Generation of calves persistently infected with HoBi-like...

1

Generation of calves persistently infected with HoBi-like pestivirus and comparison of 1

methods for detection of these persistent infections 2

3

Generation and test of HoBi-like virus PI calves 4

5

F. V. Bauermann#ah, S. M. Falkenbergb, B. Vander Leyc, N. Decarod, B. W. Brodersene, A. 6

Harmonf, B. Hessmang, E. F. Floresh, J. F. Ridpatha 7

8

a Ruminant Disease and Immunology Research Unit, National Animal Disease Center, USDA, 9

Agricultural Research Service, P.O. Box 70, Ames, IA, 50010. 10

b Elanco Animal Health, Vaccine Development, 2500 Innovation Way, Greenfield, IN, 46160. 11

c College of Veterinary Medicine, University of Missouri, Columbia, MO, 65211. 12

d Department of Veterinary Medicine, University of Bari, Valenzano, Italy. 13

e School of Veterinary Medicine and Biomedical Sciences, University of Nebraska, Lincoln, NE 14

68583. 15

f Novartis Animal Health US, Inc., Larchwood, IA, 51241. 16

g Haskell County Animal Hospital LLC, Central States Testing LLC, Sublette, KS 67877. 17

h Department of Preventiva Veterinary Medicine, Federal University of Santa Maria, Santa 18

Maria, Brazil. 19

Fernando V. Bauermann - present address: Ruminant Disease and Immunology Research 20

Unit, National Animal Disease Center, USDA, Agricultural Research Service, P.O. Box 70, 21

Ames, IA, 50010. 22

JCM Accepts, published online ahead of print on 13 August 2014J. Clin. Microbiol. doi:10.1128/JCM.01563-14Copyright © 2014, American Society for Microbiology. All Rights Reserved.

on July 11, 2018 by guesthttp://jcm

.asm.org/

Dow

nloaded from

http://jcm.asm.org/

2

#Corresponding Author: Dr. Fernando V. Bauermann, USDA, ARS, National Animal 23

Disease Center, 1920 Dayton Avenue, P.O. Box 70, Ames, IA 50010, 24

[email protected] 25

26

Abstract 27

Identification and elimination of persistently infected (PI) cattle are the most effective 28

measures for controlling bovine pestiviruses, including bovine viral diarrhea virus (BVDV) and 29

the emerging HoBi-like viruses. Here, colostrum deprived HoBi-like PI calves have been 30

generated and sampled (serum, buffy coat, ear notches) at day of birth and weekly for 5 31

consecutive weeks. Samples were assayed by diagnostic tests for BVDV: two reverse 32

transcriptase-polymerase chain reaction (RT-PCR); two commercial real-time RT-PCR (RT-33

qPCR); two antigen capture enzyme-linked immunosorbent assay (ACE) and 34

immunohistochemistry (IHC); and by HoBi-virus specific RT-PCR and RT-qPCR. The rate of 35

false negatives varied from calf to calf. The HoBi-like specific RT-PCR detected 83%, 75% and 36

87% of serum, buffy coat and ear notch samples, respectively, while the HoBi-like RT-qPCR 37

respectively detected 83%, 96% and 62%. In comparison, the BVDV RT-PCR test had a higher 38

rate of false negative in all tissues, especially for ear notches (missing at least 68% of samples). 39

The commercial BVDV RT-qPCRs and IHC detected 100% of ear notches. While ACE based on 40

the BVDV glycoprotein Erns detected at least 87% of ear notches, no samples were detected 41

using NS3 based ACE. The BVDV RT-qPCR, ACE, and the IHC tests yielded higher levels of 42

detection compared to HoBi-like specific assays, although the lack of differentiation between 43

BVDV and HoBi-like viruses would make these tests of limited use in a HoBi-like PI control 44


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

3

and/or surveillance. Improvement of HoBi-like virus tests is required before a reliable HoBi-like 45

PI surveillance program can be designed. 46

47

Key words: Atypical pestivirus, BVDV, diagnostic, transplacental infection. 48

49

50

Introduction 51

Bovine viral diarrhea (BVD) is a widespread disease in cattle, leading to significant 52

economic losses worldwide. The disease is historically associated with the bovine pestivirus 53

species bovine viral diarrhea virus type 1 (BVDV1) and BVDV2 (1, 2). Infection with a putative 54

pestivirus species variously referred as HoBi-like virus, BVDV3 or atypical pestivirus leads to a 55

repertoire of syndromes indistinguishable from BVD. Clinical signs includes upper respiratory 56

disease, fever, transient immune suppression, death among young stock, reproductive loses, and 57

the generation of persistently infected (PI) animals (3-8). 58

Calves born persistently infected with BVDV (BVDV PI) are positive for virus antigen in 59

nearly all tissues, but negative for antibodies against their homologous BVDV, prior to 60

colostrum intake. While some BVDV PI calves have congenital malformations others are 61

clinically normal (1, 9). These animals shed the virus to the environment continuously over their 62

lifetimes (1, 10) and thus play a major role in introducing and maintaining viral circulation in 63

cattle herds (11). 64

The course of uncomplicated acute BVDV infections in adult non-pregnant animals is 65

generally subclinical or clinically mild. As a consequence, the introduction of BVDV PI animals 66

into a naïve herd may goes undetected until an increased rate of reproductive loss is noticed. 67

Hence, the identification and elimination of BVDV PI calves, on the top of adoption of 68


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

4

biosecurity measures that prevent the introduction of BVDV PI animals into herds, is necessary 69

for the control of BVDV (11, 12). 70

Despite BVDV control efforts in several European countries (12), BVDV infections still 71

result in significant economical impact on major cattle markets worldwide (4, 13, 14). In 72

contrast, HoBi-like viruses do not appear to be endemic in all continents. In South America, 73

HoBi-like has been associated with reproductive disorders in Brazilian cattle herds, and death of 74

water buffalos as well (3, 4, 15). In Italy, infection of cattle with HoBi-like virus resulted in 75

abortion, respiratory disease, death of young animals and the birth of PI calves (5, 6, 16). 76

Evidence of HoBi-like virus in Asia has been reported. Although no clinical sign was noted, 77

seroconversion to HoBi-like viruses were observed in some dairy herds in Thailand (17). In 78

