GM

AA*a

R

chWm1tsmtiAsmssrsP

fi

gnccVSaI

tc(

MBa

Biochemical and Biophysical Research Communications 276, 817–822 (2000)

doi:10.1006/bbrc.2000.3513, available online at http://www.idealibrary.com on

ene Structure and Promoter Function of Murineunc18-2, a Nonneuronal Exocytic Sec1 Homolog

nurag Agrawal,*,1 Roberto Adachi,* Michael Tuvim,* Xiao-Tian Yan,*bigail H. Teich,* and Burton F. Dickey†,‡

Department of Internal Medicine, †Department of Molecular Physiology and Biophysics, and ‡Department of Molecularnd Cellular Biology, Baylor College of Medicine and Houston VA Medical Center, Houston, Texas 77030

eceived August 14, 2000

tight docking between transport vesicle and targetmvstfSiiccilttcwsSdptncp

ttbtvesSmmstii

Sec1 family proteins are regulators of diverse exo-ytic processes, from yeast to man. Three mammalianomologues, Munc18-1, -2, and -3 have been described.e have studied the structure and expression of theouse Munc18-2 gene. The Munc18-2 gene comprises

9 exons whose sizes range from 50 to 158 bp, with aotal gene size of approximately 11 kb. A single tran-cript of 2.1 kb is expressed in multiple non-neuronalurine tissues. Munc18-2 has a striking resemblance

o Munc18-1 in structure despite only 60% sequencedentity, suggesting a recent gene duplication event.nalysis of the region upstream of the transcriptiontart site shows that Munc18-2 has a TATA-less pro-oter, with a consensus initiator (Inr) sequence at the

tart of transcription, several Sp1 binding sites, andtrong promoter activity in RBL-2H3 mast cells. Theegion from 15 to 2430 is more active than 15 to 2800,uggesting upstream repressor elements. © 2000 Academic

ress

Key Words: Sec1; Munc18; exocytosis; vesicle traf-cking; secretion; syntaxin; SNARE.

Recent evidence from a variety of biochemical andenetic approaches has revealed a conserved mecha-ism of vesicular transport from yeast to man. Theentral components are SNARE proteins that are lo-alized both on transport vesicles (v-SNAREs, such asAMP) and target membranes (t-SNAREs, such asyntaxin and SNAP-25) (1, 2). These come together inparallel four-helix bundle called the core complex.

nitial formation of this complex appears to mediate

The nucleotide sequence data reported in this paper will appear inhe DDBJ/GenBank/EBI nucleotide sequence database with the Ac-ession Nos. AF263345 (Munc18-2 cDNA sequence) and AF263346Munc18-2 gene sequence). Release date: May 22, 2000.

1 To whom correspondence should be addressed at Baylor Collegeedicine and the Houston VA Medical Center, 2002 Holcombelvd, MS-151B, Houston, TX 77030. Fax: 713-794-7853. E-mail:agrawal@bcm.tmc.edu.

817

embrane, while completion of the energetically fa-ored coiling process appears to drive lipid bilayer fu-ion (3). Numerous trafficking proteins regulate func-ion of the core complex (4). Among these are Sec1amily proteins that interact with high affinity withyntaxin family proteins (5–8). Syntaxin is the most

mportant trafficking protein since absence of Syntaxinn D. melanogaster causes a complete loss of neurose-retion, whereas absence of other exocytic SNAREsauses severe but incomplete defects (9–11). Syntaxins the only SNARE whose structure is ordered in iso-ation, whereas the others only become orderedhrough interaction with Syntaxin. In isolation, Syn-axin exists in a closed conformation in which the coil itontributes to the core complex is instead complexedith three other internal coils (12, 13). In metazoan

ystems (the situation appears to differ in yeast (14)),ec1 opens the structure of Syntaxin, and then mustissociate to allow Syntaxin to participate in core com-lex formation (8, 13). Experimentally, these sequen-ial interactions have been detected as positive andegative roles in transport, whereby absence of Sec1auses a complete loss of neurosecretion, and overex-ression also impairs secretion (15).In Saccharomyces cerevesiae, four Sec1-related pro-

