a gene of How do you identify and clone a gene of interest?interest?

Many cloning strategies begin by preparing a Many cloning strategies begin by preparing a DNA libraryDNA library

Genomic libraries are collections of clones Genomic libraries are collections of clones derived from fragments of entire genomes. derived from fragments of entire genomes.

PREPARING GENOMIC DNA PREPARING GENOMIC DNA LIBRARIESLIBRARIES

GENOMIC DNA LIBRARY GENOMIC DNA LIBRARY

LIBRARY SCREENINGLIBRARY SCREENING

Once a genomic library is created, it must be Once a genomic library is created, it must be screened to identify the genes of interest.screened to identify the genes of interest.

One of the most common library screening One of the most common library screening techniques is called colony/plaque techniques is called colony/plaque hybridization method. hybridization method.

Colony hybridization methodColony hybridization method

Probe: a single-stranded radioactive labeled DNA fragment Probe: a single-stranded radioactive labeled DNA fragment that is complementary to the gene of interestthat is complementary to the gene of interest