Bangladesh, HoBi-like viral sequences were detected in samples from animals that were 79

admitted to veterinary hospitals between the years 2009 and 2010. Although the specific clinical 80

description for each animal was not disclosed, all animals admitted to the hospital displayed at 81

least one of the following clinical signs: diarrhea, respiratory distress and/or fever (18). 82

Limiting the spread of BVDV requires the fast and reliable detection of PI animals. The 83

gold standard test for BVDV PI identification is virus isolation, however this test is labor and 84

time consuming; and the presence of maternal antibodies may lead to false negative results (19, 85

20). The most commonly used tests in systematic controls and eradications strategies worldwide, 86

to detect newborn BVDV PI calves, are the antigen capture enzyme linked immunosorbent 87

assays (ACE) and variations of RT-PCR based tests using skin samples (11, 12). The RT-PCR 88

based tests yield fast results and the interference by maternal antibodies is absence or minimal 89

(20, 21). Another sensitive and specific tool for BVDV detection are immunohistochemistry 90

(IHC) test conducted on skin biopsies collected from the ear. IHC, based on detection of the 91


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

5

viral Erns in ear notch samples has been successfully used for BVDV PI screening (22). However, 92

because this test requires a higher level of expertise in determining results, the test is rarely 93

employed in large scale BVDV control efforts. 94

While the identification a HoBi-like PI calf has been detected in the field (23), there is 95

limited information available regarding HoBi-like PI animal detection. Failure to detect HoBi-96

like PIs and differentiate them from BVDV PIs may lead to underestimation the economic 97

impact of HoBi-like virus infection in cattle, and hamper efforts to detect the introduction of this 98

emerging pestivirus into non-endemic regions. In order to provide initial guidelines toward the 99

development of a HoBi-like surveillance system, the present study generated HoBi-like PI 100

animals under controlled conditions and then compared the detection rate of several tests 101

including BVDV diagnostic tests: two RT-PCR; two commercial RT-qPCR; two ACE and 102

immunohistochemistry. Samples were also tested by a RT-PCR and a RT-qPCR reaction specific 103

for HoBi-like viruses. 104

105

Material and Methods 106

107

Viruses and cells 108

Primary bovine turbinate cells (BTu) with twelve passages or less were used to propagate 109

and titrate the two HoBi-like virus strains used in this study (HoBi_D32/00 and Italy-1/10-1). 110

HoBi_D32/00 was isolated in Germany as a contaminant of a fetal bovine serum lot that 111

originated in South America (7), while the isolate Italy-1/10-1 was identified in an outbreak of 112

respiratory disease in an Italian herd (5). The cells used for virus amplification were grown in 113

minimal essential medium (MEM), supplemented with L-glutamine (1.4 mM), gentamicin (50 114


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

6

mg/l), and 10% FBS; tested free for pestivirus antigen and antibodies respectively by PCR and 115

VNT (24). For virus propagation, 25cm2 flasks containing 70% confluent BTu cell monolayers 116

were inoculated with one of the two HoBi-like strains and incubated at 37 °C for 72–96 h. 117

Following one cycle of freeze and thaw, the suspension was centrifuged for 10 min at 1,000 × g. 118

Supernatants were collected, aliquoted and stored at –70 °C until use. The virus stocks were 119

titrated in 96-well microtiter plates by end point dilution, using immunoperoxidase staining with 120

the anti-E2 monoclonal antibody N2 for endpoint detection of viral antigens as previously 121

described (24). Titers were calculated according to Reed & Muench (1938) and expressed as 122

median tissue culture infective doses (TCID) (25). 123

124

HoBi-like persistently infected calves generation and testing 125

Twelve crossbreed heifers tested negative for BVDV and HoBi-like viruses by virus 126

isolation and RT-PCR were selected (2, 26). These heifers also tested negative for BVDV and 127

HoBi-like virus neutralizing antibodies by virus neutralization test as previously described (27). 128

Estrus synchronization and artificial insemination were performed. Eight pregnant heifers were 129

selected and moved into biosecurity level 3 (BL3) containment around 55 days of gestation, and 130

housed two heifers per room. The animals were infected at around day 70 of gestation by 131

instillation of 2.5ml of infected cell supernatant (105 TCID50/ml) into each nostril. Four heifers 132

(two rooms) were infected with the HoBi-like strain Italy-1/10-1 and four heifers were infected 133

with the strain HoBi_D32/00. Body temperature was continuously monitored for 14 days post 134

infection using intravaginal devices and probes (Advanced Telemetry Systems, Isanti, MN, 135

USA), and recording using a remote system as previously described (28). Twelve temperature 136

readings (temperatures measured and stored every 5 min) were averaged for each hour. Blood 137


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

7

was collected on the 6th day post infection for virus detection. Buffy coats isolated from blood 138

were submitted to RT-PCR using the primer set N2-R5 following the protocol described below. 139

At approximately 75, 100, and 160 days of gestation, blood was collected from the heifers and 140

serum submitted to a third party commercial laboratory for certification of pregnancy status 141

using ELISA (BioPRYN - Bio Tracking LLC, Moscow, ID, USA). Six heifers achieved full 142

term gestation and birth was induced about 10 days prior to the estimated due date. Calves were 143

separated from the dam prior to receiving colostrum and were kept in BL3 containment in 144

individual crates under conditions described previously (29). Calves were housed two per room 145

in two rooms, depending on the viral strain with which they were infected. Animals were 146

handled in accordance with the Animal Welfare Acts Amended (7USC, 2131-2156). Calves were 147

sampled at day of birth (DOB) and all surviving calves were sampled weekly for five 148

consecutive weeks. Samples collected consisted of serum, buffy coat and ear notch. After 149

collection, samples were immediately processed as described below. Serum, buffy coat and ear 150

notch samples were tested using two BVDV RT-PCR and two commercial BVDV RT-qPCR. 151

Ear notches samples were also tested using two BVDV antigen capture enzyme-linked 152

immunosorbent assay (ACE) and IHC. A HoBi-like specific RT-PCR and a HoBi-like specific 153

RT-qPCR were also used to test RNA samples from serum, buffy coat, and ear notches. The 154

identity of the virus infecting the PI calves was confirmed by sequencing products amplified 155

from serum samples using the HoBi-like specific RT-PCR (primers N2-R5) as described below. 156

The PCR products were not cloned but sequenced directly in both directions. All templates were 157

sequenced in duplicate from both directions. Templates were labeled according to 158

manufacturer’s recommendations using commercial available chemistries (Terminator BigDye 159