eins are present (16–19). Sec1p is required for vesicleransport from the Golgi complex to the plasma mem-rane, Sly1p for transport from endoplasmic reticulumo the Golgi complex, and Slp1p/VPS33 and VPS45 foracuolar transport. In higher organisms, proteins clos-st in structure to Sec1p have been described thatimilarly function in secretion (20). A single exocyticec1 isoform exists in C. elegans (Unc18) and in D.elanogaster (Rop), while three have been described inammals (Munc18-1, -2, and -3). Munc18-1 was de-

cribed as a neuron-specific Sec1 ortholog, and regula-ion of its interaction with Syntaxin-1A has been stud-ed in detail (5, 8). Munc18-2 and Munc18-3 weredentified in non-neuronal tissues and have not been

0006-291X/00 $35.00Copyright © 2000 by Academic PressAll rights of reproduction in any form reserved.

wiadt2cf

M

MTp(sssd

(km5GtapC

(a(tgbts

wtlfclfvof

R

1tOksg3wfdc(eG2m(1dvla

cwfwtom

sbsbAfca(R

Vol. 276, No. 3, 2000 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

ell-studied (21). Munc18-1 is phosphorylated by PKCn vitro and in vivo, reducing its affinity for Syntaxin,nd increasing secretion (22, 23). Mast cell exocytosisepends upon PKC activation (24) and we have iden-ified Munc18-2 as the predominant isoform in RBL-H3 mast cells (unpublished observations). In thisommunication, we report the structure and promoterunction of the Munc18-2 gene.

ATERIALS AND METHODS

Isolation and sequencing of genomic clones. Full-lengthunc18-2 cDNA was cloned from RBL-2H3 mast cells by RT-PCR.his was used as a template to generate 32P-labeled, random-primedrobe, for screening a 129/Sv mouse lambda phage genomic libraryStratagene, La Jolla, CA). Approximately 2 3 106 phage clones werecreened, and positive clones were isolated by secondary and tertiarycreening. Genomic inserts were released and subcloned in pBlue-cript II SK(1) (Stratagene) for DNA sequencing using primersesigned across the cDNA sequence.

RACE analysis. 59 and 39 rapid amplification of cDNA endsRACE) was performed using a Marathon-ready mouse testes andidney cDNA libraries (Clontech, Palo Alto, CA) according to theanufacturer’s protocol. The specific primers for 59 RACE were

9ATTTCCGACATGGCGACACCACCC39 for initial PCR and 59AT-ATGAGGACCTTCCACTCGCC39 for nested PCR; for 39 RACE

hese were 59TGACCTGTGGGTGGAACTTCGGC39 for initial PCRnd 59GGCAAGTGGGAGGTGCTCATAGGC39 for nested PCR. Am-lification products were cloned into the TA vector (Invitrogen,arlsbald, CA) and then sequenced.

Northern blot. A mouse multiple tissue Northern blot membraneClontech) was used for Northern blot analyses. Each lane containspproximately 2 mg of polyA1 RNA from different mouse tissuesheart, brain, spleen, lung, liver, skeletal muscle, kidney, testis). Inhe first Northern blot we used a 32P-labelled random-primed probe,enerated from the Munc18-2 cDNA template. In the second, the-actin probe supplied by the manufacturer was used to control forhe amount of RNA loaded into each lane. The membrane wastripped between hybridizations.

Promoter analysis. The sequence upstream of the end of 59 RACEas analyzed using TESS and Matinspector software (25). The 2800

o 15 bp putative promoter region was cloned into the promoterlessuciferase vector, PGL-2 basic (Promega, Madison, WI), and trans-ected into RBL-2H3 cells using FuGENE6 (Roche Molecular Bio-hemicals, Indianapolis, IN). After 24 h, the luciferase activity of cellysates was compared to equal amounts of lysates from cells trans-ected with the promoterless vector alone or the vector with a SV-40iral promoter. The promoter region was also digested with HindIIIr MluI endonucleases to yield shorter fragments that were testedor promoter activity in the same manner.

