Gene Synthesis, Expression, Structures, and Functional Activities of ...

THE JOURNAL OF BIOLOGICAL CHEMISTRY C 1987 by The American Society for Biochemistry and Molecular Biology, Inc

Vol. 262, No . 29, Issue of October 15. PP. 14213-14221, 1987 Prrnted in U. S A .

Gene Synthesis, Expression, Structures, and Functional Activities of Site-specific Mutants of Ubiquitin*

(Received for publication, May 13, 1987)

David J. EckerSj, Tauseef R. Butt$, Jon Marsh§, Edmund J. Sternberg$, Neil Margolisgll, Brett P. MoniaQll, Sobhanaditya JonnalagaddaB, Muhammad Ishaq Khan§(I, Paul L. Weber**, Lucian0 Mueller**, and Stanley T. Crookegll From the Departments of $Molecular Pharmacology and **Physical and Structural Chemistry, Smith Kline and French Laboratories, Philadelphia, Pennsylvania 19101 and the (IDepartment of Pharmacology, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania 19104

To study the structure and function of ubiquitin we have chemically synthesized a ubiquitin gene that en- codes the amino acid sequence of animal ubiquitin, inserting a series of restriction enzyme sites that divide the gene into eight “mutagenesis modules.” A series of site-specific mutations were constructed to selectively perturb various regions of the molecule. The mutant genes were expressed in a large quantity of Esche- richia coli, and the modified proteins were purified. To determine the structural effects of the amino acid substitutions, the solution structure of ubiquitin was investigated by two-dimensional NMR and each of the mutant proteins were screened for structural perturbations. With one exception, virtually no changes were seen other than at the point of mutation. Functional studies of the mutant proteins with the ubiquitin-activating enzyme El and in the reticulocyte protein degradation assay were used to identify regions of the molecule important to ubiquitin’s activity in intracel- lular proteolysis.

Ubiquitin is a 76-amino acid, highly conserved protein found in all eukaryotes. Several functions of ubiquitin have been identified. Ubiquitin is found in the nucleus covalently attached to histone H2A, where it may play a structural role in the nucleosome (1). In the membrane, ubiquitin is covalently attached to several cell surface receptors where it may participate in or modulate receptor performance and signal transduction processes (2). Ubiquitin may have extracellular functions as a hormone or autocrine growth factor. When added to both T-precursor and B-precursor cells, it induces their differentiation into T-cells and B-cells (3). A ubiquitin- containing autocrine growth factor has recently been isolated from a human leukemic cell line (4). Ubiquitin has been found in the paired helical filaments which are the principal con- stituents of the neurofibrillary tangles found in patients with Alzheimers disease (5).

The first ubiquitin clones that were isolated and sequenced were found to contain multiple repeats of the ubiquitin gene

* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

$ To whom reprint requests should be addressed: Dept. of Molec- ular Pharmacology, L511, Smith Kline and French Laboratories, Research and Development Division, P.O. Box 1539, King of Yrussia,

11 Present address: Centre for Advanced Molecular Biology, Uni- PA 19406-0939.

versity of the Punjab, New Campus, Lahore, Pakistan.

arranged in a head to t.ail manner with no spacer regions (6- 8). These polygenes are transcribed and translated into polyu- biquitin and subsequently processed to monomers by an enzyme recognizing the glycine-methionine bond linking the ubiquitin repeats. More recently, a second set of ubiquitin genes has been cloned which encode heterologous ubiquitin fusion proteins (9, 10). The first 76 amino acids of the fusion proteins are those of ubiquitin followed by other “tail” proteins which contain sequences similar to those of the “zinc finger proteins” that bind DNA and are active as transcription factors (11). The similarity of the tail region of these fusion proteins to the transcription factors suggests some role in DNA binding or gene regulation, but no function for these fusion proteins has yet been discovered.

The best studied function of ubiquitin is its role in the cytoplasm as an ATP-dependent mediator of selective non- lysosomal proteolysis (12, 13). In the currently accepted model, proteins are marked for degradation by the covalent attachment of the carboxyl terminus of ubiquitin to the amino terminus of the target protein in a peptide bond or at the t -

amino group of lysine side chains in isopeptide bonds. The ubiquitinated protein is then rapidly and selectively degraded by a complex set of ubiquitin-dependent proteases (13). Ubiq- uitin-dependent proteolysis is an ideal model system to study protein-protein interactions. The ubiquitin-dependent proteolytic pathway involves at least five major classes of enzymes which all may have a binding site for ubiquitin.

Ubiquitin is extraordinarily highly conserved. I t is identical in man, bovine, chicken, Xenopus, and Drosophila. Three conservative amino acid substitutions are found in ubiquitin from yeast, whereas plant ubiquitin has two of the substitutions found in yeast and a different third substitution (6, 14). That ubiquitin interacts with so many other proteins may be one source of conservation pressure; a substitution that is harmless to structural interactions of ubiquitin with one enzyme may disrupt the interactions between ubiquitin and a different enzyme. Alternatively, the conservation pressure may be associated with some physical property of ubiquitin required for its diverse functions, i.e. the ability to undergo conformational changes. A substitution which does not affect the function (rather than structure) of ubiquitin as a cofactor in selective proteolysis may be detrimental to functions in the nucleosome or on cell surface receptors.