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

8

v3.1, Invitrogen, Carlsbad, CA) and sequenced (3130xl Genetic Analyzer, Invitrogen, Carlsbad, 160

CA). 161

Tissues collection and preparation 162

For serum, blood was collected in serum separation tubes with gel and clot activator. 163

Buffy coat samples were obtained from whole blood collected in heparin tubes. Tubes were 164

centrifuged at 800 x g for 25 min, buffy coats were separated and collected. Ear skin biopsies 165

were collected using an ear notch punch. Three sets of ear notch samples, from each calf, were 166

collected for each time point. One set of 0.3 cm2 ear notch pieces were individually soaked in 167

500 µl of PBS for 30 min followed by a –20 °C freeze/thaw cycle. Samples prepared using this 168

method will be hereafter called conventionally extracted samples. Aliquots of the PBS that the 169

ear notches had soaked were processed for RNA extraction and ACE. The second set of 0.3 cm2 170

ear notch pieces were individually soaked in a proprietary extraction solution (Bill Hessman - 171

Haskell County Animal Hospital LLC, Central States Testing LLC, Sublette, KS, USA), these 172

samples will be referred as enhanced extracted. Aliquots of enhanced extracted ear notches fluid 173

were used for ACE tests. The third set of ear notches was formalin-fixed, paraffin-embedded and 174

cut at 4μm. These sections were used for IHC testing as described previously (22). 175

RNA extraction 176

For RNA extraction from blood derived samples, a 140 µl aliquot of serum or a 70 µl of 177

aliquot of freeze/thawed buffy coat lysate (added of 70 µl of PBS) was used. For ear notches, 178

140 µl of solution (PBS) from samples conventionally extracted was used. RNA extraction was 179

performed using a robotic workstation (Qiacube, Qiagen, Hilden, Germany) for automated RNA 180

purification by spin-column system (QIAamp Viral RNA Mini Kit, Qiagen, Hilden, Germany) 181

according to the manufacture’s recommendations. The extracted RNA were stored at –70 °C. 182


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

9

Bovine viral diarrhea virus (BVDV) diagnostic tests 183

RT-PCR developed for use in research 184

RNA extracted from serum, buffy coat and ear notch was assayed using two published 185

RT-PCR tests that target the 5’ end untranslated region of the viral genome (5’UTR). 186

These tests previously were shown to detect several species of pestiviruses and frequently are 187

used to generate sequences used in phylogenetic analysis (2, 30). The primer sets used in these 188

two tests, HCV 90-368 and 324-326, will thereafter be referred to as BVDV primers. Reactions 189

were performed as previously described (2, 30). 190

Commercial RT-qPCR assays 191

The RNA samples extracted from the serum, buffy coats and ear notches were also 192

analyzed using two commercially available RT-qPCR assays. The first assay, hereafter-called 193

BVDV RT-qPCR-1 (Bovine Virus Diarrhea RNA test Kit - Applied Biosystems, Life 194

Technologies, Austin, TX, USA), was designed for detection of BVDV RNA extracted from 195

bovine ear notches. The 25 µl-reaction mixture used for the test consisted of 12.5 µl of 2 x RT-196

PCR Buffer, 1 µl of 25x BVDV Primer Probe Mix, 1 µl of of 25x RT-PCR Enzyme Mix and 8 197

µl of extracted RNA. Neither oligonucleotide sequences nor PCR target region are disclosed. 198

The thermal protocol consisted of revere transcription (RT) at 45 °C for 10 min, RT 199

inactivation/initial denaturation at 95 °C for 10 min, followed by 45 cycles of denaturation at 95 200

°C for 15 s and annealing-extension at 60 °C for 45 s. The second assay was the Virotype BVDV 201

test Kit (Qiagen, Labor Diagnostik Leipzig GmbH, Leipzig, Germany), hereafter called RT-202

qPCR-2. This assay was designed to detect BVDV in blood, plasma, serum, milk and ear notches 203

samples. The 25 µl-reaction mixture contained 19.75 µl of RT-PCR Mix, 0.25 µl of Enzyme Mix 204

and 5 µl of extracted RNA. Neither oligonucleotide sequences nor PCR target gene were 205


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

10

disclosed by the company. The thermal protocol follows: revere transcription at 50 °C for 20 206

min, RT inactivation/initial denaturation at 95 °C for 15 min, followed by 40 cycles of 207

denaturation at 95 °C for 30 s and annealing at 57 °C for 45 s and extension at 68 °C for 45 s. 208

Antigen capture enzyme linked immunosorbent assays (ACE) on ear notches 209

Aliquots prepared using conventional and enhanced extraction methods were tested using 210

two ACE based tests. The commercial HerdChek BVD Antigen Test Kit (IDEXX Laboratories, 211

Westbrook, ME, USA), was designed to detected epitopes located in the BVDV glycoprotein 212

Erns, and hereafter is referred as Erns ACE. This test was performed in duplicate following the 213

manufacture’s recommendations and the average value of the optical density (OD) was used to 214

calculate the sample to positive (S/P) ratio. Samples with S/P ratio equal or higher 0.3 were 215

considered positive. The second used ACE based test used was developed for use in a private 216

diagnostic laboratory (Haskell County Animal Hospital LLC, Central States Testing LLC, 217

Sublette, KS, USA) and consists of a dual antibody sandwich ACE targeting epitopes in the 218

BVDV non-structural protein NS3. It will here after be referred to as NS3 ACE. Ear notch 219

samples prepared by enhanced extraction were tested by ACE following the protocol described 220

elsewhere (31). 221

Immunohistochemistry on ear notches 222

Slides were deparaffinized and stained on an automated immunohistochemical stainer 223

(Ventana BenchMark ULTRA, Ventana Medical Systems, Inc., Tucson, AZ, USA). Primary 224

antibodies consisted of anti-BVDV Erns monoclonal antibody 15C5 IDEXX Laboratories, 225

Westbrook, Maine, USA (32). Positive and negative controls for BVDV staining consisted, 226

respectively, of a slide containing known positive tissue along with slides of test samples using 227

an irrelevant primary antibody. After deparaffinization on the immunohistochemistry stainer, the 228


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

11

slides were incubated with Protease III (Ventana, Ventana Medical Systems, Inc., Tucson, AZ, 229