FIG. 1. Munc18-2 gene. Vertical bars represent exons. Restri

818

ESULTS

Genomic structure of Munc18-2. Screening a29/Sv mouse lambda phage genomic library yieldedwo overlapping clones of approximately 14 and 16 kb.ne of the clones contained the full structural gene, 2.1b of 59 upstream sequence and 1.5 kb of 39 down-tream sequence, while the other contained part of theene and 11 kb of downstream sequence. 59 RACE and9RACE defined the start and end of transcription,ith consensus initiation and termination sequences

ound at either end. The exon-intron boundaries wereeduced by comparing the sequence of the genomiclones with the 59 and 39 RACE products and the cDNAFig. 1). The murine Munc 18-2 gene has nineteenxons, and all the exon-intron boundaries follow theT-AG rule (Table 1). The smallest exon is 50 bp (exon), and the largest 158 bp (exon 18). When compared tourine Munc18-1, both have 19 exons of similar sizes

Table 2), differing slightly in length only in exons 1,1, 16, 18, and 19. This similarity occurs despite greatifference in overall gene length (13 kb for Munc18-2s. 56 kb for Munc18-1) (26), different chromosomalocations (chromosome 8 vs. chromosome 2) (26, 27),nd only 60% identity at the protein level (21).

Transcription. By Northern blot analysis using aDNA probe, a Munc18-2 transcript of 2.1 kb lengthas detected in multiple tissues (Fig. 2). Using b-actin

or normalization, the highest Munc18-2 expressionas found in murine testis, kidney, and liver. This

ranscript can also be seen at lower levels in the mRNAf lung, heart and spleen, but is not seen in skeletaluscle or brain. No alternative transcripts were found.

Promoter analysis. Sequence analysis of the 59 up-tream region revealed multiple potential sites forinding transcription factors near the start of tran-cription (Fig. 3). Though we found no TATA or CAAToxes, we identified an initiator sequence (Inr: Py, Py,11, N, A/T, Py, Py) at the start of transcription, with

our upstream Sp1 sites in close proximity (28). Highonsensus Ets-1 binding sites (CMGGAWGYN) at 214nd 2173, a Cyclic AMP Responsive Element BindingCREB) site (GNTGACGY) at 253, a Corticosteroideceptor (CR) site at 2115 (AGAACAGATG), and

n sites are B (Bam HI), E (EcoRI), K (KpnI), and H (HindIII).

ctio

EUs

Cbmcs2tthpmcscga

TABLE 1

E

s

n

sic

pwMh

Vol. 276, No. 3, 2000 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

-boxes (CANNTG) at 259 and 2101 were also seen.SF-1 has selective affinity for E-box motifs with core

equences YCACGTGR, such as the one at 259. The

Organization of t

xon no. Size (bp) 59 Splice donor

1 55 GTAGGGGAAA/gt gagtgtca2 50 CGAGTGGAAG/gt aggggctg3 83 GGCATCACCA/gt gagtggat4 77 CACGGAGAAG/gt acctataa5 79 TTCACTGACA/gt gagtgagg6 104 TGAGGCCCAG/gt acagccc7 149 GATACCGCAA/gt ggggacc8 85 TCTGGGCGAG/gt aaggggg9 131 ACACATACAG/gt agattgga

10 108 ATGTTTCCAA/gt gagagctt11 58 CACAGACAAG/gt agaggtcc12 66 GCTGAACAAG/gt aaaagctg13 81 TGTGGAGCAG/gt aggcctgg14 139 CTGCGGAATG/gt gggtgagg15 110 CAACTCCGCG/gt acgtaggg16 96 TGTGATGGAG/gt acacaag17 86 CAGCTGTCAG/gt gagggcc18 158 GTGCTCATAG/gt aagtagcc19 149

Note. For the splice sites, exon portions are shown in uppercase, inhown in boldface and italic.

