FOLIA - UVLF€¦ · DEPARTMENT OF FOOD HYGIENE AND TECHNOLOGY STATE VETERINARY AND FOOD...

F O L I AVETERINARIA

The scientific journal of theUniversiTy of veTerinary medicine and pharmacy in Košice — The slovak republic

issn 0015-5748

Supplementum ILVI • 2012

FOLIA VETERINARIA is issued by the University of Veterinary

Medicine and Pharmacy in Košice (UVMP); address: Komenského 73,

041 81 K o š i c e, The Slovak Republic (tel.: +421 55 632 52 93,

fax: +421 55 632 52 93, E-mail: [email protected]).

The journal is published quarterly in English (numbers

1—4) and distributed worldwide.

Subscription rate for 1 year is 120 €. Orders are accepted

by The Department of The Scienti fic Information — The Library

of The University of Vete ri nary Medicine and Pharmacy in

Košice (UVIK), E-mail: [email protected]; the subscription

is accepted by the State treasure.

Bank contact: State treasure, Radlinského 32, Bratislava

15, The Slovak Republic; account number: 7000072225/8180.

FOLIA VETERINARIA, vydáva Univerzita veterinárskeho

lekárstva a farmácie v Košiciach (UVLF), Komenského 73,

041 81 K o š i c e, Slovenská republika (tel.: 055/632 52 93,

fax: 055/632 52 93, E-mail: [email protected]).

Časopis vychádza kvartálne (č. 1—4) a je distribuovaný

celo svetove.

Ročné predplatné 120 €. Objednávky prijíma Ústav vedeck-

ých infor mácií a knižnice Univerzity veterinárskeho lekárstva a

farmácie v Ko ši ciach (UVIK), E-mail: [email protected];

predplatné Štátna pokladnica (na nižšie uvedené číslo účtu).

Bankové spojenie: Štátna pokladnica, Radlinského 32,

Bratislava 15; číslo účtu: 7000072225/8180.

Tlač: Univerzita veterinárskeho lekárstva a farmácie Komenského 73, 041 81 Košice

Sadzba: Sapfo publishers, Szakkayho 1, 040 01 Košice

EV 3485/09

E D I T O R I A L B O A R D

Editor in Chief : Emil P i l i p č i n e cExecutive Editor : Jaroslav L e g á t hMembers : Baumgartner, W. (Vienna), Bíreš, J. (Košice), Buczek, J. (Lublin), Campo, M. S. (Glasgow), Cigánková,

V. (Košice), Cudlín, J. (Prague), Dianovský, J. (Košice), Huszenicza, Gy. (Budapest), Korim, P. (Košice), Kottferová, J. (Košice), Kováč, G. (Košice), Levkut, M. (Košice), Máté, D. (Košice), Mojžišová, J. (Košice), Pistl, J. (Košice), Pliešovský J. (Bratislava), Pogačnik, M. (Ljubljana), Šucman, E. (Brno), Totolian, A. A. (Saint Petersburg), Vajda, V. (Košice), Valocký, I. (Košice), Vargová, M. (Košice), Večerek, V. (Brno), Vilček, Š. (Košice)

For basic information about the journal seeInternet home pages: www.uvm.sk; www.uvlf.sk

Indexed and abstractedin AGRIS, CAB, EBSCO

FOLIA VETERINARIA

F o l i a v e t e r i n a r i aV o l . 56, Supplementum I, 2012

VYDALA UNIVERZITA VETERINÁRSKEHO LEKÁRSTVA A FARMÁCIE

KOŠICE 2012

UNIVERSITY OF VETERINARY MEDICINE AND PHARMACY IN KOŠICE

DEPARTMENT OF FOOD HYGIENE AND TECHNOLOGY

STATE VETERINARY AND FOOD ADMINISTRATION OF THE SLOVAK REPUBLIC

SLOVAK POULTRY AND EGGS ASSOCIATION

HYGIENA ALIMENTORUM XXXIII

INTERNATIONAL SCIENTIFIC CONFERENCE

Under the auspices of the Ministry of Agriculture and Rural Development of the Slovak Republic

„SAFETY AND QUALITY OF POULTRY PRODUCTS, FISH AND GAME MEAT“

May 9–11, 2012 Štrbské Pleso – Hotel Patria

Slovakia The papers published in this Supplementum have not been subjected to peer review nor have

been subjected to language correction

UNIVERSITY OF VETERINARY MEDICINE AND PHARMACY IN KOŠICEDEPARTMENT OF FOOD HYGIENE AND TECHNOLOGY

STATE VETERINARY AND FOOD ADMINISTRATION OF THE SLOVAK REPUBLIC

SLOVAK POULTRY AND EGGS ASSOCIATION

HYGIENA ALIMENTORUM XXXIII

INTERNATIONAL SCIENTIFIC CONFERENCEUnder the auspices of the Ministry of Agriculture and Rural Development of the Slovak Republic

“SAFETY AND QUALITY OF POULTRY PRODUCTS, FISH AND GAME MEAT”

May 9—11, 2012Štrbské Pleso — Hotel Patria

Slovakia

The papers published in this Supplementum have not been subjected to peer review nor have been subjected to language correction

F O L I A V E T E R I N A R I A, 56, Supplementum I, 2012

C O N T E N T S

BELEJ, Ľ., ŽIDEK, R., GOLIAN, J.: USING REAL-TIME PCR FOR SPECIES IDENTIFICATION OF HEAT TREATED PRODUCTS FROM GAME .................................................................................................................. 7

BEŁKOT Z., GONDEK M.. NUTRITIONAL VALUE OF FAT OF MECHANICALLY RECOVERED CHICKEN AND GEESE MEAT ............................................................................................................................................... 10

BRENESSELOVÁ, M., KORÉNEKOVÁ B., MAČANGA, J., MARCINČÁK, S., KOŽÁROVÁ, I.: PHYSICAL AND CHEMICAL CHANGES DURING THE RIPENING PROCESS IN QUAIL’S MEAT ........................................ 14

BUCHTOVÁ, H., JEŽEK, F.: SHELF-LIFE OF VACUUM PACKED FREEZE-THAWED FILLETS OF THE COMMON CARP (CYPRINUS CARPIO, L.) AND SILVER CARP (HYPOPHTHALMICHTHYS MOLITRIX, V.) .............................................................................................................................. 16

DOMINIK, P., SALÁKOVÁ, A., BUCHTOVÁ, H., STEINHAUSER, L.: COMPARISON OF COLOUR PARAMETRS OF DFD AND NORMAL MEAT FROM FARMED FALLOW DEER ................................................... 19

DVOŘÁK, P., BEŇOVÁ, K., ŽĎÁRSKÝ, M., MÁTÉ, D.: RADIOCESIUM IN MEAT OF THE WILD BOAR ................. 22

GODÁLOVÁ, Z., ŠMÍD, J., PIKNOVÁ, Ľ., KUCHTA, T.: MOLECULAR — BIOLOGICAL DETECTION OF SOYA IN MEAT PRODUCTS .............................................................................................................................................. 24

KACLÍKOVÁ, E., MINAROVIČOVÁ, J.: DETECTION OF SALMONELLA SPP., LISTERIA MONOCYTOGENES AND CRONOBACTER SPP. IN PRODUCTS OF ANIMAL ORIGIN USING REAL-TIME PCR BASED KITS ............................................................................................................................................... 26

KORÉNEKOVÁ, B., MAČANGA, J., KOTTFEROVÁ L., MOLNÁR, L., BRENESSELOVÁ, M., KOŽÁROVÁ, I.: COMPARISON OF THE RIPENING PROCESS IN MEAT OF FARMED AND FREE LIVING WILD DUCKS .............................................................................................................................................................. 29

KOŽÁROVÁ, I., GONDOVÁ, Z.: SCREENING OF SULPHAMETHAZINE RESIDUES IN FOOD MATRICES USING THE NAT TEST AND THE STAR METHOD ................................................................................... 31

LAUKOVÁ, A., HÁDRYOVÁ, J., IMRICHOVÁ, J., STROMPFOVÁ, V., KANDRIČÁKOVÁ, A.: ENTEROCOCCUS FAECIUM EM 41 ISOLATE FROM OSTRICHES AND ITS ENTEROCIN ...................................... 34

LUPTÁKOVÁ, O., NAGY, J., POPELKA, P., TUREK, P., NAGYOVÁ, A.: TREND ANALYSIS OF THE DEAD ON ARRIVAL AND CONDEMNATION CAUSES OF BROILER CHICKENS FROM FARM LIESKOVEC (THE SLOVAK REPUBLIC) IN THE YEARS 2006—2010 .......................................................................... 37

MARCINČÁK, S., BAČA, M., MARCINČÁKOVÁ, D., TUREK, P., NAGY, J.: QUALITY PARAMETERS OF CHILLED CHICKENS IN SLOVAK SHOPS ................................................................................................................... 39

MESARČOVÁ, L., MARCINČÁK, S., NAGY, J., BAČA, M., POPELKA, P.: EFFECT OF HERBAL EXTRACTS ADDED TO FISH GLAZE AND THE METHOD OF THAWING ON OXIDATION CHANGES IN LIPIDS IN RAINBOW TROUT FILLETS ................................................................................................... 42

NAGY, J., PAULSEN, P., LAZAR, P., TUREK, P., NAGYOVÁ, A., POPELKA, P.: COMPARISON OF SELECTED CHEMICAL COMPOSITION INDICATORS OF MOUFLON MUSCLES WITH OTHER KINDS OF WILD GAME ........................................................................................................................................... 44

NOWICKI, M., WIŚNIEWSKI, J., ANUSZ, K.: POTENTIAL USE OF MULTIPLEX PCR AS AN ADDITIONAL LABORATORY TEST IN POST-MORTEM INSPECTION OF FREE-LIVING ANIMALS ............................................. 46

ŚNIEGOCKI, T., ŻMUDZKI, J., POSYNIAK, A.: DETERMINATION OF NITROFURAN METABOLITESIN THE POULTRY MUSCLE AND EGGS BY LC-MS ........................................................................................................ 48

STARUCH, L., MATI, M.: DETECTION OF INHIBITORY SUBSTANCES IN POULTRY MEAT AND POULTRY MEAT QUALITY .......................................................................................................................................... 51

VASICKOVA, P., KRALIK, P., LAMKA, J., ZAKOVCIK, V., BICEK, J., CIHLAR, D., DVORAK, Z., LUKES, D., MACHATY, J., PISKOVSKY, R., PAVLIK, I.: PREVALENCE OF HEPATITIS E VIRUS IN POPULATION OF WILD ANIMALS AND THE RISKS FACTORS OF FOODBORNE INFECTION ASSOCIATED TO VENISON .................................................................................................................................................... 54

VAŠKOVÁ, J., FEJERČÁKOVÁ, A., MARCINČÁK, S., VAŠKO L.: CHANGES IN GLUTATHIONE LEVELS IN BROILER CHICKEN TISSUES INDUCED BY DIETARY SUPPLEMENTATION OF GAMMA LINOLENIC ACID AND SELECTED PLANT EXTRACTS .............................................................................................. 56

VOSLÁŘOVÁ, E., BEDÁŇOVÁ, I., CHLOUPEK, P., PIŠTĚKOVÁ, V., CHLOUPEK, J., VEČEREK, V.: CHANGES IN SELECTED BIOCHEMICAL INDICES IN COMMON PHEASANTS IN RESPONSE TO THEIR TRANSPORT ............................................................................................................................................................ 58

ZDOLEC, N., DOBRANIĆ, V., FILIPOVIĆ, I., MARCINCAKOVA, D.: ANTIMICROBIAL RESISTANCE OF COAGULASE-NEGATIVE STAPHYLOCOCCI ISOLATED FROM SPONTANEOUSLY FERMENTED WILD BOAR SAUSAGES ........................................................................................................................................................... 60

7

ABSTRACT

Real-time PCR method is a suitable tool for the traceability of heat processed deer meat. This method is a suitable for all opera-tions of heat treatment (cooking, frying, baking, steaming and auto-claving). The positive control was melting temperature of 80.64 °C. For the other studied samples peaks were produced by melting tem-peratures in the range from 80.64 °C to 81.58 °C, suggesting spe-cies specificity observed in products of deer samples. Using specific primers allows determination of species of meat after intensive heat treatment.

Key words: DNA; deer; heat treatment; real-time PCR

INTRODUCTION

Game meat is popular for those who want to eat healthy as it contains high proportion of easily digestible proteins, low fat and low cholesterol, finely fibrous muscle structure, has interesting fla-vour and pleasant aroma. Consumers consider venison as healthy, because, in the flesh of wild game, there are no additives, and by its labeling immediately after the hunt it traceability is assured (4). Younger consumers tend to consume less red meat and chicken and pork because of negative publicity about the safety of red meat (8). Similarly, women tend to consume less of the red meats than men, especially of venison or game meat (3). This may be linked to the disgust elicited by perception of animal origin (7) as well as their concern with the production methods employed and the ethics of killing the animals (1, 5). Game meat products are often a target

for fraudulent labeling because of the different prices between game and other meat species (2).

MATERIAL AND METHODS

Meat samples from red deer were cut into cubes of same size (2.5 cm). Raw meat samples were processed directly or stored at –20 °C until used.

Heat treatment of samplesSamples were prepared by five heat treatment techniques: A —

short baking in a pan on fat at 240 °C; B — frying in deep fat at 156 °C; C — cooking in water at boiling temperature; D — stewing in own juice with a little fat at 150 °C; E — autoclaving at 120 °C for different time intervals.

DNA extractionDNA from meat matrix was obtained using NucleoSpin®Food

Isolation Kit (Macherey-Nagel, Germany), in accordance with the manufacturer’s instructions. We used primers designed by F a j a r- d o et al. (2008). The primers used in the real-time PCR were based on 12S rRNA and 18S rRNA gene sequences from various animal species available in the Genbank database, using the Primer Express 2.0 software (Perkin-Elmer/Applied Biosystems Division, FosterCity, CA, USA). Based on mitochondrial 12S rRNA sequenc-es, three sets of primers were designed for the specific quantifica-tion of red deer (12SCEQFW-12SCEQREV).

PCR reaction was carried out in a capillary cycler LightCy-cler® 1.5 (Roche) using LightCycler software version 5.4 software (Roche). SYBR water served as negative control.

USING REAL-TIME PCR FOR SPECIES IDENTIFICATION OF HEAT TREATED PRODUCTS FROM GAME

Belej, Ľ., Židek, R., Golian, J.

Department of Food Hygiene and Safety, Faculty of Biotechnology and Food SciencesSlovak Agricultural University in Nitra, Tr. A. Hlinku, 949 76 Nitra

The Slovak Republic

[email protected]

FOLIA VETERINARIA, 56, Supplementum I: 7—9, 2012

8

RESULTS AND DISCUSSION

Based on Fig. 1, the curve representing the PCR positive control of the Central European Red Deer (Cervus elaphus) contains the characteristic peak (up to the melting point of 80.64 °C), which shows annealing of the specific primer pair. The negative control was the melting temperature of 69.74 °C. For the other studied samples are peaks created by the melting temperature in the range from 80.64 °C to 81.58 °C (Fig. 1 and 2), suggesting species specificity ob-served in products of deer samples.

ACKNOWLEDGEMENT

The work was supported by the project VEGA 1/1074/11 Authen-tication and traceability in relation to food allergens and non-allergen components, using molecular genetic methods.

REFERENCES

1. Bernue’s, A., Olaizola, A., Corcoran, K., 2003: Extrinsic at-tributes of red meat as indicators of quality in Europe: an application for market segmentation. Food Quality and Preference, 14, 265—276.

Table 1. Heat treatment of samples

No. Sample TimeHeat

treatment

1 Gravy

15 min

A2 Inner muscle

3 Edge muscle

4 Gravy

15 min

B5 Inner muscle

6 Edge muscle

7 Inner muscle

60 min

C

8 Juice

9 Inner muscle

10 Edge muscle 120 min

11 Juice

12 Inner muscle

13 Juice 180 min

14 Inner muscle

D

15 Edge muscle

16 Juice 60 min

17 Inner muscle

18 Juice 120 min

19 Inner muscle 60 min

E

20 Juice

21 Inner muscle

22 Juice 120 min

23 Inner muscle

24 Juice 180 min

Table 2. Sequence description of primers (6)

Primers Length (bp) Sequence (5´-3´) DescriptionSize(bp)

Amplicon Tm (oC)

12SCEQFW 32 CAAAAACATATAACGAAAGTAACTTTCCGACCCervus elaphus

134 76.5—78

12SCEQREV 28 AGTACTCTGGCGAATAGTTTTGTCTGCACervus eplaphus

134 76.5—78

Table 3. Composition of mastermix

Number Components Concentration Volume of one sample

(μl)

Volume of 4 samples

(μl)

126 CYBR H2O 7 28.00

232GoTaq qPCR mix

1× 12.5 50.00

275 Reddeer-F 0.5 pmol.μl-1 1.25 5.00

274 Reddeer.RW 0.5 pmol.μl 1.25 5.00

DNA 3 12.0

∑ 25 100

9

2. Brodmann, P. D., Nicholas, G., Schaltenbrand, P., Ilg, E. C., 2001: Identifying unknown game species: experience with nucleo-tide sequencing of the mitochondrial cytochrome b gene and a sub-sequent basic local alignment search tool search. European Food Research and Technology, 212, 491—496.

3. Burger, J., 2002: Daily consumption of wild fish and game: exposures of high end recreationists. International Journal of Envi-ronmental Health Research, 12, 343—354.

4. Dičáková, Z., Bystrický, P., 2009: Organoleptic properties of game (In Slovak). In Proceedings of the conference Hygiena Alimento-rum XXX, May 13—15, Štrbské Pleso, The High Tatras, 142—148.

5. Dransfield, E., 2003: Consumer acceptance — meat quality aspects. In Consistency of Quality, 11th international meat sympo-sium, Pretoria, South Africa, 146—159.

Fig. 1. Melting curves of samples

Fig. 2. Melting curves of samples and the negative control

6. Fajardo, V., González, I., Martín, I., Rojas, M., Hernandéz, E. P., García, T., Martín, R., 2008: Real-time PCR for detection and quantification of red deer (Cervus elaphus), fallow deer (Dama dama), and roe deer (Capreolus capreolus) in meat mixtures. Meat Science, 79, 2008, 289—298.

7. Kubberød, E., Dingstad, G. I., Ueland, Ø., Risvik, E., 2006: The effect of animality on disgust response at the prospect of meat preparation — an experimental approach from Norway. Food Qual-ity and Preference, 17, 199—208.

8. Russell, C. G., Cox, D. N., 2004: Understanding middle-aged consumers’ perceptions of meat using repertory grid method-ology. Food Quality and Preferences, 15, 317—329.

10

ABSTRACT

The objective of the present research was to determine nutrition-al value of fat of mechanically deboned chicken and goose meat in comparison to fat of hand trimmed meat (HTM). The samples for examinations were collected during 20 production cycles. The stud-ies were carried out on two types of mechanically deboned chickens and geese meat and two types of HTM, i. e. chicken and goose that were combined to form breast and thigh samples. The HTM meat constituted the control. Determination of saturated fatty acid (SFA) content showed significant differences in both types of mechanically deboned poultry meat (MDPM) and the manually cut-off meat. Simi-lar relationships were found in the level of polyunsaturated fatty acids (PUFA). While monounsaturated fatty acid (MUFA) contents were significantly different from those noted in the MDPM, there were no significant differences reported between the mechanically deboned and hand trimmed meat from geese. A predominant saturated fatty acid detected in all the meat types proved to be palmitic acid that accounted for approximately 70 % of total saturated fatty acids. In the MUFA group, oleic acid prevailed (C18:1), whereas in the PUFA linoleic acid (C18:2) reached the highest level; these acids made up over 90 % of total unsaturated acids. There were observed significant differences between the chicken and goose MDM fat in terms of SFA/MUFA and SFA/PUFA ratios. Goose meat as well as goose MDM derived from it were characterized by 2-fold higher MUFA content as compared to saturated acids. We found a better balance between unsaturated fatty acids (UFA) and saturated fatty acids (SFA) in the goose MDM fat than in the chicken one. However from the dietetic standpoint, chicken fat provides better quality fatty acid profile than the fat of large slaugh-ter animals. Hence, the MDM additive of both poultry species to pro-cessed meat products can serve as a good source of UFAs.

NUTRITIONAL VALUE OF FAT OF MECHANICALLY RECOVERED CHICKEN AND GEESE MEAT

Bełkot Z., Gondek M.