USA) for 12 min. Before application of the primary antibody (optimally diluted at 1:5,000), a 230

blocking step using Antibody Diluent (Ventana, Ventana Medical Systems, Inc., Tucson, AZ, 231

USA) for 12 min was performed. Primary antibody incubation was for 45 min at 37 °C. 232

Secondary antibody, alkaline phosphatase, and substrate are proprietary (UltraView Universal 233

Alkaline Phosphatase Red Detection Kit, Ventana Medical Systems, Inc., Tucson, AZ, USA). 234

Tissues were counterstained with hematoxylin for 4 min and covered with glass cover slip for 235

examination. 236

HoBi-like specific RT-PCR and RT-qPCR test 237

The RNA samples extracted from serum, buffy coat, and ear notches were tested using 238

two HoBi-like specific diagnostic tests developed for used in research. Both tests targeted the 239

5’UTR region. The first was a RT-PCR previously used for surveillance of HoBi-like viruses in 240

commercial fetal bovine serum batches (26). Briefly, the reaction employs the primers N2 241

(TCGACGCATCAAGGAATGCCT) and R5 (TAGCAGGTCTCTGCAACACCCTAT). The 242

reaction mix (25 µl total) included 6 µl of total RNA and was prepared using a commercial kit 243

(SuperScript III one-step RT-PCR system with Platinum Taq high fidelity, Invitrogen, Carlsbad, 244

CA, USA) following manufacture’s instructions. The assay included a reverse transcription step 245

at 55 °C for 25 min, followed by 2 min at 94 °C, 35 cycles of 94 °C for 30 s, 55 °C for 30 s, 68 246

°C for 25 s, with a final extension at 68 °C for 5 min. PCR amplicons were detected by 247

electrophoresis in a 1.0% stained (GelRed, Biotium, Hayward, CA, USA) agarose gel with 248

visualization under UV light. The second HoBi-like specific tested was a TaqMan RT-qPCR 249

based test also used in surveillance of clinical and biological samples for HoBi-like viruses (33). 250

The quantitative assay was conducted using the QuantiTect Probe RT-PCR Kit (Qiagen, Hilden, 251


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

12

Germany) in a 25 µl-reaction mixture containing 12.5 µl of 2x QuantiTect Probe RT-PCR 252

Master Mix, 0.25 µl of QuantiTect RT Mix, 600 nM of primers T134-F (5’-253

GACTAGTGGTGGCAGTGAGC-3’) and T220-R (5’-GAGGCATTCCTTGATGCGTC-3’), 254

200 nM of probe T155r-P (6FAM– 5’-ACTCGGGGCTTCGGTGATCCAGGG-3’-BHQ1) and 2 255

µl of RNA. The thermal profile consisted of revere transcription at 50 °C for 30 min, PCR initial 256

heat activation at 95 °C for 15 min, followed by 45 cycles of denaturation at 95 °C for 15 s and 257

annealing-extension at 60 °C for 1 min. 258

259

Results 260

HoBi-like PI calves generation 261

Based on RT-PCR testing using the primers N2-R5, buffy coat samples of all heifers 262

were positive for HoBi-like virus at day 6 post inoculation. ELISA confirmed seven out of eight 263

heifers as pregnant at days 75, 100 and 160 of gestation. One heifer #241, inoculated with 264

HoBi_D32/00 was negative during preg-check on day 75, and no evidence of abortion was found 265

in the pen during the study. Fever was verified in all heifers for at least two days during the first 266

seven days post inoculation. No other clinical signs were observed in the 14 days following virus 267

inoculation. Heifer #622 (inoculated with HoBi_D32/00) aborted around the eighth month of 268

gestation; fetal size was consistent with the gestation period and no malformation was evident. 269

HoBi-like virus was detected in the abdominal fluid of the aborted fetus using RT-PCR with the 270

N2-R5 primer set and fetal ear notch was positive by ACE and IHC (Fig. 1). 271

Parturition on the remaining six pregnant heifers was induced around 10 days before the 272

predicted due date. Calves #105 and #106 were born apparently healthy but died within 36 h of 273

birth. Both calves were born to heifers infected with the isolate Italy-1/10-1 and presented 274


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

13

bloody diarrhea in the 24 h following birth. At necropsy, their abdomen was distended and filled 275

with bloody fluid. Ear notch samples were positive using ACE and IHC (Fig. 1). HoBi-like virus 276

RNA was detected in both calves by RT-PCR using the primer set N2-R5. The four remaining 277

calves were diagnosed as PI animals by consecutive positive results throughout the study as 278

described below. Sequencing of templates of serum samples using the primers N2-R5 confirmed 279

that the virus infecting the PI calves matched the virus with which the dams were inoculated. 280

HoBi-like PI calves tissues testing 281

The results of testing are summarized in Table 1 and Figure 2. Variation in the 282

percentage of correct diagnosis was observed based on the test used, sample, and animal age. 283

The highest detection rate was achieved in ear notches using IHC, and the commercial BVDV 284

RT-qPCR-1 and 2 tests (100% for all ear notch samples in all calves). In contrast, the NS3 ACE 285

did not detect a single positive sample. 286

Bovine viral diarrhea virus (BVDV) diagnostic tests 287

RT-PCR developed for use in research 288

The rate of detection using a BVDV RT-PCR designed to detect a wide range of BVDV (HCV 289

90-368) or a “panpestivirus” test (324-326) were lower than the rate of detection using either of 290

the HoBi-like virus specific RT-PCR based tests. Comparing samples from all tested tissues and 291

time points, the rate of detection ranged from 28% to 83%. The rate of detection varied by calf 292

with the highest rate observed with tissues from calf #104 and the lowest from calf #101. Both 293

of these calves were infected with the HoBi-like strain Italy-1/10-1 (Table 1). The detection of 294

samples from calves infected with the strain Italy-1/10-1 was similar between BVDV RT-PCR-1 295

and 2. In contrast, detection was markedly lower for calves infected with the strain 296


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

14

HoBi_D32/00 using the BVDV RT-PCR-2. This was true with both ear notch and serum 297

samples. 298

Commercial BVDV RT-qPCR assays 299

The commercial BVDV RT-qPCR-1 and 2 detected all tested ear notches. Further, BVDV RT-300

qPCR-2 detected all serum and buffy coat samples. However, the rate of detection was lower on 301

serum and buffy coat samples using BVDV RT-qPCR-1. There was also a marked variation 302

observed in detection among samples from different calves using this test. While the RT-qPCR 303

test detected 61% of samples from calf #101, it detected at least 94% of the samples from the 304

other three PIs (Table 1). 305

Antigen capture enzyme linked immunosorbent assays (ACE) on ear notches 306

The Erns ACE detected all ear notch samples from PIs #102, and #104 but missed the detection of 307