The precise mechanisms as to how ubiquitin acts as a signal for proteolysis remain unknown, although it is proposed that ubiquitin acts as a denaturant to the proteins to which it becomes attached (15, 16). In this article we study the structure and activity of ubiquitin and its interactions with the enzymes of the ubiquitin-dependent proteolytic pathway. We

14213

14214 Site-directed Mutagenesis of Ubiquitin

study these interactions by site-directed mutagenesis, purification of mutant ubiquitin, NMR characterization of the mutant protein structure, and enzymatic studies of mutant ubiquitin with the ubiquitin-activating enzyme El and the enzymes required for in uitro proteolysis. The results help to identify the various regions of the molecule important to the structure and function of ubiquitin.

MATERIALS AND METHODS

Gene Construction-General methods for DNA manipulation in vitro were described previously (17). Details of the DNA synthesis and assembly scheme for the yeast ubiquitin gene are described in Ref. 18. the human gene was synthesized by replacement of the DNA in the yeast ubiquitin gene between the XbaI and BsmI restriction enzyme sites (module 4). This region contains the codons for the three amino acid differences between yeast and human ubiquitin. A unique NdeI site ( C A T m ) was introduced at the initiation codon (module 1) to transfer the synthetic gene to the expression plasmid (pMG27N-S), which was constructed with a unique NdeI site adjacent to the ribosome binding site (19). All of the mutant gene constructions were made starting with the synthetic human ubiquitin gene (Fig. 1) by replacement of the appropriate module with double-stranded synthetic DNA encoding the desired mutation(s). In some cases more than one mutation was made and then the modules were rearranged (module switching, Fig. 2) to express each mutant individually. The sequence of each mutant was confirmed by directly sequencing the double-stranded plasmids as previously described (20). The scheme for ligation of the synthetic genes into the expression vector is described in the legend of Fig. 2.

Gene Expression and Protein Purification-Gene expression in E. coli under the X PL promoter was induced with heat as described previously (19). Briefly, 10 liter cultures of Escherichia coli were grown in fermentation vessels to OD,, = 4 at 32 "C. The temperature was rapidly increased to 42 "C and the fermentation continued for 3 h. Cells were harvested by filtration, aliquoted into 100-g (wet weight) batches, and stored at -70 "C. Ubiquitin species were purified from 100 g (wet weight) of E. coli cell paste as follows: cells were resuspended in buffer (50 mM Tris, pH 8,2 mM EDTA, 5% glycerol, 1 mM dithiothreitol) to a total volume of 800 ml and split into two 500-ml centrifuge bottles. Lysozyme (0.2 g/l) was added, and the suspension was incubated at room temperature for 30 min. Each 400-ml aliquot was sonicated (Branson cell disruptor 200) for 10 min with constant stirring at room temperature followed by centrifugation at 10,000 rpm for 40 min at 0 "C. Ubiquitin species were purified from the supernatant using heat denaturation, ammonium sulfate fractiona- tion, and ion exchange chromatography as previously described (18). Pure ubiquitin fractions from the chromatography step were dialyzed against 100 mM KC1 and then extensively against water and lyophy- lized. Protein purity was determined on overloaded 18% SDS'-poly- acrylamide gels and staining with both Coomassie and silver.

Immunochemical detection of ubiquitin was done by electropho- retically transferring (Trans-Blot, Bio-Rad) the proteins from SDS gels to nitrocellulose and binding with antibody raised in rabbits against ubiquitin (purified from bovine blood). Blots were developed using goat anti-rabbit IgG and horseradish peroxidase conjugate (Bio- Rad) following the protocol provided by the manufacturer.

Physical and Biochemical Characterization-Details of the NMR methods are provided in the legend to Fig. 5. Amino acid compositions analysis was performed on ubiquitin and each ubiquitin mutant using a Beckman amino acid analyzer. The ubiquitin-activating enzyme El was purified from bovine reticulocytes and the PPi-ATP exchange assay was performed as described previously (21). Details of the El assay are given in the legend of Fig. 8. Preparations of enzymes which support the in vitro ubiquitination and degradation of exogenous proteins were made as previously described (22) and the degradation assays were performed as described in Ref. 22 with the modifications described in Ref. 23.

RESULTS AND DISCUSSION

Modular Mutagenesis-To facilitate site-directed mutagenesis, the human ubiquitin gene was chemically synthesized.

The abbreviations used are: SDS, sodium dodecyl sulfate; NOE, nuclear Overhauser effect; BSA, bovine serum albumin.

Eight restriction enzyme sites were engineered into the synthetic gene that did not change the encoded protein sequence from that of wild type ubiquitin (Fig. 1). The restriction enzyme sites divide the synthetic gene into eight "mutagenesis modules" which can be excised and replaced into a single piece of synthetic double-stranded DNA. This synthetic DNA can contain a mixture of bases in a specific codon to encode a family of mutations at one amino acid position (cassette mutagenesis) (24) or to directly encode one or more specific mutations (modular mutagenesis). The modular design makes it possible to make two independent point mutations on a single stretch of DNA resulting in expression of a double mutant protein. The double mutant gene can subsequently be rearranged (module switching, Fig. 2) to express each mutation individually as two single mutants. This procedure can also be reversed to create a double mutant from any pair of single mutants that are on different modules. The gene design also allows rapid assembly of any combination of individual mutations to study the effects of specific multiple changes on protein structure and function.

