Gene Expression of Leptin and Long Leptin Receptor Isoform in ...

Hindawi Publishing CorporationObstetrics and Gynecology InternationalVolume 2013 Article ID 879618 9 pageshttpdxdoiorg1011552013879618

Clinical StudyGene Expression of Leptin and Long Leptin Receptor Isoform inEndometriosis A Case-Control Study

Andrea Prestes Naacutecul12 Sheila Bunecker Lecke1 Maria Isabel Edelweiss3

Deacutebora Martinho Morsch1 and Poli Mara Spritzer14

1 Gynecological Endocrinology Unit Division of Endocrinology Hospital de Clınicas de Porto Alegre (HCPA)Rua Ramiro Barcelos 2350 90035-003 Porto Alegre RS Brazil

2 Human Reproduction Unit Hospital Femina Grupo Hospitalar Conceicao (GHC) Rua Mostardeiro 1790430-001 Porto Alegre RS Brazil

3 Division of Pathology HCPA Rua Ramiro Barcelos 2350 90035-003 Porto Alegre RS Brazil4 Laboratory of Molecular Endocrinology Department of Physiology Universidade Federal do Rio Grande do Sul (UFRGS)Rua Ramiro Barcelos 2350 90035-003 Porto Alegre RS Brazil

Correspondence should be addressed to Poli Mara Spritzer spritzerufrgsbr

Received 23 December 2012 Revised 12 February 2013 Accepted 14 February 2013

Academic Editor Fernando M Reis

Copyright copy 2013 Andrea Prestes Nacul et al This is an open access article distributed under the Creative Commons AttributionLicense which permits unrestricted use distribution and reproduction in any medium provided the original work is properlycited

In this study leptinBMI ratio in serum and peritoneal fluid and gene expression of leptin and long form leptin receptor (OB-RL) were assessed in eutopic and ectopic endometria of women with endometriosis and controls Increased serum leptinBMIratio was found in endometriosis patients Leptin and OB-RL gene expression was significantly higher in ectopic versus eutopicendometrium of patients and controls A positive significant correlation was observed between leptin and OB-RL transcripts inectopic endometria and also in eutopic endometria in endometriosis and control groups A negative and significant correlationwas found between OB-RL mRNA expression and peritoneal fluid leptinBMI ratio only in endometriosis These data suggest thatthrough a modulatory interaction with its active receptor leptin might play a role in the development of endometrial implants

1 Introduction

Endometriosis is defined as the presence of endometrialglands andor stroma outside the uterus In women withendometriosis the eutopic endometrium has specific char-acteristics that favor tissue survival adhesion and growthoutside the uterine cavity Several studies have demonstratedthat endometriosis is associated with abnormal peritonealand endometrial production of proinflammatory cytokinesand growth and angiogenic factors [1 2]

Leptin a hormone produced mainly by adipocytes isexpressed in endometrium [3] and has been implicatedin the regulation of sex hormone production ovulationendometrial cell physiology and early embryo developmentand implantation [4] It may also play a role in endometrio-sis through its inflammatory and angiogenic properties

Nevertheless studies evaluating serum and peritoneal fluid(PF) levels of leptin in patients with endometriosis reportconflicting results some describe increased levels [2 5ndash10] while others report no differences between patientswith endometriosis and controls [7 11ndash14] Moreover thepossibility of an association between PF leptin levels andseverity of endometriosis is also controversial with somestudies suggesting a negative correlation [2 6 8] and othersshowing a positive correlation with more severe forms ofperitoneal endometriosis [5 7 13 15]

Interestingly only a few studies so far have evaluatedleptin receptor gene andor protein expression in endometrialtissue of women with endometriosis [16ndash18] Lima-Couy etal [16] evaluated the three isoforms of leptin receptormdashtotal (OB-RT) long (OB-RL) and short (HuB2193)mdashin theeutopic endometrium of patients with moderate and severe

2 Obstetrics and Gynecology International

endometriosis Those authors observed increased receptorexpression in the period corresponding to embryo implanta-tion with no difference between patients and controls Someauthors [17 19] have reported expression of leptin receptor inboth eutopic and ectopic endometria

Therefore the aims of the present study were (a) toassess leptin and OB-RL gene expression in ectopic andeutopic endometria of women with endometriosis and ineutopic endometrium of non-endometriosis controls (b) todetermine the leptinBMI ratio in serum and PF in bothgroups (c) to assess the immunoreactive presence of OB-RL in endometrium and endometriotic implants and (d) toinvestigate the relationship among these variables

2 Materials and Methods

21 Subjects The sample was selected among patientsundergoing gynecological laparoscopy for infertility pelvicpain ovarian pathology or tubal ligation (TL) betweenSeptember 2007 and March 2009 Twenty-eight women withpelvic endometriosis and 17 women without laparoscopicallyproven endometriosis or other pelvic pathology were con-secutively selected from this group Infertility was defined asinability to achieve pregnancy after one year of unprotectedsexual intercourse Chronic pelvic pain was defined as non-cyclical pelvic pain of sufficient severity to cause functionaldisability or lead to medical care lasting six months orlonger (American College of Obstetricians and Gynecol-ogists) Endometriosis was confirmed by histology in allpatients with suspected lesions at laparoscopy Endometriosiswas classified according to the revised classification of theAmerican Society of Reproductive Medicine [20] Peritonealendometriotic lesions were observed in all patients andsuperficial ovarian endometrioma was also found in two ofthem

Inclusion criteria were (i) premenopausal status (ii) needfor laparoscopy and (iii) no use of hormonal medication inthe previous three months The sole exclusion criterion wasbody mass index (BMI) above 35 Participants presented nei-ther metabolic comorbidities such as diabetes dyslipidemiaabnormal renal or hepatic function nor clinical evidence ofsystemic diseases or pelvic inflammatory disease The studyprotocol was approved by the Research Ethics Committee atHospital de Clinicas de Porto Alegre (IRB-equivalent) andwritten informed consent was obtained from all subjects