PIs #101 and #103 at day of birth and PI #101 at week 1. Following enhanced extraction, 308

retesting using the same ACE kit, detection was improved with all samples but the ear notch 309

from PI #101 at day of birth (Fig. 2). An increase in the S/P ratio was observed with age using 310

conventional extraction. However, samples subjected to enhanced extraction exhibited a 311

consistent S/P ratio among the tested weeks (Fig. 3). The Erns ACE based tests had a higher 312

detection rate for HoBi-like viruses than BVDV RT-PCR-1 and 2 reactions. Regardless of 313

extraction method, all ear notches samples tested negative using the NS3 ACE (Table 1). 314

Immunohistochemistry on ear notches 315

IHC also detected 100% of ear notches samples. While the IHC and ACE Erns tests employed the 316

same monoclonal antibody (15C5), the detection rate was higher with IHC. Positive structures 317

included the epidermis, hair follicle infundibula, sebaceous glands, and dermal fibrocytes (Fig. 318


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

15

1). The staining pattern observed in ear skin sections from HoBi PI calves was indistinguishable 319

from the staining pattern seen in skin sections from BVDV PI animals. 320

HoBi-like specific RT-PCR and RT-qPCR tests 321

Using a HoBi-like virus specific RT-PCR, the detection of all combined tissues from each calf 322

ranged from 44% (PI #101) to 94% (PIs #102; 103; 104), using the HoBi specific RT-PCR test. 323

The rates of false negative results for each specimen were 25% for buffy coat, 17% for serum, 324

and 13% for ear notch (Table 1). Using the RT-qPCR reaction specific for HoBi-like viruses, the 325

detection ranged from 61% to 89%. The detection failure rate also varied by animal with calf 326

#101 with the highest rate and calf #103 with the lowest rate. While HoBi RT-PCR and RT-327

qPCR had the same level of detection in serum samples (83%), the rate of detection by RT-PCR 328

was lower in buffy coat samples. RT-PCR had a false negative rate of 25% compared to 4% of 329

failure using RT-qPCR. Conversely, using ear notch samples RT-qPCR had a higher false 330

negative rate, 38% versus 12% (Table 1). 331

332

Discussion 333

This study reports the generation and testing of calves persistently infected with HoBi-334

like viral strains under experimental conditions. While the abortion and the death of two 335

newborns cannot be unequivocally ascribed to HoBi-like virus infection, these events are 336

consistent with clinical presentations classically observed with other pestiviruses (1). Although 337

multiple positive tests over time were not possible, the presence of virus in multiple tissues and 338

fluids of these three animals is consistent with persistent infection (1, 9, 10, 23). The four 339

remaining calves were confirmed as persistently infected with HoBi-like viruses based on 340

multiple detections over a period of several weeks. 341


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

16

Both BVDV RT-PCR reactions had a greater number of false negative results compared 342

to HoBi-like virus specific RT-PCR based tests, corroborating with a previous report (26) these 343

results show that these frequently used BVDV tests are not reliable for use in a HoBi-like virus 344

surveillance programs. The number of the false negative results may, in part, be attributed to 345

mismatches between both BVDV primer pairs and HoBi-like virus sequences as previously 346

described (26). In contrast, a higher level of detection was achieved using either of the 347

commercial RT-qPCR tests. While the combination of all sample tissues resulted in a false 348

negative rate of 11% using the BVDV RT-qPCR-1, it should be noted that this test was 349

developed and validated for ear notches samples and the detection rate was 100% for ear notch 350

samples. However, neither test can differentiate between BVDV and HoBi-like virus infections. 351

Thus they are of limited use in a program designed to survey for HoBi-like viruses, requiring 352

additional testing for differentiation. 353

The S/P ratios on the Erns ACE were variable over time in conventionally extracted 354

samples with a trend toward increased S/P ratios with age. As these animals were colostrum 355

deprived, this effect cannot be attributed to the decrease of maternal antibodies. Additionally, 356

Erns ACE detection was improved by the enhanced extraction. Not only by stronger and 357

consistent signal throughout the study, but also by the higher number of positive samples as well. 358

It is unclear whether animals harboring BVDV strains would have a similar pattern of increased 359

S/P ratios when comparing samples from day of birth with samples collected two or more weeks 360

apart. It has been suggested that, for BVDV surveillance programs, testing at birth, before the 361

ingestion of colostrum is optimum (34). The results suggest that surveillance protocols for the 362

detection of HoBi-like viruses, especially for newborns, should include an enhanced extraction 363

step prior ACE Erns testing. Once again, these animals were colostrum deprived and the impact of 364


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

17

maternal antibodies in the tests employed in study cannot be measured. Although, using ACE 365

was reported a decrease of at least 10 fold in Erns titers when comparing samples of animals 366

before and after receiving colostrum; with Erns returning to initial levels three weeks later (21). 367

The ACE NS3 based test did not give a positive result with any of the samples. 368

Previously it has been reported that NS3 specific antibodies are present in BVDV PI calves prior 369

to ingestion of colostrum (21). In addition, in that study, calves presented a fairly stable NS3 370

antibody titer in the first month of age (21). Such antibodies could interfere with tests based on 371

NS3 detection. On the other hand, detection failure may merely correlate to the low/absent 372

antigenic cross reactivity between HoBi-like virus and BVDV within epitopes recognized by the 373

monoclonal antibodies used in this specific NS3 ACE. Some degree of divergences between 374

BVDV and HoBi-like NS3 has been shown by other studies (7, 24). Regardless for the reasons 375

for detection failure, the results presented in this study suggest that using both the Erns and the 376

NS3 ACE in tandem would allow the differentiation of HoBi-like viral infections from BVDV 377

infections for the purposes of preliminary screening. 378

It was observed that while both tests specific for HoBi-like viruses did detect HoBi-like 379

viruses in all calves, in multiple tissues and at multiple time points, neither one had a 100% 380

detection rate. While the HoBi-like strain D32/00 have no sequence mismatch with the primers 381

sequences used for the HoBi-like RT-PCR, there is one mismatch within the reverse primer (R5) 382

for the isolate Italy-1/10-1 (Fig. 4). Comparing sequences of the primers and probe used in the 383

