Vol. 10, No. 12

Functional Analysis of an Isolated fos Promoter Element with AP-1Site Homology Reveals Cell Type-Specific Transcriptional Properties

ANNA VELCICHt AND EDWARD B. ZIFF*Department of Biochemistry, New York University Medical School, 550 First Avenue, New York, New York 10016

Received 15 June 1990/Accepted 30 August 1990

A DNA element located at positions -295 to -289 of the c-fos promoter (FAP site) is highly homologous toa consensus 12-O-tetradecanoyl phorbol-13-acetate-responsive element (TRE) and to a cyclic AMP (cAMP)-responsive element (CRE). We found that an oligonucleotide containing the FAP element was a transcriptionregulator which was distinct from both the TRE and CRE. When cloned in multiple copies in front of a reportergene in HeLa cels, the FAP oligonucleotide was a powerful constitutive activator sequence. Conversely, in thesame cells, reporter plasmids containing multiple copies of the TRE of the human metallothionein generequired phorbol esters for their induction. In PC12 cells, the FAP oligonucleotide was cAMP responsive. Itsactivity was mediated through a cAMP-dependent protein kinase II and did not rely on ongoing proteinsynthesis for activation. Adenovirus Ela proteins activated viral promoters through ATF (activation transcrip-tion factor) consensus binding sequences identical to the CRE. However, Ela repressed the FAP oligonucleotide-associated transcriptional activity in HeLa cells. In PC12 cells, Ela neither transactivated nor transrepressed thebasal and cAMP-stimulated FAP activity. In contrast, the CRE of the human c-fos promoter located at -60 wasweakly induced by cAMP and Ela in both HeLa and PC12 cells. We suggest that the FAP oligonucleotide actsthrough a factor(s) distinct from those employed by the TRE and CRE and that the FAP-associated proteinfactor(s) may differ in HeLa and PC12 cells in expression or posttranslational regulation.

Eucaryotic class II promoters comprise a complex arrayof cis-acting genetic elements which constitute specific bind-ing sites for nuclear factors. The current challenge is tounderstand how protein-DNA interactions provide develop-ment stage-specific and tissue-specific regulation in responseto external stimuli, such as those provided by hormones.Some transcription factors are ubiquitous and may consti-tute components of the core transcriptional machinery;others are restricted in a tissue-specific fashion in theirresponses to extracellular stimuli. In several cellular andviral promoters, the same cis-acting DNA elements mayrespond to distinct control circuits. Thus, it seems that thegeometry and/or the association of several distinct DNAelements dictate the final control of gene expression (forreviews, see references 29 and 37).

Analysis of the c-fos promoter has identified severalcis-acting DNA elements which play a role in the regulationof c-fos transcription (11, 16, 17, 20, 60, 61). The serumresponse element has been shown to be sufficient andnecessary to mediate transcription induction by serum (17,20, 56, 60, 61). The serum response element contains thedyad symmetry element (DSE), which constitutes the mini-mal binding site for the serum response factor (20, 38, 46, 60,61). One other element, located at positions -63/-58, hasbeen identified as the principal sequence which mediates thecyclic AMP (cAMP) response of the c-fos gene (5, 52, 55).We have analyzed a region located adjacent to the DSE of

the human c-fos promoter which encompasses a residue-289/-298 element called the FAP site (12, 44, 51, 53). TheFAP sequence resembles but is not identical to the consen-sus 12-O-tetradecanoyl phorbol-13-acetate (TPA)-respon-sive element (TRE) and cAMP-responsive element (CRE)

* Corresponding author.t Present address: Department of Oncology, Albert Einstein

Cancer Center, 111 E. 210th Street, New York, NY 10467.

sequences and has been shown by footprint analysis to binda protein(s) in vivo (25). However, the factor that binds tothis site is still uncharacterized, and the functional role of theFAP element in c-fos regulation remains to be determined (5,11-13).To learn more about the FAP-binding factor(s), we have

analyzed FAP transcriptional activity in two different celllines outside the context of the c-fos promoter. We show thatan oligonucleotide containing the FAP site, placed in one ormore copies in front of a reporter gene, has transcriptionalproperties which are cell type specific. The FAP oligonucle-otide, when duplicated, has a potent constitutive transcrip-tional activity in HeLa cells. Thus, the FAP region containsan enhanson, a functional element which exhibits protoen-hancer activity when tandemly oligomerized on its own (42;15, and references therein). Conversely, in the rat pheochro-mocytoma cell line PC12 (21), the FAP oligonucleotiderequires cAMP for activity. It mediates a cAMP responseeven when present in a single copy, but activity increaseswhen it is tandemly repeated. FAP-mediated activity cannotbe induced in the A126-IB mutant PC12 cell line, whichlacks the cAMP-dependent protein kinase II, although thesecells retain the cAMP-dependent protein kinase I activity(62). Accordingly, in the PC12 cells FAP activation bycAMP requires the presence of functional cAMP-dependentprotein kinase II.

We have also compared these properties of the FAPoligonucleotide with the corresponding properties of CREand TRE oligonucleotides, which contain, respectively,binding sites for the CREB and AP-1 transcription factors.The responsiveness to serum, TPA, and cAMP in HeLa andPC12 cells is distinctive for the FAP, CRE, and AP-1 siteoligonucleotides. This leads to the conclusion that proteinfactors which associate with the FAP oligonucleotide andconfer its transcription-regulatory properties differ fromthose for the CRE and AP-1 sites.The adenovirus type 5 (AdS) Ela gene also distinguishes

6273

MOLECULAR AND CELLULAR BIOLOGY, Dec. 1990, p. 6273-62820270-7306/90/126273-10$02.00/0Copyright C) 1990, American Society for Microbiology

6274 VELCICH AND ZIFF

the properties of FAP, TRE, and AP-1 sites. The Ela gene

encodes 13S and 12S mRNAs via differential splicing (43),which yield two proteins, 289 and 243 amino acids (aa) long,respectively. These Ela proteins differ by the presence of aninternal peptide unique to the 13S mRNA product. Thisregion, domain 3, is conserved among several adenovirusserotypes. Two other regions, domain 1 and 2, are alsoconserved and are common to the two Ela proteins (forreview, see reference 40). The Ela proteins are pleiotropictranscriptional regulators of both viral and cellular promot-ers (for reviews see references 3, 4, and 29). The 289-aaprotein is the major transactivator of early viral promotersand some cellular genes (for reviews see references 3, 4, and19). Both Ela proteins can repress transcription of promot-ers associated with viral and cellular enhancers (6, 24, 58, 59,63, 66). Although no unique DNA sequence has been iden-tified that is specific for Ela transactivation, in some in-stances Ela transactivates through the DNA consensussequence 5'-TGACGTCA-3', known as the cAMP-respon-sive element (CRE) or activating transcription factor (ATF)binding site. This sequence is highly related to the consensusAP-1 binding sequence 5'-TGAGTCA-3' (49, 70) and to theFAP site.We have tested the effect of Ela proteins on FAP oligo-

nucleotide-mediated transcriptional activity in both HeLaand PC12 cells. We show that Ela represses the enhancer-like activity associated with FAP in HeLa cells. In contrast,in PC12 cells Ela is unable to either transactivate or repressthe FAP oligonucleotide-mediated basal or cAMP-inducedtranscriptional activity. To compare FAP with a bona fideconsensus CRE site, we tested the ability of Ela to affect theactivity of the CRE overlapping position -60 in the humanc-fos promoter. This DNA element is the major contributorto the cAMP induction of c-fos (5, 52, 55). We found thatboth cAMP and Ela were able to induce transcription froma reporter gene containing the -60 c-fos CRE in HeLa as

well as PC12 cells.We conclude that the FAP oligonucleotide provides tran-

scription regulation distinct from the CRE and TRE oligo-nucleotides in its response to inducers and its cell typespecificity. The implications of these novel regulatory prop-erties for protein factors which associate with the FAPoligonucleotide and for c-fos promoter control are discussed.