Using computer-assisted molecula? modeling and graphics the ubiquitin crystal structure (1.8 A resolution, coordinates kindly provided by W. Cook and C. Bugg) (25) was examined to identify important structural features. Ubiquitin is a single- domain globular structure, made up of five strands of @- pleated sheet and three and one half turns of a helix (Fig. 3). It has a dense central hydrophobic core as well as some hydrophobic patches on the surface. The last 4 residues of the carboxyl terminus, Leu-Arg-Gly-Gly, extend from the com- pact structure to form a tail. This region becomes attached to the ubiquitin-activating enzyme E, through the carboxyl- terminal glycine which is the residue of ubiquitin that is ultimately conjugated to the target proteins.

1

61

121

181

H P

1 a

M 1 M2 M3

X b

1

1""-~""_1""""""""-~"""""""""~""""..

CAATTCATATGCAGATCTTCGTCAAGACGTTAACCGGTAAAACCATAACTCTAGAACTTG 60 CTTAACTATACCTCTAGAAGCAGTTCTCCAATTGGCCATTTTGGTATTGAGATCTTCAAC

I_"""_"_I"_""""_~"_"""""""""",""~

' U e t G l n I l a P h s V ~ I L y t T h r L . u T h ~ G l ~ L y ~ T h r I l e T h r L s u C l u V ~ I C l u - 10

M4

B

m 1

""_""___"""""""""""""""""""~I_""_"

AACCATCCCATACCATCGAAAACGTTAAGGCTAAAATTCAAGACAAGGAACCCATTCCAC 120 TTGCTACCCTATCCTAGCTTTTGCAATTCCGATTTTAAGTTCTGTTCCTTCCGTAACCTC ""_"_""_""__""""""""""".""".I___""_..

P r o S a r A s p T h r I l s C l u A ~ ~ V ~ l L y ~ A l ~ L y ~ I l e G l ~ A ~ ~ L y ~ C l ~ C l y I I a P r o P r o . 20 30

X h

1 0

M6 MI3 """""""""_"""""""","""""""""""" CTGATCAACAAAGATTCATCTTTGCCGGTAAGCAGCTCGAGCACGGTAGAACGCTGTCTG 1E0 GACTAGTTGTTTCTAACTACAAACGGCCATTCGTCGAGCTCCTGCCATCTTCCGACAGAC """""""""""""""""""-I""""""""""

A r p C l n C l n A r g L a u I l e P h ~ A l ~ C l y L y ~ G l ~ L ~ ~ G l ~ A ~ p G l y A ~ g T h ~ L a ~ S ~ ~ A ~ p - 40 50

A f I

K P

1 2 1 117 M 8

ATTACAACATTCAGAAGGACTCGACCTTACATCTTCTCTTAAGACTAAGAGGTGGTTGAGGTACC 245 """"_""_""_,""""""""~I"_""""___"""""~I

TAATCTTCTAACTCTTCCTCACCTGGAATGTAGAACAGAATTCTGATTCTCCACCAACTCCATGG

FIG. 1. Synthetic modular human ubiquitin gene. The lengths of the mutagenesis modules (MI-M8) ranges from 12 to 64 base pairs and therefore all regions of the synthetic gene are accessible to site-specific or cassette mutagenesis because a single stretch of synthetic double-stranded can bridge the gap between any adjacent restriction sites. In this study modules M1, M4, M6, M7, and M8 were all replaced to produce the mutants listed in Table I.

Site-directed Mutagenesis of Ubiquitin 14215

FIG. 2. Mutagenesis and module switching. A, the modular mutagenesis strategy was used to generate a double mutant and two single mutations from one piece of synthetic double-stranded DNA. Synthetic DNA, encoding two specific mutations (Tyr-59+Phe, His-6& Lys) was ligated into the appropriately restricted wild type ubiquitin gene, re- placing modules M6 and M7 to generate a double mutant. To generate each single mutant, the double mutant, gene was cut at a unique Sal1 site between the two modules and at the unique Aat2 site in the pUC vector. The resulting fragments were gel purified and each was ligated with the complementary fragment from a similarly restricted plasmid containing the wild type gene. B, cloning the synthetic ubiquitin gene in the E. coli expression vector pMG27N-S. The synthetic ubiquitin gene has an NdeI site that includes the initiation codon CA- T E G . The ubiquitin gene was removed from the pUC plasmid by restriction with NdeI and PuuII. The gene-containing fragment was gel purified and ligated into the E. coli expression vector pMG27N-S which was restricted with HindIII, the overhang flush ended with DNA polymerase (Klenow fragment) and then cut with NdeI. Insertion of the ubiquitin gene at the NdeI site of the expression vector placed the reading frame downstream of the heat-inducible h P L promoter and adjacent to the h cII gene ribosome binding site.

Xhol s a l 1 XhJ 1

A

A01

A01 Aa1

C

B P, promoter CP ribowme

Ndol

Nde 1

Eco R1 Humon Ublquitin pMG27N-S


FIG. 3. The structure of ubiquitin and the location of the mutagenesis sites. The molecular graphics were generated from the 1.8 A ubiquitin structure coordinates (25). A, the ubiquitin backbone is shown with the (Y

helix region in yellow, the @sheet regions in red, and the remainder of the backbone in blue. B, same as A except the amino acid side chains are included. C, the amino acid side chains that were mutagenized are shown in red, whereas the backbone of the molecule is shown in blue.