RT-qPCR, both HoBi-like isolates used have mismatches when align with the forward primer 384

(T134-F) and probe (T155r-P) (Fig. 4). As mismatches are not located on the primers and/or 385

probe 3’ end extremity, it may not represent a major issue for the assay, and corroborate with 386


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

18

descriptions of successful detection of these viruses in others studies using these assays (3, 5, 26, 387

35). 388

Detection failure was particularly notable for samples from PI calf #101. Only 44% and 389

61% of these samples were detected using the HoBi-like RT-PCR and RT-qPCR assays, 390

respectively. The reason for reduced detection in this calf could not be deduced from the data 391

collected in this study. Based on simple comparison of Cq values, generated using the two 392

commercial BVDV RT-qPCR tests, the rate of false negative tests did not correlate with lower 393

viral load in the calf (Fig. 2). Neither does it correlate with viral strain, as a higher detection rate 394

was seen for PI calf #104, which was infected with the same strain. Further research is needed to 395

determine the source of the high rate of test failure in some animals. 396

This is the first report of the generation of HoBi-like virus PI calves under experimentally 397

controlled conditions. Further, generation of HoBi PIs was fairly efficient with 4 out of 8 heifers 398

giving birth to clinically normal appearing calves that survived until they were harvested at five 399

months of age for necropsy. Assuming that similar to BVDV PIs, HoBi PIs are efficient for 400

introducing HoBi-like viruses and keeping them in circulation, their detection and removal are 401

important to the control and eradication of this emerging bovine pestivirus (11, 12). While 402

HoBi-like viruses and BVDV species share genetic and antigenic similarities (7, 24), current 403

diagnostic tests designed for BVDV detection fail in detecting and/or differentiating HoBi-like 404

viruses or have decreased sensitivity compared to BVDV detection, which severely limits their 405

usefulness in a HoBi-like virus control program. (24, 26, 27, 33, 35, 36). The inability to 406

differentiate between BVDV and HoBi-like viruses is not critical if it is known that a region in 407

free of HoBi-like viruses. However differentiation is critical to surveillance programs designed 408

to either determine the prevalence of HoBi-like viruses or to monitor if HoBi-like viruses have 409


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

19

entered a region. Differentiation of BVDV and HoBi-like viruses allows determination of 410

ruminant pestivirus prevalence and would be key to developing recommendations for 411

vaccination (no vaccination, vaccination against BVDV only or vaccination against both BVDV 412

and HoBi-like viruses). 413

In summary, the two commercial BVDV RT-qPCR tests and IHC had a 100% accuracy 414

rate for positive ear notch tissue. However, HoBi-like and BVDV infections cannot be 415

differentiated using these tests. RT-PCR based tests for HoBi-like viruses could specifically 416

identify between BVDV and HoBi-like infections but had reduced accuracy compared to IHC 417

and the commercial BVDV RT-qPCR test. Enhanced extraction of samples prior to testing 418

improved detection for ACE Erns based tests. Used in tandem ACE tests designed to detect Erns 419

and NS3 respectively could be used to differentiate HoBi-like virus from BVDV. Improvement 420

on HoBi-like specific diagnostic tests is required before a reliable HoBi-like PI surveillance 421

program can be designed. 422

423

Acknowledgements 424

The authors are most thankful for the help from Brian Conrad, Doug Ewing, Jeremy 425

Spieker, John Kent, Katrina Pile and Jay Steffen for the animal care and collection of samples. 426

To Kathy McMullen and Patricia Federico for technical support as well as Dr.’s Rebecca 427

Madison and Jean Laufer for veterinary services. Thank you Novartis Animal Health for 428

providing animals for the study. Thank you Dr. Stephen Hennart for consulting. 429

430

Declaration of conflicting interests 431


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

20

Disclaimer: Mention of trade names or commercial products in this publication is solely for the 432

purpose of providing specific information and does not imply recommendation or endorsement 433

by the U.S. Department of Agriculture. 434

435

436

References 437

438

1. Baker JC. 1995. The clinical manifestations of bovine viral diarrhea infection. Vet. Clin. 439

North. Am. Food. Anim. Pract. 11:425-445. 440

2. Ridpath JF, Bolin SR, Dubovi EJ. 1994. Segregation of bovine viral diarrhea virus into 441

genotypes. Virology 205:66-74. 442

3. Bauermann FV, Ridpath JF, Weiblen R, Flores EF. 2013. HoBi-like viruses: an 443

emerging group of pestiviruses. J. Vet. Diagn. Invest. 25:6-15. 444

4. Cortez A, Heinemann MB, De Castro AMMG, Soares RM, Pinto AMV, Alfieri AA, 445

Flores EF, Leite RC, Richtzenhain LJ. 2006. Genetic characterization of Brazilian 446

bovine viral diarrhea virus isolates by partial nucleotide sequencing of the 5' -UTR 447

region. Pes. Vet. Bras. 26:211-216. 448

5. Decaro N, Lucente MS, Mari V, Cirone F, Cordioli P, Camero M, Sciarretta R, 449

Losurdo M, Lorusso E, Buonavoglia C. 2011. Atypical pestivirus and severe 450

respiratory disease in calves, Europe. Emerg. Infect. Dis. 17:1549-1552. 451

6. Decaro N, Lucente MS, Mari V, Sciarretta R, Pinto P, Buonavoglia D, Martella V, 452

Buonavoglia C. 2012. Hobi-like pestivirus in aborted bovine fetuses. J. Clin. Microbiol. 453

50:509-512. 454


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

21

7. Schirrmeier H, Strebelow G, Depner K, Hoffmann B, Beer M. 2004. Genetic and 455

antigenic characterization of an atypical pestivirus isolate, a putative member of a novel 456

pestivirus species. J. Gen. Virol. 85:3647-3652. 457

8. Ridpath JF, Falkenberg SM, Bauermann FV, VanderLey BL, Do Y, Flores EF, 458

Rodman DM, Neill JD. 2013. Comparison of acute infection of calves exposed to a 459

high-virulence or low-virulence bovine viral diarrhea virus or a HoBi-like virus. Am. J. 460

Vet. Res. 74:438-442. 461

9. McClurkin AW, Coria MF, Cutlip RC. 1979. Reproductive performance of apparently 462

healthy cattle persistently infected with bovine viral diarrhea virus. J. Am. Vet. Med. 463