MATERIALS AND METHODS

Plasmids and synthetic DNA oligonucleotides. The oligonu-cleotides containing the different consensus DNA-bindingsequences were chemically synthesized as 25-mers. Theyhave the following sequences: FAP (fos AP-1), 5'-GATCCATCTGCGTCAGCAGGTTTG-3'; CRE (fos cAMP-respon-sive element at -60), 5'-CGAGCCCTGACGTTTACACGAGCT-3'; and TRE (human metallothionein Ila AP-1 con-

sensus), 5'-AATTCTAGACTGAGTCATGGTACCG-3'.The double-stranded oligonucleotides were cloned at thesites corresponding to their linkers in the polylinker of thereporter plasmid. The reporter plasmid (e3f3-globin) has thehuman ,-globin gene including 48 nucleotides 5' to themRNA start site encompassing the TATA box (Fig. 1)cloned in pGEM4 (56). Recombinants containing differentcopy numbers of the desired oligonucleotide were isolated.The orientation of the oligonucleotide repeats was deter-mined by DNA sequencing. pSVP-globin contains the simianvirus 40 (SV40) enhancer (two 72-bp repeats) cloned at theXhoI site of e3f-globin. The Ela expression vectorspSVEla, -N20, -F12, -XL3, -XL124, and -XL214 have beendescribed previously (64).

Cell culture. HeLa cells were grown in Dulbecco modifiedEagle medium (DMEM) with 5% fetal calf serum (FCS).PC12 cells were maintained in DMEM containing 10%defined and supplemented calf serum and 5% horse serum(Hyclone Laboratories, Sterile Systems Inc., Logan, Utah).A126-1B cells, a generous gift of Dr. Wagner, were culturedin DMEM plus 10% FCS.

Transfection protocols and drug treatment. HeLa cellswere transfected by the standard calcium phosphate precip-itation technique as detailed previously (66). A 5-j,g amountof test plasmid was used for each 100-mm dish. Ela plas-mids, when included in the transfection mixture, were usedat S ,ug of DNA per dish, unless otherwise stated. The finalDNA concentration per plate was kept constant at 15 ,ug.PC12 and A126-1B cells were transfected by the electropo-ration method (14, 45) with some modifications (17a). Stim-ulation with forskolin and TPA was performed 24 h post-transfection. Cells were induced with forskolin at 10 ,ug/mlfor 8 h. For induction, TPA was used at 100 ng/ml for 4 h.When cultures were treated with cycloheximide (10 jig/ml)and anisomycin (100 jiM), forskolin was added directly tothe medium 30 min later.RNA isolation and analysis. Cytoplasmic RNA was iso-

lated by the Nonidet P-40 lysis buffer technique as describedpreviously (66). Between S and 15 jig of RNA was analyzedby the RNase protection technique as already detailed (65).When appropriate, the RNA sample was simultaneouslyhybridized with both the ,-globin and Ela radiolabeledantisense RNA probes.

RESULTS

Tandemly repeated FAP oligonucleotides provide constitu-tive transcriptional activity in HeLa cells. We cloned anoligonucleotide containing the FAP sequence at a site 5' tothe human 3-globin gene promoter (Fig. 1) and transientlytransfected plasmids containing one, two, or three copies ofthe oligonucleotide into HeLa cells. We used RNase protec-tion to assay the level of the P-globin mRNA exon I, whichreflects initiation at the ,-globin cap site. As shown in Fig. 2,a plasmid with a single copy of the FAP oligonucleotide wasnot active, but duplicated or triplicated FAP oligonucleo-tides induced transcription from the P-globin promoter.Activity was proportional to the copy number of the FAPoligonucleotide. Thus, the FAP oligonucleotide shares acharacteristic of enhansons and exhibits protoenhancer ac-tivity when oligomerized (15, 42). We also consistently sawa basal level of expression of the 3-globin exon 2 even in theabsence of FAP inserts, which we attribute to initiation at a

cryptic site in intron 1.We next tested whether plasmids with FAP oligonucleo-

tide inserts were responsive to phorbol esters or serum. Asshown in Fig. 3A, activity of the ,-globin plasmid FAP-3xwas not induced by serum and in fact was slightly decreasedin this experiment in 5% serum relative to the level in 0.5%serum. This decrease was not seen in other trials. Also,treatment of cells with 0.5% serum and TPA did not furtherstimulate ,B-globin gene expression. Similar results wereobtained with the FAP-2x P-globin plasmid (data notshown). We conclude that tandem repeats of the FAPoligonucleotide are constitutively active in HeLa cells butare not induced by serum or TPA.FAP-dependent enhancerlike activity repressed by AdS Ela

proteins. We and others (6, 63, 66) have shown that the Ad5Ela proteins can repress transcription from promoterslinked to the SV40 and polyomavirus enhancers. Both en-

MOL. CELL. BIOL.

ANALYSIS OF ISOLATED fos PROMOTER ELEMENT 6275

AFAP(h. c-fos AP-1 like element, at -296)

CRE(h.c-fos CRE element, at -60)

AP-1(h. metallothionein TRE element)

DSE

Bhumanfo promoter:

I'l

-48 +1

h. ,-globin gene

FAP

-320 CAGGATGTCCATATTAGGACATCTGCGTCAGCAGG1TTCC -289

AP-1 oligonucleotide:

FAP oligonudeotide:

CRE oligonudeotide:

5' AAMTCTAGACTGAGTCATGGTACCG 3'*-- --C-

*-- *0005' GATCCATCTGCGTCAGCAGG1TTG 3'

**C*C** *

*** ***

5' CGAGCCCTGACG1TACACGAGCT 3'

FIG. 1. Schematic representation of structures of reporter plasmids and DNA-binding motifs. (A) DNA-binding sequence, present in a25-mer oligonucleotide, was cloned in front of the 3-globin plasmid as detailed in Materials and Methods. The number and direction of arrowsindicate, respectively, the copy number and the orientation of the corresponding oligonucleotide. The orientation of the FAP oligonucleotidein the lx and 2x constructs is the same as shown in the FAP-3x plasmid. Also shown in the diagram are the TATA box and the transcriptionstart site (+ 1) of the human ,-globin gene. h., Human. (B) Sequence of the c-fos promoter spanning nucleotides -320 to -289 relative to themRNA start site. The DSE is indicated by inverted arrows, and the FAP site is underlined. Also shown are the sequences of the syntheticoligonucleotides harboring the AP-1, FAP, and CRE consensus sequences. The residues which are conserved between the AP-1 consensusand the FAP element and held in common between the FAP and CRE consensus sequences are indicated.

hancers contain elements which, like the FAP oligonucleo-tide, acquire enhancer activity when oligomerized. Further-more, a consensus AP-1 binding sequence related to the FAPsite is found in both the SV40 (7, 33) and polyomavirus (44)enhancers. We therefore asked whether the FAP oligonucle-otide enhancerlike activity is repressed by Ela.HeLa cells were cotransfected with equimolar amounts of

FAP

M e- 1x 2x 3x_IL Exon

!-n G-globin

I ExonG - giobin

FIG. 2. FAP is active in HeLa cells when oligomerized. HeLacells were transfected with 5 j±g of the P-globin plasmid containingno (e-), one (lx), two (2x), or three (3x) copies of the FAP site.After 48 h, total cytoplasmic RNA was isolated and analyzed by theRNase protection assay to determine the ,-globin mRNA level. Theband arising from the first exon is marked along with the secondexon band and represents correctly initiated mRNA. Lane M, Sizemarkers.

