Functional and structural insights of a Staphylococcus aureus apoptotic-like membrane peptide from a Toxin-Antitoxin module

Nour Sayed, Sylvie Nonin-Lecomte, Stéphane Réty and Brice Felden

SUPPLEMENTARY DATA

Table S1. DNA primers DNAs Sequences Purposes

antiA1 5’ATGACTGGTGCTATG3’ Northern SprA1 antiAS 5’AGTAAATACTTATTTTCGTT3’ Northern SprA1AS Pst1fwd Flag2 Flag3 EcorIrev

5’AACTGCAGCCTAACGTCAAAGGTGTTAAATCA 3’ 5’CTTGTCATCGTCATCCTTGTAGTCGATGTCATGATCTTTATAATCACCGTCATGGTCTTTGTAGTCTTTTGTATTGCGTCTACTTA 3’ 5’ GACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGACTACAAGGATGACGATGACAAGTAGGTGACATATAGCCGCAC 3’ 5’GGAATTCTTGAACTCATCAGGCCAATTT 3’

pCN35Ω

sprA1FLAG/sprA1AS (FLAG sequence in bold)

Pat-fwd Pat-rev

5’AACTGCAGGTCGCCTATCTCTCAGGCGT 3’ 5’ACACCAATCCCCTCACTATT 3’

pAT12ΩsprA1

Pat-fwd Pat2 Pat3 Pat-rev

5’AACTGCAGGTCGCCTATCTCTCAGGCGT 3’ 5’ACTGGTGCTATGATGTGAACTTAAATAAGCATCACCTTATAC 3’ 5’AAGTTCACATCATAGCACCAGT 3’ 5’ACACCAATCCCCTCACTATT 3’

pAT12ΩsprA1 mut6465

(mutations in bold)

Table S2. Strains and plasmids

Strains Relevant characteristics References E. coli strain DH5α S. aureus strains

αF- φ80 ∆lacZ ∆M15 ∆(lacZA-argF)U169 deoR recA1 endA1 hsdR17 (rK- mK-) phoA supE44 λ- thi-1 gyrA96 relA1

(1)

RN4220 Restriction-defective derivative of 8325-4 (2) Newman ∆sprA1/sprA1AS Newman strain deleted for sprA1 and sprA1AS (3) Plasmids pCN35cat Modified High-copy-number shuttle vector with AmpR

in E. coli and CatR in S. aureus* (4)

pCN35ΩsprA1FLAG /sprA1AS

pCN35 with 5’ST-sprA1/sprA1AS under the control of their endogenous promoter

This study

pAT12 Inducible shuttle vector with CatR in E. coli and in S. aureus. pAT12 contains the repA, repC, tetR genes and the xyl/tetO promoter (inducible with anhydrotetracycline).

(5)

pAT12ΩsprA1 pAT12 with SprA1 sequence (without promoter) This study pAT12ΩsprA1-STOP pAT12 with SprA1 sequence (without promoter)

where the nucleotides T64 and C65 were mutated to AA to create a premature stop codon.

This study

*pCN35cat is derived from pCN35 (6), the erm cassette for S. aureus selection is replaced by cat cassette (chloramphenicol selection). 1. Sambrook, J., Firtsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual.

. Cold Spring Harbour Laboratory Press, New York. 2. Kreiswirth, B.N., Lofdahl, S., Betley, M.J., O'Reilly, M., Schlievert, P.M., Bergdoll, M.S. and

Novick, R.P. (1983) The toxic shock syndrome exotoxin structural gene is not detectably transmitted by a prophage. Nature, 305, 709-712.

3. Sayed, N., Jousselin, A. and Felden, B. (2012) A cis-antisense RNA acts in trans in Staphylococcus aureus to control translation of a human cytolytic peptide. Nat Struct Mol Biol, 19, 105-112.

4. Bohn, C., Rigoulay, C., Chabelskaya, S., Sharma, C.M., Marchais, A., Skorski, P., Borezee-Durant, E., Barbet, R., Jacquet, E., Jacq, A. et al. (2010) Experimental discovery of small RNAs in Staphylococcus aureus reveals a riboregulator of central metabolism. Nucleic Acids Res, 38, 6620-6636.

5. Charpentier, E., Anton, A.I., Barry, P., Alfonso, B., Fang, Y. and Novick, R.P. (2004) Novel cassette-based shuttle vector system for gram-positive bacteria. Appl Environ Microbiol, 70, 6076-6085.