Department of Food Hygiene of Animal Origin, University of Life Sciences in LublinPoland

[email protected]

Key words: chicken; goose; fatty acid profile; MDPM; nutrition-al value

INTRODUCTION

In 2011 poultry production reached approximately 1420 tonnes and was by 3,3 % higher than in 2010. Relatively low price and high dietetic and nutritional value of poultry meat caused its increased consumption up to 25.5 kg per capita in 2011 (1). In Poland, the base resource for poultry farming are gallinaceous birds (hens, tur-keys) accounting for 93—95 % live poultry (5). A percentage of wa-terfowl (geese, ducks) in total poultry production is slight (5—8 %) and intended for export. A notable ratio of slaughtered poultry, be-side carcass production, is directed to processing plants. In 2011, poultry processed products (tinned meat, sausages, processed meat products) was 178.5 thousand tonnes and was comparable to 2010. In the poultry processed products, sausage rate was the highest — 103 thousand tonnes (1). The starting material for mechanically deboned poultry meat (MDPM) production are whole carcasses of spent hens and carcasses of heavy broiler chickens or only backs, wings and frames after hand trimmed breast and thigh muscles. The main raw material for MDPM manufacturing is gallinaceous poultry, whereas geese and ducks are utilized seasonally after the autumn fattening period. A choice of the method for raw material obtainment and selection of material for production has substantial influence on the chemical composition of the final product. The poultry MDPM is major material for manufacturing of homog-enized sausages, finely restructured, patties and chicken burgers. Processed poultry meat products contain by about 1/3 less fat than from meat of large slaughter animals. Products of a low fat con-


11

Table 1. Fatty acids in mechanically deboned poultry meat (MDPM) in relation to poultry species and comparison with fat of hand trimmed meat (HTM) (%) x ± s, V %, n = 20

Fatty acid

Chickens Geese

MDM HTM MDM HTM

Saturated SFA

x ± s V % x ± s V % x ± s V % x ± s V %

C 6:0 0.13a 0.06 32.78 0.06b 0.03 28.25 0.07b 0.01 14.28 0.10ab 0.03 4 1.70

C 12:0 0.14a 0.01 3.38 0.12ab 0.07 28.25 0.07b 0.02 28.57 0.12ab 0.03 25.00

C 14:0 0.60a 0.01 1.92 0.81c 0.06 7.08 0.43b 0.03 6.97 0.49b 0.07 14.28

C 15:0 0.10a 0.01 7.45 0.12a 0.03 21.79 0.06b 0.01 12.86 0.07b 0.02 14.28

C 16:0 22.70a 0.27 1.01 24.29bc 0.91 3.76 23.25ab 1.57 6.75 24.91c 1.75 7.02

C 17:0 0.19a 0.01 5.19 0.18a 0.02 1.19 0.11b 0.01 8.09 0.13c 0.03 22.25

C 18:0 7.66a 0.22 2.83 6.18b 0.50 8.13 5.89b 0.46 7.86 7.78a 0.98 12.65

C 20:0 0.12a 0.01 8.33 0.07b 0.01 10.07 0.06b 0.01 1 1.66 0.11a 0.02 15.58

C 21:0 0.26a 0.02 8.96 0.74b 0.22 30.21 * *

C:23:0 0.08a 0.01 12.96 0.18b 0.06 31.76 * *

Monounsaturated fatty acids (MUFA)

C 14:1 0.11a 0.02 19.73 0.26c 0.06 23.29 0.05a 0.01 9.11 0.07ab 0.02 14.28

C 16:1 3.51a 0.12 3.35 7.13b 0.74 10.34 3.79a 0.23 6.11 3.64a 0.42 11.44

C 17:1 0.11a 0.01 4.87 0.17b 0.01 6.51 0.11ab 0.01 9.22 0.20bc 0.09 14.50

C 18:1 39.42a 0.29 0.75 39.78a 1.00 2.50 54.36b 0.98 1.81 52.94b 2.66 5.02

C 20:1 0.44ab 0.01 3.42 0.46b 0.04 7.68 0.40a 0.06 14.52 0.42ab 0.04 9.51

Polyunsaturated fatty acids (PUFA)

C 18:2 22.59a 0.35 1.55 17.14c 0.99 5.79 9.60b 2.73 28.43 6.16d 3.08 9.75

C 18:3 1.41a 0.03 2.48 1.50a 0.10 6.74 1.35a 0.21 14.81 0.78b 0.20 25.70

C 20:2 0.22a 0.01 4.37 0.23a 0.08 33.75 0.05b 0.01 2.07 0.13c 0.05 37.42

C 20:3 * * 0.05a 0.01 0.20 0.14b 0.04 8.46

C 20:4 * * 0.19a 0.03 11.11 1.32b 0.50 38.16

Σ SFA 31.97ab 0.20 14.81 32.84b 1.35 4.81 29.94a 2.08 6.94 33.71b 2.69 7.81

Σ MUFA 43.65a 0.36 0.83 47.80c 1.63 3.41 58.71b 1.14 1.93 57.28b 2.63 4.59

Σ PUFA 24.21a 0.38 1.56 18.88c 1.13 5.99 11.21b 2.85 25.41 8.52d 2.72 31.46

Σ PUFA n 6 22.76a 0.35 1.55 17.32c 0.99 5.72 9.94b 2.71 14.52 7.64b 2.75 9.51

Σ PUFA n 3 1.24a 0.03 2.25 1.50b 0.10 6.74 1.25a 0.15 1 1.90 0.78c 0.20 25.70

Σ UFA 67.87ab 0.27 0.40 66.68b 1.30 1.95 69.94a 2.10 3.01 65.80b 2.71 4.12

Ogółem 99.83a 0.10 0.10 99.52b 0.30 0.30 99.88a 0.03 0.03 99.51b 0.19 0.19

SFA/MUFA 0.73a 1.06 1.88 0.68a 0.69 1.76 0.50b 2.5 1 3.17 0.58b 1.03 6.85

SFA/PUFA 1.32a 0.74 37.06 1.73a 1.04 2.47 2.67b 0.99 2.31 3.95c 0.99 1.90

Means denoted by different letters in superscript are significantly different in respective lines at ≤ 0.05; * — below level of detectability

12

tent are those made of whole muscles (loin, ham, formed ham etc). Whereas high fat poultry products include those with MDPM addi-tive — patties, luncheon, sausages restructured finely or moderately in which poultry fat content makes up 20—30 % of chemical com-position. Fat amount and type consumed by humans is of primary importance for prophylaxis and treatment of metabolic diseases of the cardiovascular system and cancer prevention (3). From the di-etetic standpoint, a diet high in saturated fatty acids is unfavourable. Health benefits of fats depend primarily on a polyunsaturated fatty acid content, especially the dietary n-6 and n-3 fatty acid ratio which should be 8—9 : 1 (4, 9). Poultry fats are characterized by favourable balance between polyunsaturated fatty acids (PUFA) and saturated fatty acids (SFA) — from 0.4 to 0.8 (6).

The objective of the present study was to determine nutritional value of fat of mechanically separated chicken and goose meat and to compare it to hand trimmed meat.


The researches involved mechanically recovered meat sepa-rated under high pressure to crush muscle tissue together with the skeletal hard parts (bones, cartilages, tendons) of chicken broilers and geese. The separation process was performed using the Simo deboner.

The starting material to produce MDPM comprised wings, necks and frames after manual trimming of breast muscles of chicken broilers and slaughter geese and whole goose carcasses that did not satisfy trading standards. The samples were collected dur-ing 20 production cycles. There was examined fat from two types of MDPM, i. e. of chicken and goose as well as two types of hand cut-off meat formed as combined breast and thigh muscle samples. The manually trimmed meat made control of the determinations performed.

Fatty acid analysis was made according to the Polish standards (11, 12) by gas chromatography employing a gas chromatograph Varian 450-GC.

Significance of differences between the mean values was mea-sured by the T-Tukey’s multiple confidence intervals test at P ≤ 0.05.


Results of fatty acid determination are presented in Table 1. The saturated fatty acid (SFA) contents indicated signifi-cant differences in two types of MDPM and in comparison with the manually cut-off meat. Total SFA included the following fatty acids: hexanoic, dodecanoic, myristic, pen-tadecanoic, palmitic, n-heptadecanoic, stearic, eicosanoic, heneicosanoic and tricosanoic. The basic saturated fatty acid in all the meat types under investigation was palmitic acid (C16 : 0) which constituted approximately 70 % of total amount of this fatty acid group. Its content differed signifi-cantly in relation to both types of MDPM and in comparison to the manually trimmed meat. Similar results were reported by other authors (3, 14). Determinations of monounsaturat-ed fatty acids (MUFA) showed significant differences with regard to the MDPM, whereas no differences were stated

between the goose MDM and the hand trimmed meat. The goose MDM exhibited substantially higher MUFA level as against the chicken meat. Total MUFA comprised the fol-lowing fatty acids: oleomyristic, palmitooleic, heptadeceno-ic, oleic arachidic. The major monounsaturated fatty acid in all the meat types proved to be oleic acid (C18 : 1) that constituted above 90 % of total monoenic fatty acid content. This dependence held true in two types of MDPM and in comparison to the hand cut off meat. According to literature poultry fat has high amounts of monounsaturated fatty acid (13, 14, 15). Polyunsaturated fatty acid content (PUFA) was found to differ significantly in both MDPM types and the manually trimmed meat. The goose MDM showed over twice lower PUFA level than the chicken meat. Total PUFA includ-ed the following acids: linolic, linoleic, eicosadienoic, eico-satrienoic and arachidonic. Linolic acid (C 18 : 2) reached the highest level in this fatty acid group and accounted for 93 % of total polyenoic fatty acids and 85 % in the goose MDM. The present data are consistent with research results found by other authors (2, 3, 13, 14, 15). Determination of PUFA n-6 content indicated significant differences consider-ing both types of MDPM and in comparison to the manu-ally cut off meat, whereas no differences in n-3 PUFA were found between the chicken MDM and the goose one. The World Health Organization developed detailed nutritional guidance on recommended fat intake as increased consump-tion of polyunsaturated fatty acids n-6 and n-3 is predicted and hence, maintenance of the appropriate balance between them 4—9 : 1 (9) should be emphasized. The present inves-tigations have highlighted the unfavourable ratio between these acids in the chicken MDM fat (18 : 1) but confirmed high nutritional value of the goose MDM fat (8:1) and hand trimmed meat (8—9 : 1). Similar results for chicken meat were presented by other authors (7, 10, 13), whereas, impor-tantly, K r a l i k et al. (9) reported a lower n-6 to n-3 ratio (5, 4 : 1).

The present study detected significant differences be-tween the chicken and goose MDM fat in terms of the ra-tios of SFA/MUFA and SFA/PUFA. The goose meat as well as MDM derived from it showed 2-fold lower SFA level as compared to MUFA. As for the chicken MDM, the SFA to MUFA proportion was 0.73 which corresponds to the results of other authors (3, 8, 10). Comparison of SFA to PUFA ra-tio showed nearly 1.5-fold higher SFA content in the chicken meat and 2.5-fold higher SFA in the goose MDM. The pres-ent researches have indicated better balance of unsaturated fatty acids (UFA) to saturated (SFA) in the goose MDM fat as compared to the chicken while, from the dietetic stand-point, chicken fat exhibits better fatty acid profile than fat of large slaughter animals. Therefore, additive of both poultry species MDM to processed meat products can be considered a good source of unsaturated fatty acids.

REFERENCES

1. Analizy Rynkowe, 2011: Rynek drobiu. Stan i perspektywy. Nr 40.

13

2. Bełkot, Z., Pyz-Łukasik, R., 2011: Wpływ wieku gęsi na cechy chemiczne i organoleptyczne tłuszczu. Medycyna Wet., 67, 843—846.

3. Biesiada-Drzazga, B., Janocha, A., Koncerewicz, A., 2009: Walory odżywcze tłuszczu gęsiego. Przegl. Hod., 77, 15—17.

4. Grabowski, T., Kijowski, J., 2004: Mięso i przetwory drobio-we. WNT, Warszawa.

5. Kapusta, F., 2010: Baza surowcowa drobiarstwa mięsnego w Polsce. Gosp. Mięsna, 62, 6—8.

6. Kijowski, J., 2000: Wartość żywieniowa mięsa drobiowego. Przem. Spoż., 54, 10—11.

7. Komprda, T., Zelenka, P., Tieffova, P., Stohandlova, M., Foltyn, J., Fajmonova, E., 2001: Meat quality of broilers fattened deliberately slow by cereal mixtures to higher age. 2. Total lipid cho-lesterol and fatty acid content. Arch. Geflügelk., 65, 359 —372.

8. Kralik, G., Ivanković, S., Kroić, Z., 2005: Fatty acids com-position of poultry meat produced in indoor and outdoor reading systems. Poljoprivreda, 11, 38—42.

9. Litwińczuk, A., Litwińczuk, Z., Barłowska, J., Florek, M., 2010: Surowce zwierzęce ocena i wykorzystanie. WRL, Warszawa, pp…

10. Pietrzak, D., Mroczek, J., Garbaczewska, A., Florkows-ki, T., Riedel, J., 2009: Wpływ wybranych dodatków do paszy o działaniu przeciwbakteryjnym na jakość mięsa i tłuszczu kurcząt. Medycyna Wet., 65, 268—271.

11. PN-EN ISO 5508:1996: Oleje i tłuszcze roślinne oraz zwierzęce. Analiza estrów metylowych kwasów tłuszczowych.

12. PN-EN ISO 5509:2001: Oleje i tłuszcze zwierzęce. Przy-gotowanie estrów metylowych kwasów tłuszczowych metodą chro-matografii gazowej.

13. Püssa, T., Raudsepp, P., Tomik, P., Pällin, R., Georg, U., Kuusik, S., Soidla, R., Rei M., 2009: A study of oxidation products of free polyunsaturated fatty acids in mechanically deboned meat. J. Food Comp. Anal., 22, 307—314.

14. Ristic, V. M., Freudenreich, P., Damme, K., 2008: Die che-mische Zusammensetzung des Geflügelfleisches. Fleischwirtschaft, 88, 124—126.

15. Trindade, M. A., Edurdo de Felicio, P., Contreras Castillo C. J., 2004: Mechanically separated meat of broiler breeder and white layer spent hens. Sci. Agric., 61, 234—239.

14

ABSTRACT

The aim of our study was investigation of physical and chemi-cal changes during ripening process of quails. The quails were di-vided into 3 groups of 10 quails. The first 10 quails (Group 1) were dissected and breast and thigh muscles were collected for analysis. Additional 20 quails were stored in a refrigerator at 4 °C and were analysed on day 7 (Group 2) and 14 (Group 3) of the experiment. We observed a significant decrease in lactic acid in thigh muscle (P ≤ 0.01; 0.707 ± 0.158) on day 14 compared with day 1 and significant increase in the level of lactic acid on day 7 (P ≤ 0.001; 1.001 ± 0078) compared with day 14. In the levels of phosphate we observed a sig-nificant decrease (P ≤ 0.01; 0.635 ± 0.061) on day 14 compared with day 1 and significant increase on day 7 (P ≤ 0.05; 0.730 ± 0.104) compared with day 14.

Key words: lactic acid; meat; pH; quails

INTRODUCTION

From the perspective of the consumer the Japanese quail (Coturnix japonica) is considered an attractive delicacy in various countries around the world for its taste and high nutritive and aes-thetic value. Japanese quail’s meat is characterised by low content of fat, and lower energy content (3). After killing the animals a se-ries of biochemical processes is initiated called post mortem chang-es. These processes mean that the muscle is changing to meat and are referred to as ripening process. The progress of these changes affects the final quality of meat (2). During the maturation the meat is changing from the point of view of culinary, sensorial and physi-

PHYSICAL AND CHEMICAL CHANGES DURINGTHE RIPENING PROCESS IN QUAIL’S MEAT

Brenesselová, M., Koréneková B., Mačanga, J., Marcinčák, S., Kožárová, I.

University of Veterinary Medicine and Pharmacy, Komenského 73, 041 81 KošiceThe Slovak Republic

[email protected]

co-chemical properties. The Japanese quails are also good subject for the experiments (1).

Decomposition of lactic acid causes gradual increase in pH. The actin-myosin complex dissociates, the meat remains fragile, the water content capacity increases and significantly improves the sensorial properties of meat (2). The ripening process of meat involves autolytic processes of energy components of tissue, espe-cially glycogen and adenosine triphosphate. During the degradation of glycogen in the tissue of killed animals, glycogen in the anaerobic environment degrades to lactic acid and adenosine triphosphate decomposes to phosphoric acid (6). The period of maturation is conditional on the species of animals and the temperature at which we store the meat (4).

The aim of our study was to monitor the physic-chemical chang-es during the ripening process in the meat of Japanese quails.


The experiment was carried out on 30 Japanese quails originat-ing from the farm Rozhanovce, 6 months old, divided to 3 groups with 10 birds in each. The quails were stunned and killed by bleeding and within 30 minutes transported to the Institute of meat hygiene and technology of UVMP in Košice. There all the quails were drawn, 10 of them (group 1) were dissected and the samples of the breast and thigh muscles were analysed. The remaining 20 birds were stored in a refrigerator at 4 oC and analyzed on days 7 (Group 2) and 14 (Group 3) of the experiment. We analysed water extracts of muscles. We determined pH in the meat (pH-meter, InoLab WTW 720) and by using an electrophoretic analyzer EA 102 with a conductivity de-tector we determined the levels of lactic acid and phosphates.


15


The breast muscles showed significant differences in the levels of lactic acid and phosphates. On day 14 the lactic acid level was decreased compared with day 7 of the experiment. It reached the highest level on day 7. The level of phosphates was higher on day 14 (Table 1). The lactic acid in the breast muscle was significantly lower (P ≤ 0.01) on day 14 (0.707 ± 0.158) compared with day 1 and on day 7 (1.001 ± 0.078) compared with day 14. Observation of phosphates showed significantly decreased level on day 14 (0.635 ± 0.061) com-pared with day 1 (P ≤ 0.01) and on day 7 (0.730 ± 0.104) compared with day 14 (P ≤ 0.05) compared with day 14 of the experiment (Table 1).

Table 1. The levels of lactic acid (g.100g-1) and phosphates on day 1, 7 and 14 of the ripening process in the breast and thigh muscles of Japanese quails

Mus-cles

Day 1 Day 7 Day 14

Lactic acid

Phos-phates

Lactic acid

Phos-phates

Lactic acid

Phos-phates

X (breast)

1.505 0.760 1.673 0.782 1.532 0.846

SD (breast)

0.224 0.100 0.227 0.028 0.276 0.099

X (thigh)

0.916 0.754 1.001*** 0.730* 0.707** 0.635**

SD (thigh)

0.160 0.115 0.078 0.104 0.158 0.061

* — significant at the level P ≤ 0.05; ** — significant at the level P ≤ 0.01

*** — significant at the level P ≤ 0.001

The mean level of pH in the breast muscles on day 7 of the experiment (5.934 ± 0.167) was decreased significantly (P ≤ 0.05) compared with day 14 and the mean level of pH in the thigh muscles was significantly higher on day 1 (7.014 ± 0.075; P ≤ 0.010) compared with the day 7 (Table 2).

Table 2. The level of pH on day 1, 7 and 14 of the ripening process in the breast and thigh muscles of Japanese quails

Muscles Day 1 Day 7 Day 14

pH pH pH

X (breast) 6.034 5.934* 6.064

SD (breast) 0.118 0.167 0.103

X (thigh) 7.014*** 6.653 6.850

SD (thigh) 0.075 0.133 0.274

* — significant at the level P ≤ 0.05; *** — significant at the level P ≤ 0.001

Dynamics of pH values which showed the most signifi-cant decrease on day 7 of the experiment was caused by increased levels of lactic acid. In the process of anaerobic glycolysis, which progresses during conversion of muscle to meat, glycogen is degraded to lactic acid. Increased level of lactic acid in the ripening process causes a significant de-crease in the level of pH in the muscles (5).

CONCLUSION

Our experiment showed higher levels of lactic acid and phosphates in the breast muscles compared to thigh muscles and the level of pH reflected the increased and subsequently the decreased level of lactic acid. The level of lactic acid in-creased and peaked on day 7 of the experiment.

ACKNOWLEDGEMENT

This study was supported by the projects VEGA 1/0648/11 and VEGA 1/0939/12.

REFERENCES

1. Cigánková, V., Almášiová, V., Holovská, K., 2010: Mor-phological changes in Japanese quail duodenal epithelium after chronic cadmium exposure, Polish Journal of Environmental Study, 19, 275—282.

2. Gál, R., 2004: Evaluation of Selected Characteristics of Meat and Game. Doctoral dissertation thesis, Brno, 157 pp.

3. Lagin, L., Lopašovský, L., 2008: Technology of Meat, Meat processing 2 (In Slovak), SPÚ Nitra, 150 pp.

4. Sopková, D., Várady, J., Pástorová, B., Staníková, A., Kožárová, I., 2002: Stress and amino-acid values of poultry meat. Folia Veterinaria, 46, 53—54.

5. Stringer, M., Dennis, S., 2000: Chilled Food — Comprehen-sive Guide. Cambridge, England, 487 pp.

6. Winkelmayer, R., Lebersorger, P., Zedka, H. F., Forejtek, P., Vodňanský, M., Večerek, V. et al., 2005: Hygiene of Game. Cen-tral institute of ecology of game, Wien-Brno-Nitra, 168 pp.

16

ABSTRACT

The aim of this work was to monitor chemical changes in vacu-um-packed freeze-thawed fillets of the common carp (Cyprinus Car-pio L.) and silver carp (Hypophthalmichthys molitrix Val.). Vacuum-packaged thawed samples of muscle tissue were stored at 2 ± 2 °C for 11 days. The experiment showed that the processes were different in freeze-thawed vacuum-packed fillets of both common and silver carp compared with the fresh meat and thus freeze-thawed meat cannot be recommended for vacuum packing if its purpose is shelf-life extension.

Key words: lipid oxidation; shelf-life; thawed fish; total volatile basic nitrogen

INTRODUCTION

Contrary to deep-frozen fish meat, fresh fish has only very lim-ited shelf life (1). Freezing is the preferred treatment if fish is to be transported over long distances. In justified cases, the freezing of fish is a necessary veterinary hygiene requirement (Regulation EC No. 1276/2011). Frozen fish can also be marketed to the final consumer as freeze-thawed products. There are no legal regulations prohibiting the marketing of such fish as long as the customer is informed that the fish he is buying has been freeze-thawed (Regula-tion EC No. 1169/2011). In the Czech Republic (CR), the use-by date of unpackaged chilled freeze-thawed fish is usually set on the second day after the product was sold; in that case the short use-by period guarantees that the product is safe. If freeze-thawed fish mus-cle is vacuum-packed, its shelf life is extended up to 7 days, which may have a negative effect on the product quality. In the CR, only

limited attention is given at present to shelf life of freeze-thawed fish muscle.

The aim of this work was to monitor changes in vacuum-packed freeze-thawed fillets of common carp and silver carp, and to statisti-cally compare the results with values published for vacuum-packed fresh muscle tissues of the same fish species (2).

MATERIALS AND METHODS

Common carp and silver carp samples were obtained from Rybníkářství Pohořelice a. s., and they were processed by a stan-dard procedure. Chilled (2 ± 2 °C) unskinned fillets were vacuum packed, labelled, frozen at –40 °C to muscle core temperature of –18 °C and stored at –18 °C for 7 days. Frozen fish samples were then thawed in a cold chamber at 2 ± 2 °C and kept at this tempera-ture for 11 days. The samples were analyzed on days 1, 2, 4, 7, 9 and 11 after thawing. The parameters investigated in the samples included water activity a

w using LabMaster-aw (Novasina Ltd., Swit-

zerland), total volatile basic nitrogen (TVBN) and nitrogen trimeth-ylamine (N-TMA) using Kjeltec 2300 (FOSS Analytical AB, Swe-den). Free fatty acids (FFA, in accordance with CSN ISO 660) and peroxide values (PV, according to CSN ISO 3960) were determined after fat extraction with diethyl ether. The thiobarbituric acid assay (TBA) was determined by the distillation method and the oxidation products were quantified as malondialdehyde equivalents.

Values measured in thawed fillets on individual sampling days were statistically compared using unifactorial ANOVA analysis of variance (Microsoft Office EXCEL 2007) with the results obtained from vacuum packed chilled fillets of the same fish species.

SHELF-LIFE OF VACUUM PACKED FREEZE-THAWED FILLETS OF THE COMMON CARP (CYPRINUS CARPIO, L.) AND SILVER CARP

(HYPOPHTHALMICHTHYS MOLITRIX, V.)

Buchtová, H., Ježek, F.