TABLE 2

Comparison of the Structure of Munc18-1and Munc18-2 Genes

Exonumber

Munc18-1exon size

(bp)

Munc18-2exon size

(bp)

Munc18-1intron size

(kb)

Munc18-2intron size

(kb)

1 235 [37] 55 [37] 24 1.02 50 50 1.6 0.23 82 82 1.9 0.74 77 77 1.3 0.55 79 79 1.0 0.16 104 104 2.3 0.47 149 149 2.8 1.08 85 85 0.8 0.19 131 131 2.0 0.1

10 108 108 1.0 0.311 61 58 1.2 0.112 66 66 0.6 0.113 81 81 3.0 0.614 139 139 1.3 2.315 110 110 1.1 1.016 102 96 2.4 0.617 86 86 2.0 0.118 155 158 6.4 0.619 1676 [80] 149 [83]

Note. The size of each exon of Munc18-1 is compared to the corre-ponding exon of Munc18-2, followed by the size of the correspondingntrons. For exons containing noncoding sequences, the length of theoding region is listed in brackets.

819

R binding site is not a high consensus binding site,ut is identical to a 10 bp sequence known to bindurine corticosteroid response element (29). Since

omputer based modeling of the Munc18-2 gene haduggested the presence of promoter sequences up to700 bp, the region extending from 15 to 2800 was

ested for promoter activity. In RBL-2H3 mast cellshat express Munc18-2, this sequence was found toave robust promoter activity (Fig. 4), equaling ap-roximately 50% of the activity of the viral SV-40 pro-oter known to have strong promoter activity in these

ells (30). Using restriction endonuclease digestion,horter promoter fragments were obtained that wereompared to the full-length promoter (Fig. 5). The re-ion from 15 to 2598 is more active than 15 to 2800,nd the region from 15 to 2430 is still more active,

Munc18-2 Gene

39 Splice acceptor Intron size (kb)

ttccctgt ag /AAATTTTAAG 1.0atctggtc ag /GTCCTCATCA 0.2ttgcgttt ag /TCGTGGAAGA 0.7tcctcccc ag /TCGGTTCAGG 0.5gccaaccc ag /CATGCCCTGA 0.1tccttcct ag /GTGTTCTCTC 0.4tcacctcc ag /GGGTCCAGAA 1.0gcgtgccc ag /GGCCCAGAGA 0.1

gtcggtcc ag /GTATGAGACC 0.1tcatgtct ag /GAAGGTCACA 0.3attacctc ag /GCCAACATCA 0.1caccctgc ag /TACTCTACGC 0.1tgtcatgc ag /GACCTGGCCA 0.6tgtgcccc ag /GGGTGAGTGA 2.3ccctctgt ag /GGCTCAGGGA 1.0ggctcccc ag /GATGTGGTGG 0.6accccagc ag /CGCTCGCTTT 0.1tcctgccc ag /GCTCTTCTCA 0.6

n portions are shown in lowercase, and donor and acceptor sites are

FIG. 2. Northern blot analysis. A membrane containing 2 mg ofoly-A1 RNA per lane from different mouse tissues was hybridizedith two different probes. (a) Random-primed probe using full lengthunc18-2 cDNA as a template. (b) Random-primed probe using

uman b-actin as a template.

he

caa

tc

tro

ss

D

tlrtea(iSs

(dew

Msso21CrcioTapm

tas(fetimsdchoiM

i

ovMMt

Vol. 276, No. 3, 2000 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

uggesting the presence of multiple upstream repres-or elements.