Assoc. 174:1116-1119. 464

10. Arenhart S, Bauermann FV, Oliveira SA, Weiblen R, Flores EF. 2009. Shedding and 465

transmission of bovine viral diarrhea virus by persistently infected calves. Pesq. Vet. 466

Bras. 29:736-742. 467

11. Houe H, Lindberg A, Moennig V. 2006. Test strategies in bovine viral diarrhea virus 468

control and eradication campaigns in Europe. J. Vet. Diagn. Invest. 18:427-436. 469

12. Stahl K, Alenius S. 2012. BVDV control and eradication in Europe--an update. Jpn. J. 470

Vet. Res. 60 Suppl:S31-39. 471

13. Ridpath JF, Fulton RW, Kirkland PD, Neill JD. 2010. Prevalence and antigenic 472

differences observed between Bovine viral diarrhea virus subgenotypes isolated from 473

cattle in Australia and feedlots in the southwestern United States. J. Vet. Diagn. Invest. 474

22:184-191. 475

14. Ridpath JF, Lovell G, Neill JD, Hairgrove TB, Velayudhan B, Mock R. 2011. 476

Change in predominance of Bovine viral diarrhea virus subgenotypes among samples 477


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

22

submitted to a diagnostic laboratory over a 20-year time span. J. Vet. Diagn. Invest. 478

23:185-193. 479

15. Bianchi E, Martins M, Weiblen R, Flores EF. 2011. Genotypic and antigenic profile of 480

bovine viral diarrhea virus isolates from Rio Grande do Sul, Brazil (2000-2010). Pesq. 481

Vet. Bras. 31:649-655. 482

16. Decaro N, Mari V, Pinto P, Lucente MS, Sciarretta R, Cirone F, Colaianni ML, Elia 483

G, Thiel HJ, Buonavoglia C. 2012. Hobi-like pestivirus: both biotypes isolated from a 484

diseased animal. J. Gen. Virol. 93:1976-1983. 485

17. Kampa J, Alenius S, Emanuelson U, Chanlun A, Aiumlamai S. 2009. Bovine 486

herpesvirus type 1 (BHV-1) and bovine viral diarrhoea virus (BVDV) infections in dairy 487

herds: self clearance and the detection of seroconversions against a new atypical 488

pestivirus. Vet. J. 182:223-230. 489

18. Haider N, Rahman MS, Khan SU, Mikolon A, Gurley ES, Osmani MG, Shanta IS, 490

Paul SK, Macfarlane-Berry L, Islam A, Desmond J, Epstein JH, Daszak P, Azim T, 491

Luby SP, Zeidner N, Rahman MZ. 2014. Identification and epidemiology of a rare 492

HoBi-like pestivirus strain in Bangladesh. Transbound. Emerg. Dis. 61:193-198. 493

19. Dubovi EJ. 2013. Laboratory diagnosis of bovine viral diarrhea virus. Biologicals 41:8-494

13. 495

20. Zimmer GM, Van Maanen C, De Goey I, Brinkhof J, Wentink GH. 2004. The effect 496

of maternal antibodies on the detection of bovine virus diarrhoea virus in peripheral 497

blood samples. Vet. Microbiol. 100:145-149. 498


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

23

21. Fux R, Wolf G. 2012. Transient elimination of circulating bovine viral diarrhoea virus 499

by colostral antibodies in persistently infected calves: a pitfall for BVDV-eradication 500

programs? Vet. Microbiol. 161:13-19. 501

22. Brodersen BW. 2004. Immunohistochemistry used as a screening method for persistent 502

bovine viral diarrhea virus infection. Vet. Clin. North. Am. Food. Anim. Pract. 20:85-93. 503

23. Decaro N, Losurdo M, Lucente MS, Sciarretta R, Mari V, Larocca V, Elia G, 504

Cavaliere N, Martella V, Fasanella A, Buonavoglia C. 2013. Persistent infection 505

caused by Hobi-like pestivirus. J. Clin. Microbiol. 51:1241-1243. 506

24. Bauermann FV, Flores EF, Ridpath JF. 2012. Antigenic relationships between Bovine 507

viral diarrhea virus 1 and 2 and HoBi virus: possible impacts on diagnosis and control. J. 508

Vet. Diagn. Invest. 24:253-261. 509

25. Reed LJ, Muench H. 1938. A simple method of estimating fifty per cent endpoints. 510

Amer. J. Epid. 27:493-497. 511

26. Bauermann FV, Flores EF, Falkenberg SM, Weiblen R, Ridpath JF. 2014. Lack of 512

evidence for the presence of emerging HoBi-like viruses in North American fetal bovine 513

serum lots. J. Vet. Diagn. Invest. 26:10-17. 514

27. Bauermann FV, Harmon A, Flores EF, Falkenberg SM, Reecy JM, Ridpath JF. 515

2013. In vitro neutralization of HoBi-like viruses by antibodies in serum of cattle 516

immunized with inactivated or modified live vaccines of bovine viral diarrhea viruses 1 517

and 2. Vet. Microbiol. 166:242-245. 518

28. Falkenberg SM, Ridpath J, Vander Ley B, Bauermann FV, Sanchez NCB, Carroll 519

JA. 2014. Comparison of temperature fluctuations at multiple anatomical locations in 520

cattle during exposure to bovine viral diarrhea virus. Lives. Sci. 164:159-167. 521


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

24

29. Liebler-Tenorio EM, Ridpath JE, Neill JD. 2002. Distribution of viral antigen and 522

development of lesions after experimental infection with highly virulent bovine viral 523

diarrhea virus type 2 in calves. Am. J. Vet. Res. 63:1575-1584. 524

30. Vilcek S, Herring AJ, Herring JA, Nettleton PF, Lowings JP, Paton DJ. 1994. 525

Pestiviruses isolated from pigs, cattle and sheep can be allocated into at least three 526

genogroups using polymerase chain reaction and restriction endonuclease analysis. Arch. 527

Virol. 136:309-323. 528

31. Hessman BE, Sjeklocha DB, Fulton RW, Ridpath JF, Johnson BJ, McElroy DR. 529

2012. Acute bovine viral diarrhea associated with extensive mucosal lesions, high 530

morbidity, and mortality in a commercial feedlot. J. Vet. Diagn. Invest. 24:397-404. 531