the FAP-3x P-globin plasmid and the Ela expression vectorpSVEla, which encodes both the 289- and 243-aa Elaproteins (66). As shown in Fig. 3A, the Ela plasmid greatlyreduced the activity of the FAP-3x ,-globin vector. Repres-sion was also observed with cells stimulated with TPA ineither high or low serum (lanes 2, 4, and 6). Figure 3B alsoshows that the expression of pSVEla was stimulated bytreatment with phorbol esters.We next analyzed the ability of plasmids expressing indi-

vidual wild-type or mutant Ela proteins to repress FAPactivity. We transfected the FAP-3x 3-globin plasmid to-gether with a series of Ela plasmids expressing the wild-typeor mutant 13S (pSVN20) or 12S (pSVF12) Ela polypeptide.pSVXL3 is a mutant 13S plasmid which encodes a severelytruncated peptide lacking enhancer repression activity (66).pSVXL3 was unable to repress expression from the FAP-3x,B-globin plasmid (Fig. 3C), ruling out promoter competitionas the mechanism. Note that pSVN20 (which encodes the289-aa Ela protein) repressed FAP enhancer activity lessefficiently than pSVEla (which encodes both the 243- andthe 289-aa Ela proteins) and pSVF12 (which encodes the243-aa Ela protein). Previously, we have shown thatpSVEla, pSVN20, and pSVF12 repress the intact SV40 andpolyomavirus enhancers with similar efficiencies (63, 66).To confirm differential repression of FAP-3x ,-globin by

these plasmids, we transfected cells with a fixed amount ofFAP-3x ,-globin plasmid plus increasing amounts of Elaplasmids. As a control, we cotransfected equimolar amountsof the pSV ,B-globin plasmid, which contains the intact SV40enhancer, with the Ela expression plasmids. As found

VOL. 10, 1990

6276 VELCICH AND ZIFF

A

* -d

B

I

..r

i_- "I ;

.i> ... > ; ." ,)

aCL - aa

I: Exr

.Ex-3n _

FIG. 3. FAP activity is insensitive to TPA induction but repress-ible by Ad5 Ela. HeLa cells were transfected with the FAP-3x(-globin plasmid in the presence (+) or absence (-) of the Elaexpression vectors. (A) Cells were kept in either low (0.5%) or high(5%) FCS and at 40 h posttransfection were treated (+) or nottreated (-) with TPA (PMA, 10 ng/ml) for 4 h; 10 ,ug of mRNA wasanalyzed to determine the level of expression of the (3-globin((-glob) plasmid. Although in this particular experiment the level ofexpression of the FAP-3x (-globin plasmid seemed to be lower incells kept in high serum, subsequent experiments did not show any

difference. (B) mRNA (10 ,ug) was analyzed for the level of ElamRNA in the corresponding sample. (C) Ela vectors expressingeither both or individual Ela proteins were cotransfected withFAP-3x. pSVEla encodes both 12S and 13S Ela mRNAs. pSVN20and pSVF12 express only the 13S and 12S Ela polypeptide, respec-tively. pSVXL3 encodes a 70-aa-long, severely truncated 13SmRNA peptide. All the Ela expression vectors were present at 5 p.gof DNA per dish except for pSVEla, which was assayed at 1 and 5,ug DNA per dish (1y and 5y, respectively). The RNA from thedifferent samples was assayed simultaneously for the level of,-globin and Ela mRNAs. Bands specific for the 13S and 12SmRNAs are indicated, as are bands corresponding to the first andsecond exon of the 3-globin mRNA.

previously, the 243- and 289-aa products repressed the SV40enhancer to comparable extents (Fig. 4A). In contrast, the289-aa product encoded by pSVN20 was much less efficientin repressing the FAP-dependent enhancer activity than the243-aa product from pSVF12. While 1 ,ug of either pSVElaor pSVF12 DNA gave the maximum level of repression, 10,ug of pSVN20 DNA provided only a 50% reduction inFAP-mediated activity. We estimate that the 289-aa Elaprotein is at least 10 times less efficient than the 243-aapeptide in repressing FAP activity. Figure 4B also shows

that the partial repression obtained at the high concentrationof pSVN20 was specific to this plasmid. At similar DNAconcentrations, two mnutant Ela plasmids, pSVXL124 andpSVXL214, which are deficient for enhancer repressionactivity (64), were unable to repress transcription from theFAP-3x 3-globin plasmid.FAP element is distinct from human metallothionein IIA

AP-1 binding site in its response to TPA in HeLa cells. Theresults shown above suggest that despite high homology to aconsensus AP-1 binding site, the FAP oligonucleotide is notinducible by TPA. Because some clones of HeLa cells arerefractory to TPA induction, we asked whether a character-ized TPA-responsive element, the TRE of the human metal-lothionein promoter, could be induced by TPA in HeLa cellsunder conditions that failed to allow induction of FAP (1,33).HeLa cells were transfected with ,-globin plasmids with

one, two, or four copies of an oligonucleotide containing theTRE site, as shown in Fig. 1. Expression of the P-globinmessenger was detected only after treatment of the cells withTPA, and P-globin mRNA levels were proportional to thenumber of AP-1 binding site inserts (Fig. SA). Figure 5A alsoshows that TPA induced these plasmids only in cells whichwere maintained in low serum concentrations prior to TPAtreatment (compare lanes 5 and 7 with lanes 9 and 10).Together, these results demonstrate that although the FAPand AP-1 binding elements have related sequences, theyrespond differently to TPA, suggesting that they are regu-lated by distinct factors.To determine whether the AP-1 and FAP oligonucleotides

also differ in their sensitivity to Ela, we transfected the AP-1P-globin plasmids in the presence and absence of Ela DNA.Coexpression of Ela greatly reduced the level of expressionof the AP-1 plasmid in TPA-treated cells. Ela had no effecton the basal level of expression in untreated cells (Fig. SA).Also note that the Ela promoter itself responded to TPA, asshown by the increased levels of Ela mRNAs in TPA-treated cells (Fig. SB). Despite the possibility that the Elaand AP-1 ,B-globin promoters use common factors, repres-sion of AP-1-dependent transcriptional activity was not duesimply to promoter competition. Rather, repression requiredfunctional 13S and 12S Ela proteins, as shown by theinability of the mutant Ela plasmid pSVXL124 to repressAP-1-2x ,-globin expression (Fig. SC). pSVXL124 has beenshown previously to lack the ability to repress both SV40and polyomavirus enhancer activities (64). Taken together,these data indicate that Ela can repress both constitutiveFAP oligonucleotide activity and TPA-induced AP-1 oligo-nucleotide activity in HeLa cells.FAP oligonucleotide is cAMP responsive in PC12 cells. The

FAP element is partially homologous to the CRE as well asto the TRE. The TRE and CRE differ by the presence of acentral C residue in the CRE (9). The FAP element also has11 of 12 residues identical to the ENKCRE-2 sequence of theproenkephalin gene promoter (28). ENKCRE-2 contributesto both the basal and the cAMP-induced transcription of thisgene (28). We therefore asked whether FAP could mediate acAMP response. The FAP-ix, FAP-2x, and FAP-3x P-globinplasmids were transfected into PC12 cells, a cell line forwhich cAMP induction has been well characterized. Incontrast to HeLa cells, in untreated PC12 cells the FAPelement, even when triplicated, did not stimulate P-globintranscription (Fig. 6A, lanes 1, 4, and 7). However, the,B-globin promoter was active with all three constructs whenthe PC12 cells were treated for 8 h with forskolin, an agentwhich raises cAMP levels. The level of induction was

MOL. CELL. BIOL.