Department of Meat Hygiene and Technology, Faculty of Veterinary Hygiene and EcologyUniversity of Veterinary and Pharmaceutical Sciences in Brno, Palackého tř. 1/3, 612 42, Brno

The Czech Republic

[email protected]


17

Table 1. The course of chemical changes in vacuum-packed freeze-thawed fillets of the common carp-CC (Cyprinus Carpio) and silver carp-HM (Hypophthalmichthys molitrix)

Inde

x Day1

Mean ± SD2

Mean ± SD4

Mean ± SD7

Mean ± SD9

Mean ± SD11

Mean ± SDFish

a w

CC

0.997 ± 0.01 0.998 ± 0.00 0.998 ± 0.00 0.996 ± 0.00 0.997 ± 0.01 0.995 ± 0.00

–0.029** –0.028** –0.024** –0.028** –0.027** –0.024**

HM

0.973 ± 0.00 0.978 ± 0.00 0.979 ± 0.00 0.973 ± 0.00 0.979 ± 0.00 0.980 ± 0.00

0.008** 0.005** 0.006** 0.014** 0.006** 0.004*

TV

BN

mg.

100g

-1

CC

20.21 ± 1.02 20.88 ± 1.30 19.64 ± 1.81 19.92 ± 1.40 20.47 ± 1.39 23.74 ± 2.54

0.39 –0.45 –0.12 1.58 4.20** 2.83

HM

18.45 ± 0.71 17.71 ± 0.96 18.37 ± 0.49 18.71 ± 0.56 18.84 ± 0.88 19.40 ± 0.52

–2.51** –2.45** –2.47** –1.41* 0.58 1.60

TM

A m

g.10

0g-1

CC

11.50 ± 1.04 11.87 ± 0.73 11.14 ± 0.94 11.40 ± 1.10 11.86 ± 0.82 14.95 ± 1.81

–2.61** -3.95** –4.38** –4.62** –1.54** –2.44

HM

12.06 ± 1.58 11.72 ± 1.22 11.89 ± 0.58 11.88 ± 0.57 12.19 ± 0.96 11.70 ± 0.37

–3.27** –3.21** –2.74** –2.10* –1.02 0.52

1 FF

A

CC

1.07 ± 0.24 1.30 ± 0.48 2.11 ± 0.68 1.61 ± 0.33 1.79 ± 0.56 2.80 ± 1.00

2.69** 3.42** 2.03** 5.51** 4.79** 3.90**

HM

4.88 ± 0.52 3.30 ± 0.59 5.02 ± 1.12 5.57± 1.43 3.63 ± 0.06 6.71 ± 0.85

–3.44** –2.10** –3.91** –4.30** –2.01** –4.96**

PV

m

ekvO

2.kg

-1 CC

1.19 ± 0.53 1.27 ± 0.50 3.30 ± 1.11 2.55 ± 0.45 2.12 ± 0.55 3.40 ± 2.29

3.39** 4.47** 2.81** 13.85** 8.33** 5.93**

HM

7.47 ± 4.73 7.40 ± 2.24 12.45 ± 11.78 10.86 ± 12.02 5.65 ± 2.00 7.25 ± 1.30

–1.47 0.21 –7.32* –4.62 1.08 –1.64*

TB

A

mg.

kg-1

CC

8.14 ± 3.22 9.71 ± 2.48 13.37 ± 4.55 10.76 ± 6.46 16.10 ± 8.81 9.89 ± 7.28

2.89 5.72** –6.64* –4.09 –10.13 –1.86

HM

10.45 ± 5.40 13.14 ± 4.93 19.59 ± 6.23 18.09 ± 10.38 18.16 ± 13.86 34.60 ± 25.69

–4.46** –4.55** –7.97** –3.16 –1.74 –19.75*

Italics denote the difference obtained by subtracting freeze-thawed fillet values from fresh fillet values of that parameter, with the asterisks identifying statistical significance of that difference (** — P < 0.01; * — P < 0.05). 1 — FFA as % total lipids of oleic acid


Throughout the experiment the water activity (aw) in

freeze-thawed common carp fillets was higher (P < 0.01) than in the fresh vacuum-packed fillets contrary to silver carp, where a

w values of freeze-thawed fillets were lower (P < 0.01).

We may hypothesize that the available “free” water in silver carp fillets may have been metabolized by contaminating mi-croorganisms (Pseudomonas sp.) during the experiment. The intensity of proteolytic changes (TVBN) in freeze-thawed carp fillets was practically the same as in the fresh meat. In silver carp, protein decomposition was more intensive in

18

freeze-thawed fillets than in fresh meat. Proportions of TMA increased in both fish species (Tab. 1). Hydrolysis (FFA) and primary lipid oxidation (PV) in freeze-thawed common carp fillets were significantly (P < 0.01) slower throughout the ex-periment than in fresh muscle tissues. In silver carp, the prog-ress of fat lipolysis in freeze-thawed fillets (FFA) was faster compared with the fresh meat (P < 0.01), which may have been due to fillet contamination with lipolytic bacteria (lacto-bacilli). In both freeze-thawed and fresh silver carp fillets, the production of primary oxidation products (PV) was practi-cally the same, in contrast with secondary oxidation (TBA), which was more intensive in freeze-thawed samples especially at the beginning and at the end of the experiment (Tab.1).

The experiment showed that the processes were differ-ent in freeze-thawed vacuum-packed fillets of both common and silver carp compared with the fresh meat. Besides the absence of oxygen, the factors influencing the intensity of decomposition and oxidation processes in lipids (FFA, PV, TBA) were interspecies differences in chemical composition (water/fat) and, in the case of fat, also differences in fatty

acid spectra. In view of the differences in the processes dis-cussed in this work, freeze-thawed meat of neither common carp nor silver carp can be recommended for vacuum pack-ing if its purpose is shelf-life extension.

ACKNOWLEDGEMENTS

This study was supported by the Research Plan MSM 6215712402.

REFERENCES

1. Bremner, H. A., 2002: Safety and Quality Issues in Fish Processing. Woodhead Publishing Limited. Cambridge, England, 507 pp.

2. Ježek, F., Buchtová, H., 2011: Physicochemical changes of chilled simple and vacuum packaged muscle tissue of silver carp (Hypophthalmichthys molitrix, V.) (In German). Fleischwirtschaft, 1, 94—98.

19

ABSTRACT

The aim of this study was to evaluate the colour of DFD (dry, firm, dark) and normal meat of farmed fallow deer and analyse haem pigment in musculus gluteus medius. Colour parameters (L* — light-ness, a* — redness, b* — yellowness) and haem pigment (Hornsey method) were measured in DFD meat (pH over 6.2) and normal deer meat (pH < 6.0). Colour parameters and values of pH were measured during 48 hours. We found significant differences (P < 0.001) be-tween DFD and normal meat in all pH values and in all L* values dur-ing 48 hours. Differences in a* values were in the time of 0 h and 48 h (P < 0.01) and of b* value in the time of 48 h. Other significant differ-ences were in the time of 0 h and 24 h (P < 0.001) of b* values. DFD meat of farmed fallow deer had the lowest L* value and the lowest b* value, but the highest pH value. Significant difference (P < 0.05) was found in haem pigments.

Key words: CIELab; DFD; farmed fallow deer; meat

INTRODUCTION

Farming fallow deer is becoming a widespread practice largely due to the high quality of fallow dear meat and the fact that it is an undemanding animal which adapts well to various conditions. Fal-low deer meat is delicately fibrous and has a low content of connec-tive tissue compared to common farm animals (4). The DFD quality deviation assessment is sensorial; the meat is very dark, sticky and dry in the sense of absence of fresh cut meat juice due to superior binding capacity of DFD meat. The pH

ult value is a reliable criterion

for an objective assessment which is in terms of our technology

COMPARISON OF COLOUR PARAMETRS OF DFD AND NORMAL MEAT FROM FARMED FALLOW DEER

Dominik, P., Saláková, A., Buchtová, H., Steinhauser, L.

Department of Meat Hygiene and Technology, Faculty of Veterinary Hygiene and EcologyUniversity of Veterinary and Pharmaceutical Sciences Brno, Palackého tř. 1/3, 612 42, Brno

The Czech Republic

[email protected]

practically identical with pH24

. With DFD meat the pH24

values are higher than 6.20. This criterion reliably indicates the worst quality DFD meat, which is associated with reduced shelf life, perishability and contamination with micro-organisms (3).

The incidence of DFD in farmed fallow deer used to be rela-tively high because these animals have not been fully domesticated. Conventional slaughter and pre-slaughter manipulation is for them a strong stressing factor (1).

The aim of this study was to evaluate the colour of DFD meat from farmed fallow deer and compare it with normal farmed fallow deer meat focusing on the content of haem pigments which affect the overall colour of meat.


Samples for the experiment came from farmed fallow deer – part of leg (musculus gluteus medius). All examined animals origi-nated from a farm in the South Moravia region of the Czech Repub-lic and were slaughtered in September/October 2010 in approved registered slaughterhouses. Based on the measurement of pH we selected 10 specimens that suited the condition defects DFD meat (pH > 6.2). The meat samples with the normal ageing were selected for comparison from 10 animals of similar age (18 months), weight (mean weight 28 kg), and especially gender (males). The pH and co-lour were measured 24 hours after the slaughter (ultimate value) — marking pH

0 equals pH

ult, together with the colour parameters. Sub-

sequent measurements were performed after 24 and 48 hours under considerable variations in the ageing.

Muscle pH was measured by injection electrode (Double Pore, Hamilton, USA) using a digital pH-meter WTW 340i (WTW


20

GmbH, Germany). Colour was measured by a spectrophotometer Konica Minolta CM 2600d (Minolta, Japan). The content of haem pigments was determined by the method of H o r n s e y (2), mea-suring the absorbance at 640 nm. The results were processed by statistical software Minitab 6.


Meat from farmed fallow deer is generally dark (lightness L* < 40, higher values of the red colour a* and lower pro-portion of yellow colour b*) and therefore it is important to measure the pH value of the meat to prevent confusion with DFD meat (6, 7). Table 1 shows the colour values (L*, a*, b*) and pH measured within 48 hours. The table shows dif-ferences between normal and DFD meat colour in the mea-sured parameters, pH and haem pigments. Most of these pa-rameters differed significantly (P < 0.001). The values of co-lour parameters a*

0, a*

48 and b*

48 were significantly different

(P < 0.01). Only the colour parameter a*24

showed no signifi-cant difference. Significant difference (P < 0.05) was found

also between the content of haem pigments. The colour of DFD meat was darker, less yellow, but red was variable with-in 48 hours. Values of L* and b* were lower for DFD meat while a* values at the DFD within 48 hours increased, but at normal meat a* values decreased. The a* values of DFD meat differed significantly (P < 0.05) over time (0 h→48 h) and the normal meat (P < 0.05) at times of 0 h→48 h and 24 h→48 h. Also in yellow colour we found significant dif-ferences over time for DFD meat with increasing value in the normal meat. The DFD meat differed significantly regarding b* in time of 0 h→24 h and 0 h→48 h (P < 0.05) and nor-mal meat only during time of 0 h→24 h (P < 0.05).

Previous studies showed that pHult

of venison varied from 5.5 to 5.75 such as in farm animals (5, 8). Our results were higher probably due to stress of pre-slaughter manipulation. The principal reason was cutting antlers of males to ensure safety of personnel when manipulating with animals. In short time (several hours) after cutting the antlers the animals were slaughtered which resulted in the DFD defect. The content of haem pigments was higher in the DFD meat but a direct effect on the colour has not been demonstrated.

Table 1. Values of pH, L*, a*, and b* within 48 hours and the content of haem pigments for DFD and normal meat from farmed fallow deer

Meat of farmed fallow deer

DFD Normal P value

Parameters Mean ± SD Mean ± SD P <

pH

0 h 6.978 ± 0.26 5.894 ± 0.17 0.001

24 h 6.841 ± 0.36 5.928 ± 0.13 0.001

48 h 7.122 ± 0.34 5.888 ± 0.05 0.001

L*

0 h 27.513 ± 1.85 33.726 ± 1.42 0.001

24 h 28.262 ± 2.87 36.132 ± 3.80 0.001

48 h 28.142 ± 3.01 35.451 ± 3.89 0.001

a*

0 h 10.633b ± 1.56 13.628a ± 1.93 0.01

24 h 12.177 ± 2.01 12.220a ± 1.41 NS

48 h 12.928a ± 1.85 10.608b ± 0.65 0.01

b*

0 h 5.864a ± 1.03 10.042b ± 1.14 0.001

24 h 7.310b ± 1.65 11.698a ± 1.84 0.001

48 h 7.732b ± 1.71 10.872 ± 1.87 0.01

Content of haem pigments (mg.g-1)

3.553 ± 0.80 2.451 ± 1.22 0.05

NS — not significant (P ≥ 0.05); SD — standard deviation; letters in superscript indicate significant differences in the column — the dynamic assessment within 48 hours (P < 0.05)

21

ACKNOWLEDGEMENT

The study was supported by the Ministry of Education, Youth and Sports of the Czech Republic, Grant No. MSM6215712402, Veterinary Aspects of Food Safety and Quality.

REFERENCES

1. Fabiansson, S., Ericsson, I., Reutersward, A., 1984: The incidence of dark cutting beef in Sweden. Meat Sci., 10, 21—28.

2. Hornsey, H. C., 1956: The colour of cooked cured pork. I. Estimation of the nitric oxide-haem pigments. J. Sci. Food Agric., 7, 534—540.

3. Lawrie, R. A., 1998: Lawrie’s Meat Science. 6th edn., Woodhead Publishing Ltd., 356 pp.

4. Mojto, J., Kartousek, V., Palanská, O., Zaujec, K., 1999: Quality of butcher’s body and discarded meat of young fallow deer females in farm breeding. Folia Venatoria, 28—29, 57—63.

5. Pollard, J. C., Littlejohn, R. P., Aster, G. W., Pearse, A. J. T., Stevenson-Barry, J. M., McGregor, S. K. et al., 2002: A com-parison of biochemical and meat quality variables in red deer (Cer-vus elaphus) following either slaughter at pasture or killing at a deer slaughter plant. Meat Sci., 60, 85—94.

6. Ryu, Y. C., Kim, B. C., 2006: Comparison of histochemi-cal characteristics in various pork groups categorized by postmor-tem metabolic rate and pork quality. J. Anim. Sci., 84, 894—901.

7. Volpelli, L. A., Valusso, R., Morgante, M., Pittia, P., Pias-entier, E., 2003: Meat quality in male fallow deer (Dama dama): effects of age and supplementary feeding. Meat Sci., 65, 555—562.

8. Wiklund, E., Nilsson, A., Ahman, B., 2000: Sensory meat quality, ultimate pH values, blood metabolites and carcass param-eters in reindeer (Rangifer tarandus tarandus L.) fed various diets. Rangifer, 20, 9—20.

22

ABSTRACT

We observed activity of 137Cs in the wild boar (Sus scrofa) meat from different locations of the Czech Republic during the period from 2002 to 2011. We detected significant inter-annual variation depen-dent on the season. Results from the year 2011 from the Šumava loca-tion showed that the maximum allowed limit was exceeded multiple times.

Key words: 137Cs; food safety; ionizing radiation

INTRODUCTION

After the gradual reduction in the radiocaesium activity (137Cs) in meat of game animals in the nineties, an unexpected growth after floods in North-Eastern Moravia in July 1997 was observed. The ac-tivities randomly exceeded the allowed limit of 600 Bq.kg-1 in meat of the wild boar, particularly in the age group under one year. After year 2000 the activities decreased again and corresponded to those before the floods (4).

A seasonal variability of 137Cs activities in samples of wild boar meat was found. The fluctuation was characterized by a higher number of results exceeding the activity limit (over 600 Bq.kg-1 in muscle) in two summer (March and September) periods (26 % and 24 %) and a lower portion of such limit-exceeding samples in three winter periods (9.3 %, 7.9 %, and 1 %). The median in muscle was 129 Bq.kg-1, the maximum activity was 5573 Bq.kg-1 (3).

Analysis of musculature of 656 wild boars shot in the Ravens-burg district (Southern Germany) between 1998 and 2008 showed high variations, ranging from less than 5 to 8266 Bq·kg-1 depending

RADIOCESIUM IN MEAT OF THE WILD BOAR

Dvořák, P.1, Beňová, K.2, Žďárský, M.1, Máté, D.2

1University of Veterinary and Pharmaceutical Sciences Brno, Palackého tř. 1/3, 612 42, BrnoThe Czech Republic

2University of Veterinary Medicine and Pharmacy, Komenského 73, 041 81 KošiceThe Slovak Republic

[email protected]

on the season, weather conditions and the related changes in di-etary habits and the availability of feed (5). L a t i n i (2) pointed to limit-exceeding results in wild boars in the areas of the Šumava National Park Administration and Protected Landscape Area. The findings were consistent with the results from the German side of Šumava.


Wild boars (Sus scrofa) weighing 5 to 100 kg originated from various locations in the Czech Republic. To determine the 137Cs ac-tivity depending on the season, 24 muscle samples from wild boars weighing 20 to 100 kg were collected from two hunting grounds in the Odra Hills, Šabrava and Dvorce locations, in the period from 11/08/2006 to 04/03/2008.

The 137Cs activity was determined by a gamma-spectrometric system with HPGe GC2020 semiconductor detector (20 % rela-tive efficiency; 1.8 keV resolution at 1.3 MeV), Canberra Inspector MCA, verified by the Czech Metrological Institute.


The maximum radiocaesium activity of 603 Bq.kg-1 in hogget meat from Velké Losiny (Northern Moravia) in 2002 is shown in Table 1. The limit activity for the post-Chernobyl radiocaesium was slightly exceeded, which corresponds to the results presented by O b z i n a (4). The radiocaesium activities in two wild boars coming from Staré Ransko (Bohe-


23

Table 1. Activity of 137Cs in wild boars from different locations in the Czech Republic between 2002 and 2005

Kindand

occurrence

Activity 137Cs

Bq.kg-1

ua

%

Activity 40K

Bq.kg-1

ua

%

Northern Moravia, Velké Losiny 2002

hogget 603 2.8 232 3.2

Southern Bohemia, 2003, Přízeň near Krumlov

piglet — 5 kg 237 2.7 151 3.3

piglet —10 kg < 0.4* — 257 3.3

Bohemian-Moravian Upland, 2004, Staré Ransko

piglet 103 3.6 286 3.6

hogget 89 3.4 120 5.3

Podivín (Břeclavsko), 2004

4 piglets, 15 to 22 kg < 0.4* —159 to 398

3.2

hogget 52 kg < 0.4* — 148 3.3

Southern Bohemia, 2005

piglet — Rožmberk 0.8 30.0 155 3.3

piglet — Horní Jílovec 32 3.4 154 3.3

piglet — Rožmberk-Švýcarák1

35 3.4 146 3.3

piglet — Rožmberk-Švýcarák2

38 3.1 153 3.2

3 piglets — Hrudkov and Jiříčko

< 0.4* —155 to

1913.3

piglet — Ostrov, Větrná

341 2.7 210 3.3

Šumava, 2011

hogget 40 kg 4 770 4.0 71 5.,0

piglet 10 kg 5 620 2.3 177 4.4

piglet 8 kg 2 050 2.4 66 4.5

* — MDA (minimum detectable activity) for the Marinelli beaker (MDA) is 0.4 Bq.kg-1.

mian-Moravian Uplands) were also presented. Higher activ-ity of radiocaesium of 103 Bq.kg-1 was found in pig meat. The radiocaesium activity of 89 Bq.kg-1 was found in hogget leg.

Furthermore, the results measured in samples from the

Podivin location (Břeclavsko) in 2004 are shown. The ac-tivities below the minimum detectable activity of 137Cs, i. e. 0.4 Bq.kg-1 were determined in five observed wild boars. The potassium activity, 40K ubiquitarian isotope, ranged from 148 to 398 Bq.kg-1. Since radiocaesium behaves both in food chains and in metabolism in the same way as potassium, it is clear that these wild boars were from uncontaminated areas. Table 1 lists the results of radicaesium activities in meat of 10 wild boars from Southern Bohemia. The highest radiocae-sium activity of 341 Bq.kg-1 was found in a piglet (2005). The average radiocaesium activity found in wild boars in this area was 119 Bq.kg-1 in 2003 and 56 Bq.kg-1 in 2005. The results showed significant annual fluctuations in the respective area. In contrast, the results from 2011 in Šumava exceed the al-lowed limit multiple times. It was interesting that some boars demonstrated low activity of 40K, which may be associated with a lack of potassium in fodder, and thus a higher ability to deposit radiocaesium. Observations of 24 wild boars from Odra Hill (Dvorce and Šabrava) showed that the values of 137Cs activity in their meat ranged from minimum detection activity (MDA) to 286 Bq. kg-1. Of these boars, five had the activities below the MDA (0.9 Bq.kg-1). The median was 7 ± 66.7 Bq.kg-1. Dependence of radiocaesium accumulation on the month of killing corresponds to the results published by H o h m a n n and H u c k s c h l a g (3). The origin of ra-diocaesium in meat of wild boars has been associated with the consumption of Jelenka underground fungi, Elaphomyces granulatus, the sought-after food source of wild boar piglets capable of extreme accumulation of radiocaesium (1, 3).

ACKNOWLEDGEMENTS

This study was funded by the Ministry of Education, Youth and Sports of the Czech Republic, under grant No. MSM6215712402

REFERENCES

1. Dvořák, P., Snášel, P., Beňová, K., 2010: Transfer of ra-diocaesium into wild boar meat. Acta Veterinaria Brno, 79, Suppl., 85—91.

2. Latini, T., 2011: Occurrence of radioactivity in wild boars (In Czech). Maso, 5, 24—26.

3. Hohmann, U., Huckschlag, D., 2005: Investigations on the radicaesium of wild boar (Sus scrofa) meat in Rhineland — Palatine: a stomach content analysis. European Journal of Wildlife Research, 51, 263—270.

4. Obzina, J., 2002: Radiocaesium findings in meat of game hunted in years 1992—2002 in regions Šumperk and Jeseník (In Czech). Attestation work, Veterinary and Pharmaceutical Univer-sity in Brno, 35 pp.

5. Semizhon, T., Putyrskaya, V., Zibold, G., Klemt, E., 2009: Time-dependency of the 137Cs contamination of wild boar from a region in Southern Germany in the years 1998 to 2008. Journal of Environmental Radioactivity, 100, 988—992.