22 Study Protocol All participants underwent physicalexamination including measurement of height and weightand estimation of BMI Laparoscopy with biopsy ofendometriotic implants and a concomitant biopsy of theeutopic endometrium were performed preferentially in thesecond half of the menstrual cycle However in about 20 ofparticipants laparoscopy and biopsy were performed in theproliferative phase A single sample of superficial peritonealendometriotic tissue was obtained from the largest lesionSubcutaneous adipose tissue samples (approximately 1 cc)were also collected from the periumbilical region before theend of the procedure Eutopic endometrial samples were

Table 1 Characteristics of women with endometriosis and normalpelvis controls

Endometriosis Controls119873 28 17Age (years)a 32 plusmn 7 33 plusmn 5BMI (kgm2)a 256 plusmn 45 252 plusmn 35Estradiol (pgmL)

Proliferative 122 (37ndash160) 64 (18ndash144)(119899 = 5) (119899 = 4)

Secretory 104 (56ndash226) 91 (55ndash132)(119899 = 23) (119899 = 13)

Progesterone (ngmL)



aAge and BMI are expressed as mean plusmn SDNo significant difference in age BMI estradiol and progesterone betweenendometriosis and control groups (Studentrsquos 119905-test)BMI body mass index

collected using curettage The same surgeon performed alllaparoscopic evaluations (AN)

Peripheral venous blood samples were collected immedi-ately before anesthetic induction for laparoscopy PF sampleswere collected from the Douglas pouch immediately afterthe start of the procedure All samples were kept on icefor transport to the laboratory and stored in aliquots atminus80∘Cuntil assayed Endometriotic and endometrial samples

were fractioned one portion was immediately frozen inliquid nitrogen and stored at minus80∘C until mRNA extractionwhile the other was fixed in 10 buffered formalin andembedded in paraffin for subsequent histological diagnosisand immunohistochemistry as previously described [21]

Based on histological and laparoscopic findings threetypes of tissue were studied (1) eutopic endometrium fromnonendometriosis controls (2) eutopic endometrium frompatients with endometriosis and (3) ectopic endometriumfrom patients with endometriosis

23 Serum and Peritoneal Fluid Measurements Serum estra-diol and progesterone concentrations were assayed by elec-trochemiluminescence (Roche Diagnostic Mannheim Ger-many) Serum and peritoneal leptin levels were determinedusing a Human Leptin ELISA kit (LINCO Research StCharles MO USA)

24 RNA Isolation Endometrial and adipose tissue totalRNA extraction was carried out in phenolguanidine isoth-iocyanate (Trizol Invitrogen Life Technologies Foster CityCAUSA) as previously described [21 22] Concentration andquality of total RNA were assessed using a GeneQuant spec-trophotometer (Pharmacia Biotech Cambridge England)

25 Real-Time Reverse Transcription-Polymerase Chain Reac-tion (RT-PCR) Protocol Reverse transcription of 1 120583g of

Obstetrics and Gynecology International 3

0

1

2

3

4

5

lowastlowast

lowast

mRN

A in

endo

met

rium

(119899- fo

ld ch

ange

)

Ectopic endometrium Eutopic endometrium

LeptinOB-RL

(a)

0

1

2

3

4

5

6

7

8

Control Minimalmild ModeratesevereLe

ptin

mRN

A in

endo

met

rium

(

lowastlowast

lowast

119899- fo

ld ch

ange

)

(b)

0

1

2

3

4

5

Control Minimalmild Moderatesevere

lowastlowast

lowastlowastlowast

mRN

A in

endo

met

rium

(O

B-R L

119899- fo

ld ch

ange

)

(c)

Figure 1 Leptin and long leptin receptor isoform (OB-RL) gene expression in endometriosis (a) Ectopic endometrium and eutopicendometrium of patients with endometriosis Values are expressed as n-fold difference in relation to the calibrator sample (ΔΔCt method)lowastlowast119875 lt 0001 (leptin mRNA ectopic versus eutopic endometrium) lowast119875 lt 005 (OB-RL mRNA ectopic versus eutopic endometrium) (Wilcoxon

signed-rank test) (b) Leptin gene expression and (c) long leptin receptor isoform (OB-RL) in eutopic endometrium of non-endometriosiscontrols and ectopic endometrium of minimalmild andmoderatesevere endometriosis Values are expressed as n-fold difference in relationto the calibrator sample (ΔΔCt method) Asterisks indicate significant difference in comparison to controls lowast119875 lt 005 lowastlowast119875 lt 001 andlowastlowastlowast119875 lt 0001 (Mann-Whitney U)

total RNA into cDNA was carried out using the SuperscriptII First-Strand Synthesis System for RT-PCR (InvitrogenLife Technologies Foster City CA USA) according to themanufacturerrsquos instructions in a PCT-100 ProgrammableThermal Controller (MJ Research Inc Watham MAUSA)

Real-time PCR was performed in triplicate in a 7500Fast real-time PCR System thermal cycler with 7500 FastSystem Sequence Detection 14 Software (Applied Biosys-tems Foster City CA USA) Experiments were performedby monitoring in real time the increase in fluorescence ofthe SYBRGreen dye as previously described [23ndash25] Primers


(a) (b)

(c) (d)

Figure 2 Immunostaining of long leptin receptor isoform (OB-RL) in eutopic endometrium (a) Non-endometriosis controls (b) eutopicand (c) ectopic endometria of patients with endometriosis and (d) positive control (choroid plexus) Original magnification 400x

were designed by Primer Express 30 Software for real-time PCR (Applied Biosystems Foster City CA USA) andacquired from Invitrogen (Life Technologies Foster CityCA USA) Primer sequences were designed to target twoexons of an mRNA sequence with respect to known splicevariants and single-nucleotide polymorphism positions Theforward and reverse primer sequences designed for lep-tin (NM 0002302) were (51015840 to 31015840) TCCCCTCTTGACC-CATCTC andGGGAACCTTGTTCTGGTCAT respectivelyThese primers anneal between residues 858 to 876 (forward)and 967 to 948 (reverse) producing a PCR product of110 bp The forward and reverse primer sequences for leptinreceptor (NM 0010036792) were (51015840 to 31015840) AGGAAGC-CCGAAGTTGTGTT and TCTGGTCCCGTCAATCTGArespectively These primers anneal between residues 3617 to3636 (forward) and 3716 to 3698 (reverse) resulting in anamplicon of 100 bp Beta-2 microglobulin (NM 0040482)was used to normalizemRNAquantitation CTATCCAGCG-TACTCCAAAG and ACAAGTCTGAATGCTCCACT (51015840to 31015840) forward and reverse B2M primer sequences annealbetween residues 119 to 138 (forward) and 283 to 264(reverse) resulting in an amplicon of 165 bp cDNA samples(10 ng120583L) were mixed with a predetermined forward andreverse primer volume (09 and 07 120583L for leptin 09 and