... 4

I L ;. ;

ANALYSIS OF ISOLATED fos PROMOTER ELEMENT 6277

SV P-globin FAP 3x ,-globin

1.0-o o

-> 0

+0.5-

-0

Ela Plasmid:

1.0-

0.5-

cl) C) C/) Cl) Cl)<- <- <9- <- <:' 'v 2 )< >(oj N) 0r3 r20 C) ~~-r" .r

15 15

-o -oa c

D r%3

1 510

Cl)N,0

l 510

c*xl)

1 510 ,q

Cl)I-N)l

FIG. 4. 13S and 12S Ela proteins are not equivalent repressors of FAP activity. (A) HeLa cells were transfected with pSV 1-globin, avector containing the entire SV40 enhancer sequence (two 72-bp repeats) in front of the ,3-globin gene, alone or with equimolar amounts (5,ug) of the different Ela expression vectors. (B) Cells were transfected with FAP-3x f3-globin alone or in the presence of the Ela plasmids atthe indicated concentrations. mRNA was isolated and analyzed to determine the f-globin mRNA levels. The histograms in panels A and Brepresent the 3-globin mRNA levels obtained in the absence (= 1) or in the presence of Ela plasmids as obtained by densitometric scanningof the corresponding autoradiograms. The Ela expression vectors are those described in the legend to Fig. 3 except for pSVXL124 and -214,which encode an out-of-frame truncated and a in-frame deletion mutant form of the 13S Ela polypeptide, respectively.

proportional to the FAP oligonucleotide copy number in therecombinants (Fig. 6A, lanes 2, 6, and 9). No induction ofglobin gene expression from these plasmids was detected inPC12 cells following treatment with TPA, in agreement withthe results in HeLa cells.The induction of FAP activity by cAMP did not rely on

new protein synthesis. As shown in Fig. 6B, in the absenceof any inhibitor, P-globin mRNA was readily detectable 30min after forskolin induction, reached a maximum at ca. 8 h,and remained constant up to 24 h, the last time pointconsidered. Very similar kinetics of induction were observedin cells which were treated for 30 min with the inhibitorscycloheximide and anisomycin and then induced with for-skolin in the presence of the drugs (Fig. 6B, right panel).These results indicate that FAP activity in PC12 cells resultsfrom the posttranslational activation of an existing factor.A transcriptional response to cAMP mediated through a

consensus CRE binding site requires the cAMP-dependentprotein kinase (39, 69). To determine whether FAP functionalso requires such a kinase, we transfected the FAP-3x3-globin plasmid into A126-1B cells, a mutant PC12 cell linewhich is defective in the protein kinase II regulatory subunit(62) and which lacks the cAMP response. As expected, theFAP-3x P-globin plasmid was highly expressed in forskolin-treated PC12 cells (Fig. 7). However, no ,-globin mRNAaccumulated in response to cAMP in the A126-1B mutantcell line, indicating that FAP activation requires cAMP-dependent protein kinase II.Ela does not repress FAP activity in PC12 cells. Activation

transcription factor (ATF) binds to a consensus motif whichis identical to the CRE (27, 32, 36), which also binds thetranscription factor CREB (39). Indeed, ATF and CREBbelong to a family of transcription factors which bind thisconsensus sequence (22, 23). We tested the effect of Ela onthe expression of FAP oligonucleotide-containing plasmids

in PC12 and A126-1B cells. In PC12 cells, the presence ofEla did not affect the level of expression of the P-globin genein such plasmids at either the basal or cAMP-induced level(Fig. 7, compare lanes 1 and 2 with 3 and 4). Severallaboratories have shown that ATF activity is modulated bythe Ela transactivation function (27, 32, 36, 50). The failureof Ela to alter the level of transcription by the FAP-3xplasmid suggests that ATF is not modulating the FAPoligonucleotide activity in PC12 cells. In A126-1B cellsalone, Ela was able to weakly induce expression from theFAP-3x plasmid, and such expression was further stimulatedby treatment with forskolin (Fig. 7, lanes 7 and 8). Thus, it ispossible that in the absence of cAMP induction, the plasmidutilizes a different, Ela-responsive factor.

Activity of the CRE of human c-fos promoter distinct fromthat of FAP-3X plasmid. To further compare the properties ofthe FAP plasmids with those controlled by the CRE, weanalyzed the CRE motif located at nucleotide -60 of thehuman c-fos promoter. This sequence is the main elementwhich mediates the cAMP response of the c-fos gene (5, 52,55). In the 3-globin plasmid CRE-3x (Fig. 1), the c-fos CREmotif is triplicated in the same geometrical arrangement asthe FAP element in the FAP-3x ,B-globin plasmid. TheCRE-3x ,B-globin plasmid was transfected into PC12 andHeLa cells. In both cell types, forskolin treatment induced avery weak but detectable level of transcription from thisplasmid (Fig. 8A and B, compare lanes 1 and 2). In contrast,as shown previously, the FAP-3x P-globin plasmid washighly induced by cAMP in PC12 cells (Fig. 8A, comparelanes 6 and 8) and was expressed at high constitutive levelsin HeLa cells (Fig. 2).We also tested the effect of Ela on the transcriptional

activity of the CRE. In both PC12 and HeLa cells, Elamodestly induced CRE activity (Fig. 8A and B, comparelanes 1 and 3). The CRE activity was greatly increased when

VOL. 10, 1990

I

6278 VELCICH AND ZIFF

AP-l ix AP-1 2x AP- 1 4xri I

E1 J - i - + ± - t - - - t - +FOS % 10.5 u.5 C-50.5 0.50.50.5 555 O. 0.50.50.5pMrIAA -- ++ - -++-4--- - + +

a_T-~ ,I- Exon

do /o,-gIobir~

.234 567 8 9 10 14 121344

2 4 6 8 12 44

.a.-__ -_ 13S Elc

FIG. 5. Human metallothionein TRE, is TPA inducible and Elarepressible in HeLa cells. (A) RNase protection assay of RNAisolated fro'm HeLa cells transfected with the P-globin plasmidcontaining one (lx), two (2x), and four (4x) copies of the humanmetallothionein TRE (AP-1). The transfection was perfo'rmed with()or without (-) equimolar amounts of pSVEla. Different culture

conditions were used: cells were kept in either low (0.5%) or high(5%) FCS concentration and subjected to treatment (+) or notreatment (-) with TPA (PMA) for 4 h. (B) The same RNA samplesas in panel A were analyzed for the levels of Ela mRNA. (C) HeLacells we're cotransfected with different amounts, as indicated, of Elaexpression vectors and a fixed amount of AP-1-2x P-globin plasmid(5 p.g). Cells received no treatment (-) or treatment (+) with TPA(PMA) at low FCS concentration (0.5%). Total cytoplasmic RNAwas isolated and analyzed for P3-globin RNA levels. Lane M, Sizemarkers.

both Ela and forskolin were present (Fig. 8A and B,compare lanes 2 and 3 with lanes 4). Conversely, theexpression of the FAP plasmid was not affected by Ela. inPC12 cells (Fig. 8A) and was repressed in HeLa cells (Fig.3). These results further distinguish the properties of plas-mids regulated by the FAP and CRE oligonucleotides.