TABLE I Description and location of ubiquitin mutations and their activities in

supporting the in vitro degradation of “‘I-BSA by the ubquitin dependent pathway

The activities of mutant ubiquitins are reported relative to the act.ivity of animal ubiquitin, isolated from bovine blood, in the degradation of substrate with 4 pg of ubiquitin or mutant ubiquitin per assay. Aliquots were removed at hourly intervals until the end of the experiment at 4 h, and the rate of substrate degradation with time was measured. Mutant Location of I n uitro BSA

number

Protein structure change degradation activitv

Surface

Animal ubiquitin (from cow) 100 1 Animal ubiquitin (expressed 100

2 Pro-19 “t Ser, Ala-28 + 100 in E. coli)

Ser, Glu-24 + Asp (yeast ubiquitin, from E. coli)

3 Pro-19 + Ser Surface 100 4 Leu-67 -+ Asn, Leu-69 -+ Core 0

5 Gly-76 + Ala Tail 0-10

7 Leu-73 + A, Arg-72 + Ser Tail 0 8 Tyr-59 + Phe Surface 70-100 9 His-68 + Lys Surface 30

10 Tyr-59 -+ Phe, His-68 “t Surface 30

Asn

6 Leu-73-A Tail 0

LYS

The selected mutations are divided into three general cat- egories (Table I): tail, hydrophobic core, and protein surface regions. The mutant genes were expressed under the strong heat-inducible X PI, promoter in E. coli on the expression vector pNMHUB (Fig. 2). Upon induction, ubiquitin(s) was expressed at very high levels (10-15% of total E. coli protein). Expression was monitored by electrophoresis on 18% polyac- rylamide gels and staining with Coomassie Blue. Ubiquitin was identified by co-migration with a ubiquitin standard isolated from bovine blood and immunological detection with

antibody prepared in rabbits against bovine ubiquitin (Fig. 4). No significant cross-reactivity was observed in control E. coli extracts which did not contain the synthetic ubiquitin gene (Fig. 4B control lanes), consistent with the notion that E. coli does not normally produce ubiquitin.

Each mutant protein was purified to homogeneity (Fig. 4). The yield of pure protein was approximately 100 mg/100 g of wet-packed E. coli pellet. Amino acid composition analysis of each mutant confirmed the correct expression of the mutations as predicted from the DNA sequence to within 10-15% accuracy at the level of each amino acid residue. Immunolog- ical detection of the mutant proteins with polyclonal antibodies raised against bovine ubiquitin showed that the carboxyl- terminal tail of ubiquitin is a major recognition epitope for these antibodies. Mutants in the tail portion of ubiquitin were poorly immunoreactive, whereas mutants in other areas of the protein such as the globular surface or hydrophobic core were as reactive as wild type ubiquitin (Fig. 4C).

Protein Structure-Since altered activities of ubiquitin mutants could be due to major changes in the protein confor- mation, we used NMR, an extremely sensitive indicator of protein conformational changes, to probe the solution structure of each mutant (for recent reviews, see Refs. 26 and 27). Structural perturbations were monitored using three different NMR parameters, namely scalar couplings, resonance chemical shift, and dipolar cross-relaxation. Scalar or J-coupling is dependent upon the torsion angle formed by a vicinal pair of protons, and the conversion between them (the Karplus re- lationship) is well known (28, 29). Dipolar cross-relaxation (the NOE) is strongly dependent upon the distance separating two protons (30), and the conversion between NOE buildup rates and interproton distance can often be made with an accuracy within 10% (31). The conversion between chemical shift and the “chemical” environment surrounding a proton, however, is not well defined, but an altered chemical shift may be taken to indicate an altered structure. Two caveats, however, must be understood in this analysis: first, the degree


A Control Ubiquitin plasmid plasmid

Ub I I 1

Std. 0 .5h l h 2h 0 .5h l h 2h 1

26K - - 6K -

D

3 K -

C 43 -

25.7 - 18.4 - 14.3 - 6.2 - 3.0 -

Control Ubiquitin plasmid plasmid

'0 .5h l h 2h 0 .5h l h 2h I 1 I

6 1 2 3 4 5 6 7 8 9 1 0 6

F I G . 3. Large scale expression and protein purification. A , total b,'. c d i proteins from cells containing a control plasmid (pMG27N-S) and the same plasmid with the svnthetic ubiquitin gene inserted (pNMHUH). Gene expression was induced by raising the temperature from 32 to 4 % "C. Aliquots were removed and centrifuged. ('ell pellets were resuspended in loading dve containing SDS, loaded on an 18"; SI)S-polvacrylamide gel, and stained with Coomassie I3lrte. H , a gel identical to A was blotted onto nitrocellulose and prohed with antibodv raised to purified bovine ubiquitin. C', purified site- specific ubiqrtitin mutant on an SDS-polvacrvlamide gel stained with Coomassie Blue and an identical gel blotted onto nitrocellulose paper and probed with antibodies raised to purified bovine uhiquitin. The number at the top of each lane corresponds with a ubiquitin mutation as descrihed in Table 1. H = hovine uhiquitin.

of chemical shift cannot readily he used to indicate the degree of structural change; and second, a structural change can occur without any change in the chemical shift(s) of the resonance(s) involved.