03 120583L for leptin receptor and 07 and 09 120583L for B2M)and 125 120583L of 2X Fast SYBR Green Master Mix (AppliedBiosystems FosterCity CAUSA) in a total of 25 120583L Protocolconditions consisted of denaturation at 94∘C for two minutesfollowed by 50 cycles (30 s at 94∘C and 30 s at 60∘C)Primers generated amplicons that produced a single sharppeak during melting curve analysis Data were analyzed byrelative quantitation using the comparative CT method [26]Validation assays for endometrium and adipose tissue wereperformed by amplification of the target and reference genesseparately using serial dilutions of an mRNA sample Bothtarget and reference mRNAs exhibited equal amplificationefficiency The ΔΔCT method calculates changes in geneexpression as relative fold difference between an experimen-tal and calibrator sample correcting nonideal amplificationefficiencies [27]

26 Immunohistochemistry Formalin-fixed paraffin-embed-ded endometrial samples were cut into 5 120583m slices whichwere stained by immunohistochemistry using the avidin-biotin-peroxidase method [28] as previously described [2930] Following deparaffinization and rehydration with a


Table 2 Serum and peritoneal fluid leptinBMI ratio according to stage of endometriosis

Controls Endometriosis 119875rASRM

119875a

Stage III Stage IIIIV041 061 056 078

SerumleptinBMI (022ndash071) (041ndash095) 004 (028ndash099) (043ndash096) 008

119899 = 17 119899 = 28 119899 = 13 119899 = 15

Peritoneal fluid 044 07 054 071leptinBMI (028ndash073) (045ndash118) 007 (028ndash136) (059ndash115) 012

119899 = 17 119899 = 23 119899 = 12 119899 = 11

Data are presented as median and interquartile range (Mann-Whitney)aControls versus rASRM stage III versus rASRM stage IIIIV (Kruskal-Wallis)rASRM stages revised American Society for Reproductive Medicine classification (15)

graded series of ethanol immunohistochemistry was per-formed using peroxidase reaction Sections were incubatedwith 3 H

2O2at room temperature for five minutes in order

to suppress endogenous peroxidase activityThe sampleswerethen incubated in a humidity chamber at room temperaturefor 30minutes with a 05 120583gmLgoat antihuman leptin recep-tor antibody C20 (Santa Cruz Biotechnology Santa CruzCA USA) Phosphate-buffered saline (PBS) containing 05bovine serum albumin (wv) replaced the primary antibodyin negative controls Samples of the choroid plexus wereused as positive controls After 20-minute incubation withthe linker streptavidin-peroxidase was used for five minutesto stain the slices Subsequent to each incubation step thetissues were washed three times with PBS 50mM TrisndashHClbuffer Slices were counterstained with Mayerrsquos hematoxylinand mounted A positive reaction was characterized by thepresence of granular brown staining in the cytoplasm Theintensity of immunostaining in epithelium and stroma wasevaluated by two independent observers and classified asnegative weak moderate or intense and converted intoarbitrary units on a semiquantitative scale of 0 to 3 [31]

27 Statistical Analysis The sample size for detecting signif-icant differences in serum leptin levels was estimated as 12women with endometriosis and 12 controls based on thestudy by Matarese et al [2] and considering a power of80 and alpha of 5 Data are presented as mean plusmn SD ormedian and interquartile range Comparisons between groupmeans were analyzed by Studentrsquos t-test Median values werecompared using the Mann-Whitney U test Comparisons ofmedian values involving three groupswere analyzed using theKruskal-Wallis test The chi-square test was used to comparequalitative variables Pearsonrsquos rank or Spearmanrsquos correlationcoefficients were calculated using a two-tailed significancetest for variables with a Gaussian or non-Gaussian distribu-tion respectively The nonparametric Wilcoxon signed-ranktest was used if required based on the number of subjects andthe nonhomogeneous features of each groupThe gamma testwas used for qualitative comparison ofmore than two groups

All analyses were performed using the Statistical Packagefor the Social Sciences 16 (SPSS Chicago IL USA) Data wereconsidered significant at 119875 lt 005

3 Results

Participants age ranged from 21 to 50 years In one nonen-dometriosis control endometrial biopsy was of insufficientquality for interpretation Therefore the results of geneexpression and immunohistochemistry refer to data from 28patients with endometriosis and 16 controls

Endometriosis was classified as stage I (minimal) in 13patients stage III (moderate) in six and stage IV (severe) innine Laparoscopy was performed for infertility investigationin 15 patients (333) tubal ligation in 13 (28) chronicpelvic pain in nine (20) adnexal pathology in five (11)association of infertility and chronic pelvic pain in two(45) and association of tubal ligation and chronic pelvicpain in one (22) patient Table 1 presents the clinical profileof the endometriosis and control groups Circulating levels ofestradiol and progesterone in the proliferative and secretoryphases of the menstrual cycle in each group also appearin Table 1 While progesterone levels were higher in thesecretory than in the proliferative phase no differences wereobserved in estradiol and progesterone levels between theendometriosis and control groups Serum leptinBMI ratiowas similar in the proliferative and secretory phases of thecycle in the endometriosis (056 (027ndash124) versus 061 (041ndash091) resp 119875 = 097) and control (033 (021ndash053) versus037 (018ndash068) resp 119875 = 077) groups PF leptinBMIratio was also found to be similar in the proliferative andsecretory phases in the endometriosis (115 (035ndash197) versus062 (039ndash104) resp 119875 = 064) and control (046 (012ndash072)versus 039 (026ndash074) resp 119875 = 073) groups Thereforeposterior analyses were performed including all patientswithout considering the cycle phase