DISCUSSION

The human c-fos promoter contains an element (FAP) thatbears homology to the consensus AP-1 binding site and islocated adjacent to the DSE (12, 44, 51, 53). Previousfunctional analyses with constructs containing portions of

FIG. 6. FAP is a CRE in PC12 cells and its activity is indepen-dent of new protein synthesis. (A) PC12 cells were transfected bythe electroporation technique with FAP-lx, FAP-2x, and FAP-3xp-globin plasmids. Cells received no treatment (-) or were inducedwith forskolin or TPA (PMA) (+) as described in the text. Cytoplas-mic RNA was isolated, and ,B-globin mRNA levels were determinedby the RNase protection assay technique. (B) PC12 cells weretransfected with FAP-3x f-globin plasmid, incubated without orwith cycloheximide (+CXE) and anisomycin (+ANISO) for 30 min,and then stimulated with forskolin in the presence of the proteinsynthesis inhibitors. At the indicated time points (0, 15, or 30 min or

1 to 24 h) following forskolin induction, RNA was isolated from bothsets of cultures and analyzed for ,-globin mRNA levels.

the c-fos promoter mutated at the FAP site have failed todisclose a role for the FAP element in c-fos promoterfunction (11, 12). In this study, we have analyzed an oligo-nucleotide containing the FAP element outside the contextof the c-fos promoter and have defined several distincttranscriptional properties. Our results demonstrate that a

powerful transcription element which is cell type specific inits capacity for regulation by physiological inducers and viraltransforming proteins lies adjacent to the DSE. We showthat the FAP oligonucleotide can confer a powerful consti-tutive enhancerlike activity in HeLa cells. Transcriptionactivation by the element increases dramatically as thenumber of tandemly repeated copies of the oligonucleotide isincreased. Thus, in HeLa cells, the element displays a

characteristic property of enhansons which is shared withother enhancer elements (42; 15, and references therein). Itremains, however, to be determined whether the FAP oligo-nucleotide displays a second essential feature of enhancers,the ability to function in a position-independent fashion. In a

different cell type, PC12 cells, the FAP oligonucleotideconfers regulation by cAMP. In pC12, multiple copies of the

A......~~~~~~~~~~~~~~~2

._ # -~FrAjI-9: 1L

B

0- ..

MOL. CELL. BIOL.

do --- dw .. 00 --*-- 12 S El a

ANALYSIS OF ISOLATED fos PROMOTER ELEMENT 6279

FAP 3x

Elo' _+ + _- + +Forskoiin: - + - + - + - 4

_¶ Exon-3-globin

_I9 :3~ Exorw e g _,,-g_9ob:in

1 2 3 4 5 67 8- JX

PC12 A126-lB

FIG. 7. Distinct effects of forskolin and Ela on FAP activity inPC12 and A126-1B cells. PC12 and A126-1B cells were transfectedwith FAP-3x ,-globin plasmid alone (-) or in the presence ofpSVEla DNA (+). Cells were either treated (+) or not treated (-)with forskolin. Cytoplasmic RNA was isolated and analyzed by theRNase protection assay for the presence of P-globin mRNA.

FAP oligonucleotide also work synergistically and are en-hansonlike, although cAMP dependent. The element, inHeLa cells, is subject to repression by the AdS Ela trans-forming proteins, a property shared with other enhancers (6,63, 66). In contrast, the element is refractile to Ela in PC12cells.We found that vectors encoding the 243-aa Ela protein

were 10-fold more efficient in repressing the tandemly re-peated FAP oligonucleotide than vectors encoding the289-aa Ela protein. The basis for this difference is notknown. Possibly repression depends upon binding of factorsto Ela which are sterically hindered by domain 3, which ispresent only in the 289-aa protein.

PC12 Cells

Elo:Forskolin :

CRE 3x FAP 3xI L\ I_ _ + + - -++z_-+ _-+ -+- +

31 Exon/3-globin- a 40

4

1 Exon -/3-globin

13S Ela -

The nature of the protein(s) which mediates activity of theFAP oligonucleotide is not yet known, and it is possible thatthe regulation is provided by a novel transcription factor(s)which differs from those acting at the CRE and TRE. Ourresults make it unlikely that the classical AP-1 transcriptionfactor, the fos-jun complex (for review, see reference 8),mediates FAP activity. We found that FAP plasmid activitywas not modulated by TPA treatment. Our results agree withthose of Fisch et al. (12), who recently reported that fos-catfusion genes were not responsive to TPA. As a control, wehave shown that the TRE of the human metallothioneinpromoter, originally identified as the consensus AP-1 bindingsite (1, 33), can be activated in HeLa cells by treatment withphorbol esters under conditions that do not activate FAPplasmids. Furthermore, R. Metz and E. Ziff (personal com-munication) were unable to detect the c-Fos protein in theFAP oligonucleotide-protein complex. It is possible, how-ever, that a complex containing c-Fos is formed with ex-tracts from cells which overexpress the c-Fos protein (53).The FAP sequence has a high degree of homology with the

CRE. In addition, 11 of 12 residues in FAP are identical tothe ENKCRE-2 element, which mediates both basal andcAMP-regulated transcription of the proenkephalin gene(28). More recently, Sonnenberg et al. (57) have shown thatin vitro-synthesized c-Fos and c-Jun complexes can bind tothe ENKRE-2 element. We therefore tested whether FAPcould be a CRE and/or TRE. We show that in PC12 cells, theFAP oligonucleotide confers a very strong transcriptionalresponse to cAMP, a result in agreement with the finding byFisch et al. (13) that an oligonucleotide containing thesequence spanning the FAP site confers cAMP responsive-ness to a minimal fos promoter. The induction is indepen-dent of ongoing protein synthesis, a property shared withinduction by CREB, a factor which binds to the CRE andwhich is activated by phosphorylation (39, 69). The FAP-3X

HeLa Cells

Ela:Forskolin:

CRE 3xr-------+_ +

-4041 II Exon/3 g-globin

_ - I ExonIs-globin

1 2 3 4

M 1 2 3 4 5 6 7 8

FIG. 8. Comparison of CRE and FAP activities in PC12 and HeLa cells. PC12 cells (A) and HeLa cells (B) were cotransfected with thep-globin plasmid containing three copies of the CRE of the c-fos gene, as represented in Fig. 1, alone (-) or with an equimolar amount ofpSVEla (+). For direct comparison, PC12 cells (A) were also transfected with the FAP-3x plasmid under the same conditions. PC12 andHeLa cells were treated (+) or not treated (-) with forskolin for 8 h. Thereafter, RNA was isolated and analyzed for ,-globin mRNA levels.In panel A, the RNA of samples 5, 7, and 8 was simultaneously analyzed for the presence of Ela and P-globin mRNAs.

VOL. 10, 1990

6280 VELCICH AND ZIFF

3-globin plasmid was not induced by cAMP in A126-1Bcells, which lack the cAMP-dependent protein kinase II.Although these cells retain a functional cAMP-dependentprotein kinase 1 (62), this was not sufficient to mediate theFAP oligonucleotide cAMP response.