The NMR data can he fully exploited only when resonance assignments have been made; t?lpically it is not useful to know the torsion angle or distance between two protons without knowing the identity of the protons involved. To this end the ubiquitin NMR spectrum has been assigned,? so that structural changes in the ubiquitin mutants can be readily inter- preted using the indicators described above. We have concen- trated on screening mutations by searching for chemical shift differences in the amide protons (which would indicate an altered backbone structure) using one-dimensional NMR techniques. A few selected mutants were studied using two- dimensional NMR methods. Measurements of accurate .J- couplings could not he made using the DQF-COSY experiment. due to complications arising from the resonance line widths; such measurements are presently being made using the new PE-COSY technique (32) and will be reported else- where.

Fig. 5 shows all mutant spectra that displayed only minor changes from the wild t-ye spectrum. For mutations in the carboxyl terminus (residues 72-76), virtually no changes were seen other than at the point of mutation. In other cases, slight changes were seen in surrounding resonances. For example, t h e H i s - 6 b L y s m u t a t i o n showed slight chemical shift perturbations of surrounding protons, consistent with subtle backbone conformational changes, and/or the loss of the imidazole ring current chemical shift contributions. The one exception was the Leu-W-Asn, Leu-69-Asn double mutant (not shown), which was difficult to solubilize at high enough concentrations to collect reproducible data. We also experi- enced sample-dependent variations with this mutant which may reflect a substantially less stable protein structure.

A more detailed analysis of the mutant uhiquitin structures was performed using two-dimensional NMR techniques, but for the mutants analyzed, little or no structural changes could be detected. DQF-COSY spectra of t h e G l y - 7 b A l a a n d Leu- 73-1 mutants were identical to the wild t-ye spectrum, except for (a ) the loss of the Gly-76 resonances and the appearance of Ala-76 resonances and ( h ) the loss of Leu-73 resonances accompanied by a minor shift (50.05 ppm) in the Arg-74 C"H and C"H resonances. These data are consistent with our observations' that residues 72-76 are highly mobile in solution; hence deletions and mutations in this region will only alter the steric and chemical nature of the carboxyl terminus, since it has no defined structure.