As shown in Table 2 the serum leptinBMI ratio wassignificantly higher in the endometriosis group than incontrols A trend toward significantly higher PF leptinBMIratio was also observed in the endometriosis group (119875 =007) There were no significant differences in serum and PFleptinBMI ratio when controls were compared to patientswith minimalmild or moderatesevere endometriosis

Leptin mRNA and OB-RL were detectable in all sam-ples of ectopic endometrium In the eutopic endometriaof patients and controls leptin mRNA and OB-RL were


detectable in 25 out of 28 and 16 out of 17 tested samples(89 and 94 resp) Figure 1(a) shows that leptin mRNAexpression was significantly higher in ectopic lesions thanin the eutopic endometrium of patients with endometriosis(119875 lt 0001) OB-RL mRNA expression was also signifi-cantly higher in ectopic lesions as compared to the eutopicendometrium of the endometriosis group (119875 lt 005)

Leptin (Figure 1(b)) and OB-RL mRNA (Figure 1(c))expressions were also significantly higher in ectopicendometrium when endometriosis patients were stratifiedinto minimalmild and moderatesevere endometriosisgroups as compared to the eutopic endometrium of non-endometriosis controls Conversely no differences werefound between endometriosis stages Leptin and OB-RLtranscripts were also similar in the eutopic endometriaof patients with endometriosis and controls (data notshown) In addition no differences were found in leptinand OB-RL gene expression in subcutaneous fat samples ofnonendometriosis controls (leptin mRNA 195 (145ndash234)and OB-RL mRNA 235 (202ndash257)) and samples of patientswith endometriosis (221 (158ndash284) and 213 (198ndash267)resp)

A positive and significant correlation was observedbetween leptin and OB-RL transcripts in the ectopicendometrium of patients with endometriosis (119877 = 057 119875 lt001) and in the eutopic endometrium of both endometriosisand control participants (endometriosis 119877 = 052 119875 lt 001nonendometriosis controls 119877 = 057 119875 lt 002)

Figure 2 shows immunostaining of OB-R119871in representa-

tive biopsies of eutopic endometrium from the control andendometriosis groups in representative biopsies of ectopicendometrium and in positive control samples of the choroidplexus Cytoplasmic staining was observed in both the stro-mal and epithelial compartments of women with differentstages of endometriosis and controls Intensity of OB-RLimmunostaining in moderatesevere endometriosis sampleswas similar to the OB-RL immunostaining of minimalmildendometriosis samples for both epithelial (119875 = 0153gamma test) and stromal cells (119875 = 0767 gamma test)

A negative and significant correlation was observedbetween OB-RL transcripts and PF leptinBMI ratio inectopic endometrium (119877 = minus049 119875 = 0019 Spear-manrsquos correlation) This was not observed in the eutopicendometrium of controls (119877 = 006 119875 = 08)

4 Discussion

In the present study we found a significantly higher serumleptinBMI ratio in the endometriosis group as well as asignificantly higher expression of leptin and OB-RL tran-scripts in the ectopic endometrium compared to the eutopicendometrium of patients with endometriosis and normalpelvis controls These results suggest a putative role of leptinin the development of endometrial implants

Despite the strong relationship between leptin and BMIonly a few studies have analyzed the leptinBMI ratio insteadof leptin concentrations in women with endometriosis [1332] Using the leptinBMI ratio allowed us to control the

influence of individual body weight on leptin secretion thusincreasing the accuracy of results

In the present study we found a trend toward higherlevels PF leptinBMI ratio in the presence of endometriosisSome investigators have also reported higher PF leptin inwomen with endometriosis as compared to controls [2 6 910 12] Concerning the severity of endometriosis whereasthis aspect was not correlated with serum and PF leptinBMIratio in the present study it was inversely correlated with PFleptin levels in the study by Mahutte et al [8] Wertel et al[13] Bedaiwy et al [5] and Gungor et al [7] found a positivecorrelation between endometriosis severity and leptin levelswhile Barcz et al [11] did not observe any correlation Suchdiscrepancies are not surprising given the fact that thesestudies differ widely with regard to patient characteristics(including age BMI and endometriosis severity) endpointsand stratification (or not) of the primary endometriotic lesionby anatomical location Nevertheless despite the specificitiesof each study all seem to indicate (at least with the currentcommercially available kits) that PF leptin alone is not agood marker to screen for the presence location or severityof endometriosis In fact recent studies have shown thatcombining the serum concentration of various proteins thatare differentially expressed in women with and withoutendometriosis including leptin would greatly increase diag-nostic accuracy as compared to assaying each protein alone[33 34]

Concerning the associations between leptin levels andgene expression and the menstrual cycle phases our resultsare consistent with previous findings that showed no sig-nificant differences in leptin levels between follicular andluteal phases [5 6] Previous studies have shown higher leptinexpression during the implantation period [16] and total andlong-form leptin receptor gene expression throughout themenstrual cycle with increased expression in the early lutealphase [3] In the present study laparoscopies were scheduledpreferentially in the secretory phase in order to evaluate theassociation between leptin and endometrial differentiationrather than proliferation However because some partici-pants had their samples collected in the proliferative phasewe observed that serum and PF leptinBMI ratios were com-parable in the two phases in both endometriosis and controlparticipants In addition the estradiol andprogesterone levelsrecorded in each cycle phase (proliferative or secretory) weresimilar in endometriosis patients and controls