24

ABSTRACT

Food allergy, an adverse immune response to a food protein, is an important health problem in industrialized countries. Undeclared allergenic food components as contaminants in food products pose a major risk for sensitized persons. Reliable detection and quantifica-tion methods for food allergens are necessary to ensure compliance with food labelling and improve consumer protection. A sensitive qualitative detection method for soybeans in foods by using real-time polymerase chain reaction (Real-time PCR) was developed. The pres-ence of soya DNA was determined with two pairs of specific oligo-nucleotides amplifying soya lectin L2 gene. Limit of detection was 2.75 pg and practical detection limit was 0.02 %.

Key words: allergy; real-time PCR; soya

INTRODUCTION

Soya (Glycine max) is considered an important allergenic food or food component. Soya is widely used in the food industry, in par-ticular as texturiser, emulsifier and protein filler (in meat products). For example, lecithin is used as an emulsifier (E 322). Soya is a rec-ognized allergen which has to be labelled if present in foodstuffs ac-cording to the European Directive of the European Parliament and Council Directive 2003/89/EC amending Directive 2000/13/EC (3, 6). Allergy to soya is caused by proteins (storage proteins) of the vicilin and legumin in the seeds. Technological processes of food production may convert their structure and change the allergenic-ity of foods (1, 4). Besides immunochemical methods, DNA-based food analytical methods using real-time polymerase chain reaction

MOLECULAR — BIOLOGICAL DETECTION OF SOYA IN MEAT PRODUCTS

Godálová, Z., Šmíd, J., Piknová, Ľ., Kuchta, T.

Food Research Institute, Priemyselná 4, 824 75 BratislavaThe Slovak Republic

[email protected]

(real-time PCR) have become widely applied to identify of soya in food — for the analysis of allergens in food.


The samples used were as follows: soya (different cultivars), plants of the family Fabaceae and non-Fabaceae and the model samples: meat pie with 0.01 %, 0.02 %, 0,05 %, 0.1 %, 0.2 %, 0.5 %, 1 %, 2 %, 5 %, 10 % (wet weight/wet weight) of soya in individual samples and different meat products.

DNA extractionEach material was homogenized and a sample was taken for

analysis. DNA was extracted from the samples using the CTAB method (7) or chaotropic solid-phase extraction using NucleoSpin kit (Macherey-Nagel, Germany). DNA concentration was deter-mined spectrophotometrically at λ = 260 nm.

Real-time polymerase chain reactionAmplifiability of the extracted DNA was checked by a universal

eukaryotic system using primers TR03 (tctgccctatcaactttcgatgga), TR04 (aatttgcgcgcctgctgccttcctt) and probe TRPb (FAM — ccgtttct-caggctccctctccggaatcgaacc — TAMRA) (2). Specific amplification of lectin gene was performed by a lectin system using primers Le2F (ccagcttcgccgcttccttc), Le2R (gaaggcaagcccatctgcaagcc) and probe Le2P (FAM-cttcaccttctatgcccctgacac-TAMRA). It was performed in 25 μl volumes, each reaction contained 1× reaction buffer for the polymerase (Biotium, Hayward, CA, USA), 2.5 mmol.l-1 MgCl

2,

0.2 mmol.l-1 dNTP mixture (GeneAmp, Applied Biosystems Foster City, CA, USA) 300 pmol.l-1 of each primer, 200 nmol.l-1 probe and


25

1 U Cheetah Hot Start Taq DNA polymerase (Biotium). Real-time PCR was carried out in a GeneAmp PCR cycler 7900 (Applied Biosystems), or in an iQ5 Multicolor Real-Time PCR (Bio-Rad, Ser-gate, Italy). Negative control samples consisted from the master mix only with no DNA added.


We tested two methods for DNA extraction. Better re-sults (yield and purity) were obtained with the NucleoSpin kit.

Three analytical parameters of each method were as-sessed: limit of detection, practical detection limit and detec-tion of soya in food samples. The detection limit of DNA

from raw soybean was determined to be 2.75 pg per sample. The practical detection limit, which is the minimum detect-able amount of soya in model samples (meat pie), was deter-mined to be 0.02 %. An important parameter reflecting speci-ficity and sensitivity is the threshold cycle (Ct). Positive Ct values were between 21 and 36. The method was applied to 29 meat commercial products (Table 1). The method is spe-cific for soya (100 % inclusivity and 100 % exclusivity) and is suitable for qualitative analysis of soya in meat products.

ACKNOWLEDGEMENTS

The work was supported by EU Structural Funds project “Use of scientific knowledge for high-quality and healthy foods”, ITMS code 26240220013.

REFERENCES

1. Breiteneder, H., Radauer, Ch., 2004: A classification of plant food allergens. J. Allergy Clin. Immunol., 113, 821—30.

2. Brežná, B., Hudecová, L., Kuchta, T., 2006: A novel real-time polymerase chain reaction (PCR) method for the detection of walnuts in food. European Food Research and Technology, 223, 373—377.

3. Espineira, M., Herrero, B., Vieites, J. M., Santaclara, F. J., 2010: Validation of end-point and real-time PCR methods for the rapid detection of soy allergen in processed products. Food Ad-dit. Contam., 27, 426—432.

4. Mills, E. N. Mackie, A. R., 2008: The impact of process-ing on allergenicity of food. Curr. Opin. Allergy Clin. Immunol., 5, 38—42.

5. Meyer, R., Chardonnens, F., Huber, P., Luthy, J., 1996: Polymerase chain reaction in the quality assurance and safety of food: detection of soya in processed meat products. Z. Lebensm. Unters. Forsch., 203, 339—44.

6. Poms, R. E., Anklam, E., 2004: Polymerase chain reaction techniques for food allergen detection. J. AOAC Int., 87, 1391—1396.

7. Trifa, Y., Zhang, D., 2004: DNA content in embryo and endosperm of maize kernel Zea mays L.: Impact on GMO quantifi-cation. J. Agricult. Food Chem., 52, 1044—1048.

Table. 1 Meat products analysed and the results of the soya-specific PCR

Food sample Country of originSoya dec-

laration

PCR

result

Pork pâté 1 Czech Republic – –

Pork pâté 2 Slovak Republic + +

Pork pâté 3 Czech Republic + +

Liver pâté 1 Czech Republic – –

Liver pâté 2 Slovak Republic – –

Chicken pie Poland + +

Chicken pie

with pepperPoland – +

Meat pie Czech Republic + –

Pâté with herbs Czech Republic – –

Chicken ham Czech Republic – –

Steamed ham Czech Republic – –

Sausages Czech Republic + +

26

ABSTRACT

Hundreds of foodborne infections occur throughout the world each year. Food products, such as milk and meat, are susceptible to contamination by pathogenic bacteria, including Salmonella spp., Listeria monocytogens and, in recent years, also Cronobacter spp. Traditional methods for the detection of these bacteria are labori-ous and time-consuming. However, DNA analysis-based technologies made the development of alternative tests for the detection of micro-bial pathogens feasible. In this study, ready-to-use kits for the next-day detection of L. monocytogenes, Salmonella spp. and Cronobacter spp. in foods were designed based on PCR, mostly developed in our laboratory, and evaluated for their selectivity, detection limit and ap-plicability.

Key words: Cronobacter; detection kits; food; Listeria monocyto-genes; PCR; Salmonella

INTRODUCTION

Foodborne infections resulting from the consumption of contaminated foods include a large group caused by pathogenic micro-organisms (12). Hundreds of foodborne infections s occur worldwide and up to one third of the population in industrialized countries suffers from foodborne illness each year (11). In recent years Salmonella enterica, L. monocytogenes and o Cronobacter spp. belong to the most important bacterial contaminants of food (7). Food producers are required to ensure that the food products meet the criteria laid down by the Commission Regulation 2073/2005 specifying also control reference methods. It also allows the use of

DETECTION OF SALMONELLA SPP., LISTERIA MONOCYTOGENES AND CRONOBACTER SPP. IN PRODUCTS OF ANIMAL ORIGIN USING

REAL-TIME PCR BASED KITS

Kaclíková, E., Minarovičová, J.

Department of Microbiology, Molecular Biology and Biotechnology, Food Research InstitutePriemyselná 4, SK-82475, Bratislava

The Slovak Republic

[email protected]

alternative methods, particularly more rapid ones, as far as they provide equivalent results. Molecular-biological methods based on DNA analysis by means of PCR have a great potential for rapid and reliable pathogen identification.

In this study three ready-to-use kits for the detection of S. enteri-ca, L. monocytogenes and Cronobacter spp. in food using real-time PCR were developed and evaluated for selectivity, detection limit and applicability. They were evaluated on the basis of analysis of 850 food samples and 100 artificially contaminated samples using alternative and reference methods.


Listeria monocytogenes NCTC 1199, Salmonella Enteritidis CCM 4420 a Cronobacter sakazakii ATCC 29544 were used to pre-pare template DNA for positive controls and for individual cultures (at 37 °C, 16 to 18 hours in BHI medium) and dilutions were used for artificial contamination. Decimal culture dilutions were pre-pared in 0.85 % NaCl and the cell concentration was determined using colony count technique.

Most food and food products were purchased from Slovakian markets, some samples of fresh cheese were obtained from sheep farms. Samples used for validation were selected according to the standard for validation of alternative methods (2). To prepare arti-ficially contaminated food samples, culture dilutions of 100 CFU.ml-1 and 101 CFU.ml-1 were used prior to enrichment. Food sample enrichment for the detection of individual bacterial targets was per-formed according to respective microbiological standards (3, 1, 4).

The detection kits for L. monocytogenes, S. enterica and Crono-bacter spp., based on real-time PCR, specifically target actA gene


27

Table 1. Detection of L. monocytogenes (LM), S. enterica (SE) and Cronobacter spp. (CR)

Food sample categoryNumber of samples Real-time PCR Reference method

LM SE CR LM SE CR LM SE CR

Milk and milk products 166 120 178 12 8 16 11 8 14

Meat and meat products 112 189 – 14 24 – 14 22 –

Poultry and eggs 78 94 – 9 18 – 9 16 –

Fish and fish products 56 56 – 21 9 – 20 8 –

Delicatessen 44 41 41 8 2 4 8 2 3

Desserts and sweets 30 57 25 0 4 7 0 4 7

Ready-to-eat foods 27 21 21 3 0 2 3 0 2

Sum 513 578 265 67 65 29 65 60 26

Table 2. Detection of artificially contaminated samples by PCR and reference method

Target pathogenNumber

of samples

Real-time PCR Reference method

100 CFU

101 CFU

100 CFU

101 CFU

L. monocytogenes 50 50 50 44 47

S. enterica 50 49 50 49 50

Cronobacter spp. 50 50 50 48 50

(8), fimC gene (9, 6) and dnaG gene (10), respectively, were modi-fied in our laboratory (5).


The above described detection kits were evaluated by the analysis of a wide range of food samples divided to suitable categories. Results are summarized in Table 1.

Fifty samples that tested negatively for the target patho-gens were contaminated artificially at the level of detection using two concentration levels and were analyzed by real-time PCR kits and a particular reference method. Results are summarized in Table 2.

All food samples that tested positive by the reference method were positive according to the real-time PCR meth-od. False negative results were obtained by the reference method in case of high levels of accompanying competitive microflora in food samples that made the identification of target bacteria on selective media impossible.

Results of natural food samples analysis, as well as de-tection of artificially contaminated samples at the level of

detection limit, confirmed higher reliability of the detection method based on real-time PCR.

ACKNOWLEDGEMENT

The study was financially supported by the ASFEU project ITMS code 26240220012 “Effective control methods for safety foods”.

REFERENCES

1. EN ISO 11290-1, 1996: Microbiology of Food and Animal Feeding Stuffs — Horizontal Method for the Detection and Enumera-tion of Listeria monocytogenes, Part 1: Detection Method. European Committee for Standardization, Brussels, 16 pp.

2. EN ISO 16140, 2003: Microbiology of Food and Animal Feed-ing Stuffs — Protocol for the Validation of Alternative Method, Euro-pean Committee for Standardization, Brussels, 74 pp.

3. EN ISO 6579, 2002: Microbiology of Food and Animal Feed-ing Stuffs — Horizontal Method for the Detection of Salmonella spp. European Committee for Standardization, Brussels, 27 pp.

4. ISO/TS 22964, 2006: Milk and Milk Products — Detection of Enterobacter sakazakii. International Standard Organization, Ge-neva, 13 pp.

5. Kaclíková, E., Turcovský, I., 2011: A method for the detec-tion of Cronobacter strains in powdered milk-based foods using en-richment and real-time PCR. J. Food Nutr. Res., 50, 118—124.

6. Krascsenicsová, K., Piknová, Ľ., Kaclíková, E., Kuchta, T. 2008: Detection of Salmonella enterica in food using two-step en-richment and real-time polymerase chain reaction, Lett. Appl. Micro-biol., 46, 483—487.

7. Newell, D. G, Koopmans M., Verhoef, L., Duizer, E. et al., 2010: Food-borne diseases — the challenges of 20 years ago still persist while new ones continue to emerge. Int. J. Food Microbiol., 139, 3—15.

28

8. Oravcová, K., Kuchta, T., Kaclíková, E., 2007: A novel real-time PCR-based method for detection of Listeria monocytogenes in food. Lett. Appl. Microbiol., 45, 568—573.

9. Piknová, Ľ., Kaclíková, E., Pangallo, D., Polek, B., Kuch-ta, T., 2005: Quantification of Salmonella by 5’-nuclease real-time polymerase chain reaction targeted to fimC gene. Curr. Microbiol., 50, 38—42.

10. Seo, K. H., Brackett, R. E., 2005: Rapid, specific detection of Enterobacter sakazakii in infant formula using a real-time PCR. J. Food Prot., 68, 59—63.

1 1. Severgnini, M., Cremonesi, P., Consolandi, C., De Bellis, G., Castiglioni, B., 2011: Advances in DNA microarray technology for the detection of foodborne pathogens. Food Bioprocess. Technol., 4, 936—953.

12. Tauxe, R. V., Doyle, M. P, Kuchenmüller, T., Schlundt, J., Stein, C. E., 2010: Evolving public health approaches to the global challenge of foodborne infections. Int. J. Food Microbiol., 139, 16—28.

29

ABSTRACT

The aim of the study was to compare the ripening process in breast and thigh muscles of wild ducks living in different way. Ducks of Group 1 (n = 6) were kept as farmed game with regular intake of food and water and were killed by bleeding. Wild ducks of Group 2 (n = 6) lived free and were killed by hunting. Killed ducks of both groups were cooled and eviscerated after 24h. Breast and thigh mus-cles were stored at 4 °C. Lactic acid was determined on days 1, 7, and 14 of the experiment in water extract of meat by an electrophoretic analyzer, EA-102, pH of meat was measured by a pH meter WTW In-oLab-525. Changes in muscle pH during 14 days of storage reflected the changes in lactic acid during the ripening. The highest decrease in pH was observed on day 7 in both types of muscles of wild living ducks. It was caused by a significant increase in lactic acid. The level of lactic acid was higher in breast than in thigh muscle.

Key words: lactic acid; meat; pH; wild duck

INTRODUCTION

Meat of the wild duck (Anas platyrhynchos) has optimum nu-tritive composition. It is low in carbohydrates (0.3—0.5 %) and fat (2—3 %) and is a rich source of polyunsaturated acids with carbon atoms 20 and 22, proteins (19—23 %), purine compounds and cre-atinine (3, 1, 9). Quality of game meat depends on living condi-tions and nutrition of game, the way of hunting and treatment after hunting (2, 5, 8). The body of killed wild duck should be cooled to 4 °C and stored at this temperature. Proper cooling and storing of game meat suppresses activity of microorganisms. The post mortem

process leads to irreversible biochemical changes resulting in inter-mediate and final degradation products (7). Lactic acid is gradually released in the process glycogenolysis and affects the pH value and the ripening of meat.

The aim of this study was to observe the levels of lactic acid and pH during the ripening process in breast and thigh muscles of farmed and wild living ducks.


The experiment was carried out on 2 groups of wild ducks (Anas platyrhynchos). The first group (n = 6) was kept as farmed game with regular intake of feed and water. These ducks were killed by bleeding. The second group were ducks living in the wild. They were killed during the hunt (n = 6). Breast and thigh muscles of wild ducks were stored at 4 °C. The pH value was measured in wa-ter extract of breast and thigh muscles by a pH meter (WTW ino-Lab-525). Lactic acid was analysed by an electrophoretic analyzer EA102 (Vila Labeco, SR). The analyses were performed on days 1, 7 and 14 of the experiment.


A significant decrease in lactic acid was observed in breast muscles of farmed wild ducks on day 7 (P ≤ 0.05) and 14 (P ≤ 0.01) in comparison to day 1 of the experiment. In thigh muscles lactic acid decreased significantly (P ≤ 0.05) on day 14 (Table 1).

In breast muscles of wild living ducks we observed a sig-

COMPARISON OF THE RIPENING PROCESS IN MEAT OF FARMED AND FREE LIVING WILD DUCKS

Koréneková, B., Mačanga, J., Kottferová L.Molnár, L., Brenesselová, M., Kožárová, I.


[email protected]


30

nificant increase in lactic acid (P ≤ 0.05) on day 7 and a sig-nificant decrease (P ≤ 0.05) on day 14. Similarly, lactic acid in thigh muscles significantly increased (P ≤ 0.01) on day 7 and decreased (P ≤ 0.05) on day 14.

Lower content of glycogen in wild ducks living as farmed game should be the reason for decreasing level of lactic acid during 14 days of the experiment. On the other hand, we as-sumed higher content of glycogen in wild living ducks result-ing in increased lactic acid level on day 7 by the process of glycogenolysis.

Meat obtained from various species of game has differ-ent morphological properties and chemical composition depended on the life conditions, particularly intensity of muscle activity which is much higher in wild compared to farmed animals (10).

We observed significantly increased (P ≤ 0.05) pH values on day 14 in breast and thigh muscles of wild duck kept as farmed. On the other hand, pH values in breast and thigh muscles of free living wild ducks were decreased on day 7 and significantly increased (P ≤ 0.05) on day 14 (Table 2)

The value of pH can be affected by the physiological con-ditions during slaughtering. Glycogen is decreased in case of stressful situation, however, the effects of stress are not always reflected in the changes of final pH (4, 6).

CONCLUSIONS

The detected levels of lactic acid and pH in wild duck meat were affected by different condition of life and way of killing the birds. The temperature of 4 °C, used during 14 days of the experiment showed to be suitable for optimum ripening process.

ACKNOWLEDGEMENT

The study was supported by the Ministry of the education of the Slovak Republic, project VEGA 1/0939/12.

REFERENCES

1. Cobos, A., Veiga, A., Diaz, O., 2000: Chemical and fatty acid composition of meat and liver of wild duck (Anas platyrhyn-chos). Food Chemistry, 68, 1, 77—79.

2. Dominik, P., Steinhauser, L., 2009: Topicality and perspec-tives of game in Czech Republic (In Czech). Hygiena Alimentorum XXX, May 13—15, the High Tatras, 30—34.

3. Haščík, P., Kulíšek, V., Kačániová, M., Čuboň, J., Gašpa-rík, J., 2009: Analysis nutrition composition (M. pectoralis major) of wild and farmed ducks as suitable source of proteins in human food (In Slovak). Acta Fytotechnica et Zootechnica, 2, 39—41.

4. Henckel, P., Karlsson, A., Jensen, M. T., Oksbjerg, N., Petersen, J. S., 2002: Metabolic condition in Porcine longissimus muscle immediately pre-slaughter and its influence on peri- and post mortem energy metabolism. Meat Sci., 62, 145—155.

5. Kimáková, T., Bernasovská, K., 2006: Monitoring of mer-cury in selected food (In Slovak). Life Conditions and Health, Bratislava, 74—177.

6. Liste, G., Villarroel, M., Chacon, G., Sanudo, C., Olleta, J. L., Garcia-Belenguer, S., 2009: Effect of lairage duration on rab-bit welfare, meat quality. Meat Sci., 82, 71—76.

7. Nagy, J. at al., 2009: Hygiene of Meat, Poultry and Game (In Slovak). UVMF in Košice, 371 pp.

8. Skalická, M., 2010: Plants extracts as feed additives (In Slo-vak). Slovenský Veterinársky Časopis (Slovak Veterinary Journal), 1, 18—19.

9. Straková, E., Večerek, V., Suchý, P., Vitula, F., 2003: Comparison of carcass quality of fattening chicks and pheasants (In Czech). In Topicality and Perspectives of Poultry Breeding, May 15—16, Prague, 83—87.

10. Tudor, L., Lie, L. I., Tudor, L. A., Mitranescu, E., 2009: The physic-chemical quality for refrigerated wild boar meat. Lucrári Stiinifice Med. Vet., Timisoara, 2, 310—314.

Table 1. Lactic acid (g.100g-1) on days 1, 7, and 14 of the ripening process in breast (b) and thigh (t) muscles of farmed (F) and free living (FL) wild ducks

MuscleDay 1 Day 7 Day 14

F FL F FL F FL

X (b) 1.311 1.050 0.903* 1.608* 0.705** 0.849*

SD (b) 0.121 0.147 0.198 0.117 0.208 0.195

X (t) 1.035 0.657 0.748 1.184** 0.649* 0.569*

SD (t) 0.086 0.123 0.277 0.086 0.062 0.191

SD — Standard deviation; * — significant at P ≤ 0.05** — significant at P ≤ 0.01

Table 2. pH values on day 1, 7 and 14 of the ripening process in breast (b) and thigh (t) muscle in farmed (F) and free living (FL) wild ducks

MuscleDay 1 Day 7 Day 14

F FL F FL F FL

X (b) 5.945 6.220 6.007 5.992 6.333* 6.453*

SD (b) 0.061 0.118 0.042 0.173 0.100 0.150

X (t) 6.035 6.573 6.095 6.333 6.687* 7.120*

SD (t) 0.048 0.099 0.042 0.201 0.329 0.206

SD — Standard deviation; * — Significant at P ≤ 0.05

31

ABSTRACT

The aim of our study was to detect sulphamethazine (SMZ) resi-dues in food matrices fortified with the respective concentration of SMZ standard using Nouws Antibiotic Test (NAT) with the test strain Bacillus pumilus CN 607 and screening test for antibiotic residues (STAR) with the test strain Bacillus stearothemophilus var. calidol-actis ATCC 10149. When the fortified food matrices were screened by the NAT with B. pumilus CN 607, we detected inhibition zones around the samples of breast and thigh muscles at the concentration of 0.3 μg.ml-1, the samples of meat juice from breast and thigh muscle at the concentration of 0.2 μg.ml-1, and the samples of eggs at the concentration of 0.1 μg.ml-1. At the maximum residue limit (MRL) level (0.1 μg.g-1) we detected the SMZ residues only in eggs. When the fortified food matrices were screened by the STAR with B. stea-rothermophilus var. calidolactis ATCC 10149, we detected the inhibi-tion zones around the samples of thigh muscle, meat juice from the thigh muscle and eggs at the concentration of 0.1 μg.ml-1, and around the samples of breast muscle and meat juice from the breast muscle at the concentration of 0.2 μg.ml-1. The results obtained showed that although detection sensitivity of B. pumilus CN 607 of the NAT for SMZ was 0.1 μg.g-1, B. stearothermophilus var calidolactis ATCC 10149 of the STAR appears to be a more suitable test strain for the screening of SMZ residues in food matrices at the level of MRL. How-ever, the inhibition zones around the food matrices could be affected by the composition of the matrix itself.