The most detailed analysis of the mutant structures involves the analysis ofoNOESY data, where all interproton distances less than 4 A can, in principle, be measured and compared with the wild type. We selected the Tyr-59+Phe mutation to analyze in this fashion (Fig. 6 and 7 ) . since it was reported that the loop containing residues 50-60 was stahi- lized by a hydrogen bond involving t.he hydroxyl group of Tyr- 59 (25). Furthermore, Tyr-59 is included in a region involved in immunostimulatory activity (3). Even at the level of detail available in the NOESY spectrum, we could detect only two very minor changes from the wild t.ye spectrum. suggesting

~~~~ ~~~~

'' Weher, P., Brown, S., and Mueller. L. (1987) Rinchcrnistn. 261, in press.

"11. J. Rcker, T. R. Butt, ,J. Marsh, E. .J. Sternherg. N. Margolis, H. P. Monia, S. .Jonnalagadda, M. I. Khan. P. I,. Weber. L. Mueller. and S. T. Crooke, unpublished ohservations.


I n s57

FIG. 5 . 500 MHz NMR spectra of wild type and mutant ubiquitins. __ The wild type ( WT) ubiquitin spectra are shown at the top and bottom. The spectra for each of the mutant ubiquitin species are identified at the far right side of the spectra using the one letter amino acid code (i.e. P19S = proline 19- serine). The region of the 1H NMR spectrum containing amide and aromatic proton resonances is shown. In the WT spectra, arrowheads indicate WT resonance positions of amide (bottom spectrum) and aromatic (top spectrum) protons of the sites of mutation. In the mutant spectra, these positions are again indicated by open arrows. Large arrowheads indicate new resonances arising from the mutation involved; small arrows indicate shifts in resonances other than those at the site of mutation. All samples were prepared in 0.4 ml 25 mM NaOAc- 4, pH 4.7, with 10% (v/v) D,O added; protein concentrations ranged from 0.1 to 5 mM in ubiquitin. Spectra were ob- tained at 500 MHz using a spectral width of 6250 Hz divided into 8192 complex data points. All data were collected on a JEOL GX500 and transferred to a microVAX I1 for processing using the FTNMR software (Hare Research, Inc.).

1 I I I I

PPM

I I 10 9 8 7

I

both that the Phe-59 ring is in a similar position as the Tyr- 59 ring (detectable by both resonance chemical shifts and NOE distances) and that the loop does not require the hydrogen bond for stability.

Protein Function-The role of ubiquitin as an essential cofactor in selective ATP-dependent proteolysis has been studied primarily in experiments using a rabbit reticulocyte lysate which is purified of ubiquitin and ATP by DEAE- cellulose chromatography and dialysis (22). The partially purified cell extract is supplemented with ATP, ubiquitin, and an iodinated protein such as BSA or lysozyme as sub-

strate. Proteolysis of the labeled substrate is followed by the release of trichloroacetic acid soluble counts.

In this assay, animal ubiquitin, isolated from bovine blood and from expression in E. coli were equally active in supporting the in vitro degradation of BSA over a range of ubiquitin concentrations from 0.1 to 4 pg/assay (not shown). The triple mutant pro-l9--tSer, Ala-28+Ser, Glu-24-+Asp (the sequence of yeast ubiquitin), and the single mutant Pro-19-Ser were as active as wild type ubiquitin. The full biological potency of yeast ubiquitin, isolated from expression in E. coli, is consistent with the previously reported result that wild type yeast

Site-directed Mutagenesis of Ubiquitin

8 0

1138;

F59 0

0

0

0

8

0

. o

- - o.

" . D - "

9 . 5 9 . 0 8 . 5 8 . 0 7 . 5 7 . 0 6 . 5 PPM

FIG. 6. NH-C"H cross-peak regions of wild type (luwer) and Tyr-BO+Phe (upper) ubiquitins. The identity of each cross-peak is labeled in the wild type spectrum; in the mutant those peaks which shift by more than 0.10 ppm are relabeled, and a line connects their position to that in the wild type. Despite the large changes in the Leu-50, Glu-51, and Phe-59 cross-peaks, no significant structural change occurs except for the loss of Tyr- 590fH-Glu-51NH hydrogen bond.

14219

Lo

M

0

U

3 Loa .Q- U

0

Lo

Lo

M

0

U

Lox

0

LD

Lo

Lo

14220 Site-directed Muta 22 26 46 T I E N V A G K Q L E D G

50

R T L S D V F : I Q K E E T 55

dNN 9 . . . . . . . . . ~ . . . . . . . . . . ~ . . . . . . . . , FIG. 7. Backbone sequential NOEs for residues near posi-

tion 59. The thickness of the bars correspond to the intensities of NOEs identified in the wild type (above dashed line) and Phe-59 mutant (below dashed line).

ubiquitin, isolated from yeast, is fully active in supporting protein degradation in reticulocyte extracts (18, 33). The single mutant Pro-19-Ser is an animal-yeast hybrid protein, having a Ser-19 residue as in yeast ubiquitin, but Glu-24 and Ala-28 residues as in animal ubiquitin. This hybrid was constructed to test the possibility that the three differences between yeast and animal ubiquitin represent a mutation, followed by a "second site compensation" to restore the protein to the active structure (34). The identical activities of the three proteins suggest that this is not the case. Rather the conservative substitutions in these amino acid positions are tolerated by the enzymes that utilize ubiquitin as a cofactor for proteolysis.

Mutagenesis of the single tyrosine at position 59 to a phenylalanine resulted in a substantial loss in Solubility (less than 1 mg/ml in pure water), but the solution structure was not detectably changed from the wild type structure by NMR when dissolved in 25 mM NaOAc buffer a t pH 4.7 (see below). In the in uitro degradation assay, this mutant was consistently 70-100% as active as wild type ubiquitin, suggesting that the single tyrosine side chain plays no essential role in the proteolytic function of ubiquitin.