ISCUSSION

The gene structure of Munc18-2 is extremely similaro Munc18-1, despite only 60% identity at the proteinevel, suggesting rapid evolutionary divergence afterecent gene duplication. This is supported by the facthat only a single exocytic Sec1 isoform is present in C.legans and D. melanogaster. Although both Munc18-1nd Munc18-2 can bind Syntaxins 1, 2, and 3 in vitro31), they are usually associated with specific Syntax-ns in vivo, i.e. Syntaxin-1A with Munc18-1, andyntaxin-3 with Munc18-2 (32, 33). While, the genetructure of Munc18-3, which is found with Syntaxin 4

FIG. 3. Munc18-2 promoter region. 344 bases upstream of the tras italicized. Boxed text represents transcription factor binding sites

FIG. 4. Promoter analysis. Luciferase activity of equal amountsf transfected RBL-2H3 mast cell lysate is shown. Promoterlessector and SV-40 viral promoter are compared with the 2800 to 15unc18-2 promoter. All values are expressed as a percentage of theunc18-2 promoter activity, and are the result of three separate

ransfections.

820

31), is currently unknown, it is possible that afteruplication, Munc18 genes have become modified byvolutionary pressure to be able to optimally interactith specific Syntaxin isoforms.In comparing the gene structures of Munc18-1 andunc18-2, differences in coding region length were

een only in exons 11, 16, 18, and 19. When the proteintructure is compared to the gene structure, the blocksf sequence identity between the two are shifted by 1,, and 1 amino acids in the regions coded by exon 11,6, and 18, while the extra codon in exon 19 is at the-terminus of the Munc18-2 protein. All differenceselated to exon size occur in poorly ordered loops of therystal structure of Munc18-1 (8), so that substitutionsn these areas are unlikely to significantly affect theverall protein structure. Serine469 in Munc18-1 andhreonine554 in Munc18-2 correspond to extra aminocids in exons 16 and 18. Since Munc18 is known to behosphorylated by protein kinases, these differencesay have functional relevance (22, 34).The TATA-less Munc18-2 promoter has strong ac-

ivity in RBL-2H3 mast cells and a consensus initi-tor (Inr) sequence at the start of transcription. Inrequences direct accurate transcription initiation28), and in conjunction with upstream transcriptionactors, such as Sp1, they can direct high levels ofxpression. Multiple Sp1 sites are known to replacehe need for a TATA box (35–37), and four Sp1 sitesn close proximity are present in the Munc18-2 pro-

oter. Furthermore, the region extending from thetart of transcription to 2200 has abundant andiverse transcription factor binding sites (Fig. 3), inontrast to the TATA-less Munc18-1 promoter thatas a paucity of transcription factor binding sites,ther than a GC rich region and Sp1 sites (26). Thiss consistent with a restricted expression of

unc18-1, which is relatively neuron-specific, while

ription initiation site are represented, and the transcribed sequence

nsc.

Mw

o3vsitsthRptMbabs

aTMTtu

R

(M

Vol. 276, No. 3, 2000 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

unc18-2 has been found in a number of tissues,ith the exception of brain.Munc18-2 is abundantly expressed in epithelial cells

f kidney, lung, gastrointestinal tract, and testis (38,9). Munc18-2 transcription increases during the de-elopment of secretory epithelium (40), and duringtimulation of secretory cells (41), consistent with anmportant role in expression of the fully mature secre-ory phenotype. In the lung, production of pulmonaryurfactant by epithelial cells is enhanced by glucocor-icoids (42). It is interesting that a 10 bp sequence thatas been reported to bind the murine Corticosteroidesponse Element (29) is also present in the Munc18-2romoter at position 2115. When the Surfactant Pro-ein A (SP-A) promoter is compared to that ofunc18-2, a number of common transcription factor

inding sites are found, including those for Sp1, USF-1,nd CREB (43–45). The SP-A promoter contains a GTox (GGGGTGGGG) coordinately acting with a CREBite (46), and an identical GT box sequence is found

FIG. 5. Promoter analysis. Luciferase activity of equal amounts2, 3, 4, 5) span regions as indicated in the lower panel, and are comp

unc18-2 promoter activity, and are the result of two or more sepa

821

djacent to a CREB site in the Munc18-2 promoter.he SP-B promoter also shares motifs with theunc18-2 promoter, such as Ets-1 and Sp1 (47, 48).ogether, these observations suggest that secreted pro-eins and the exocytic machinery are coordinately reg-lated in secretory epithelium.