Several observations, however, distinguish the responsesof FAP and CRE plasmids. Under conditions in whichforskolin strongly induced the FAP-3X P-globin plasmid inPC12 cells, the triplicated CRE sequence located at -60 ofthe c-fos promoter conferred a very weak response toforskolin. The same low level of CRE induction was alsoobserved in HeLa cells in response to cAMP. Thus, the FAPand CRE oligonucleotides are not equivalent, indicating thatthey bind distinct transcription factors.A complex set of activator proteins bind to ATF/CRE sites

(23), and at least one of these proteins, CREB, has beendirectly implicated in activation by cAMP (18, 26). Thefunctional relationship between the polypeptides that bind toATF/CRE sites is, however, unknown. Furthermore, dif-ferent elements containing the ATF/CRE motifs may notfunction equivalently, since some ATF/CRE-containing pro-moters fail to respond to cAMP. A fine mutational analysisof the FAP and CRE sites, employing both binding andfunctional studies, is in progress to clarify these relation-ships.We found that plasmids under the control of the FAP

oligonucleotide responded differently to Ela depending uponthe cell type. FAP transcription activity was repressed byEla in HeLa cells but was insensitive to Ela in PC12 cells.These findings suggest that FAP is mediating transcriptionby cell type-specific mechanisms which show different sen-sitivities to Ela repression and activation. It is possible thatHeLa and PC12 cells differ in the sets of transcription factorswhich recognize the single FAP oligonucleotide. Recently,Metz and Ziff (personal communication) screened an expres-sion library from PC12 cells and isolated a cDNA clone of aprotein which binds to the FAP oligonucleotide. Polyclonalantibodies raised against this protein recognized a doublet of33- and 38-kDa proteins in PC12 cells and a 50-kDa peptidein HeLa cells. In a gel retardation assay, these antibodiesinhibited the formation of the FAP DNA-protein complexobtained with extracts from both cell types. These data thussupport the notion that the FAP site can bind differentfactors in different cells. Further experiments are required tofully establish the functional role of these proteins in theactivity of the FAP oligonucleotide. In addition, cell typedifferences could reflect an alteration by cell transformationof transcription factors which regulate the FAP oligonucle-otide. Transformation could result in the constitutive activ-ity of otherwise posttranscriptionally inducible transcriptionfactors or in the induction of expression of factors normallynot present in those cells. Indeed, Siegfried and Ziff (56a)have shown that FAP oligonucleotide activity is induced bycAMP in NIH 3T3 cells but is constitutive in clones of NIH3T3 cells stably transformed with the v-raf oncogene.The results from the experiments with Ela may be rele-

vant to understanding the mechanism of Ela-dependentenhancer repression. Enhancers are composed of multiplefunctional elements (enhansons) which act synergistically topotentiate transcription from an associated promoter (42; 15,and references therein). Any of these basic elements couldbe the target of Ela repression. Indeed, the Ela proteins areable to repress the enhancer function associated with oligo-merized FAP and AP-1 elements in HeLa cells. Theseelements mediate a constitutive (FAP) and induced (TRE)enhancerlike activity and are both repressed by Ela. Inter-

estingly, when FAP mediated a cAMP-inducible transcrip-tion activity in PC12 cells, such activity was insensitive toEla, suggesting that the Ela repression function may notaffect the activity dependent on factors in PC12 cells whichbind to consensus ATF/CRE binding sites. Ela is able totransactivate a subset of promoters containing ATF/CREelements (27, 32, 36, 50). We note, however, that in A126-1Bcells Ela could induce FAP activity, albeit moderately. Suchactivity was further stimulated by forskolin treatment.

It is possible that Ela is able to overcome the effect of thekinase mutation in A126-1B cells and renders the cell exquis-itely sensitive to cAMP action. In this model, Ela wouldwork as a signal amplifier. Alternatively, in the absence of afunctional (as in A126-1B cells) or efficient (as in HeLa cells)cAMP-dependent pathway, Ela could overcome the require-ment for phosphorylation of CREB to become active oractivate different pathways. There are contrasting reports asto whether Ela and forskolin have distinct but interactivepathways or a single pathway (10, 34, 50). We found syner-gism between Ela and cAMP in the A126-1B cells, whichlack cAMP-dependent protein kinase II activity but retainprotein kinase I. Most likely, these dissimilar findings are theresult of differences in the type of promoter analyzed or cellline used.

Muller et al. (41) have reported synergism between Elaand cAMP in inducing AP-1. This cooperation requires thepresence of a functional protein kinase A-dependent path-way. We observed synergism between Ela and cAMP ininducing FAP activity only in cells which lacked the proteinkinase II-dependent pathway, further suggesting that thetranscription factor(s) which binds FAP is not the classicalAP-1 transcription factor.

Lillie and Green (35) suggest that Ela may transactivatevia interactions with a protein(s) associated with the targetpromoter. Perhaps Ela interactions with one class of factor(such as ATF) give rise to a productive complex. Theinteraction of Ela with a different set of transcription fac-tors, such as enhancer-binding proteins, could be nonpro-ductive and block formation of an active complex, leading torepression by Ela. Recent evidence from Webster andKedes (67) supports this model. These authors report thatthe Ela-dependent repression of the human cardiac a-actin(HCA) promoter in myogenic cells is abolished when thetissue-specific expression of the HCA promoter is lost uponinsertion of the c-fos CRE in the promoter. These datasuggest that distinct transcriptional complexes, which dis-play differential sensitivity to Ela, are formed in each case.Ela may block the activities of proteins which are commonintermediates to the function of many enhancers, as sug-gested by the ability of Ela to repress a variety of distinctprotoenhancers (48).

In summary, we have shown that the promoter-proximalsequences adjacent to the DSE are capable of exertingstrong cell type-specific transcriptional activation. Becausethe FAP oligonucleotide can confer responsiveness to cAMPand can, under appropriate conditions, be repressed by theAdS Ela proteins, it is likely that it can interact with multiplecellular regulatory pathways. In addition, we have shownthat the regulation provided by the FAP oligonucleotide isdistinct from that provided by the better-characterized CREand AP-1 site elements. Experiments are in progress todefine the proteins which associate with the FAP oligonu-cleotide, the precise contacts made by these proteins withDNA, and their mechanisms of control.The FAP element which is present in a single copy in the

c-fos promoter has enhansonlike properties. Thus, it is

MOL. CELL. BIOL.

ANALYSIS OF ISOLATED fos PROMOTER ELEMENT 6281

possible that its effects on transcription reflect interactionsbetween proteins bound to neighboring sites in the tandemlyrepeated structures. In agreement, recent reports (30, 54)indicate that in tissue culture, the FAP element, in its naturalarrangement, plays a role in the regulation of the basal levelof expression of the c-fos gene. The FAP element also showsa transcriptional activity which is transformation sensitive(56; Z. Siegfried and E. Ziff, unpublished data). It will be ofparticular interest to determine whether proteins binding tothe FAP oligonucleotide sequences in the c-fos promoter candifferentially interact with neighboring serum response fac-tor protein or with other serum response element-bindingproteins and to determine the contribution of such interac-tions to c-fos gene control.

ACKNOWLEDGMENTS

We thank Zahava Siegfried for critical reading of this manuscriptand for providing us with the FAP P-globin plasmids. We aregrateful to J. Wagner for the gift of A126-1B cells. We also thankHeinz Annus for excellent photographic reproduction and TonyDeMalio for careful preparation of the manuscript.Anna Velcich was a Leukemia Society Special Fellow. This work

was supported by Public Health Service grant GM-30760 from theNational Institutes of Health and grant MV 75 from the AmericanCancer Society.

LITERATURE CITED1. Angel, P. M., M. Imagawa, R. Chiu, B. Stein, R. J. Imbra, H. J.

Rahmsdorf, C. Jonat, P. Herrlich, and M. Karin. 1987. Phorbolester-induced genes contain a common cis element recognizedby a TPA-modulated trans-acting factor. Cell 49:729-739.

2. Bagchi, S., P. Raychaudhuri, and J. R. Nevins. 1989. Phospho-rylation-dependent activation of the adenovirus-inducible E2Ftranscription factor in a cell-free system. Proc. Natl. Acad. Sci.USA 86: 4352-4356.