32. Corapi WV, Donis RO, Dubovi EJ. 1990. Characterization of a panel of monoclonal 532

antibodies and their use in the study of the antigenic diversity of bovine viral diarrhea 533

virus. Am. J. Vet. Res. 51:1388-1394. 534

33. Liu L, Xia H, Belak S, Baule C. 2008. A TaqMan real-time RT-PCR assay for selective 535

detection of atypical bovine pestiviruses in clinical samples and biological products. J. 536

Virol. Methods. 154:82-85. 537

34. Hilbe M, Stalder H, Peterhans E, Haessig M, Nussbaumer M, Egli C, Schelp C, 538

Zlinszky K, Ehrensperger F. 2007. Comparison of five diagnostic methods for 539

detecting bovine viral diarrhea virus infection in calves. J. Vet. Diagn. Invest. 19:28-34. 540

35. Decaro N, Mari V, Lucente MS, Sciarretta R, Moreno A, Armenise C, Losurdo M, 541

Camero M, Lorusso E, Cordioli P, Buonavoglia C. 2012. Experimental infection of 542

cattle, sheep and pigs with 'Hobi'-like pestivirus. Vet. Microbiol. 155:165-171. 543


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

25

36. Larska M, Polak MP, Liu L, Alenius S, Uttenthal A. 2013. Comparison of the 544

performance of five different immunoassays to detect specific antibodies against 545

emerging atypical bovine pestivirus. J. Virol. Methods. 187:103-109. 546

547

548

549

550

551

552

553

554

555

556

557

558

559

560

561

562

563

564

565

566


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

26

Table 1 – Rate of detection of samples from HoBi-like persistently infected (PI) calves by 567

various testing methods* 568

Test specificity/ assay

Positive samples for each PI (day of birth to week 5)

Detection totals for each

tested tissue

Calf 101

Calf 104

Calf 102

Calf 103

Serum Buffy coat

Ear notch

BVDV

RT-PCR1 28% 83% 61% 50% 83% 58% 25%

RT-PCR2 17% 72% 33% 33% 37% 46% 33%

RT-qPCR1 61% 100% 100% 94% 83% 83% 100%

RT-qPCR2 100% 100% 100% 100% 100% 100% 100%

BVDV - ear notch

Conv. ext. + ErnsACE 67% 100% 100% 83% - - 87%

Enh. ext. + ErnsACE 83% 100% 100% 100% - - 96%

Enh. ext. + NS3 ACE 0% 0% 0% 0% - - 0%

IHC 100% 100% 100% 100% - - 100%

HoBi-like

RT-PCR 44% 94% 94% 94% 83% 75% 87% RT-qPCR 61% 89% 89% 83% 83% 96% 62%

569

* Test identification: 570

BVDV RT-PCR1 – primers 324-326; BVDV RT-PCR2 – primers HCV 90-368; BVDV qRT 571

PCR1 – Bovine Virus Diarrhea RNA test Kit; BVDV RT-qPCR2 –Virotype BVDV test Kit; 572

Conventional extracted samples tested by Erns antigen capture ELISA – HerdCheck BVD 573

antigen; Enhanced extracted samples tested by Erns antigen capture ELISA; Enhanced extracted 574

samples tested by NS3 antigen capture ELISA; Immunohistochemistry; HoBi-like RT-PCR – 575

primers N2-R5; HoBi-like RT-qPCR – primers T134-F, T220-R and probe T155r-P. 576

577

578

579

580

581


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

27

Figure legends 582

583

Fig. 1 – Aural skin biopsies stained using monoclonal antibody 15C5. Fetus infected with strain 584

Italy-1/10-1. Positive staining in hair follicle infundibula and apocrine glands. Scale 50μm (A). 585

Calf #101 at one day of age; persistently infected with the HoBi-like strain HoBi_D32/00. 586

Positive staining in epidermis, hair follicle infundibula, sebaceous glands, and dermal fibrocytes 587

(B). Calf #102 at one day of age; persistently infected with the HoBi-like strain HoBi_D32/00. 588

Positive staining in epidermis, hair follicle infundibulum, sebaceous glands, and arterial wall (C). 589

B and C scale is 20μm. 590

591

Fig. 2 – Results of testing animals persistently infected with a HoBi-like virus from day of birth 592

(DOB) to week 5 (W5). White squares filled with “+” means positive result. Positive results for 593

the RT-qPCR are represented by the Cq value. Dark squares means negative result. Test 594

identification: BVDV RT-PCR1 – primers 324-326; BVDV RT-PCR2 – primers HCV 90-368; 595

BVDV qRT PCR1 – Bovine Virus Diarrhea RNA test Kit; BVDV qRT-PCR2 –Virotype BVDV 596

test Kit; Conventional extracted samples tested by Erns antigen capture ELISA – HerdCheck 597

BVD antigen; Enhanced extracted samples tested by Erns antigen capture ELISA; Enhanced 598

extracted samples tested by NS3 antigen capture ELISA; Immunohistochemistry; HoBi-like RT-599

PCR – primers N2-R5; HoBi-like qRT-PCR – primers T134-F, T220-R and probe T155r-P. The 600

used cutoff value for all the RT-qPCR was 38 cycles. 601

602

Fig. 3 – Sample to positive ratio (S/P ratio) for each persistently infected (PI) calf (#101; #102; 603

#103 and #104). Samples from day of birth (DOB) and weekly for five consecutive weeks (W1 604


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

28

to W5) were tested using commercial Erns ACE kit, with conventional (Conv. ext.) or enhanced 605

extraction (Enh. ext.) process, and respectively represented by triangle or square marker. Axis 606

“X” crosses axis “Y” at 0.3, the threshold sample to positive ratio (S/P) value for the Erns antigen 607

capture ELISA used. 608

609

Fig.4 Alignment of the HoBi-like viruses isolates HoBi_D32/00 (AB871953.1) and Italy-1/10-1 610

(HQ231763.1) with the primers N2, R5, T134-F, T220-R, and probe T155r-P used for specific 611

detection of HoBi-like viruses. Primers reverse R5, T220-R and the probe T155r-P are presented 612

as the reverse complement of the original sequence. 613

614


.asm.org/

Dow

nloaded from

http://jcm.asm.org/


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

Generation of calves persistently infected with HoBi-like...

Documents

Transcript of Generation of calves persistently infected with HoBi-like...