EFERENCES

1. Sollner, T. H., and Rothman, J. E. (1996) Cell Struct. Funct. 21,407–412.

2. Linial, M. (1997) J. Neurochem. 69, 1781–1792.3. Bock, J. B., and Scheller, R. H. (1999) Proc. Natl. Acad. Sci. USA

96, 12227–12229.4. Clague, M. J. (1999) Curr. Biol. 9, R258–R260.5. Hata, Y., Slaughter, C. A., and Sudhof, T. C. (1993) Nature 366,

347–351.6. Pevsner, J., Hsu, S.-C., and Scheller, R. H. (1994) Proc. Natl.

Acad. Sci. USA 91, 1445–1449.7. Garcia, E. P., Gatti, E., Butler, M., Burton, J., and De Camilli, P.

(1994) Proc. Natl. Acad. Sci. USA 91, 2003–2007.

ransfected RBL-2H3 mast cell lysate is shown. Deletion constructsd to (1). All values are expressed as a percentage of the 2800 to 15transfections.

of tare

rate

8. Misura, K. M., Scheller, R. H., and Weis, W. I. (2000) Nature 404,

11

1

1

1

1

1

11

1

22

2

2

2

2

2

2

2

29. Speck, N. A., and Baltimore, D. (1987) Mol. Cell Biol. 7, 1101–

3

3

3

3

3

333

3

3

4

4

4

4

4

4

4

4

4

Vol. 276, No. 3, 2000 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

355–362.9. Schulze, K. L., Broadie, K., Perin, M. S., and Bellen, H. J. (1995)

Cell 80, 311–320.0. Schulze, K., and Bellen, H. J. (1996) Genetics 144, 1713–1724.1. Broadie, K., Prokop, A., Bellen, H. J., O’Kane, C. J., Schulze,

K. L., and Sweeney, S. T. (1995) Neuron 15, 663–673.2. Dulubova, I., Sugita, S., Hill, S., Hosaka, M., Fernandez, I., dhof,

T. C., and Rizo, J. (1999) EMBO J. 18, 4372–4382.3. Yang, B., Steegmaier, M., Gonzalez, L. C., Jr., and Scheller, R. H.

(2000) J. Cell Biol. 148, 247–252.4. Carr, C. M., Grote, E., Munson, M., Hughson, F. M., and Novick,

P. J. (1999) J. Cell Biol. 146, 333–344.5. Wu, M. N., Littleton, J. T., Bhat, M. A., Prokop, A., and Bellen,

H. J. (1997) EMBO J. 17, 127–139.6. Aalto, M. K., Ruohonen, L., Hosono, K., and Keranen, S. (1991)

Yeast 7, 643–650.7. Aalto, M. K., Keranen, S., and Ronne, H. (1992) Cell 68, 181–182.8. Gerhardt, B., Kordas, T. J., Thompson, C. M., Patel, P., and

Vida, T. (1998) J. Biol. Chem. 273, 15818–15829.9. Cowles, C. R., Emr, S. D., and Horazdovsky, B. F. (1994) J. Cell

Sci. 107(Pt. 12), 3449–3459.0. Halachmi, N., and Lev, Z. (1996) J. Neurochem. 66, 889–897.1. Tellam, J. T., McIntosh, S., and James, D. E. (1995) J. Biol.

Chem. 270, 5857–5863.2. Fujita, Y., Sasaki, T., Fukui, K., Kotani, H., Kimura, T., Hata, Y.,

Sudhof, T. C., Scheller, R. H., and Takai, Y. (1996) J. Biol. Chem.271, 7265–7268.