3. Berk, A. J. 1986. Adenovirus promoters and ElA transactiva-tion. Annu. Rev. Genet. 20:45-79.

4. Berk, A. J. 1986. Functions of adenovirus Ela. Cancer Surv.5:367-389.

5. Berkowitz, L. A., K. T. Riabowol, and M. Z. Gilman. 1989.Multiple sequence elements of a single functional class arerequired for cyclic AMP responsiveness of the mouse c-fospromoter. Mol. Cell. Biol. 9:4272-4281.

6. Borrelli, E., R. Hen, and P. Chambon. 1984. Adenovirus-2 Elaproducts repress enhancer-induced stimulation of transcription.Nature (London) 312:608-612.

7. Chiu, R., M. Imagawa, R. J. Imbra, J. R. Bockoven, and M.Karin. 1987. Multiple cis- and trans-acting elements mediate thetranscription response to phorbol esters. Nature (London) 329:648-651.

8. Curran, T., and B. R. Franza, Jr. 1988. fos and jun: the AP-1connection. Cell 55:395-397.

9. Deutsch, P. J., J. P. Hoeffler, J. L. Janeson, and J. F. Habener.1988. Cyclic AMP and phorbol ester-stimulated transcriptionmediated by similar DNA elements that bind distinct proteins.Proc. Natl. Acad. Sci. USA 85:7922-7926.

10. Engel, D. A., S. Hardy, and T. Shenk. 1988. cAMP acts insynergy with Ela protein to activate transcription of the adeno-virus early genes E4 and Ela. Genes Dev. 2:1517-1528.

11. Fisch, T. M., R. Prywes, and R. G. Roeder. 1987. c-fos se-quences necessary for basal expression and induction by epi-dermal growth factor, 12-O-tetradecanoyl phorbol-13-acetate,and the calcium ionophore. Mol. Cell. Biol. 7:3490-3502.

12. Fisch, T. M., R. Prywes, and R. G. Roeder. 1989. An AP-1-binding site in the c-fos gene can mediate induction by epider-mal growth factor and 12-O-tetradecanoyl phorbol-13-acetate.Mol. Cell. Biol. 9:1327-1331.

13. Fisch, T. M., R. Prywes, M. C. Simon, and R. G. Roeder. 1989.Multiple sequence elements in the c-fos promoter mediateinduction by cAMP. Genes Dev. 3:198-211.

14. Flug, F., R. P. Copp, J. Casanova, Z. D. Horowitz, L. Janocko,

M. Plotnick, and H. Samuels. 1987. cis-Acting elements of therat growth hormone gene which mediate basal and regulatedexpression by thyroid hormone. J. Biol. Chem. 262:6373-6382.

15. Fromental, C., M. Kanno, H. Nomiyama, and P. Chambon.1988. Cooperativity and hierarchical levels of functional orga-nization in the SV40 enhancer. Cell 54:943-953.

16. Gilman, M. Z. 1988. The c-fos serum response element re-sponds to protein kinase C-dependent and -independent signalsbut not cyclic AMP. Genes Dev. 2:394-402.

17. Gilman, M. Z., R. N. Wilson, and R. A. Weinberg. 1986.Multiple protein-binding sites in the 5'-flanking region regulatec-fos expression. Mol. Cell. Biol. 6:4305-4316.

17a.Gizang-Ginsberg, E., and E. B. Ziff. 1990. Nerve growth factorregulates tyrosine hydroxylase gene transcription through anucleoprotein complex which contains c-fos. Genes Dev. 4:477-491.

18. Gonzalez, G. A., K. K. Yamamoto, W. H. Fischer, D. Karr, P.Menzel, W. Biggs, W. W. Vale, and M. R. Montminy. 1989. Acluster of phosphorylation sites on the cyclic AMP-regulatednuclear factor CREB predicted by its sequence. Nature (Lon-don) 337:749-752.

19. Grand, R. J. A. 1987. The structure and functions of theadenovirus early region 1 proteins. Biochem. J. 241:25-38.

20. Greenberg, M. E., Z. Siegfried, and E. B. Ziff. 1987. Mutation ofthe c-fos gene dyad symmetry element inhibits serum inducibil-ity of transcription in vivo and nuclear regulatory factor bindingin vitro. Mol. Cell. Biol. 7:1217-1225.

21. Greene, L. A., and A. S. Tischler. 1982. PC12 pheochromocy-toma cultures in neurobiological research. Adv. Cell. Neuro-biol. 3:373-414.

22. Hai, T., F. Liu, E. A. Allegretto, M. Karin, and M. R. Green.1988. A family of immunologically related transcription factorsthat includes multiple forms of ATF and AP-1. Genes Dev.2:1216-1226.

23. Hai, T., F. Liu, W. J. Coukos, and M. R. Green. 1989.Transcription factor ATF cDNA clones: an extensive family ofleucine zipper proteins able to selectively form DNA-bindingheterodimers. Genes Dev. 3:2083-2090.

24. Hen, R., E. Borrelli, and P. Chambon. 1985. Repression of theimmunoglobulin heavy-chain enhancer by the adenovirus-2 ElAproducts. Nature (London) 321:249-251.

25. Herrera, R. E., P. E. Shaw, and A. Nordheim. 1989. Occupationof the c-fos serum response element in vivo by a multi-proteincomplex is unaltered by growth factor induction. Nature (Lon-don) 340:68-70.

26. Hoeffler, J. P., T. E. Meyer, Y. Yun, J. L. Jameson, and J. F.Haebner. 1988. Cyclic AMP-responsive DNA-binding protein:structure based on a cloned placental cDNA. Science 242:1430-1433.

27. Hurst, H. C., and N. C. Jones. 1987. Identification of factors thatinteract with the ElA-inducible adenovirus E3 promoter. GenesDev. 1:1132-1146.

28. Hyman, S. E., M. Comb, Y.-S. Lin, J. Pearlberg, M. R. Green,and H. M. Goodman. 1988. A common trans-acting factor isinvolved in transcriptional regulation of neurotransmitter genesby cyclic AMP. Mol. Cell. Biol. 8:4225-4233.

29. Jones, N. C., P. W. J. Rigby, and E. B. Ziff. 1988. Transactingprotein factors and the regulation of eukaryotic transcription:lessons from studies on DNA tumor viruses. Genes Dev.2:267-281.

30. Konig, H., H. Pont, U. Rahmsdorf, M. Buscher, A. Schonthal,H. J. Rahmsdorf, and P. Herrlich. 1989. Autoregulation offos:the dyad symmetry element as the major target of repression.EMBO J. 8:2559-2566.

31. Lee, K. A. W., J. S. Fink, R. H. Goodman, and M. R. Green.1989. Distinguishable promoter elements containing ATF-bind-ing sites are involved in transcriptional activation by Ela andcyclic AMP. Mol. Cell. Biol. 9:4390-4397.

32. Lee, K. A. W., T. Y. Hai, L. SivaRaman, B. Thimmappaya,H. C. Hurst, N. C. Jones, and M. R. Green. 1987. A cellularprotein, activating transcription factor, activates transcriptionof multiple Ela-inducible adenovirus early viral promoters.Proc. Natl. Acad. Sci. USA 84:8355-8359.

VOL. 10, 1990

6282 VELCICH AND ZIFF

33. Lee, W., P. Mitchell, and R. Tjian. 1987. Purified transcriptionfactor AP-1 interacts with TPA-inducible enhancer elements.Cell 49:741-752.

34. Leza, M. A., and P. Hearing. 1989. Independent cyclic AMP andEla induction of adenovirus early region 4 expression. J. Virol.63:3057-3064.

35. Lillie, J. W., and M. R. Green. 1989. Transcription activation bythe adenovirus Ela protein. Nature (London) 338:39-44.