Table S3: NMR distance restraints and structure analysis ________________________________________________________________________ NMR restraints

- total 311 - intra-residue 211 - sequential (i,i+1) 57 - medium range [(i,i+2)-(i,i+3)] 43

- long-range (>i,i+4) 0 ________________________________________________________________________ Distance violations > 0.2 Å 0 ________________________________________________________________________ CNS Mean Energies (kcal/mol)

- Etot -957.8±21 - Ebond 6.1 ± 0.7 - Eangle 36.7 ± 5.3 - Eimpr 61.3 ± 16.5 - Edihed 140.3 ± 4.6 - Evdw -237.8 ± 5.2 - Eelec -964.5 ± 24.5

________________________________________________________________________ r.m.s.d. from idealized geometry

- Bonds (Å) -0.0033 ± 0.0002 - Angles (deg) 0.47± 0.02 - Improper angles (deg) 1.27± 0.15

________________________________________________________________________ Atomic rms deviations to mean structure (Å)

- Backbone, all residues 1.24 ± 0.22 - Heavy atoms, all residues 1.91 ± 0.27

__________________________________________________________________________ Ramachandran: mean values over the 5 best NMR structures

- Allowed regions 27/28 - Favored regions 24/28 - Slight Outliers 1.5/28 - Rotamer Outlier 1.25/28

___________________________________________________________________________ Ramachandran: MD structure (in DPPC bilayer)

- Allowed regions 28/28 - Favored regions 25/28 - Outliers 0/28

FIGURE S1. Schematic representation SprA1 structure and of the sprA1/sprA1AS genetic locus emphasizing the identity of a constructed SprA1 mutant as well as the position of the Flag within the PepA1 and SprA1 sequences. A. The nucleotide sequence of SprA1 and the PepA1 internal open reading frame (ORF) are shown. The Shine-Dalgarno sequence is boxed, the PepA1 initiation and termination codons are blue, the PepA1 codons are in black and grey, the mutated nucleotides in the SprA1-STOP mutant are circled in red (U64C65→A64A65) and the position of the flagged sequence within SprA1 structure is indicated. B. Schematic representation of the ‘sprA1-sprA1AS’ gene pair with the location of PepA1. PepA1 amino-acids composition is indicated with the position of the inserted Flag. Mutations are circled.

FIGURE S2. PepA1 1D-Watergate NMR spectrum recorded at pH 3.8 and 288K in a CD3OH/CDCl3/H2O (50:45:5) ternary buffer. The selected region emphasizes the peak dispersion in the region of the amino and aromatic protons.

FIGURE S3. Assignment chart: NMR distances restraints used to compute PepA1 structure symbolized by horizontal black bars. The thicker the bars are, the shorter the distances are.

FIGURE S4. Influence of a slight variation of the ‘CDOH/CDCl2/H2O’ ratio at pH 3.8 onto PepA1 structure. Superposition of a 250ms pepA1 NOESY reference spectrum (black) to another collected after adding 50ml of CDCl3/CD3OH, 1:1 (blue) in the NMR tube (formerly filled with 300µl of PepA1 in solution in the mixed buffer used for structure determination), emphasizing that the overall peptide structure is maintained. Nevertheless, perturbations of the chemical shifts are detected. They are circled in red for the residues at the N-ter part of the molecule and in green for those at the C-ter. Numerous and strong variations involve residues at PepA1 N-ter half, indicating that this domain is highly sensitive to its environment, as suggested by the molecular dynamics simulations.

FIGURE S5. PepA1 conformational changes induced by the SDS lipid-membrane mimic. PepA1 structural changes, upon addition of SDS-d25, were monitored by NMR. (Left) stack plot of the proton 1D NMR spectra of pepA1 recorded at 293K. Along the titration, the pH was gradually increased from 3.0 (lower spectrum) to 6.8 (upper spectrum). The region of the NH and aromatic protons is displayed. The conservation of thin line widths and of the dispersion of the resonance peaks all along the SDS titration discloses that PepA1 remains folded during the titration. The pattern of resonances, however, varies according to the SDS concentration and pH. At 100mM SDS-d25 and pH 6.8, minor peaks (stars) evidence the existence of alternative conformations. (Right) Expanded contour plots of the NH-NH and NH-Hα regions of a 350ms 2D-NOESY spectrum. Experimental conditions are identical to those used to collect the 1D spectrum at 100mM SDS-d25 of the left panel. The pattern of the cross-peaks resembles that of Fig 3, with minor changes. The overall helical conformation of pepA1 is conserved (i/i+3 cross-peaks boxed in red) but it also discloses changes in chemical shifts and in cross-peaks intensities, consistent with pepA1 conformational changes. The new H6 NH/I3 Hα cross-peak shows that structural variations occur at pepA1 N-terminal portion, consistent with the MD calculations.

FIGURE S6. Analysis of the 50ns MD trajectory. The Root Mean Square Deviation (RMSD) from PepA1 starting structure, averaged over all peptide C-alpha atoms, is plotted as a function of time. The system reaches stability after 20ns and undergoes minor fluctuations during the next 30ns.

FIGURE S7. Circular dichroïsm spectra of PepA1 structure as a function of decreasing SDS concentrations. This is a reverse experiment as compared to that presented in Fig. 5B. Starting from stock solutions of concentrated PepA1 in SDS 400mM and of SDS 400mM in water, CD spectra of PepA1 were recorded for successive dilutions of SDS. The PepA1 concentration was maintained constant at 50µM. The spectra show that PepA1 structure remains helical when the lipid/PepA1 ratio (R) is lowered from 4000 to 1000. By comparison, the addition of growing amounts of SDS, starting from the CMC, did not promote so elevated helical content at these ratios. It suggests that once inserted within a membrane, PepA1 maintains its helical structure.