Key words: food matrices; microbial screening; residues; sulpha-methazine

SCREENING OF SULPHAMETHAZINE RESIDUES IN FOOD MATRICES USING THE NAT TEST AND THE STAR METHOD

Kožárová, I., Gondová, Z.

University of Veterinary Medicine and Pharmacy in Košice, Komenského 73, 041 81 KošiceThe Slovak Republic

[email protected]

INTRODUCTION

Sulphamethazine is the most common agent of the sulphon-amides used in veterinary medicine to treat bacterial and protozoan diseases of food producing animals. Owing to concern related to SMZ residues in food products of animal origin, there is a require-ment to screen animal products for residues of sulphonamides (1). Monitoring of sulphonamide residues in foods of animal origin is carried out using microbial inhibition tests (MIT) based on inhibi-tion of growth of the test strain. NAT is a relatively young screen-ing method and comprises five test strains preferentially sensitive to one or two families of antibiotics. For detection of the presence of sulphonamide residues, the NAT prescribes Bacillus pumilus CN 607 (4). STAR is the official method for laboratory diagnostics of food and as well as NAT consists of five test strains preferentially sensitive to one or two families of antibiotics. For detection of the presence of sulphonamide residues, the STAR prescribes Bacillus stearothermophilus ATCC 10149 (3).

The aim of our study was to evaluate the suitability of the NAT and the STAR for the screening of SMZ residues in food matrices at the level of interest. The level of interest means the concentration of SMZ in the sample that is significant for the determination of its compliance with the MRL of 0.1 μg.g-1 established for all sulphon-amides by Commission Regulation (EU) No. 37/2010 (2).


Standard solutions and preparation of fortified food samplesThe stock solution of SMZ standard (1000 μg.ml-1) was pre-

pared by dissolving 10 mg of SMZ (Sigma S 5637) powder in 5 ml


32

ammonia (Lachema), and diluting it to 10 ml with sterile distilled water. The working solutions of SMZ were prepared by serial dilu-tion with sterile distilled water to concentrations of 0.1, 0.2, 0.3, 0.4 and 0.5 μg.ml-1. Breast and thigh muscles of broiler chickens, juice obtained from breast and thigh muscles of broiler chickens and the eggs of laying hens were fortified with the respective concentration of SMZ standard to the concentrations of SMZ in food matrices of 0.1, 0.2, 0.3, 0.4 and 0.5 μg.ml-1.

Media and strainsNAT — DST agar pH 7.4 (Oxoid CM 261) with trimethoprim

(TMP [0.007 μg.ml-1], Fluka 92131), test strain Bacillus pumilus CN 607 (NCIMB Ltd; 106 spores.ml-1), STAR — DST agar pH 7.4 (Oxoid CM 261) with TMP (0.005 μg.ml-1), test strain Bacillus stea-rothermophilus var. calidolactis ATCC 10149 (Merck 11.499; 5.105 spores.ml-1) were used in the experiment.

Sampling procedureNAT — Samples of breast and thigh muscles or filter paper discs

(12.7 mm, Schleicher & Schuell No. 2668) moistened with 100 μl of meat juice or homogenized eggs were applied into the punch holes with the diameter of 14 mm formed by means of a sterile cork borer. Samples were supplemented with 300 μl 0.133 M and 100 μl 1.5 M phosphate buffer (pH 8.0). The plates were incubated at 37 °C for 16—18 hours. STAR — Samples of breast and thigh muscle or filter

paper discs (9 mm, Whatman Grade No. 1) moistened with 30 μl of meat juice or homogenized eggs were applied onto the surface of agar medium. The plates were incubated at 55 °C for 12—15 hours. After incubation, the plates were evaluated by measuring the width of clear inhibition zones around the tissue samples or filter paper discs with a precision of 0.01 mm using a digital calliper (Mitutoyo).


The detection limit (LOD) of Bacillus pumilus CN 607 of the NAT for SMZ was 0.1 μg.ml-1 (at the level of MRL) and the LOD of Bacillus stearothermophilus var. calidolactis ATCC 10149 of the STAR was 0.2 μg.ml-1 (above the level of MRL). The presence of SMZ residues in fortified food matri-ces was shown by the formation of inhibition zones around the examined samples.

When the fortified food matrices were screened by the NAT with Bacillus pumilus CN 607, we detected inhibition zones around the samples of breast and thigh muscles at the concentration of 0.3 μg.ml-1, around the samples of meat juices from breast and thigh muscles at the concentration of 0.2 μg.ml-1, and around the samples of eggs at the concentra-tion of 0.1 μg.ml-1. The results are presented in Table 1.

When the fortified food matrices were screened by the

Table 1. Mean diameters of the inhibition zones (mm ± SD) observed at the screening for SMZ residues in fortified food matrices using the NAT with Bacillus pumilus CN 607

SMZ (μg.ml-1/μg.g-1)

0.1 0.2 0.3 0.4 0.5

Breast 0 0 26.89 ± 0.87 28.83 ± 0.71 29.18 ± 0.80

Thigh 0 0 29.52 ± 0.24 30.60 ± 1.22 31.21 ± 1.36

Breast – juice 0 20.85 ± 1.29 22.87 ± 1.22 26.39 ± 1.2 29.85 ± 0.29

Thigh – juice 0 22.05 ± 1.02 23.87 ± 1.02 24.93 ± 1.02 27.56 ± 1.1

Eggs 19.14 ± 1.26 21.27 ± 1.04 23.51 ± 0.83 26.85 ± 0.72 28.15 ± 0.62

Table 2. Mean diameters of the inhibition zones (mm ± SD) observed at the screening for SMZ residues in fortified food matrices using the STAR with Bacillus stearothermophilus var. calidolactis ATCC 10149

SMZ (μg.ml-1/ μg.g-1)

0.1 0.2 0.3 0.4 0.5

Breast 0 1.76 ± 0.20 1.75 ± 0.25 2.13 ± 0.25 2.44 ± 0.33

Thigh 2.04 ± 0.28 2.68 ± 0.45 2.97 ± 0.64 3.32 ± 0.69 4.76 ± 0.64

Breast – juice 0 2.18 ± 0.14 2.53 ± 0.20 2.80 ± 0.90 3.10 ± 0.42

Thigh – juice 2.38 ± 0.22 2.51 ± 0.50 3.38 ± 0.52 4.36 ± 1.12 4.46 ± 1.12

Eggs 3.92 ± 0.76 4.06 ± 0.22 4.39 ± 0.55 5.85 ± 0.49 7.20 ± 0.76

33

STAR with Bacillus stearothermophilus var. calidolactis ATCC 10149, we detected inhibition zones around the samples of thigh muscle, meat juice from the thigh muscle and eggs at the concentration of 0.1 μg.ml-1, and around the samples of breast muscle and meat juice from the breast muscle at the concentration of 0.2 μg.ml-1. The results are presented in Table 2.

The results obtained allowed us to state that although the LOD of Bacillus pumilus CN 607 of the NAT for SMZ was at the level of MRL, Bacillus stearothermophilus var. calidolactis ATCC 10149 of the STAR showed higher sensitivity at the screening of fortified food matrices. However, formation of inhibition zones around the food matrices can be affected by the composition of the matrix itself.

ACKNOWLEDGEMENT

This study was supported by VEGA Grant No. 1/0939/12.

REFERENCES

1. European Commission, 1996: Council Directive 96/23/EC. Official Journal of the European Communities, L 125, 10—32.

2. European Union, 2010: Commission Regulation (EU) No. 37/2010. Official Journal of the European Union, L 15, 1—72.

3. CH 12.19., 2006: Screening test for determination of anti-biotic residues using bacterial strains (STAR). Bulletin of the Minis-try of Agriculture of the Slovak Republic, 38, 68—81.

4. Pikkemaat, M. G., Oostrava-van Dijk, S., Schouten, J., Rapallini, M., Van Egmond, M. J., 2008: A new microbial screen-ing method for the detection of antimicrobial residues in slaughter animals: The Nouws Antibiotic Test (NAT-screening). Food Control, 19, 781—789.

34

ABSTRACT

Faecal samples of Struthio camelus were treated by the standard microbiological method to select bacteriocin-producing strain among Enterococci. By genotypization (PCR), the strain EM 41 was allotted to the species Enterococcus faecium with presence of the structural genes for enterocins A and B. It was tested for its bacteriocin activity by qualitative and quantitative methods. The bacteriocin substance was semi-purified and checked for activity and stability. Thermo-sta-bile proteinaceous semi-purified enterocin Bs 41 is produced by E. fae-cium EM 41 in its late logarithmic growth phase (25 600 AU/ml). It exhibits bacteriostatic activity against the target Gram-positive and Gram-negative indicator bacteria and stability for 5 months at 4 °C. Its production has started after 2 h of cultivation of the producing strain with culmination in late logarithmic growth phase (25 600 AU). The reduction of L. monocytogens CCM 4699 by Bs 41 was noted (difference by 1—2 orders). S. aureus SaBok1 was inhibited with dif-ference 2 orders. Bs 41 is a bacteriocin from new not yet studied niche which could be allotted to class II enterocins.

Key words: enterocin; inhibitory activity; ostrich; properties

INTRODUCTION

Since 1995 the ostriches (Struthio camelus var. domesticus) have been included among the farm animals in Slovakia (10). Ostrich husbandry is focused especially on production of meat and eggs. Although ostriches have a well developed immune system, they can be affected by pathogenic or spoilage agents (2). Enterocins are antimicrobial proteinaceous substances with mostly wide range

ENTEROCOCCUS FAECIUM EM 41 ISOLATE FROM OSTRICHES AND ITS ENTEROCIN

Lauková, A.1, Hádryová, J.2, Imrichová, J.1

Strompfová, V.1, Kandričáková, A.1

1Institute of Animal Physiology Slovak Academy of Sciences, Šoltésovej 4-6, 040 01 Košice2University of Veterinary Medicine and Pharmacy, Komenského 73, 048 01 Košice

The Slovak Republic

[email protected]

of antimicrobial spectrum. Their study intensified greatly in the nineties and up to now more enterocins purified to homogeneity or semi-purified were detected, especially those produced by the strains of the species Enterococcus faecium, E. faecalis, E. durans, E. hirae, isolated from different niches but most often from food and/or animals (4, 7). In this study, partial results concerning the enterocin-producing strain from ostriches Enterococcus faecium EM 41 and its bacteriocin have been presented from niche which has not been studied in detail. The present study is also aimed at further practical use of enterocins in animal husbandry to prevent spoilage contamination or to support immunity (8). An advantage of enterocin is that European Food/Feed Safety Authority (EFSA) as the controlling authority evaluated the safety/acceptability of the bacteriocin-producing strain and thus futher evaluation of bacterio-cin safety is unnecessary. The bacteriocin studied here can also be used in model experiments in animals to confirm its in vitro studied antibacterial activity but also its influence on the immunological pa-rameters which were investigated previously at our workplace with other bacteriocins (7, 8).


Faecal samples of Struthio camelus (ZOO Košice) were treated by the standard microbiological method (ISO) and the appropriate dilutions were spread onto M-Enterococcus agar (Difco) and cultivat-ed at 37 °C for 24 h. The strain EM 41 was genotyped by PCR (13) and allotted to the species Enterococcus faecium. The presence of known structural genes for enterocin (Ent) production was checked (12). Bacteriocin activity was tested by the qualitative method (11) using Brain Heart Infusion Agar (BHIA) and broth or Trypticase


35

Agar and broth (TSAI, Difco); it was expressed in the size of the inhibitory zones in mm. The zone of 10 mm and more was accepted as the zone of inhibition. Bacteriocin substance was semi-purified according to M a r e k o v á et al. (2003) and the activity was checked by a quantitative method (3) using previously mentioned media and expressed in Arbitrary unit per ml media (AU.ml-1); it means the minimal critical dilution of bacteriocin which causes inhibition of the indicator strain. Properties of the semi-purified substance (Bs) were tested according to L a u k o v á et al. (1993). Competitive activity of Bs was analysed in BHI and TSB (Difco) against Listeria monocytogenes CCM 4699 and S. aurues Nip 1 (5). The species tested are the most frequent causative agents in poultry. The indicator bacteria were Enterococcus sp. (2); Staphylococcus sp. (6, our isolates-rabbits faeces, appendix); L. monocytogenes CCM 4699 (Czech Collection of Microorganisms, CCM, Brno, Czech Republic); L. monocytogenes P7223 (meat products, Dr. Sýčevová, State Veterinary and Food Administration-SVFA, Košice); S. au-reus SaBok 1 (our isolate from sheep cheese); Streptococcus hominis 10/63R (reference mastitis isolate, University of Veterinary Medi-cine and Pharmacy, Košice), E. coli (2), Enterobacter sp. (3, our isolates from rabbits appendix), Cedecea davisae 64A/1, C. lapagei 36A/1-our isolates from horse faeces.

For the quantitative test, the target of 107 strains was used: E. faecalis (12), 1 E. faceium (rabbits faeces); 4 E. hirae (isolates, canine feed, canine and goats faeces); S. xylosus (17 isolates from horse and rabbits faeces); S. epidermidis (22), S. warneri (15), 2 S. saprophyticus (dairy plants, Dr. Kunová, Prague, Czech Repub-lic); 17 S. aureus (12 isolates were from rabbits faeces), 4 isolates (Dr. Kunová, Prague), 1 isolate from sheep cheese; 7 L. monocyto-genes (Dr. Sýčevová, SVFA, Košice), L. monocytogenes CCM 4699 (CCM), 1 L. innocua LMG 13568 (University Ghent, Belgium), 7 Acinetobacter lwofii (3 caecal, 1 from rabbits, 3 from horse fae-ces). The most sensitive-principal indicator was E. avium EA5 (our isolate from piglet).


Among 20 indicators (7 Gram-negative, 13 Gram-posi-tive) tested by the qualitative method, the growth of 55 % was inhibited by the substance of EM 41 strain. E. avium EA5 was inhibited with inhibitory zone of 24 mm. The rest of the strains were inhibited with the inhibitory zones from 10 to 24 mm (the highest in Enterococci). Bs 41 (semi-purified bac-teriocin) in the quantitative test inhibited E. avium EA5 (3 200 AU/ml). E. hirae (2 from canine and goat faeces) were not susceptible to Bs 41. The other isolates E. faecalis, E. faecium and E. hirae were inhibited (800 to 12 800 AU/ml); the most sensitive was E. hirae AD2 (canine faeces, 12 800 AU/ml).Staphylococci were less sensitive to Bs 41 than Enterococci. From among 69 strains, 17 were inhibited (24.6 %, 100 AU/ml). Staphylococci have different structure of the cells than En-terococci which can influence their sensitivity to bacteriocins. Moroever, Bs 41 produced by E. faecium EM 41 probably act-ed more intensively against indicators derived from the same genus. Previous studies mentioned that bacteriocins have been active against closely related genera (6). Nowadays (de-pending on the type of bacteriocin) they can also inhibit less

related species, especially enterocins are active against Gram-negative spoilage strains (1, 7). Interestingly, 2 S. aureus were inhibited (100 AU.ml-1). Listeria have common phylogenesis with Enterococci; it explains why enterocins predominantly inhibit the growth of listeria (4). Bs 41 produced by E. fae-cium EM 41 is thermo-stabile substance (even at 100 °C for 15 min-activity 1600 AU.ml-1); active even after long storage conditions e. g. at 4 °C (5 months). Its production was noted after 2 h of cultivation of the producing strain (400 AU.ml-1) with culmination in late logarithmic growth phase-after 8 h in broth (25 600 AU.ml-1). Bacteriostatic activity of Bs 41 was noted against L. monocytogenes CCM 4699 with cells decrease by 1—2 orders. S. aureus SaBok1 was inhibited with difference 2 orders. According to Bs EM 41 up to now stud-ied properties, it could be belonged to class II enterocins (4). Further testing is in progress.

ACKNOWLEDGEMENT

The results were achieved within the framework of the project No. 2/0002/11 by the Slovak Scientific Agency VEGA. We are grateful for skillful assistance of Mrs. Margita Bodnárová and Bc. Jozef Lenárd (ZOO Košice-Kavečany) for his willingness to sample ostriches. Part of results was reported as a poster presentation at Hygiena Alimentorum XXXIII, May 2012, Štrbské Pleso, Slovakia, p. 327—330.

REFERENCES

1. Audisio, C. M., Oliver, G., Apella, M. C., 2000: Protective ef-fect of Enterococcus faecium J96, a potential probiotic strain on chicks infected with Salmonella pullorum. J. Food Prot., 10, 1333—1337.

2. Cooper, R. G., 2005: Bacterial, fungal and parasitic infec-tions in the ostrich (Struthio camelus var. domesticus). J. Anim. Sci., 76, 97—106.

3. De Vuyst, L., Callewaert, R., Pot, B., 1996: Characteriza-tion and antagonistic activity of Lactobacillus amylovorus DCE471 and large scale isolation of its bacteriocin amylovorin L471. Syst. Appl. Microbiol., 19, 193—202.

4. Franz, C. M. A. P., van Belkum, M. J., Holzapfel, W. H., Abriouel, H., Gálvéz, A., 2007: Diversity of enterococcal bacterio-cins and their grouping in a new classification scheme. FEMS Micro-biol. Rev., 31, 293—310.

5. Hádryová, J., 2011: Bacteriocin-Producing Bacteria and their use for Health (In Slovak). Diploma thesis, UPJŠ, IAP SAS, 1—69.

6. Klaenhammer, T., 1993: Genetics of bacteriocins produced by lactic acid bacteria. FEMS Microbiol. Rev., 12, 39—85.

7. Lauková, A., Mareková, M., Javorský, P., 1993: Detection and antimicrobial spectrum of a bacteriocin-like substance pro-duced by Enterococcus faecium CCM 4231. Let. Appl. Microbiol., 16, 257—260.

8. Lauková, A., Pogány Simonová, M., Plachá, I., Strompfová, V., Čobanová, K., Szabóová, R., Chrastinová, Ľ., 2009: In Intestinal Barrier in Animals and Alternative Methods that Influence it,“Science for Practice”, Levkut, M., Pistl, J., Revajová, V., Herich, R., Faixová, Z. et al. (Eds.), June 25., UVL, Košice, 22—26.

9. Mareková, M., Lauková, A., De Vuyst, L., Skaugen, M.,

36

Nes, I. F., 2003: Isolation and characterization of a new bacterio-cin, termed enterocin M, produced by environmental isolate Entero-coccus faecium AL 41. J. Appl. Microbiol., 94, 523—530.

10. Sabolová, G., Egyedová, A., Gulovič, J., 2008: Ostrich as a farmed animal (In Slovak). Slovenský Veterinársky časopis (Slovak Veterinary Journal), 1, 21—24.

11. Skalka, B., Pillich, J., Pospíšil, L., 1983: Further obser-vations on Corynebacterium renale as an indicator organism in the

detection of exfoliation-positive strains of Staphylococcus aureus. Zentralbl. Bakteriol. Hyg., A256, 168—174.

12. Strompfová, V., Lauková, A., Simonová, M., Marciňáková, M., 2008: Occurrence of the structural enterocin A, P, B, L50B genes in Enterococci of different origin. Vet. Microbiol., 132, 293—301.

13. Woodford, N., Egelton, M. C., Morrison, D., 1997: Com-parison of PCR with phenotypic methods for the speciation of En-terococci. Plenum Press, New York, 405—409.

37

ABSTRACT

We evaluated the influence of transport distance and temperature on the dead on arrival and condemnation causes in broiler chickens from a small farm Lieskovec (Slovak Republic) in the period of 2006—2010. The results showed a significant increase in dead on arrival and condemnation percentage in relation to the transport distance and season. The average percentage of dead on arrival throughout the period was 0.209 % (0.031 to 0.702 %) and the average percentage of condemnation was 0.524 % (0.041 to 1.422 %). The most common causes of condemnation were cyanosis, birds slaughtered in agony, breaking of the legs and wings and cachexy.

Key words: condemnation; dead on arrival; slaughter poultry; transport

INTRODUCTION

Interest in welfare of food-producing animals throughout the European Union (EU) continues to increase and the perceived “welfare status” of the animal from which food is produced is now seen as a part of product quality (5). Numerous on-farm welfare problems can be identified in slaughterhouses where one can easily observe large number of animals or birds. Many problems detrimen-tal to animal welfare, occurring during transport and handling can be scored at the plant (4). The Council Regulation No. 1/2005 (2) applies to the transport of live vertebrate animals within the Com-munity, including specific checks to be carried out by official on consignments entering or leaving the custom territory of the Com-munity. In the context of the controls performed under the Regula-

TREND ANALYSIS OF THE DEAD ON ARRIVAL AND CONDEMNATION CAUSES OF BROILER CHICKENS FROM FARM LIESKOVEC

(THE SLOVAK REPUBLIC) IN THE YEARS 2006—2010

Luptáková, O.1, Nagy, J.2, Popelka, P.2, Turek, P.2, Nagyová, A.2

1District Veterinary and Food Administration, Nám. SNP 50, Zvolen2University of Veterinary Medicine and Pharmacy, Komenského 73, 041 81 Košice

The Slovak Republic

[email protected]

tion (EC) No 854/2004 (8), the official veterinarian shall evaluate the results of the post mortem inspection to identify other possible indications of poor welfare, such as abnormal level of contact der-matitis, parasitism and systemic illness in the holding or the unit of the house of the holding of origin. If the mortality rate or the results of post mortem inspection are consistent with poor animal welfare, the official veterinarian shall communicate the data to the owner or keeper of the animals and to the competent authority. Appropriate actions shall be taken by the owner or the keeper of the animals and by the competent authority (1).

The aim of this study was to evaluate the influence of trans-port distance and season on the dead on arrival of broiler chickens and the results of the post mortem inspection.