36. Lin, Y. S., and M. R. Green. 1988. Interaction of a commoncellular transcription factor, ATF, with regulatory elements inboth Ela- and cyclic AMP-inducible promoters. Proc. Natl.Acad. Sci. USA 85:3396-3400.

37. Maniatis, T., S. Goodbourn, and J. A. Fischer. 1987. Regulationof inducible and tissue-specific gene expression. Science 236:1237-1245.

38. Metz, R., J. Gorham, Z. Siegfried, D. Leonard, E. Gizang-Ginsberg, M. A. Thompson, D. Lawe, T. Kouzarides, R. Vo-satka, D. MacGregor, S. Jamal, M. E. Greenberg, and E. B. Ziff.1988. Gene regulation of growth factors. Cold Spring HarborSymp. Quant. Biol. 53:727-737.

39. Montminy, M. R., and L. Bilezikjian. 1987. Binding of a nuclearprotein to the cyclic-AMP response element of the somatostatingene. Nature (London) 328:175-178.

40. Moran, E., and M. B. Mathews. 1987. Multiple functionaldomains in the adenovirus Ela gene. Cell 48:177-178.

41. Muller, U., M. P. Roberts, D. A. Engel, W. Doerfler, and T.Shenk. 1989. Induction of transcription factor AP-1 by adeno-virus Ela protein and cAMP. Genes Dev. 3:1991-2002.

42. Ondek, B., L. Gloss, and W. Herr. 1988. The SV40 enhancercontains two distinct levels of organisation. Nature (London)333:40-45.

43. Perricaudet, M., G. Akusjarvi, A. Virtanen, and U. Pettersson.1979. Structure of two spliced mRNAs from the transformingregion of human subgroup C adenovirus. Nature (London)281:694-696.

44. Piette, J., and M. Yaniv. 1987. Two different factors bind to thea-domain of the polyoma virus enhancer, one of which alsointeracts with the SV40 and c-fos enhancers. EMBO J. 6:1331-1337.

45. Potter, H., L. Weir, and P. Leder. 1984. Enhancer-dependentexpression of human kappa immunoglobulin genes introducedinto mouse pre-B lymphocytes by electroporation. Proc. Natl.Acad. Sci. USA 81:7161-7165.

46. Prywes, R., and G. Roeder. 1986. Inducible binding of a factor ofthe c-fos enhancer. Cell 47:777-784.

47. Raychaudhuri, P., S. Bagchi, and J. R. Nevins. 1989. DNA-binding activity of the adenovirus-induced E4F transcriptionfactor is regulated by phosphorylation. Genes Dev. 3:620-627.

48. Rochette-Egly, C., C. Fromental, and P. Chambon. 1990. Gen-eral repression of enhanson activity by the adenovirus-2 Elaproteins. Genes Dev. 4:137-150.

49. Roesler, W. J., G. R. Vandenbark, and R. W. Hanson. 1988.Cyclic AMP and the induction of eukaryotic gene transcription.J. Biol. Chem. 263:9063-9066.

50. Sassone-Corsi, P. 1988. Cyclic AMP induction of early adenovi-rus promoters involves sequences required for Ela trans-acti-vation. Proc. Natl. Acad. Sci. USA 85:7192-7196.

51. Sassone-Corsi, P., J. C. Sisson, and I. M. Verma. 1988. Tran-scriptional autoregulation of the proto-oncogene fos. Nature(London) 334:314-319.

52. Sassone-Corsi, P., J. Visvader, L. Ferland, P. L. Mellon, andI. M. Verma. 1989. Induction of proto-oncogene fos transcrip-tion through the adenylate cyclase pathway: characterization of

a cAMP-responsive element. Genes Dev. 2:1529-1538.53. Schonthal, A., M. Buscher, P. Angel, H. J. Rahmsdorf, H. Ponta,

K. Hattori, R. Chiu, M. Karin, and P. Herrlich. 1989. The fosand junIAP-1 proteins are involved in the downregulation offostranscription. Oncogene 4:629-636.

54. Shaw, P. E., S. Frasch, and A. Nordheim. 1989. Repression ofc-fos transcription is mediated through p67SRF bound to theSRE. EMBO J. 8:2567-2574.

55. Sheng, M., S. T. Dougan, G. McFadden, and M. E. Greenberg.1988. Calcium and growth factor pathways of c-fos transcrip-tional activation require distinct upstream regulatory se-quences. Mol. Cell. Biol. 8:2787-2796.

56. Siegfried, Z., and E. B. Ziff. 1989. Transcription activation byserum, PDGF, and TPA through the c-fos DSE: cell type-specific requirements for induction. Oncogene 4:3-11.

56a.Siegfried, Z., and E. B. Ziff. 1990. Altered transcriptionalactivity of c-fos promoter plasmids in v-raf-transformed NIH3T3 cells. Mol. Cell. Biol. 10:6073-6078.

57. Sonnenberg, J. L., F. J. Rauscher, Ill, J. I. Morgan, and T.Curran. 1989. Regulation of proenkephalin by fos and jun.Science 246:1622-1625.

58. Stein, R. W., and J. Whelan. 1989. Insulin gene activity isinhibited by adenovirus type 5 Ela gene products. Mol. Cell.Biol. 9:4531-4534.

59. Stein, R. W., and E. B. Ziff. 1987. Repression of insulin geneexpression by adenovirus type 5 Ela proteins. Mol. Cell. Biol.7:1164-1170.

60. Treisman, R. 1985. Transient accumulation of c-fos RNA fol-lowing serum stimulation requires a conserved 5' element andc-fos 3' sequences. Cell 42:889-902.

61. Treisman, R. 1986. Identification of a protein-binding site thatmediates transcriptional response of the c-fos gene to serumfactors. Cell 46:567-574.

62. Van Buskirk, R., T. Corcoran, and J. A. Wagner. 1985. Clonalvariants of PC12 pheochromocytoma cells with defects in cyclicAMP-dependent protein kinases induce ornithine decarboxylasein response to nerve growth factor but not to adenosine ago-nists. Mol. Cell. Biol. 5:1984-1992.

63. Velcich, A., F. G. Kern, C. Basilico, and E. B. Ziff. 1986.Adenovirus Ela proteins repress expression from polyomavirusearly and late promoters. Mol. Cell. Biol. 6:4019-4025.

64. Velcich, A., and E. B. Ziff. 1988. Adenovirus Ela ras cooper-ation activity is separate from its positive and negative tran-scription regulatory functions. Mol. Cell. Biol. 8:2177-2183.

65. Velcich, A., and E. B. Ziff. 1989. The adenovirus-5 12S Elaprotein but not the 13S induces expression of the endoAdifferentiation marker in F9 cells. Oncogene 4:707-713.

66. Velcich, A., and E. B. Ziff. 1985. Adenovirus Ela proteinsrepress transcription from the SV40 early promoter. Cell 40:705-716.

67. Webster, K. A., and L. Kedes. 1990. The c-fos cyclic AMP-responsive element conveys constitutive expression to a tissue-specific promoter. Mol. Cell. Biol. 10:2402-2406.

68. Webster, K. A., G. E. 0. Muscat, and L. Kedes. 1988. Adeno-virus Ela products suppress myogenic differentiation and in-hibit transcription from muscle-specific promoters. Nature(London) 322:553-557.

69. Yamamoto, K. K., G. A. Gonzalez, W. H. Biggs, Ill, and M. R.Montminy. 1988. Phosphorylation-induced binding and tran-scriptional efficacy of nuclear factor CREB. Nature (London)334:494-498.

70. Ziff, E. B. 1990. Transcription factors: a new family gathers atthe cAMP response site. Trends Genet. 6:69-72.

MOL. CELL. BIOL.