It should be noted that our control group did not includestrictly normal women but rather patients without pelvic dis-ease at laparoscopic inspection Some previous studies haveinvestigated the association between leptin infertility andchronic pelvic pain Wertel et al [13] have shown that serumand peritoneal fluid concentrations of leptin were similar infertile and infertile patients with endometriosis as well as inpatients with unexplained infertility and tubal ligation Tao etal [14] also found no difference in peritoneal fluid leptin lev-els of patients with endometriosis and infertility compared toa group with fallopian-associated infertility and controls withmyoma According to Barcz et al [11] infertile patients hadhigher leptin levels than patients with chronic pelvic painregardless of the presence of endometriosis However fertility


was not tested in all patients with chronic pelvic pain in thatstudy Bedaiwy et al [5] observed higher peritoneal fluidleptin levels in patients with endometriosis versus patientswith unexplained infertility or those undergoing laparoscopyfor tubal ligation or reversal of tubal ligation There was nodifference in leptin levels between the unexplained infertilityand tubal ligationreversal of tubal ligation groups In asubgroup of endometriosis patients presenting pelvic paina positive correlation was found between peritoneal fluidleptin concentration and severity of symptoms except wheninfertility was the main presenting symptom Thus thepresence of infertility associated with endometriosis does notseem to influence leptin concentrations but leptin mightplay a role in thepathophysiology of pain associated withendometriosis It is important to note that in our study68 of patients underwent laparoscopy for tubal ligationThese patients had a laparoscopically normal pelvis and weresymptomfree Five patients complained of infertility andonly two reported pelvic pain All suspicious lesions wereevaluated by histopathology Thus our control group may beregarded as adequate for the purpose of this study

We observed that expression of leptin and OB-RL tran-scripts was significantly higher in ectopic versus eutopicendometrium of patients with endometriosis and normalpelvis controls In addition we detected leptin mRNA inalmost all eutopic and ectopic endometrium samples afinding that might be attributable at least in part to themethod used in our study as real-time RT-PCR is moresensitive to smaller amounts of mRNA

Our choice to analyze only the long form of the leptinreceptor was based on the evidence that this isoform has thehighest transcriptional activity [35] Lima-Couy et al [16]assessed the total long and short isoforms of leptin receptorin eutopic endometrium of patients with moderate andsevere endometriosis and observed an increase in receptorexpression during the period of embryo implantation withno differences between eutopic endometrium from patientswith endometriosis and controls

Other authors have identified leptin andOB-R transcriptsin eutopic endometrium Kitawaki et al [3] identified thelong form of the receptor in 84 of endometrial samplesversus 85 in our study including eutopic endometria ofpatients and controls In an in vitro study Gonzalez et al [36]demonstrated that the presence of leptin and leptin receptormRNA in endometrial epithelial cells and embryos could berelated to the embryo implantation process Kitawaki et al[3] also showed fluctuations in the expression of OB-R inendometrium with a peak in the early secretory phase

OB-RL mRNA expression was negatively correlated withPF leptinBMI ratio in ectopic endometrium This observa-tion is in agreement with a previous study which found thattreatment of stromal cell cultures with leptin reduces OB-RL[17] suggesting modulation between leptin and its receptorin endometriosis Later the same authors demonstratedthat under hypoxic conditions leptin gene expression wasincreased in both eutopic and ectopic endometrial stromalcells and that this process is likely to be mediated directlyby hypoxia-inducible factor-1120572 (HIF-1120572) Considering that

leptin may promote cell proliferation a low-oxygen environ-ment in endometriotic implants could lead to stimulationof leptin gene expression increasing the proliferation ofendometrial stromal cells with subsequent implantation ofthese cells in the peritoneum [18] Our finding of a signifi-cant negative correlation between OB-RL mRNA expressionand peritoneal fluid leptinBMI ratio in endometriosis alsosuggests that peritoneal fluid leptinBMI ratio might havegreater influence on the molecular regulation of OB-RLreceptor than the circulating leptinBMI ratio However theexperimental design of the present study does not allow us toconfirm this possibility Further in vitro studies are neededin order to determine the effect of different leptin concen-trations on OB-RL gene expression in isolated endometrioticcells

Leptin is thought to play a role in endometriosis throughits inflammatory and angiogenic properties Using a ratmodel of endometriosis Styer et al [37] demonstratedthat disruption of leptin signaling by administration ofthe pegylated leptin peptide receptor antagonist (LPrA) ornonfunctional leptin receptor (LeprdB) inhibits the estab-lishment and development of endometriosis-like lesions thatresemble peritoneal endometriotic foci The administrationof recombinant VEFG to these animals led to an increasein the formation of endometrial glands however at a lowerdensity in relation to controls Therefore leptin signalingseems to be a necessary component of lesion proliferationinitial vascular recruitment and maintenance of neoangio-genesis in a murine model of endometriosis Recently Ohet al [19] showed in an in vitro model of cell culture fromendometrioma and endometrial tissues of women withoutendometriosis that the expression of leptin receptor wassignificantly higher in endometriotic epithelial cells thanin epithelial and stromal cells of the normal endometriumor in endometriotic stromal cells In addition leptin treat-ment stimulated the proliferation of only endometrioticepithelial cells In contrast inhibition of JAK2STAT3 andERK signaling pathways of the leptin receptor induced ablockage of growth in these endometriotic epithelial cellsthrough leptin stimulation The increase in leptin and leptinreceptor expression in the ectopic endometrium of womenwith endometriosis may lead to increased leptin signalingin implants resulting in proliferation neoangiogenesis andmaintenance of ectopic endometrial tissue [37]

The higher serum leptinBMI ratio observed in theendometriosis group as compared to the control group maybe due to endometriotic implants rather than adipose tissuesince leptin and OB-RL transcripts were similar in the fattissue of endometriosis and control participants

We were unable to confirm previous findings reportingmore elevated PF leptin in milder disease [2 6 8] Howeverthe biological activity of the disease might be related to typerather than extent of lesion In this sense Gazvani et al[38] showed that red lesions are more biologically activethan white or black lesions Further studies are needed tospecifically study the relationships between leptin and itsreceptor transcripts according to the type of lesions found atlaparoscopy


One limitation of our study concerns the purity of cellpopulations in the ectopic endometrium samples Tissuesobtained from lesions contain a mixture of cell types includ-ing leukocytes and peritoneal fibroblasts in addition toectopic endometrium [39] Thus there is a small risk thatperitoneal cells may account for some of the results observed

5 Conclusions

The present data suggest that serum leptinBMI ratio isassociated with the presence of endometriosis Neverthelessthe clinical applicability of the leptinBMI ratio for predic-tion of endometriosis still requires confirmation Moreoverthe increased expression of leptin and OB-RL in ectopicendometrium suggests a modulatory interaction betweenleptin and its active receptor and a role of leptin aninflammatory and angiogenic cytokine in the initiation ordevelopment of endometrial implants