Forty-two deliveries of broiler chickens (858 317 birds) were evaluated (2006 – 208 990 birds; 2007 – 245 327 birds; 2008 – 203 788 birds; 2009 – 44 430 birds; 2010 – 155 467 birds). Broiler chickens were caught manually by hand and placed into crates. They were transported early morning by trucks with passive ventila-tion. Capacity of the trucks was 4000 birds and the deliveries were performed in all seasons (spring – 16; summer – 9; autumn – 14; winter –3).

The transport distance to the three poultry slaughterhouses was as follows: 3 km to Zvolen; 170 km to Kežmarok; 243 km to Košice. The data considering the dead on arrival and condemnation causes were reached from statistical records of the District Veterinary and Food Administration in Zvolen (the Slovak Republic). The broiler chickens dead on arrival at the slaughter plant and percentage of


38

condemned poultry was evaluated according to the official results of the ante mortem and post mortem inspection during the period from January 2006 to September 2010.

Statistical analysis was based on group means and standard deviations using column statistics, following by one-way ANOVA analysis of variance and Tukey’s multiple comparison test (3). The treatments were considered significant at a level P < 0.05.


The catching and loading of birds is a potential source of injury, as prior to transport broiler houses are depopulated by catching teams working at speeds of 1000—1500 birds per man and hour. The handling of poultry probably always causes some degree of stress and, moreover, broilers suffer bruising, discolorations and bone breaks (6). The results of forty-two deliveries of broiler chickens transported from poultry farm Lieskovec to the poultry slaughterhouses during the years 2006—2010 showed that the average percentage of dead on arrival was 0.209 % and of condemned birds 0.524 %. From 2009 to 2010 the poultry was transported to the more distant poultry slaughterhouses Kežmarok and Košice (170 and 240 km, resp.). The highest average percentage of dead on arrival (0.702 %) was in 2009 when the poultry was trans-ported to the poultry slaughterhouse in Kežmarok (170 km). In all deliveries in 2009 the dead on arrival (0.799 %) was the highest (P < 0.05) compared with previous years and the following year 2010. In 2010 the dead on arrival was insig-nificantly higher compared to 2006—2008 when distance to the slaughterhouse was short. The highest percentage of dead on arrival in individual years was recorded as follows: 2006 (May, June), 2007 (May, July and December), 2008 (November), 2009 (October, one delivery only), and 2010 (November). The highest average percentage of dead on ar-rival was recorded in autumn (0.142 %) and the lowest in summer (0.057 %).

Condemnation percentage of slaughtered birds was lower in the years 2006—2008 (0.211, 0.288, and 0.308 %). With increasing transport distance the percentage of condemned birds (P < 0.05) in 2009—2010 (0.558 and 1.254 %, resp.) increased. The highest mean percentage of condemned birds was recorded in 2010 (1.254 %) and the lowest in 2007 (0.288 %). The highest percentage of condemnation was in august 2010 (1.422 %). There were no significant differences in respiratory and digestive diseases comparing all deliver-ies in the evaluated period. Technological defects were more frequent (P < 0.05) in 2008 (47.73 %) than in 2009 and 2010. Percentage of cachexy causes was higher (P < 0.05) in 2010 (37.12 %) in comparison with 2008 and 2009 and other

causes were most frequent (P < 0.05) in 2009 (52.44 %) com-pared with all other years. The results showed the highest average percentage (36.40 %) of “other causes” as reasons of condemnation during the reporting period. These causes (“other” and cachexy) represented the highest percentage of condemnation (41.16 and 39.42 %) in 2010 when the highest percentage of condemnation was recorded (1.263 %). The highest percentage of condemned birds was in summer, the lowest in winter. N a g y et al. (7) evaluated the incidence of poultry dead on arrival and analyzed the reasons of broiler chickens condemnation in poultry slaughterhouses in the Slovak Republic in 2000—2010. Average percentage of mor-tality throughout the period was 0.34 % (0.07 to 0.64 %) and 0.98 % of carcasses were declared unfit for human consump-tion.

The results showed the dependence of dead on arrival and condemnation percentage on the transport distance. During the years 2006—2008 the mean percentage of dead on ar-rival was 0.052 % in comparison with period of 2009—2010 (0.42 %). Similarly, a significant increase in mean number of condemned birds (0.269 and 0.906 %) was observed.

REFERENCES

1. Council Directive 2007/43/EC: of 28 June 2007, laying down minimum rules for the protection of chickens kept for meat production. Official Journal of the European Union. L 182. July 12, 2007.

2. Council Regulation (EC) No 1/2005: of 22 December 2004, on the protection of animals during transport and related opera-tions and amending Directions 64/432/EEC and 93/119/EC and Regulation (EC) No 1255/97. Official Journal of the European Union. L 3. January 5, 2005.

3. Grandin, T., 2010: Auditing animal welfare at slaughter plants. Meat Sci., 86, 56—65.

4. GraphPad Prism program, 1999. 5. Haslam, S., 2008: Legislation and poultry welfare. Poultry

Diseases, 6th edn., Elsevier Ltd., 94—08. 6. Metheringham, J., 1996: Guest editorial. Poultry in transit-

a cause for concern ? Br. Vet. J., 152, 247—250. 7. Nagy, J., Pekár, I., Popelka, P., Luptáková, O., Nagyová,

A., Gulovič, J., 2011: Inspection system of poultry meat (In Slo-vak). In Food Safety and Control, Nitra, Slovak Republic, March 30—31, 30—33.

8. Regulation (EC) No 854/2004: of the European Parliament and of the Council of 29 April 2004, laying down specific rules for the organisation of official controls on products of animal origin intended for human consumption. Official Journal of the European Union. L 226, 2004.

39

ABSTRACT

We evaluated qualitative parameters of chilled chicken breast and thighs from Slovak, Polish and Czech producers, sold in Slo-vak shops. Breast meat from Slovakia had higher level of proteins (22.63 %), the highest content of fat (3.27 %) and the lowest content of lactic acid (1.67 g.100g-1). The highest loss of water after cooking was recorded in thigh meat from Poland (93.35 g). The sensory evalu-ation of breast and thighs showed no significant differences among samples, although the poultry of Slovak origin was evaluated as best (P > 0.05).

Key words: meat quality; poultry; sensory evaluation

INTRODUCTION

Currently, the quality of imported meat is a widely discussed is-sue. The “Slovak Poultry and Eggs Association” claims that poultry imported to our country is not of good quality. The foreign retail chains import poultry meat products that could not be sold in the respective countries. In fact, these products do not correspond even to quality class B. The solution is the policy of retail chains which strive to obtain lower price at the expense of quality (1). On the other hand, these retail chains object that imported chickens must have the same quality parameters as poultry of Slovak origin.

The aim of this study was to compare the quality of chilled poul-try of Slovak, Polish and Czech origin purchased from retail chains. We determined chemical parameters of meat, water loss after cook-ing and sensory quality of poultry meat.

QUALITY PARAMETERS OF CHILLED CHICKENS IN SLOVAK SHOPS

Marcinčák, S.1, Bača, M.1, Marcinčáková, D.2, Turek, P.1, Nagy, J.1

1Department of Food Hygiene and Technology2Department of Pharmacology and Toxicology

University of Veterinary Medicine and Pharmacy, Komenského 73, 041 81, KošiceThe Slovak Republic

[email protected]


The investigated samples of chilled poultry meat (breasts and thighs of broiler chickens) were bought in 3 supermarkets and 2 local markets in Košice. Slovak (SK) poultry and Polish (PL) poultry meat was from two producers and Czech (CZ) from one producer. All the samples were stored properly and showed no sen-sory changes.

Determination of chemical composition of meat (water, fat, dry matter and protein content) was performed according to P o p e l- k a et al. (5). Lactic acid was determined by electrophoresis using an analyser EA-102 (Villa Labeco, Ltd.) according to M a č a n g a et al. (3). Water loss on cooking was evaluated by cooking of meat (88 °C in the core).

The sensory evaluation was performed according to method-ological procedure for sensory evaluation of the meat (6). The sam-ples were boiled until they achieved internal temperature of 88 °C. After cooking, the samples were cooled to 40 °C and served to the panellists to evaluate the sensory attributes. Six panellists were se-lected from among the trained laboratory staff to evaluate the fol-lowing properties using a 5-point intensity scale (maximum score 20 points): taste, aroma, juiciness, and appearance.

Statistical analysis was performed by GraphPad Prism (2), ver-sion 4.00 statistical software. All data were presented as mean val-ues with standard deviation (mean ± SD). The results of chemical composition of breast and tight meat within groups and sensory evaluation were compared by one-way ANOVA test. Tukey’s mul-tiple comparison test was used to compare the differences among values and P < 0.05 was considered significant.


40


The differences in chemical composition of breast and tight meat samples are shown in Table 1. The lowest content of water and the highest amount of protein was recorded in breasts from Slovak producers. On the contrary, the content of lactic acid was the lowest. Breast meat from Polish chick-ens showed higher content of water and significantly higher level of lactic acid.

Table 1. Chemical composition of breast and thigh meat of poultry

Water%

Fat%

Proteins%

Lactic acid g.100g-1

Breast SK 73.11 ± 0.79b 3.27 ± 0.55 22.63 ± 0.10a 1.67 ± 0.15

Breast CZ 73.94 ± 0.09ab 2.87 ± 0.15 21.62 ± 0.04b 1.81 ± 0.24

Breast PL 74.24 ± 0.26a 2.68 ± 0.33 21.71 ± 0.57b 2.07 ± 0.39

Thigh SK 71.77 ± 0.79 9.74 ± 0.66cd 17.64 ± 0.41 1.17 ± 0.25

Thigh CZ 70.97 ± 0.72 11.02 ± 0.72c 17.60 ± 0.20 1.13 ± 0.13

Thigh PL 72.61 ± 1.40 8.79 ± 1.62d 17.36 ± 0.17 1.06 ± 0.26

a,b — different letters in superscript in a column indicate significant differences at P < 0.05.

c,d — different letters in superscript in a column indicatesignificant differences at P < 0.05.

The losses of water on cooking in the samples are report-ed in Table 2. Higher water losses per sample (one piece of breast) after cooking were recorded in Polish (82.3 g) and the lowest in Slovak chickens.

Table 2. Loss of water after cooking of breast and thigh meat

Row meatg

Cooked meat g

Loss of water g

Loss of water %

Breast SK 181.4 ± 32.4 128.9 ± 25.3 52.49 ± 5.2b 28.9 ± 3.2b

Breast CZ 184.3 ± 22.4 125.7 ± 15.7 56.89 ± 9.8b 30.8 ± 3.3a

Breast PL 287.9 ± 52.9 215.7 ± 51.8 85.30 ± 11.0a 29.6 ± 4.6a

Thigh SK 282.2 ± 16.3 209,1 ± 12,1 67.42 ± 16.2d 23.9 ± 1.3d

Thigh CZ 238.8 ± 5.0 187.6 ± 6.7 52.14 ± 2.8e 21.8 ± 0.4e

Thigh PL 311.1 ± 17.6 227.0 ± 16.4 93.35 ± 9.2c 30.0 ± 1.6c

a,b — different letters in superscript in a column indicate significant differences at P < 0.05

c,d,e — different letters in superscript in a column indicate significant differences at P < 0.05

When expressed as body weight percentages, the losses of water were higher in Czech and Polish chickens in com-parison with breast meat from Slovak chickens. Similarly, the water losses on cooking in the thigh were the highest in Pol-ish chickens (93.35 g per chicken; 30 %; P < 0.05). The low-est loss of water was observed in Czech chicken thighs, but mean weight of their bodies was also the lowest. The mean water loss on cooking in poultry from Slovak producers was 67.4 g per sample (one piece of thigh) (23.9 %). Our results support the arguments of the Slovak Poultry and Eggs As-sociation, which points to low quality of imported products (mainly from Poland and Brasil). According to this Associa-tion, imported poultry meat contains more water and foreign substances. Water content in these products ranged from 25 to 40 % (4).

The total sensory evaluation of chicken breasts and thighs is presented in Table 3. The sensory quality of meat produced in Slovakia was comparable with meat imported from Poland and Czech Republic. However, breast and thigh samples from Slovakia (P > 0.05) obtained the best sensory scores.

Table 3. Sensory evaluation of poultry (max. 20)

PL SK CZ

Breast 17.13 ± 1.99 17.53 ± 1.85 17.30 ± 2.20

Thigh 18.27 ± 1.53 18.73 ± 0.96 18.75 ± 1.53

CONCLUSION

Chilled breast of Slovak origin had the higher content of proteins and lower water losses on cooking in compari-son with breast produced in Poland and the Czech Republic. Chicken thighs from Slovak producers of poultry showed sig-nificantly lower water losses on cooking compared to thigh samples from Poland. The sensory evaluation was compara-ble in all samples without significant differences. In conclu-sion we can state that the quality of investigated poultry meat was good and there were no significant differences between imported and Slovak poultry meat. In spite of this assertion, the Slovak poultry meat showed the best quality parameters.

ACKNOWLEDGEMENT

This study was supported by grant VEGA No. 1/0648/11.

REFERENCES

1. Čímová, D., 2011: Quality of imported meat sparked contro-versy (In Slovak). Sme, http://ekonomika.sme.sk/c/5860128/kvali-ta-hydiny-z-dovozu-vyvolala-spor.html.

2. GraphPad Prism, 2003: GraphPad Prism version 4.00 for Windows, GraphPad Software. San Diego, California.

41

3. Mačanga, J., Koreneková, B., Nagy, J., Marcinčák, S., Popel-ka, P., Kožárová, I., Korenek, M., 2011: Post mortem changes in the concentration of lactic acid, phosphates and pH in the muscles of wild rabbits (Oryctolagus cuniculus) according to the perimortal situation. Meat Sci., 88, 701—704.

4. Molnár, D., 2012: Most of Poultry in Restaurants is Imported (In Slovak). Slovak Poultry and Eggs Association, http://www.unia-hydinarov.sk/aktuality/?id=35&start=0

5. Popelka, P. et al., 2009: Laboratory Examination of Meat and Meat Products (In Slovak). Editing centre UVL. Košice, 199 pp.

6. Príbela, A., 2001: Sensory Evaluation of Food Stuff, Additives and Food Products (In Slovak). Institute for Education of Veterinary Surgeons, Košice, 201 pp.

42


ABSTRACT

We examined the influence of the addition of red grapes extract and the way of thawing on lipid oxidation in rainbow trout (Oncorhyn-chus mykis) fillets was examined. Thirty six fillets from the rainbow trout originating from the fishery Rybárstvo Požehy were used. They were divided to three groups: unglazed fillets (N), fillets glazed with fresh potable water (GV) and fillets glazed with water extract of red grapes (0.3 %, GH). All samples were frozen and stored at –18 °C for one week and then gradually thawed in three ways: the first group of fillets was defrosted at room temperature (21 °C) for 12 hours, the second group was thawed in a refrigerator at 4 °C for 24 hours and the third group was thawed by microwave heating at 160 Watts for 2.5 min. The protective effect of the added antioxidant was most significant in samples thawed by microwave heating and at room tem-perature while the oxidation processes were the most intensive in the samples which were thawed at room temperature.

Keywords: antioxidant; defrosting; grape; lipid oxidation; rain-bow trout;

INTRODUCTION

The most common way of thawing is the “open air” method or thawing with forced circulation (3). Other ways, such as thawing by water, contact thawing, by dielectric heating and microwave heat-ing, are used less often because of considerable temperature differ-ences on the surface and inside the thawed raw materials.

Fish are very susceptible to oxidation changes, therefore glazing is used to protect it against dehydration of surface and to inhibit

the access of oxygen to fish muscles and the consecutive oxidative changes. The protective effect of fish glazing can be increased by addition of antioxidants to the glaze. Grape is a very common and effective antioxidant (2, 5) and grape skins and grape seeds are rich sources of the active compounds, including flavonoids, with varying degrees of polymerization, which are known as proanthocyanidins (4).


Fillets from rainbow trout were used in the experiment. They were divided to three groups as follows:

Group 1 — unglazed fillets (N)Group 2 — fillets glazed with fresh potable water (GV)Group 3 — fillets glazed with water extract of red grapes (0.3 %; GH)Extract from red grape pomace (Calendula, Nová Ľubovňa)

was used as an antioxidant. The grape extract was diluted with fresh potable water and used for glazing of fish samples in the concentra-tion of 3.0 mg.ml-1 (0.3 %). The fillets were glazed by dipping in po-table water for 20 seconds to achieve optimum coating glaze (10 %). Subsequently, all samples were stored for one week under freezing conditions (–18 °C). The samples were then gradually thawed in three ways: the first group of fillets was thawed at room temperature (21 °C) for 12 hours, the second group was thawed in a refrigerator at 4 °C for 24 hours and the third group was thawed by microwave heating at 160 Watts for 2.5 min.

Determination of TBARs was performed according to the meth-od described by M a r c i n č á k et al. (1). Extinction of samples was measured by a UV-spectrophotometer Heλios γ v 4.6 (Ther-

EFFECT OF HERBAL EXTRACTS ADDED TO FISH GLAZE AND THE METHOD OF THAWING ON OXIDATION CHANGES IN LIPIDS

IN RAINBOW TROUT FILLETS

Mesarčová, L., Marcinčák, S., Nagy, J., Bača, M., Popelka, P.


[email protected]

43

mospectronic, UK) at a wavelength of 532 nm, and expressed as g of MDA per 1 kg of sample. Statistical analysis was performed by GraphPad Prism (1999), version 3.00, statistical software.


Basic chemical composition of meat of glazed and un-glazed samples of fish fillets of rainbow trout is shown in Table 1. Lower lipid content and protein content and con-versely higher water content was recorded in glazed fillets. Glazing has a moderate influence on the chemical compo-sition of the fish fillets. The results of determination of fat decomposition are shown in Table 2. The trout fillets thawed in the refrigerator (4 °C) showed no significant differences (all groups) although fillets glazed with the addition of grape extract exhibited the lowest level of degradation products.

Table 1. Chemical composition of rainbow trout fillets

Water [%]

Fat [%]

Dry mater [%]

Proteins [%]

N 69.65 ± 0.43 11.39 ± 0.54 30.35 ± 0.43 20.94 ± 0.17

GV 70.47 ± 0.18 10.37 ± 0.24 29.53 ± 0.18 20.08 ± 0.02

GH 70.52 ± 0.31 10.71 ± 0.43 29.48 ± 0.31 19.91 ± 0.06

N — unglazed; GV — glazed with fresh potable waterGH — glazed with water extract of grapes (0.3 %)

Table 2. Lipid oxidation (expressed as an amount of Malone dialdehyde mg.kg-1)

in herring fillets (mean ± SD)

Way of thawing N GV GH

Low temperature

0.34 ± 0.03 0.29 ± 0.06 0.25 ± 0.04

Microwave heating

0.82 ± 0.05a 0.76 ± 0.08a 0.47 ± 0.07b

Room temperature

1.55 ± 0.44a 1.49 ± 0.28a 0.63 ± 0.05b

N — unglazed; GV — glazed with fresh potable waterGH — glazed with water extract of grapes (0.3%); a,b — different letters in

superscript in a column indicate significant differences at P < 0.05

Thawing by microwave heating during the processing of fish is used relatively rarely because of the large tempera-ture differences on the surface and inside the defrosted raw materials (3). After microwave thawing, the level of malone dialdehyde was increased in all samples and the lowest con-centration was recorded in samples glazed by water with the addition of grapes (0.47 ± 0.07 mg.kg-1). Fillets thawed at room temperature contained the lowest amount of oxidation products, but the protective effect of grapes was the most obvious.

We can conclude that the method of thawing affects the rate of oxidation processes in fish and the best seems to be thawing at refrigerator temperature. The least suitable is thawing at room temperature during which the level of de-composition products grew by more than half compared to samples thawed at refrigerator temperatures. A protective ef-fect of extract of red grapes (0.3 %) was visible in all three groups of samples, but the most of those were thawed at room temperature.

ACKNOWLEDGEMENT

The study was supported by grant VEGA No. 1/0648/11.

REFERENCES

1. Marcinčák, S. et al., 2003: Effect of the natural antioxi-dants on the oxidative processes in pork meat. Folia Veterinaria, 47, 215—217.

2. Natella, F., Belelli, F., Gentili, V., Ursini, F., Scaccini, C., 2002: Grape seed proanthocyanidins prevent plasma postprandial oxidative stress in humans. J. Agric. Food Chem., 50, 7720—7725.

3. Pipová, M. et al., 2006: Chemical composition of fish meat. In Pipová et al.: Hygiene and Technology of Freshwater and Seafish Processing, UVL Košice and VFU Brno, 125—138.

4. Souquet, J. M., Cheinier, V., Brossaud, F., Moutounet, M., 1996: Polymeric proanthocyanidins from grape skins. Phytochemis-try, 43, 509—512.

5. Torres, J. L., Varela, B., Garcı’a, M. T., Carilla, J., Mati-to, C., Centelles, J. J. et al., 2002: Valorization of grape (Vitis vinif-era) byproducts. Antioxidant and biological properties of polyphe-nolic fractions differing in procyanidin composition and flavomol content. J. Agric. Food Chem., 50, 7548—7555.

44

ABSTRACT

The study compared the basic chemical composition indicators of mouflon muscles (neck, shoulder, back, thigh, flank) with other kinds of wild game. Eight years old mouflon (Ovis musimon) was hunted in May in game reserve Rozhanovce of the University of Veter-inary Medicine and Pharmacy in Košice. The results obtained showed that mouflon muscles contained 74.08 % of water, 21.43 % of proteins and 2.15 % of fat.

Key words: chemical composition; game; mouflon meat

INTRODUCTION

Nowadays, the terms healthy and natural become more rele-vant. Game meat is very important from this perspective as it comes from animals living in the wild. Wild animals have free food choice, and their feed spectrum is very wide in comparison with livestock animals, which affects the aromatic properties of meat. Moreover, wild animals are free to move which results in optimum muscle de-velopment and good blood supply (8).

Due the low fat content, game meat together with fish is very reach in proteins. Protein content of game meat exceeds the meat of livestock animals. These proteins are of particular biological value, which allows their use in the protein construction of the human body. The muscle fibres of game meat are finer in comparison with livestock animals that are strongly encircled with superficial apo-neuroses (8). From the nutritional point of view consumption of game meat brings some positive dietary benefits, especially due to relatively high protein content, which according to P i p e k (4)

COMPARISON OF SELECTED CHEMICAL COMPOSITION INDICATORS OF MOUFLON MUSCLES WITH OTHER KINDS OF WILD GAME

Nagy, J., Paulsen, P.1, Lazar, P., Turek, P., Nagyová, A., Popelka, P.


1University of Veterinary Medicine, WienAustria

[email protected]

ranges from 17 to 26 %. An advantage is also its low content of fat. Game meat contains high amounts of thiamine, riboflavin and pantothenic acid (1).