Uhiquitin contains a single histidine at position 68, which is on the surface of the molecule. Surprisingly, mutagenesis of this residue to a lysine resulted in loss in solubility. In in vitro degradation this mutant was approximately 30% as active as wild type ubiquitin.

The double mutant Leu-67-Asn, Leu-69-+Asn was completely inactive in supporting the in vitro degradation of BSA. These two mutations are in a strand of a @-sheet with the side chains buried deep in the hydrophobic core of the protein. Substitution of Asn for Leu would be sterically possible in uhiquitin, hut would result in a substantially less hydrophobic core. Insertion of amide groups in lipopholic pockets may also generate repulsive interactions that prevent the protein from folding properly. Alternatively, the increased hydrophylicity of Asn over Leu may create a more energetically favored unfolded structure because of the increased number of hydrogen bonds that can be formed between Asn and water when the protein is unfolded. The NMR data were insufficient to determine the structure of this mutant.

All of the mutants affecting the carboxyl-terminal tail of ubiquitin were completely inactive in the proteolysis assay. Mutations in the ubiquitin tail did not disrupt the globular domain as evidenced in the NMR, but more likely disrupted

genesis of Ubiquitin

the interactions between ubiquitin and the enzymes of the ubiquitin pathway. Moreover, mutations in the tail resulted in substantially lower binding of ubiquitin antibodies.

The most studied of the ubiquitin pathway enzymes is the ubiquitin-activating enzyme E l , which activates ubiquitin in an ATP-dependent reaction to form an enzyme-ubiquitin thiolester. According to the current model, activated ubiquitin is then transferred to other enzymes in the pathway and ultimately to the target protein that is to be degraded. Failure of E, to successfully activate ubiquitin would be expected to prevent ubiquitin-dependent proteolysis. Another model for ubiquitin-dependent proteolysis that does not include El and target protein ubiquitination has been proposed in which ubiquitin and ATP cause the release of a protease inhibitor from an endogenous protease, thereby activating the protease (35).

We studied the activities of the ubiquitin mutants with purified E1 using the PP,-ATP exchange assay as previously described (21). The rate of PP,-ATP exchange was strongly dependent on the ubiquitin concentration and severe inhibi- tion of exchange was observed above 5 p~ ubiquitin. Inhibi- tion of PP,-ATP exchange a t high ubiquitin concentrations is indicative of an ordered addition of substrates, with ubiquitin binding to the enzyme after ATP. This result is identical to that reported previously (21). The important point is that the PPi-ATP exchange assay is useful to study the substrate specificity of El (for ubiquitin) and to monitor the activation of the ubiquitin mutant proteins. The ubiquitin mutants with the conservative substitutions Pro-lS+Ser, A la -2bSer , Glu- 24jAsp (yeast ubiquitin) and the single mutant Pro-lS+Ser all had activities identical to wild type ubiquitin in this assay (Fig. 8).

All of the mutants in the carboxyl-terminal tail of ubiquitin were completely inactive in catalyzing PPi-ATP exchange, including the conservative Gly -7bAla substitution (Fig. 8). This suggests a high degree of substrate specificity for the ubiquitin tail in the El active site. I t is noteworthy that the tail mutants were also completely inactive in the in vitro protein degradation assay. The two-dimensional NMR data on these mutants showed that the globular domains of the mutant ubiquitins are identical to wild type uhiquitin and that structural changes in these mutants are restricted exclu- sively to the tail region. The failure of the tail mutants to be activated by El or stimulate in vitro proteolysis strongly implies a requirement for El activation as a prerequisite to ubiquitin-dependent proteolysis and supports the more widely accepted model. This is also consistent with the previously reported data that ubiquitin which has lost the terminal Gly- Gly residues by tryptic cleavage is inactive in supporting in vitro proteolysis (23, 36).

The surface mutants Tyr-59--tPhe, His-6bLys and the double mutant containing both of these changes were partially active in the PPi-ATP exchange assay. These activities were concentration-dependent and increased by increasing the mutant protein concentration. Since we know that these mutants are folded properly from the NMR data and that they are not changed in the carboxyl-terminal tail, we conclude that during the El activating reaction the enzyme has points of contact with the globular domain of ubiquitin, which are disfavored by these mutations. This conclusion is further supported by our observations that synthetic peptides with the sequences like the ubiquitin tail (Arg-Gly-Gly, Leu-Arg-Gly-Gly, Arg- Leu-Arg-Gly-Gly) are inactive in this assay, whereas the hexamer (Leu-Arg-Leu-Arg-Gly-Gly) catalyzes only a small amount of PPi-ATP exchange at very high concentrations. The double mutant Leu-67-Asn Leu-69-+Asn, which is


30

25

-5 20 E

5 15 E

\

0,

Q

> 0 10

5

0 - 0 1 0 20 30 40 50 60 70

[Ubiquitin] pM FIG. 8. Ubiquitin and mutant ubiquitin concentration de-

pendence of ATP:PPI exchange rates catalyzed by the ubiquitin-activating enzyme E,. Each reaction contained purified El, 0.09 mg; Tris-HC1 50 mM, pH 7.6; ATP 1 mM, PP,, 100 FM, specific activity 6.6 X 10' dpm/nmol; MgCl,, 10 mM; dithiothreitol, 0.1 mM, and varying ubiquitin concentrations. The reactions were stopped after 20 min and counts in ATP adsorbed to charcoal were measured as previously described (36). Animal ubiquitin, isolated from bovine blood, from expression in E. coli, yeast ubiquitin from expression in E. coli, and animal ubiquitin mutant Pro-19jSer were identical in this assay and represented in the single curve A. The experimental variation on each data point was approximately 5-10%. Mutants in the tail, Gly"IhAla, Leu-734elete, Leu-734elete, Arg-72+Ser, and Leu-67,69+Asn were completely inactive and shown in the single curve (0). 0, Tyr-59-Phe; ., His-6hLys; A, double-mutant Tyr- 59+Phe, His-6hLys.