Conflict of Interests

The authors declare that they have no conflict of interests

Acknowledgments

This work was supported by grants from Conselho Nacionalde Desenvolvimento Cientıfico e Tecnologico (CNPq INCT5737472008-3) and Fundo de Apoio a Pesquisa do Hospitalde Clınicas de Porto Alegre (FIPE-HCPA 07-339) Brazil

References

[1] R Gazvani and A Templeton ldquoPeritoneal environmentcytokines and angiogenesis in the pathophysiology ofendometriosisrdquo Reproduction vol 123 no 2 pp 217ndash2262002

[2] G Matarese C Alviggi V Sanna et al ldquoIncreased lep-tin levels in serum and peritoneal fluid of patients withpelvic endometriosisrdquo Journal of Clinical Endocrinology andMetabolism vol 85 no 7 pp 2483ndash2487 2000

[3] J Kitawaki H Koshiba H Ishihara I Kusuki K Tsukamotoand H Honjo ldquoExpression of leptin receptor in humanendometrium and fluctuation during the menstrual cyclerdquoJournal of Clinical Endocrinology and Metabolism vol 85 no5 pp 1946ndash1950 2000

[4] M Mitchell D T Armstrong R L Robker and R J Nor-man ldquoAdipokines implications for female fertility and obesityrdquoReproduction vol 130 no 5 pp 583ndash597 2005

[5] M A Bedaiwy T Falcone J M Goldberg R K Sharma D RNelson and A Agarwal ldquoPeritoneal fluid leptin is associatedwith chronic pelvic pain but not infertility in endometriosispatientsrdquoHuman Reproduction vol 21 no 3 pp 788ndash791 2006

[6] G De Placido C Alviggi C Carravetta et al ldquoThe peritonealfluid concentration of leptin is increased in women with peri-toneal but not ovarian endometriosisrdquo Human Reproductionvol 16 no 6 pp 1251ndash1254 2001

[7] T Gungor M Kanat-Pektas R Karayalcin and L Mollamah-mutoglu ldquoPeritoneal fluid and serum leptin concentrations inwomen with primary infertilityrdquo Archives of Gynecology andObstetrics vol 279 no 3 pp 361ndash364 2009

[8] N G Mahutte I M Matalliotakis A G Goumenou S Vas-siliadis G E Koumantnakis and A Arici ldquoInverse correlationbetween peritoneal fluid leptin concentrations and the extent ofendometriosisrdquo Human Reproduction vol 18 no 6 pp 1205ndash1209 2003

[9] N Pandey A Kriplani R K Yadav B T Lyngdoh and SC Mahapatra ldquoPeritoneal fluid leptin levels are increased butadiponectin levels are not changed in infertile patients withpelvic endometriosisrdquo Gynecological Endocrinology vol 26 no11 pp 843ndash849 2010

[10] M H Wu M F Huang F M Chang and S J Tsai ldquoLeptinon peritoneal macrophages of patients with endometriosisrdquoAmerican Journal of Reproductive Immunology vol 63 no 3 pp214ndash221 2010

[11] E Barcz Ł Milewski D Radomski et al ldquoA relationshipbetween increased peritoneal leptin levels and infertility inendometriosisrdquo Gynecological Endocrinology vol 24 no 9 pp526ndash530 2008

[12] P Vigano E Somigliana R Matrone et al ldquoSerum leptin con-centrations in endometriosisrdquo Journal of Clinical Endocrinologyand Metabolism vol 87 no 3 pp 1085ndash1087 2002

[13] I Wertel M Gogacz G Polak J Jakowicki and JKotarski ldquoLeptin is not involved in the pathophysiologyof endometriosis-related infertilityrdquo European Journal ofObstetrics Gynecology and Reproductive Biology vol 119 no 2pp 206ndash209 2005

[14] Y Tao Q Zhang W Huang H Zhu D Zhang and W LuoldquoThe peritoneal leptin MCP-1 and TNF-120572 in the pathogenesisof endometriosis-associated infertilityrdquo American Journal ofReproductive Immunology vol 65 no 4 pp 403ndash406 2011

[15] Ł Milewski E Barcz P Dziunycz et al ldquoAssociation of leptinwith inflammatory cytokines and lymphocyte subpopulationsin peritoneal fluid of patients with endometriosisrdquo Journal ofReproductive Immunology vol 79 no 1 pp 111ndash117 2008

[16] I Lima-Couy A Cervero F Bonilla-Musoles A Pellicer andC Simon ldquoEndometrial leptin and leptin receptor expressionin women with severemoderate endometriosisrdquo MolecularHuman Reproduction vol 10 no 11 pp 777ndash782 2004

[17] M H Wu P C Chuang H M Chen C C Lin and S J TsaildquoIncreased leptin expression in endometriosis cells is associatedwith endometrial stromal cell proliferation and leptin gene up-regulationrdquo Molecular Human Reproduction vol 8 no 5 pp456ndash464 2002

[18] M H Wu K F Chen S C Lin C W Lgu and S J TsaildquoAberrant expression of leptin in human endometriotic stromalcells is induced by elevated levels of hypoxia inducible factor-1120572rdquo American Journal of Pathology vol 170 no 2 pp 590ndash5982007

[19] H K Oh Y S Choi Y I Yang J H Kim P C Leungand J H Choi ldquoLeptin receptor is induced in endometriosisand leptin stimulates the growth of endometriotic epithelialcells through the JAK2STAT3 and ERK pathwaysrdquo MolecularHuman Reproduction vol 19 no 3 pp 160ndash168 2013

[20] M Canis J G Donnez D S Guzick et al ldquoRevisedAmerican Society for Reproductive Medicine classification ofendometriosis 1996rdquo Fertility and Sterility vol 67 no 5 pp817ndash821 1997

[21] D M Morsch M M Carneiro S B Lecke et al ldquoC-fos geneand protein expression in pelvic endometriosis a local markerof estrogen actionrdquo Journal of Molecular Histology vol 40 no1 pp 53ndash58 2009