3. De Vries, K. J., Geijtenbeek, A., Brian, E. C., de Graan, P. N.,Ghijsen, W. E., and Verhage, M. (2000) Eur. J. Neurosci. 12,385–390.

4. Nechushtan, H., Leitges, M., Cohen, C., Kay, G., and Razin, E.(2000) Blood 95, 1752–1757.

5. Quandt, K., Frech, K., Karas, H., Wingender, E., and Werner, T.(1995) Nucleic Acids Res. 23, 4878–4884.

6. Gotoh, K., Yokota, H., Kikuya, E., Watanabe, T., and Oishi, M.(1998) J. Biol. Chem. 273, 21642–21647.

7. Ziegler, S. F., Mortrud, M. T., Swartz, A. R., Baker, E., Suther-land, G. R., Burmeister, M., and Mulligan, J. T. (1996) Genomics37, 19–23.

8. Javahery, R., Khachi, A., Lo, K., Zenzie-Gregory, B., and Smale,S. T. (1994) Mol. Cell Biol. 14, 116–127.

822

1110.0. Roa, M., Paumet, F., Le Mao, J., David, B., and Blank, U. (1997)

J. Immunol. 159, 2815–2823.1. Tellam, J. T., Macaulay, S. L., McIntosh, S., Hewish, D. R.,

Ward, C. W., and James, D. E. (1997) J. Biol. Chem. 272, 6179–6186.

2. Riento, K., Galli, T., Jansson, S., Ehnholm, C., Lehtonen, E., andOlkkonen, V. M. (1998) J. Cell Sci. 111(Pt 17), 2681–2688.

3. Haynes, L. P., Morgan, A., and Burgoyne, R. D. (1999) Biochem.J. 342, 707–714.

4. Shuang, R., Zhang, L., Fletcher, A., Groblewski, G. E., Pevsner,J., and Stuenkel, E. L. (1998) J. Biol. Chem. 273, 4957–4966.

5. Smale, S. T. (1997) Biochim. Biophys. Acta 1351, 73–88.6. Suske, G. (1999) Gene 238, 291–300.7. Philipsen, S., and Suske, G. (1999) Nucleic Acids Res. 27, 2991–

3000.8. Riento, K., Jantti, J., Jansson, S., Hielm, S., Lehtonen, E., Ehn-

holm, C., Keranen, S., and Olkkonen, V. M. (1996) Eur. J. Bio-chem. 239, 638–646.

9. Gaisano, H. Y., Huang, X., Sheu, L., Ghai, M., Newgard, C. B.,Trinh, K. Y., and Trimble, W. S. (1999) Biochem. Biophys. Res.Commun. 260, 781–784.

0. Lehtonen, S., Riento, K., Olkkonen, V. M., and Lehtonen, E.(1999) Kidney Int. 56, 815–826.

1. Jacobsson, G., Bean, A. J., and Meister, B. (1999) Neuroendocri-nology 70, 392–401.

2. Xu, Z.-X., Stenzel, W., Sasic, S. M., Smart, D. A., and Rooney,S. A. (1993) Am. J. Physiol. Lung Cell. Mol. Physiol. 265, L140–L147.

3. Young, P. P., and Mendelson, C. R. (1996) Am. J. Physiol. 271,L287–L299.

4. Gao, E., Wang, Y., Alcorn, J. L., and Mendelson, C. R. (1997)J. Biol. Chem. 272, 23398–23406.

5. Alcorn, J. L., Gao, E., Chen, Q., Smith, M. E., Gerard, R. D., andMendelson, C. R. (1993) Mol. Endocrinol. 7, 1072–1085.

6. Young, P. P., and Mendelson, C. R. (1997) Mol. Endocrinol. 11,1082–1093.

7. Luzi, P., Anceschi, M., and Strayer, D. S. (1995) Gene 165,285–290.

8. Margana, R., Berhane, K., Alam, M. N., and Boggaram, V. (2000)Am. J. Physiol Lung Cell Mol. Physiol 278, L477–L484.