The properties and composition of game meat are affected by species, sex, environment, lifestyle, and season in which the wild game was hunted. The major impact has the health and nutritional status of wild game, way of game obtaining as well as game meat treatment and storage (5).

The aim of this study was to compare selected chemical compo-sition indicators of mouflon with those of other kinds of wild game.


The chemical analysis was carried out on muscles from differ-ent anatomical parts (neck, shoulder, back, thigh, flank) of mou-flon (Ovis musimon). The investigated mouflon (8 years old) was hunted in May in game reserve Rozhanovce of the University of Veterinary Medicine and Pharmacy in Košice.

The muscle samples were analyzed for the following:• water (dry matter) — by drying at 103 ± 2 °C (6),• protein by KJELTEC AUTO 1030 ANALYZER

(TECATOR, Sweden),• fat by extraction method according to Soxhlet (6).


The results of water, protein and fat content of different ana-tomical parts of mouflon are summarized in Table 1.

The mean water content of mouflon muscle was 74.08 %.


45

The water content in different parts of mouflon ranged from 73.30 % (back) to 76.14 % (shoulder). P o l a n s k á and M o j t o (3) presented the values of the water content reaching 74.24 % in red deer and 73.48 % in roe deer.

M o j t o et al. (2) published that meat of deer contains 22.53 % of protein, however, depending of the killing method it may contain 24.45 %, or even 24.64 %.

The mean value of protein content in mouflon muscle was lower (21.43 %) in comparison with deer meat, as in the case of protein content in different anatomical parts. The values of protein content in mouflon muscles ranged from 20.38 to 22.78 %.

W i n k e l m a y e r et al. (7) compared the values of fat content in wild animals with those in slaughter animals. They found a significant range in different kind of wild game (red deer 1—5 %, roe deer 0.7—6 % and hare 0.9—5 %). The fat content in red deer was compared with the fat content in beef (10—34 %), and roe deer with mutton (6—33 %). The average fat content in mouflon was 2.15 % and ranged from 0.56 % (back) to 4.50 % (flank).

Table 1. Water, protein and fat content of different anatomical parts of mouflon

Neck Shoulder Back Thigh Flank Mean

Water [%]

75.57 76.14 73.30 74.56 70.85 74.08

Protein [%)

20.38 21.25 21.48 21.28 22.78 21.43

Fat [%]

2.40 1.80 0.56 1.50 4.50 2.15

CONCLUSION

The content of water, protein and fat in different ana-tomical parts (neck, shoulder, back, thigh, flank) of mouflon (Ovis musimon) were determined. The mouflon contained on average 74.08 % water, 21.43 % proteins and 2.15 % fat.

REFERENCES

1. Honikel, K., Arneth, W., 1996: Neue Daten über den Cho-lesterin (In German). Fleischwirtschaft, 76, 1210—212.

2. Mojto, J., Kartusek, V., Palanská, O., Zaujec, K., 1999: Quality of butcher’s body and discarded meat of young fallow deer females in farm breeding. Folia Venatoria, 28—29, 57—63.

3. Polanská, O., Mojto, J., 1992: The quality is still good (In Slovak). Poľovníctvo a rybárstvo (Hunting and Fishing), 44, 9.

4. Pipek, P., 1995: Composition and properties of meat (In Czech). In Steinhauser et al.: Meat Hygiene and Technology, LAST, 1995, 11—23.

5. Smetana, M., 1978: Hygiene of game meat (In Czech). In Izák et al.: Food Hygiene, Príroda, 213—242.

6. Veterinary laboratory methods. Food chemistry (In Czech), 1990: SVS ČR, ŠVS SR, Bratislava, 223 pp.

7. Winkelmayer, R., Cenker, Ch., Zedka, H. F., 2000: Wild-bret (In German). Wildfleisch Verordnung, 2000, 11—13.

8. Winkelmayer, R., Lebersorger, P., Zedka, H. F., Forej tek, P., Vodňanský, M., Večerek, V. et al., 2005: Hygiene of Game Meat (In Czech). Central European Institute of Animal Ecology, Wien-Brno-Nitra, 168 pp.

46


ABSTRACT

Certain foodstuffs may present specific hazards to human health, requiring the setting of specific rules. The main objective of the EU legislation is consumer confidence in food owing to transparency and information of the public. Main principles of the new food legisla-tion cover high level of consumer protection, functioning of the inter-nal market, primary production and feedstuffs, ensuring food safety through self-monitoring by food business operators and risk analysis. Some threats remain undetected even if the food business operator (FBO) applied proper procedures and official controls were used. Therefore new methods are demanded for fast and reliable screen-ing of foodborne diseases. The majority of existing serological tests do not confirm that bacteria are present in the sample. Definitive results regarding presence of bacteria can be obtained during classi-cal culture methods or PCR. Among dozens of available PCR assays, Multiplex PCR seems to be the most adequate and useful method for this purpose. Multiplex PCR may be combined with a multi-pathogen pre-enrichment so its sensitivity is comparable to the traditional cul-ture method. Multiplex PCR assays may be able to simultaneously detect more than ten organisms in a single sample. Multiplex PCR may also be used for detection of moulds-producing mycotoxins (e.g. aflatoxin, ochratoxin or patulin). The features and advantages of mul-tiplex PCR make it a reliable, useful and cost-effective method for food safety purposes.

Key words: food safety; free-living animals; meat; multiplex PCR

POTENTIAL USE OF MULTIPLEX PCR AS AN ADDITIONAL LABORATORY TEST IN POST-MORTEM INSPECTION OF FREE-LIVING ANIMALS

Nowicki, M., Wiśniewski, J., Anusz, K.

Warsaw University of Life Sciences–SGGW (WULS-SGGW), Faculty of Veterinary MedicineDepartment of Food Hygiene and Public Health Protection, Nowoursynowska 159, 02-776 Warsaw

Poland

[email protected]

INTRODUCTION

According to European legislation the safety of food of animal origin is protected mainly by food business operators (FBO), of-ficial veterinarians and by hunters. Certain foodstuffs may present specific hazards to human health, requiring the setting of specific rules. The hazards result from the presence of specific microbio-logical, parasitological and chemical factors. In the EU, official controls and responsibilities of the FBO are described in the “Hy-giene Package” and related regulations. The main objective of this legislation is consumer confidence in food thanks to transparency and information of the public. The main principles of this new food legislation cover high levels of consumer protection, functioning of the internal market, primary production of feedstuffs responsibility for ensuring food safety through self-monitoring by the FBO and risk analysis. We also find that in some situations this regulation seems to be too general and does not cover all hazards related to food safety. Some threats may remain undetected even if the FBO applies proper procedures and official controls are performed.

The post-mortem inspection procedures described in the Regu-lation 854/2004 are the minimum requirements for the examination for diseases which can be dangerous to humans and animals. There-fore, new methods are demanded for fast and reliable screening of foodborne diseases.


Literature search, analysis of legislation and publications pro-vided by the manufacturers of instruments, equipment and reagents.

47


The most important threats connected to meat are de-scribed as “specific hazards” and cover transmissible spon-gifiorm encephalopathies (TSEs), brucelosis, tuberculosis, glanders, trichinosis and cysticercosis. In case of brucelosis and tuberculosis, meat assessment is based on visible symp-toms and changes. Even if the results of additional, specific serological tests are positive, meat can be treated as fit for consumption. Most serological tests do not confirm that bac-teria are present in the sample. This information only shows that an animal has specific antibodies. Definitive results re-garding presence of bacteria can be obtained during classic culture methods or PCR assays. Detection of bacteria using cultivation methods is time consuming but relatively inexpen-sive. PCR is fast but relatively expensive. PCR methods un-dergo rapid development and are more popular and therefore more routinely used. The price of kits is lower than a few years ago and may be considered in the future as a routine method of meat inspection.

Among dozens of available PCR assays, Multiplex PCR appears to be the most adequate and useful method of testing for this purpose. Multiplex PCR is a molecular technique for amplification of multiple targets in a single PCR run. Mul-tiple primer pairs are used in one reaction mixture to amplify more than one target sequence of DNA. In practice, this as-say has the potential to produce considerable savings in time and effort in the laboratory without compromising sensitivity and specificity.

For food safety purposes the Multiplex PCR methods for simultaneous detection of foodborne pathogens (e. g. salmo-nella, campylobacter, staphylococcus, listeria, E. coli O157:H7 or shigella) may be an effective method (1, 4, 5, 6, 9). Bacte-ria may be present in meat even if there are no visible symp-toms and changes and are detectable during ante-mortem and post-mortem inspection. Multiplex PCR may be com-bined with a multi-pathogen pre-enrichment so its sensitiv-ity is comparable to that of traditional culture methods (7). Multiplex PCR is capable of simultaneously detecting more than ten organisms in a single sample (2, 8). This advantage was used to introduce successfully a novel method of auto-mated nested multiplex PCR for multi-pathogen detection. The method is currently evaluated for the detection of respi-ratory viruses and bacteria (8). A new gastrointestinal panel is under development for the detection of over twenty bacte-rial, viral and parasitic pathogens. Multiplex PCR may also be used for detection of moulds-producing mycotoxins (e. g. aflatoxin, ochratoxin or patulin) (3).

The features and advantages of multiplex PCR make it a reliable, useful and cost-effective method for food safety purposes.

CONCLUSIONS

Meat inspection by veterinarians and inspectors cannot be replaced by any automated method of analysis. Even if all procedures have been completed, some threats may continue to remain undetected. Multiplex PCR appears to be an ad-equate, fast and reliable method to complement the existing procedures.

REFERENCES

1. Alves, J., Hirooka, E. Y., Marques, V. V., Protasio Pereira, L. F., Rocha Moreira De Oliveira, T. C., 2012: Multiplex PCR for the detection of Campylobacter Spp. and Salmonella Spp. in chicken meat. Journal of Food Safety, 32, 345—350.

2. Amiott, E., Blaschke, A. J., Byington, C. L., Daly, J., Dobrowolski, S. F., Herbener, A. et al., 2011: FilmArray, an auto-mated nested multiplex PCR system for multi-pathogen detection: development and application to respiratory tract infection. PLoS One, 6, 10.

3. Andrade, M. J., Córdoba, J. J., Rodríguez, A., Rodríguez, M., 2012: Development of a multiplex real-time PCR to quantify aflatoxin, ochratoxin A and patulin producing molds in foods. Int. J. Food Microbiol., 155, 10—18.

4. Bai, X., Cai, Z., Chen, J., Liu, J., Tang, J., 2012: Develop-ment and evaluation of a multiplex PCR for simultaneous detection of five foodborne pathogens. J. Appl. Microbiol., 112, 823—830.

5. Bolton, D., Fanning, S., Leonard, N., Rajtak, U., 2011: A real-time multiplex SYBR Green I polymerase chain reaction assay for rapid screening of salmonella serotypes prevalent in the european Union. Foodborne Pathog. Dis., 8, 769—780.

6. Buschow, A. W., Hill, W. E., Richter, H. C., Samadpour, M., Smith, C. R., Suhalim, R., 2011: Polymerase chain reaction screening for salmonella and enterohemorrhagic Escherichia coli on beef products in processing establishments. Foodborne Pathog. Dis., 8, 1045—1053.

7. De Reu, K., De Rijk, P., De Zutter, L., Del-Favero, J., Her-man, L., Heyndrickx, M. et al., 2012: Evaluation of a multiplex-PCR detection in combination with an isolation method for STEC O26, O103, O111, O145 and sorbitol fermenting O157 in food. Food Microbiol., 29, 49—55.

8. Elkan, M., Hodinka, R. L., Leet, M., McGowan, K. L., Pierce, V. M., 2011: Comparison of the Idaho Technology FilmAr-ray system to real-time PCR for detection of respiratory pathogens in children. J. Clin. Microbiol., 50, 364—371.

9. Wang, H., Xing, D., Zhang, C., 2011: Multichannel oscilla-tory-flow multiplex PCR microfluidics for high-throughput and fast detection of foodborne bacterial pathogens. Biomed. Microdevices, 13, 885—897.

48


ABSTRACT

A liquid chromatography-tandem mass spectrometry (LC-MS/MS) method has been developed for the determination of metabolites of furazolidone, furaltadone, nitrofurantoin, and nitrofurazone in the poultry muscle and eggs. The procedure requires an acid-catalysed release of protein-bound metabolites, followed by their in situ con-version into the 2-nitrobenzaldehyde (NBA) derivatives. The sample clean up was performed on a solid phase extraction (SPE) cartridge. LC-MS/MS analysis was performed by positive electrospray ionisa-tion (ESI) applying multiple reaction monitoring (MRM) of two transition reactions for each compound. The validation of the method was conducted following the European Union (EU) criteria for the analysis of veterinary drug residues in foods. The decision limits (CCa) were 0.16—0.24 mg.kg-1, and the detection capabilities (CCb) 0.22—0.36 mg.kg-1.

Key words: eggs; mass spectrometry; muscle; nitrofurans me-tabolites

INTRODUCTION

Use of the four main nitrofurans (furazolidone, furaltadone, nitrofurazone, and nitrofurantoin) has been banned within the Eu-ropean Union (Commission Regulation 37/2010) due to their toxi-cological influence on health of consumers of food animal origin (5). Previously, these antibacterial agents were added to feeds to stimulate growth or/and to prevent and treat several bacterial and protozoan infections, such as fowl cholera, coccidiosis and black-head. After administration to poultry, the nitrofurans are quickly

DETERMINATION OF NITROFURAN METABOLITES IN THE POULTRY MUSCLE AND EGGS BY LC-MS

Śniegocki, T., Żmudzki, J., Posyniak, A.

Department of Pharmacology and ToxicologyNational Veterinary Research Institute, 24-100, Pulawy

Poland

[email protected]

metabolized to more stable products as follow: nitrofurantion to 1-aminohydantoin (AHD); furazolidone to 3-amino-2-oxazolidone (AOZ); furaldatone to 5-methylamorfolino-3-amino-2-oxazolidone (AMOZ); and nitrofurazone to semicarbazide (SEM). The metabo-lism products are bound in protein and stay in animal body or ani-mal products (e.g. eggs) for a few days (elimination half-life time between 4 and 9 d) (2).

In this paper, procedure described for the determination of SEM (6) was modified for the simultaneous determination of four target analytes (AOZ, AMOZ, AHD, and SEM) in the poultry mus-cle and eggs. The nitrofuran metabolites were analyzed by LC-MS/MS after electron spray ionization (ESI) in the positive mode using multiple reaction monitoring (MRM).


Reagents and Chemicals. Ammonium formate, acetic acid (99.5 %), hexane (95 %), ethyl acetate and methanol (HPLC grade) were from J. T. Baker (Deventer, the Netherlands). Ultrapure wa-ter was filtered through a Milli-Q system Millipore (Bedford, MA, USA). Anhydrous dipotassium hydrogen orthophosphate, hydro-chloric acid (35 %) and sodium hydroxide were supplied from POCH (Gliwice, Poland). 2-nitrobenzaldehyde (2-NBA) was from Sigma Aldrich Chemical Company (Germany).

Standard solutions. The metabolites AOZ, AMOZ, AHD and SEM, the internal standards AOZ-d4, AMOZ-d5, and SEM (C13, N15, N15) were supplied by Sigma (Aldrich Chemical Company, Germany). Stock solutions may be stored refrigerated below –14 °C for at least 12 months and standard solutions should be stored re-frigerated from 2 °C to 8 °C.

49

Table 1. Transition reactions monitored by LC-ESI–MS/MS

AnalytesRetention time [min]

Q1 Q3Ion ratio

[%]Internal standard

Internal standardQ1/Q3

AOZ 10.8 335.2291.1

9.3 AMOZ-d5

340.3/296.2

262.1 340.3/25.2

AMOZ 10.2 209.2191.9

60.4 SEM-C13

, 2 N15

212.0/195.0

166.0 212.0/168.0

SEM 9.8 249.2134.2

46.7 AOZ-d4

240.0/134.0

104.1 240.0/104.0

AHD 10.4 236.2134.0

36.0 AOZ-d4

240.0/134.0

104.0 240.0/104.0

Table 2. Recovery, repeatability, and reproducibility-validation data for eggs matrix

AnalytesRecovery

[%]Repeatability Reproducibility

CCa, mg.kg-1

CCb, mg.kg-1

0.5a 1.0 1.5 2.0 0.5 1.0 1.5 2.0

AOZ 102.8 7.4 10.4 14.2 8.2 7.6 9.0 13.3 7.1 0.16 0.22

AMOZ 110.8 3.9 4.8 7.8 7.5 4.3 4.6 7.6 7.8 0.25 0.36

SEM 102.0 4.7 3.0 7.2 7.4 4.1 4.0 7.0 7.7 0.17 0.24

AHD 101.0 8.9 4.4 10.6 4.3 11.6 3.9 10.4 3.8 0.24 0.33

a — fortification level in μg.kg-1

Table 3. Recovery, repeatability, and reproducibility-validation data for the poultry muscle matrix

AnalytesRecovery

(%)Repeatability Reproducibility

CCa, mg.kg-1

CCb, mg.kg-1

0.5a 1.0 1.5 2.0 0.5 1.0 1.5 2.0

AOZ 102.8 3.7 1.5 1.0 8.2 4.3 3.8 3.8 7.1 0.55 0.60

AMOZ 110.8 2.1 4.4 6.3 7.5 2.6 5.4 7.5 7.8 0.53 0.55

SEM 102.0 2.4 3.5 2.1 7.4 3.1 4.2 4.9 7.7 0.54 0.56

AHD 101.0 9.5 5.7 11.5 7.5 12.9 12.4 10.4 3.8 0.56 0.65

a — fortification level in μg.kg-1

Extraction. An amount of 2.0 ± 0.05 g of fresh egg portion and muscle of each samples were transferred to centrifuge tubes. The samples were submitted to hydrolysis and derivatisation processes, by adding internal standard mixture (AMOZ-d5, AOZ-d4 and 1,2-

[15N2, 13C] SEM), 10 ml of the 0.2 mol.l-1 hydrochloric acid and 240 ml of 2-NBA (10 mg.ml-1 in methanol). The samples were trans-ferred to centrifuge tubes, capped securely and vortexed for 30 s, then placed in a water bath at 40 ± 3 °C and incubated overnight.

50

After the incubation the samples were removed from the water bath and they were allowed to cool to room temperature. The pH-value of about 7.0 was adjusted by addition of 10 ml of 0.2 mol.l-1 dipo-tassium hydrogen orthophosphate solution and 800 ml of 2 mol.l-1 sodium hydroxide solution. The samples were centrifuged at 4500 g for 15 min and transferred to the SDB-L cartridges.

Clean-up. SPE cartridges were placed on vacuum manifold and the cartridges were conditioned (3 ml of ethyl, 3 ml of methanol and 5 ml of water, sequentially), a small portion (0.5 ml) of water should be remains on the cartridges until the sample extracts were applied. The samples extract were passed through the SDB-L car-tridges, followed by washing with 5 ml of water and 5 ml of hexane and elution with ethyl acetate. The eluates were vortexed for 10 s and evaporated to dryness on the heating block at 40 °C under a gentle stream of nitrogen. The residues were dissolved in 200 ml of 60 % methanol solution in water and filtered through 0.45 mm filters, before injecting onto the LC column.

LC-MS/MS. The LC-MS/MS system consisted of an Agilent Series 1100 HPLC system (Agilent Technologies, Waldbrom, Ger-many) connected to a PE Sciex API 4000 triple quadrupole mass spectrometer (PE Sciex, Toronto, Canada) in electrospray positive ionization mode. The chromatography analysis was performed in a C18 column 3 mm × 2 mm 150 mm (Phenomenex, Torrance, CA, USA). The ions were monitored by Multiple Reaction Monitoring (MRM), and are listed in Table 1.

Validation. The whole procedure was validated according the qual-ity standard 2002/657/EC decision (4). As it was shown in Tables 2 and 3, the following parameters were established: linear regression equation, correlation coefficient, linearity (working range), detection limit (CCα), detection capability (CCβ), recovery, repeatability and uncertainty.


In this study, a polystyrene-divinylbenzene copolymer (SDB-L) was used as sorbent material, which enables a strong and quite selective retention of the nitro-aromatic derivatives (π-π-interaction) while most of the matrix compounds are more weakly retained. We observed that the procedure of solvent prewashing by water and especially hexane reduced the amount of matrix co-extractives and permitted adequate clean up of sample extracts by SPE. The chromatographic system applied in our method exhibited enough resolution to separate the analyte peaks from those resulting from matrix interference and separation was performed with gradient elu-tion on a Luna C18 analytical column and the mobile phase for LC analyses consisted of ammonium formate and metha-nol (80 : 20 v/v).

All nitrofuran metabolites have low molecular masses, from 75 m/z (SEM) to 201 m/z (AMOZ). In liquid chroma-tography coupled to mass spectrometry analysis of low-mo-lecular-mass substances promotes a relative poor sensitivity due to high abundant mass spectrometric background noise in this mass range and non-specific fragmentation behaviour (e. g. loss of ammonia, water or carbon dioxide). The

derivatisation of the free amino groups with NBA normally in-creases the sensitivity of the MS analysis significantly which has been described by various authors (1, 2, 6). This simple approach has the additional advantage of simultaneous hy-drolysis of the protein-bond metabolites and rapid derivatisa-tion with NBA since the chemical attack of the nucleophile, R-NH2, on the NBA carbonyl group is catalyzed by acid. The best MS sensitivity for the four analytes was obtained using the positive ESI mode. To reach the highest sensitivity, optimal MS-MS parameters proved to be quite different for the four analytes. Substance identification and quantification was performed by multiple reaction monitoring (MRM) se-lecting one parent ion and two product ions for each analyte, which is in accordance with the EU guidelines for unambigu-ous positive identification and quantification of analytes (4).

CONCLUSIONS

The method for the determination of residual nitrofu-rans metabolites in the poultry muscle and eggs has been developed. The selection of an adequate clean-up procedure using SPE polymeric cartridges made the method suitable for routine analysis of nitrofurans metabolites in the poultry muscle and eggs. The applied LC-MS/MS conditions allows to satisfactory separate and analysis of target agents with ac-cordance to considered conditions.

ACKNOWLEDGEMENT

This work was supported by grant No. 2PO6K02230 from the Min-istry of Science and Higher Education, Warsaw, Poland.

REFERENCES

1. Bock, C., Stachel, C., Gowik, P., 2007: Validation of a con-firmatory method for the determination of residues of four nitrofu-rans in egg by liquid chromatography-tandem mass spectrometry with the software InterVal. Anal. Chim. Acta, 586, 348—358.