[22] I O Oliveira C Lhullier I S Brum and P M Spritzer ldquoGeneexpression of type 2 17120573 hydroxysteroid dehydrogenase in scalphairs of hirsute womenrdquo Steroids vol 68 no 7-8 pp 641ndash6492003

[23] R Higuchi G Dollinger P S Walsh and R Griffith ldquoSimulta-neous amplification and detection of specific DNA sequencesrdquoBioTechnology vol 10 no 4 pp 413ndash417 1992

[24] R Higuchi C Fockler G Dollinger and R Watson ldquoKineticPCR analysis real-time monitoring of DNA amplificationreactionsrdquo BioTechnology vol 11 no 9 pp 1026ndash1030 1993

[25] H Zipper H Brunner J Bernhagen and F Vitzthum ldquoInves-tigations on DNA intercalation and surface binding by SYBRGreen I its structure determination and methodological impli-cationsrdquoNucleic Acids Research vol 32 no 12 article e103 2004

[26] ldquoRelative quantitation of gene expression experimental designand analysis relative standard curve method and comparativeCt method (ΔΔ119862119879)rdquo 2004 httpwww3appliedbiosystemscomcmsgroupsmcb supportdocumentsgeneraldocumentscms 042380pdf

[27] K J Livak and T D Schmittgen ldquoAnalysis of relative geneexpression data using real-time quantitative PCR and the 2-ΔΔCT methodrdquoMethods vol 25 no 4 pp 402ndash408 2001

[28] S M Hsu and L Raine ldquoProtein A avidin and biotin inimmunohistochemistryrdquo Journal of Histochemistry and Cyto-chemistry vol 29 no 11 pp 1349ndash1353 1981

[29] F M Reis A L Maia M F M Ribeiro and P M SpritzerldquoProgestin modulation of c-fos and prolactin gene expressionthe human endometriumrdquo Fertility and Sterility vol 71 no 6pp 1125ndash1132 1999

[30] P M Spritzer M F M Ribeiro M C Oliveira et al ldquoEffects oftamoxifen on serum prolactin levels pituitary immunoreactiveprolactin cells and uterine growth in estradiol-treated ovariec-tomized ratsrdquo Hormone and Metabolic Research vol 28 no 4pp 171ndash176 1996

[31] F M Reis M F M Ribeiro A L Maia and P M SpritzerldquoRegulation of human endometrial transforming growth factor1205731 and 1205733 isoforms through menstrual cycle and medroxypro-gesterone acetate treatmentrdquo Histology and Histopathology vol17 no 3 pp 739ndash745 2002

[32] C Alviggi R Clarizia G Castaldo et al ldquoLeptin concentrationsin the peritoneal fluid of womenwith ovarian endometriosis aredifferent according to the presence of a ldquodeeprdquo or ldquosuperficialrdquoovarian diseaserdquo Gynecological Endocrinology vol 25 no 9 pp610ndash615 2009

[33] B Seeber M D Sammel X Fan et al ldquoPanel of markerscan accurately predict endometriosis in a subset of patientsrdquoFertility and Sterility vol 89 no 5 pp 1073ndash1081 2008

[34] B Seeber M D Sammel X Fan et al ldquoProteomic analysisof serum yields six candidate proteins that are differentiallyregulated in a subset of women with endometriosisrdquo Fertilityand Sterility vol 93 no 7 pp 2137ndash2144 2010

[35] J A Cioffi A W Shafer T J Zupancic et al ldquoNovel B219OBreceptor isoforms possible role of leptin in hematopoiesis andreproductionrdquoNature Medicine vol 2 no 5 pp 585ndash588 1996

[36] R R Gonzalez P Caballero-Campo M Jasper et al ldquoLeptinand leptin receptor are expressed in the human endometriumand endometrial leptin secretion is regulated by the humanblastocystrdquo Journal of Clinical Endocrinology and Metabolismvol 85 no 12 pp 4883ndash4888 2000

[37] A K Styer B T Sullivan M Puder et al ldquoAblation ofleptin signaling disrupts the establishment development and

maintenance of endometriosis-like lesions in a murine modelrdquoEndocrinology vol 149 no 2 pp 506ndash514 2008

[38] M Rafet Gazvani S Christmas S Quenby J Kirwan P MJohnson and C R Kingsland ldquoPeritoneal fluid concentrationsof interleukin-8 in women with endometriosis relationship tostage of diseaserdquo Human Reproduction vol 13 no 7 pp 1957ndash1961 1998

[39] J N Bulmer R K Jones and R F Searle ldquoIntraepithelialleukocytes in endometriosis and adenomyosis comparison ofeutopic and ectopic endometrium with normal endometriumrdquoHuman Reproduction vol 13 no 10 pp 2910ndash2915 1998

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014


MEDIATORSINFLAMMATION

of


Behavioural Neurology

EndocrinologyInternational Journal of



Disease Markers


BioMed Research International

OncologyJournal of



Oxidative Medicine and Cellular Longevity


PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of



Computational and Mathematical Methods in Medicine

OphthalmologyJournal of


Diabetes ResearchJournal of



Research and TreatmentAIDS


Gastroenterology Research and Practice


Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom


endometriosis Those authors observed increased receptorexpression in the period corresponding to embryo implanta-tion with no difference between patients and controls Someauthors [17 19] have reported expression of leptin receptor inboth eutopic and ectopic endometria

Therefore the aims of the present study were (a) toassess leptin and OB-RL gene expression in ectopic andeutopic endometria of women with endometriosis and ineutopic endometrium of non-endometriosis controls (b) todetermine the leptinBMI ratio in serum and PF in bothgroups (c) to assess the immunoreactive presence of OB-RL in endometrium and endometriotic implants and (d) toinvestigate the relationship among these variables

2 Materials and Methods

21 Subjects The sample was selected among patientsundergoing gynecological laparoscopy for infertility pelvicpain ovarian pathology or tubal ligation (TL) betweenSeptember 2007 and March 2009 Twenty-eight women withpelvic endometriosis and 17 women without laparoscopicallyproven endometriosis or other pelvic pathology were con-secutively selected from this group Infertility was defined asinability to achieve pregnancy after one year of unprotectedsexual intercourse Chronic pelvic pain was defined as non-cyclical pelvic pain of sufficient severity to cause functionaldisability or lead to medical care lasting six months orlonger (American College of Obstetricians and Gynecol-ogists) Endometriosis was confirmed by histology in allpatients with suspected lesions at laparoscopy Endometriosiswas classified according to the revised classification of theAmerican Society of Reproductive Medicine [20] Peritonealendometriotic lesions were observed in all patients andsuperficial ovarian endometrioma was also found in two ofthem