structurally changed in the globular domain but has a normal tail, was also completely inactive in the E, assay.

From these studies we draw the following conclusions on ubiquitin structure, folding, and function in proteolysis. 1) Throughout the entire known eukaryotic domain there are only three forms of ubiquitin; animal, yeast, and plant. The latter two differ from animal ubiquitin by only three amino acid substitutions. The full biological activity of an animal- yeast hybrid protein suggests that the substitutions (in groups of three) are not required in concert to maintain a properly folded, active structure. Conservative changes in these positions do not interfere with protein folding, stability, and function in proteolysis. 2) Mutations in the ubiquitin tail completely destroy the biological activity of ubiquitin as a cofactor in proteolysis. This is a result of an inability of the first enzyme in the pathway (E , ) to recognize the mutant ubiquitin tail. 3) E, also interacts with the globular domain of ubiquitin and surface mutations can hinder this. 4) Acti- vation of ubiquitin by E, appears to be essential for all ubiquitin-dependent proteolysis in our assays, as no mutant was active in in vitro proteolysis that was not active in the El assay. 5 ) That ubiquitin is so highly conserved suggests that there is selection pressure from some source on virtually every amino acid to maintain either the proper folding, stability, or function of ubiquitin. With only one exception, all of the mutants reported here were folded in a manner similar or identical to wild type ubiquitin, suggesting that some amino acid substitutions can be made in ubiquitin without destroying the ability of the protein to fold properly. However, in the proteolysis function of ubiquitin, activity was lost when the mutations adversely affected points of contact between ubiq-

uitin and the enzymes of the pathway. This should provide an interesting model system for further studies of protein- protein interactions during enzymatic reactions.

Acknowledgments-We gratefully acknowledge Allan Shatzman for the expression vectors and large scale fermentations, W. Cook, K. Wilkinson, and C. Bugg for supplying the crystal structure coordinates of ubiquitin, Scott Dixon and Drake Eggleston for assistance with the molecular modeling and computer graphics, Stephen Brown for assistance with the NMR assignments, and Angela Varrichio for the amino acid composition analysis.

1. 2.

3.

4.

5.

6.

7.

8.

9.

10.

11.

12.

13. 14.

15.

16.

17.

18.

19.

20. 21.

22.

23.

24.

25.

26. 27.

28. 29. 30. 31. 32. 33.

34. 35.

36.

REFERENCES Busch, H. (1984) Methods Enzymol. 106,238-262 Siegelman, M., Band, M., and Gallatin, M. W. (1986) Science

Audhya, T., and Goldstein, G. (1985) Methods Enzymol. 116,

Okabe, T., Fujisawa, M., Mihara, A., Sato, S., Fujiyoshi, N., and

Mori, H., Kondo, J., and Ihara, Y. (1987) Science 235, 1641-

Ozkaynak, E., Finley, D., and Varshavsky, A. (1984) Nature 312 ,

Dworkin-Rastl, E., Shrutkowski, A., and Dworkin, M. B. (1984) Cell 39,321-325

Wiborg, O., Pedersen, M. S., Wind, A., Berglund, L. E., Marcker, K. A., and Vuust, J. (1985) EMBO J. 4,755-759

Lund, P. K., Moats-Staats, B. M., Simmons, J. G., Hoyt, E., D'Ercole, A. J., Martin, F., and Van Wyk, J. J . (1985) J. Biol. Chem. 260,7609-7613

Ozkaynak, E., Finley, D., Solomon, M., and Varshavsky, A. (1987)

Miller, J., McLachlan, A. D., and Klug, A. (1985) EMBO J. 4,

Hersko, A., and Ciechanover, A. (1986) Prog. Nucleic Acid Res.

Rechsteiner, M. (1987) Annu. Reu. Cell Biol. Vierstra, R. D., Langan, S. M., and Schaller, G. E. (1986) Bio-

chemistry 25,3105-3108 Haas, A. L., and Bright, P. M. (1985) J. Biol. Chem. 260,12464-

12473 Wilkinson, K. D., and Mayer, A. (1986) Arch. Biochem. Biophys.

250,390-399 Maniatis, T., Fritch, E. F., and Sambrook, J. (1982) Molecular

Cloning: A Laboratory Manual, Cold Spring Harbor Labora- tory, Cold Spring Harbor, NY

Ecker, D. J., Khan, M. I., Marsh, J., Butt, T. R., and Crooke, S.

Shatzman, A. R., and Rosenberg, M. (1986) Ann. N. Y. Acad. Sci.

Chen, E. Y., and Seehurg, P. H. (1985) DNA (NY) 4, 165-170 Haas, A. L., and Rose, I. A. (1982) J. Biol. Chern. 257, 10329-

Hersko, A., Ciecbanover, A., and Rose, I. A. (1979) Proc. Natl.

Wilkinson, K. D., and Audhya, T. K. (1981) J . Biol. Chem. 256,

Dalbadie-McFarland, G., Neitzel, J . J., and Richards, J. H. (1986)

Vijay-Kumar, S., Bugg, C. E., and Cook, W. J. (1987) J. Mol.

Bax, A., and Lerner, L. (1986) Science 232, 960 Wemmer, D. E., and Reid, B. R. (1985) Annu. Reu. Phys. Chem.

Karplus, M. (1959) J. Chem. Phys. 30, 11 Bystrov, V. F. (1976) Prog. NMR Spec. 10, 41 Solomon, I. (1955) Phys. Reu. 90 , 559 Keepers, J. W., and James, T. L. (1984) J. Magn. Reson. 57,404 Mueller, L. (1987) J . Mugn. Reson. 72, 191-196 Wilkinson, K. D., Cox, M. J., O'Connor, L. B., and Shapira, R.

Ho, C., Jsin, M., and Schimmel, P. (1985) Science 229,389-393 Speiser, S., and Etlinger, J. D. (1983) Proc. Natl. Acad. Sci.

Haas, A. L., Murphy, K. E., and Bright, P. M. (1985) J. Biol.

23 1,823-829

279-291

Takaku, F. (1986) J. Cell Biol. 103, 442a

1644

663-666

EMBO J. 6, 1429-1439

1609-1614

Mol. Biol. 33, 19-56

T. (1987) J . Biol. Chem. 262 , 3524-3527

478,233-248

10337

Acad. Sci. U. S. A. 76, 3107-3110

9235-9241

Biochemistry 25,332-338

Bid. 194 , 531-544

36 , 105

(1986) Biochemistry 25, 4999-5004

U. S. A. 80,3577-3580

Chem. 260, 4694-4703

Gene Synthesis, Expression, Structures, and Functional Activities of ...

Documents

Transcript of Gene Synthesis, Expression, Structures, and Functional Activities of ...