Inclusion criteria were (i) premenopausal status (ii) needfor laparoscopy and (iii) no use of hormonal medication inthe previous three months The sole exclusion criterion wasbody mass index (BMI) above 35 Participants presented nei-ther metabolic comorbidities such as diabetes dyslipidemiaabnormal renal or hepatic function nor clinical evidence ofsystemic diseases or pelvic inflammatory disease The studyprotocol was approved by the Research Ethics Committee atHospital de Clinicas de Porto Alegre (IRB-equivalent) andwritten informed consent was obtained from all subjects

22 Study Protocol All participants underwent physicalexamination including measurement of height and weightand estimation of BMI Laparoscopy with biopsy ofendometriotic implants and a concomitant biopsy of theeutopic endometrium were performed preferentially in thesecond half of the menstrual cycle However in about 20 ofparticipants laparoscopy and biopsy were performed in theproliferative phase A single sample of superficial peritonealendometriotic tissue was obtained from the largest lesionSubcutaneous adipose tissue samples (approximately 1 cc)were also collected from the periumbilical region before theend of the procedure Eutopic endometrial samples were

Table 1 Characteristics of women with endometriosis and normalpelvis controls

Endometriosis Controls119873 28 17Age (years)a 32 plusmn 7 33 plusmn 5BMI (kgm2)a 256 plusmn 45 252 plusmn 35Estradiol (pgmL)



Progesterone (ngmL)



aAge and BMI are expressed as mean plusmn SDNo significant difference in age BMI estradiol and progesterone betweenendometriosis and control groups (Studentrsquos 119905-test)BMI body mass index

collected using curettage The same surgeon performed alllaparoscopic evaluations (AN)

Peripheral venous blood samples were collected immedi-ately before anesthetic induction for laparoscopy PF sampleswere collected from the Douglas pouch immediately afterthe start of the procedure All samples were kept on icefor transport to the laboratory and stored in aliquots atminus80∘Cuntil assayed Endometriotic and endometrial samples

were fractioned one portion was immediately frozen inliquid nitrogen and stored at minus80∘C until mRNA extractionwhile the other was fixed in 10 buffered formalin andembedded in paraffin for subsequent histological diagnosisand immunohistochemistry as previously described [21]

Based on histological and laparoscopic findings threetypes of tissue were studied (1) eutopic endometrium fromnonendometriosis controls (2) eutopic endometrium frompatients with endometriosis and (3) ectopic endometriumfrom patients with endometriosis

23 Serum and Peritoneal Fluid Measurements Serum estra-diol and progesterone concentrations were assayed by elec-trochemiluminescence (Roche Diagnostic Mannheim Ger-many) Serum and peritoneal leptin levels were determinedusing a Human Leptin ELISA kit (LINCO Research StCharles MO USA)

24 RNA Isolation Endometrial and adipose tissue totalRNA extraction was carried out in phenolguanidine isoth-iocyanate (Trizol Invitrogen Life Technologies Foster CityCAUSA) as previously described [21 22] Concentration andquality of total RNA were assessed using a GeneQuant spec-trophotometer (Pharmacia Biotech Cambridge England)

25 Real-Time Reverse Transcription-Polymerase Chain Reac-tion (RT-PCR) Protocol Reverse transcription of 1 120583g of


0

1

2

3

4

5

lowastlowast

lowast

mRN

A in

endo

met

rium

(119899- fo

ld ch

ange

)


LeptinOB-RL

(a)

0

1

2

3

4

5

6

7

8


ptin

mRN

A in

endo

met

rium

(

lowastlowast

lowast

119899- fo

ld ch

ange

)

(b)

0

1

2

3

4

5


lowastlowast

lowastlowastlowast

mRN

A in

endo

met

rium

(O

B-R L

119899- fo

ld ch

ange

)

(c)






(a) (b)

(c) (d)








119875a



119899 = 17 119899 = 28 119899 = 13 119899 = 15


119899 = 17 119899 = 23 119899 = 12 119899 = 11







3 Results












4 Discussion



















5 Conclusions




Acknowledgments


References















































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of

















0

1

2

3

4

5

lowastlowast

lowast

mRN

A in

endo

met

rium

(119899- fo

ld ch

ange

)


LeptinOB-RL

(a)

0

1

2

3

4

5

6

7

8


ptin

mRN

A in

endo

met

rium

(

lowastlowast

lowast

119899- fo

ld ch

ange

)

(b)

0

1

2

3

4

5


lowastlowast

lowastlowastlowast

mRN

A in

endo

met

rium

(O

B-R L

119899- fo

ld ch

ange

)

(c)






(a) (b)

(c) (d)








119875a



119899 = 17 119899 = 28 119899 = 13 119899 = 15


119899 = 17 119899 = 23 119899 = 12 119899 = 11







3 Results












4 Discussion



















5 Conclusions




Acknowledgments


References















































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of

















(a) (b)

(c) (d)








119875a



119899 = 17 119899 = 28 119899 = 13 119899 = 15


119899 = 17 119899 = 23 119899 = 12 119899 = 11







3 Results












4 Discussion



















5 Conclusions




Acknowledgments


References















































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of



















119875a



119899 = 17 119899 = 28 119899 = 13 119899 = 15


119899 = 17 119899 = 23 119899 = 12 119899 = 11







3 Results












4 Discussion



















5 Conclusions




Acknowledgments


References















































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of























4 Discussion



















5 Conclusions




Acknowledgments


References















































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of




























5 Conclusions




Acknowledgments


References















































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of









































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of
















Gene Expression of Leptin and Long Leptin Receptor Isoform in ...

Documents

Transcript of Gene Expression of Leptin and Long Leptin Receptor Isoform in ...