2. Connely, A., Nugget, A., O’Keeffe, M., Mulder, P. P. J., van Rhijn, J. A., Kovacsics L. et al., 2003: Isolation of bound resi-dues of nitrofuran drugs from tissue by solid-phase extraction with determination by liquid chromatography with UV and tandem mass spectrometric detection. Anal. Chim. Acta, 483, 91—98.

3. Commission Regulation (EC) 1442/95, 1995: Off. J. Eur. Commun. No. L143, 26.

4. Commission Decision (EC) 2002/657, 2002: Off. J. Eur. Commun. No. 1221, 8.

5. Commission Regulation (EC) 37/2010, 2010: Off. J. Eur. Commun. No. 3, 1.

6. De La Calle, M. B., 2006: Determination of semicarbazide in fresh egg and whole egg powder by liquid chromatography/tan-dem mass spectrometry: interlaboratory validation study. J. AOAC Int., 89, 1664—1671.

51


ABSTRACT

Antibiotics are used to maintain and improve the health of poultry by treating some diseases and preventing and controlling them but, in some cases, also to promote poultry growth. As residues of these antibiotics can persist in poultry meat, consumers of this meat are exposed to the risk of decreasing their sensitivity to antibiotic usage. There are several methods of antibiotic residue detection in foodstuffs as well as in the meat and meat products. One of the most effective detection methods is the semi-quantitative PREMI®Test.

Key words: inhibitory substances; poultry meat; PREMI®Test

INTRODUCTION

Antibiotics are used by meat producers to treat diseases and to improve animal production. They are also widely administered in fin-fish aquaculture to prevent bacterial infections that result from poor sanitation in fish farming (6). The Council regulation (EES) No. 2377/90 includes antibiotics under the name “veterinary me-dicinal products.” Veterinary medicinal products are defined as “all pharmacologically active substances, whether active substances, whether active principles, excipients or degradation products, and their metabolites which remain in foodstuffs obtained from animals to which the veterinary medicinal product in question has been ad-ministered.”

The term maximum residue limit (MRL) is defined as “the maximum concentration of residue resulting from use of a veteri-nary medicinal product (expressed in mg.kg-1 or μg.kg-1 on a fresh weight basis) which may be accepted by the Community to be legal-

DETECTION OF INHIBITORY SUBSTANCES IN POULTRY MEAT AND POULTRY MEAT QUALITY

Staruch, L., Mati, M.

Department of Biotechnology and Food Science, FCHPT STU, Radlinského 9, 812 37 BratislavaThe Slovak Republic

[email protected]

ly permitted or recognized as acceptable in or on a food” (1). The regulation also contains a list of all pharmacologically active sub-stances with their maximum tolerable limits in target tissues except the following, that cannot be specified in the meaning of tolerable limits: aristicholia and products derived from it, chloramphenicol, chlorophorm, chlorpromazine, kolchicine, dapsone, dimetridazole, metronidazole, nitrophuranes (including furazolidon) a ronidazole. These substances are not tolerated (neither in minimal quantities) in animals (1). This list of pharmacologically active substances was updated by the Council regulation (EU) No. 37/2010 (2).

The present study focused on detection of antibiotic residues and pharmaceuticals in poultry meat of producers from several countries by using PREMI®Test, based on inhibition of Bacillus stearothermophilus growth.

Pharmacologically active substances in poultry meatIn poultry, antibiotics and antiparasitics are used very often for

treatment and disease prevention. In the USA, antibiotics are used for growth promotion, while in the European Union this type of use has been prohibited since 2006. The following groups of phar-macologically active substances are used in poultry: aminocyclitols (spektinomycin and apramycin); aminoglycosides (streptomycin, neomycin and gentamycin); amphenicols (chloramphenicol, which application in animals is in developed parts of the world prohib-ited because of the bone marrow damage suspicion; thiampheni-col and florfenicol); beta-lactams (penicillin, ampicillin, cephalo-sporins and cephalexins); macrolides (erythromycin, tylosin and spiramycin); nitrofurans; polymyxins (colistin); quinolones, fluo-roquinolones and quinolone derivatives; sulphonamide synergists (trimethoprim, ormetoprim and pyrimethamine); tetracyclines (doxycycline, oxytetracycline); ionophores (lasalocid, monensin,

52

Table 1. Results of inhibitory substances analysis

Name of a product ProducerResult — presence

of the inhibitory substances

“Úprimné kurča s rodokmeňom” Hyza, a.s., SR neg.

“Sedliacke kurča bez drobkov” Hydina Košice, s.r.o., SR neg.

“Kura kráľovské” HSH, s.r.o., SR neg.

“Maxi kurča bez drobkov” Hydina Košice, s.r.o., SR neg.

“Čerstvé kurča s plnkou” Hyza, a.s., SR neg.

“Kurča bez drobov” Hyza, a.s., SR neg.

“Kurča bez drobkov (Best farm)” Hyza, a.s., SR neg.

“Kurča (HYZA)” Hyza, a.s., SR neg.

“Kurča bez drobkov (albert)” Hyza, a.s., SR neg.

“Zlaté kuře (Vodňanské kuře)” Vodňaská drůběž, a.s., CR neg.

“Kurča chladené celé BIO” Hubers Landhendl, AUT neg.

“Kurča chladené” Mäsosort, SR neg.

“Bio kuře (biopark)” Biopark, s.r.o., CR neg.

“Kura chladené” PD Trsteník neg.

“Kura chladené” Atlanta, spol. s.r.o., Čadca, SR neg.

“Kura chladené” PD Lokca, SR neg.

“Kura chladené” PD Bolešov, SR neg.

“Kura chladené” PD Lisková, SR neg.

“Kuracie prsia (filet) (Kabanos)” Kabanos, PL neg.

Repeated analysis:

“Kura chladené” Atlanta, spol. s.r.o., Čadca, SR neg.

“Kura chladené” PD Lokca, SR neg.

“Kura chladené” PD Bolešov, SR neg.

“Kura chladené” PD Lisková, SR neg.

“Kuracie prsia (filet)” Kabanos, PL neg.

narasin and salinomycin); carbanilides; benzamides; triazines; an-thelmintics- benzimidazoles (flubendazole and albendazole); nitro-imidazoles (dimetridazole, ronidazole, ipronidazole). Edible tissues containing veterinary drug residues can pose risks to human health, including direct toxic effects, allergic reactions and increased bacte-rial resistance to common antibiotics (4).

Antibiotic detection methods in animal productsThere is a number of methods for the antibiotic residue detec-

tion in animal products. Antibiotest is one of the simplest methods that uses reaction stripes (stripes are designed for dipping into the samples — most commonly milk). Microbiological plate control methods resemble the antibiotest and are frequently used in milk

53

industry. Other ways of detection are immuno-enzymatic ELISA methods of analysis; microbial inhibitory tests e.g. PREMI test or radio-immunoenzymatic method (RIA, Charm II). Association of liquid chromatography and mass spectrometry (LC-MS) is used as a highly accepted confirmatory analysis of previously mentioned methods (3, 6).


We examined 20 samples of poultry meat from Slovak, Polish, Czech, Austrian and Hungarian producers by the PREMI®Test

The PREMI®Test is a semiquantitative microbial inhibitory test. By means of 25 ampoules it allows screening meat (beef, pork, poultry), fish, shrimp, eggs, feed and urine. Two negative control ampoules are also used


Results obtained in our study are presented in Table1.All 20 samples of poultry meat tested negative for inhibi-

tory substances which means that the producers and dealers complied with the respective regulations. The importance of this monitoring is still very high despite negative results in the last couple of years. The reason is that the residues of inhibitory substances in foodstuffs pose serious health risk to consumers. We highly recommend to perform the analysis of products directly from farmers before they get on the market.

ACKNOWLEDGEMENT

This study was supported by JEMO TRADING Company.

REFERENCES

1. Council regulation EES No. 2377/90 of 26 June, 1990: Lay-ing down a Community procedure for the establishment of maxi-mum residue limits of veterinary medicinal products in foodstuffs of animal origin.

2. Council regulation (EU) No. 37/2010 of 22 December, 2009: On pharmacologically active substances and their classification re-garding maximum residue limits in foodstuffs of animal origin.

3. Gaare, M., Kumar, N., Raghu, H. V. et al., 2012: Specific detection of β-lactam antibiotics in milk by spore based assay. Inter-national Research Journal of Microbiology, 3, 168—178.

4. Goetting, V., Lee, K. A., Tell, L. A. et al., 2011: Pharma-cokinetics of veterinary drugs in laying hens and residues in eggs: a review of the literature. J. Vet. Pharmacol. Ther., 53, 1—36.

5. Kološta, M., 2007: Risk of occurrence of inhibitory substanc-es residues in milk (In Slovak) [online]. Available on the internet: <http://www.mpsr.sk%2Fdownload.php%3FfID%3D1497&ei=raoNUNKEEYiisQbF9oHoAQ&usg=AFQjCNF9il1Lb3KmTD0_jJi8md89xTFBKg&sig2=4RjNChTyerwAkLCQnR6L9g >.

6. Zeliger, H. I., 2011: Human Toxicology of Chemical Mix-tures. 2nd edn., Oxford, Elsevier, 558 pp.

54


ABSTRACT

Hepatitis E virus (HEV) is new emerging pathogen with zoonotic potential. Domestic pigs, wild boars and deer have been recognised as natural reservoirs of the virus. In the process, the consumption of raw or undercooked meat, offal, meat products or direct contact with infected animals have been classified as risks factors of HEV transmission. Based on this knowledge, the aim of the study was to determine the prevalence of HEV in wild boars (Sus scrofa), cervid (Cervus elaphus, Capreolus capreolus, Dama dama and Cervus nip-pon) and moufflons (Ovis musimon) and find out possible relation between the animal and human isolates in the Czech Republic. Using real time RT-PCR, HEV genomic RNA was detected in a total of 74 (21.3 %) tested animals; 70 (30.2 %) wild boars, two (5 %) red deer, one roe deer and one moufflon. The HEV prevalence of 16.7 % was detected in free-living wild boars, while up to 62.5 % of wild boars bred in game enclosure were found to be HEV positive. Phylogenetic relation between HEV isolates of animal and human origin indicated zoonotic transmission of HEV in the Czech Republic.

Key words: foodborne transmission; molecular-biological meth-ods; phylogenetic analysis; zoonosis

INTRODUCTION

Hepatitis E virus (HEV) is a small, non-enveloped RNA virus, which is classified in the genus Hepevirus, family H e p e v i r i - d a e . The virus is the main causative agent of enterally transmitted hepatitis non-A non-B in human, hepatitis E (HE). Outbreaks of HE occur in developing countries mainly due to the poor sanitation

PREVALENCE OF HEPATITIS E VIRUS IN POPULATION OF WILD ANIMALS AND THE RISKS FACTORS OF FOODBORNE INFECTION ASSOCIATED TO VENISON

Vasickova, P.1, Kralik, P.1, Lamka, J.2, Zakovcik, V.3, Bicek, J.3

Cihlar, D.3, Dvorak, Z.3, Lukes, D.3, Machaty, J.3, Piskovsky, R.3, Pavlik, I.1

1Veterinary Research Institute, Hudcova 70, 621 00 Brno2Charles University in Prague, Faculty of Pharmacy in Hradec Kralove, Heyrovskeho 1203, 500 05 Hradec Kralove

3Central Military Veterinary Institute at Hlucin, Opavska 29, 748 01 HlucinThe Czech Republic

[email protected]

or hygiene and thus to faecal contamination of drinking water. In industrial countries, HE is detected sporadically. The HEV infec-tion can be associated to visit of developing countries; however, an increasing numbers of autochthonous cases were identified over the last decade (3). According to analysis of HEV genome, the isolates segregate into four major genotypes (g1, g2, g3 and g4) and several subtypes. Each HEV genotype (even subtype) appears to have spe-cific geographical distribution. Besides, the relative conservation of g1 and g2 corresponds with primary circulation in humans and epidemics in developing countries. To the contrary, the diversity of g3 and g4 (especially g3) is related to its zoonotic potential. These genotypes are responsible for sporadic cases of HE in both develop-ing and industrialized countries. Domestic pigs, wild boars, deer and likely other animals are considered as natural reservoirs of g3 and g4 and consumption of raw or undercooked meat and offal or direct contact with infected animals belong to risks factors of HEV infection (1).

Based on this data, the aim of the study was to i) determine the prevalence of HEV in wild boars (Sus scrofa), cervid (Cervus elaphus, Capreolus capreolus, Dama dama and Cervus nippon) and moufflons (Ovis musimon) bred in the Czech Republic, ii) to per-form sequence comparison and phylogenetic analysis of HEV iso-lates and iii) to find out possible genetic relation the isolates and isolates originating from Czech HE patients.


A total of 347 animals (232 wild boars, 44 red deer, 9 roe deer, 21 fallow deer, 20 sika deer and 20 moufflons) originating from five hunting grounds and two game enclosures were subjected to testing

55

for the presence of HEV genomic RNA. Bile, liver tissue and faeces were collected from wild boars and moufflons, whereas only liver tissue and faeces were obtained from cervid.

The isolation of RNA from tested matrices and detection of HEV RNA by triplex real time reverse transcription polymerase chain reaction (qRT-PCR) was performed as described previously (7). Subsequently, the specific parts of ORF1 gene from acquired HEV isolates were subjected to sequencing (Eurofins MWG Op-eron, Germany). The sequence and phylogenetic analyses were car-ried out by MEGA 5.05 software using neighbor-joining method (6).


Triplex qRT-PCR revealed HEV RNA in at least one sample originating from 74 (21.3 %) animals; i. e. 70 (30.2 %) wild boars, two (5 %) red deer, one roe deer and one mouf-flon were found to be HEV RNA positive. The HEV preva-lence of 16.7 % was detected in free-living wild boars, which is comparable to other European countries; e.g. 12.2 % in Hungary (4), 25 % in Italy (2), and 14.9 % in Germany (5). To the contrary, up to 62.5 % of wild boars bred in game enclosure were found to be HEV positive. The finding of HEV RNA in moufflons was the first detection of HEV in this species reported in the literature. All samples originat-ing from fallow deer and sika deer were HEV RNA negative. Sequence and phylogenetic analysis showed that the isolates originating from wild boars were clustered in g3 and were the most related to other Czech isolates originating from domes-tic pigs, Czech HE patients and neighbouring countries (e.g. Germany and Austria). This indicated interspecies circula-tion of HEV in the Czech Republic. Besides anamnestic data of HE’s patients supported the possible foodborne or zoo-notic transmission of HEV (personal communication, Prof. MUDr. Pavel Chalupa, CSc., Hospital Na Bulovce, Prague, Czech Republic).

CONCLUSIONS

HEV genome was detected in a total of 74 (21.3 %) tested animals; 70 (30.2 %) wild boars, two (5 %) red deer, one roe deer and one moufflon. In the process, the HEV prevalence of 16.7 % was detected in free-living wild boars, while up to

62.5 % of wild boars bred in game enclosure were found to be HEV positive. According to the sequence analyses of de-tected HEV isolates, supported by anamnestic data of HE’s patients, consumption of insufficiently heat treated veni-son represents one of the risk factors of HEV transmission. Therefore, the knowledge of HEV distribution and possible circulation within animal species is important for public health.

ACKNOWLEDGEMENT

This work was supported by the Min. Agr. (No. MZE0002716202), the Min. Edu., Youth and Sports (AdmireVet CZ 1.05/2.1.00/01.0006-ED0006/01/01) and Min. of interior of the Czech Republic (VG2010 2015011).

REFERENCES

1. Lu, L., Li, C. H., Hagedorn, C. H., 2006: Phylogenetic analysis of global hepatitis E virus sequences: genetic diversity, sub-types and zoonosis. Rev. Med. Virol., 16, 5—36.

2. Martelli, F., Caprioli, A., Zengarini, M., Marata, A., Fieg-na, C., Di, B., I. et al., 2008: Detection of hepatitis E virus (HEV) in a demographic managed wild boar (Sus scrofa) population in Italy. Vet. Microbiol., 126, 74—81.

3. Meng, X. J., 2010: Hepatitis E virus: animal reservoirs and zoonotic risk. Vet. Microbiol., 140, 256—265.

4. Reuter, G., Fodor, D., Forgach, P., Katai, A., Szucs, G., 2009: Characterization and zoonotic potential of endemic hepatitis E virus (HEV) strains in humans and animals in Hungary. J. Clin. Virol., 44, 277—281.

5. Schielke, A., Sachs, K., Lierz, M., Appel, B., Jansen, A., Johne, R., 2009: Detection of hepatitis E virus in wild boars of rural and urban regions in Germany and whole genome character-ization of an endemic strain. Virol. J., 6, 58—65.

6. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011: MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol., 28, 2731—9.

7. Vasickova, P., Kralik, P., Slana, I., Pavlik, I., 2012: Opti-misation of a triplex real time RT-PCR for detection of hepatitis E virus RNA and validation on biological samples. J. Virol. Methods, 180, 38—42.

56


ABSTRACT

Enzymatic and non-enzymatic oxidative defence mechanisms are a guiding principle for reverting the undesirable effects of reac-tive oxygen species (ROS) and ensuring the oxidative stability and biological safety of chicken meat. Under physiological conditions the redox state is kept within a narrow range. The most important sys-tem maintaining the homeostatic balance is the glutathione buffer system. Effect of feed supplementation on this redox homeostasis was investigated in mitochondria, which alone are the greatest source of endogenous ROS production by major metabolic organs or organs sensitive to oxidative damage. Feed supplements did not affect the investigated system but plant extracts affected positively the levels of reduced glutathione.

Key words: oxidative stability; oxidative stress; reduced glutathi-one

INTRODUCTION

The presence of free radicals derived from both endogenous and exogenous sources in the body has its function involving signal-ing pathways but their excess is undesirable. Defensive mechanisms in the body include prevention of their formation and reparative and antioxidant mechanisms. Very effective dietary antioxidants are tocopherols, carotenoids and flavonoids, the secondary metabolism products of plants. In biological systems they manifest themselves as free radicals quenchers, metal ions chelators, activators of anti-oxidant enzymes, substances interacting with an enzyme and acting synergistically with other antioxidants. In addition, flavonoids are

CHANGES IN GLUTATHIONE LEVELS IN BROILER CHICKEN TISSUES INDUCED BY DIETARY SUPPLEMENTATION OF GAMMA

LINOLENIC ACID AND SELECTED PLANT EXTRACTS

Vašková, J.1, Fejerčáková, A.1, Marcinčák, S.2, Vaško L.1

1Department of Medical and Clinical Biochemistry, Faculty of MedicinePavol Jozef Šafárik University in Košice, Tr. SNP 1, 040 11 Košice

2University of Veterinary Medicine and Pharmacy, Komenskeho 73, 041 81 Košice,The Slovak Republic

[email protected]

oxidized by radicals to more stable and less reactive radicals. The main endogenous antioxidant and redox buffer in cells is the tri-peptide, glutathione. The highest incidence of reduced glutathione (GSH) is in cytosol, nucleus and mitochondria. GSH is effective against oxidative stress as a cofactor of some antioxidant enzymes, such as glutathione-S-transferase, involved in the transfer of amino acids across the plasma membrane, directly taken up hydroxyl radi-cal and singlet oxygen and nitrogen particles, converting hydrogen peroxide and lipid peroxides by the catalytic activity of glutathione peroxidase, and directly or indirectly regenerating the most impor-tant antioxidants (vitamin A and E). GSH regeneration capacity is related to maintaining a high ratio of reduced and oxidized glu-tathione GSH/GSSH (3). Decrease in GSH levels indicates oxida-tive stress at the time when other biochemical changes are not yet detectable (3) and therefore is an important indicator of the redox state.

The aim of this study was to investigate the levels of GSH in plasma, heart, liver and kidney mitochondria after administration of selected active ingredients applied to compound broiler chickens.


120 one-day-old broiler chickens (Cobb 500) were divided to 3 groups, 40 chicks in each. They were fed growth phase rations ad libitum. The control group (C) was given basic mixed feed mixture. Diet of the first experimental group (E1) was supplemented with a combination of 0.1 % extract of Agrimonia Eupatoria L. (A) and 0.1 % extract of Vitis vinifera L. (V) re and 0.05 % extract of Gentiana lutea L. (G) was added to drinking water. The second experimental group (E2) received 0.1 % extract of Agrimonia Eupatoria L. and 1 %

57

of γ-linolenic acid (GLA) in drinking water. On day 42, the animals were killed by cervical dislocation after previous stunning. Isolation of mitochondria was performed according to F e r n á n d e z - V i- z a r r a et al. (1). GSH level was determined by F l o r e a n i et al. (2). Results are reported as mean ± SD of three independent mea-surements. Statistical significance was determined by t-test.


The effect of metabolized flavonoids and GLA would soon be reflected in the liver after their absorption, as poly-phenols are degraded to low molecular weight particles dur-ing the absorption in the intestinal epithelium and are then conjugated in the liver. We observed significantly reduced lev-els of GSH only in the E1 group supplemented with polyphe-nols (Fig. 1). This may not be related directly to conditions

of oxidative stress but rather to the described ability of vari-ous plant extracts to react directly with nucleophilic agents which contain highly reactive-SH groups. It is therefore prob-able that the metabolites of extracts react with thiols directly, without involvement of other antioxidant mechanisms. In the E2 group we did not detect decrease in the levels of GSH. It is known that unsaturated fatty acids (as GLA) are oxido-labile and lead to increased formation of peroxides. Lipid peroxi-dation is controlled only in the liver, where, unlike in other organs, this regulatory element is desirable in the synthesis of apoproteins (4). In heart mitochondria, we observed reduced levels of GSH in both experimental groups. Clearly speaking, the reduction in GSH levels in these cases enables develop-

ment of oxidative stress development rather than a decrease in GSH. In this context it should be noted that GSH is not synthesized in mitochondria (3).

Reduction in GSH levels, but not depletion may therefore result from reduced synthesis in the cytosol and thus also transmission of GSH to mitochondria in concentration gra-dient and/or by affecting the GSH transporter activity in the inner mitochondrial membrane. This supports the observed increased activity of glutathione reductase but not of per-oxidase (unpublished data). Plasma GSH levels remained in equilibrium. The concentration of flavonoids administered in the diet achieves peak in plasma levels approximately 2 hours after administration, and if high enough in the diet, their ac-cumulation in the plasma leads to a concomitant decrease in the oxidation state (3). The drop in GSH levels in both ex-perimental groups was not observed in kidney mitochondria. However, this may be associated with a lower concentration of active substances, their degradation and formation of inac-tive metabolites.

We observed an effect of administered substances on the redox homeostasis in mitochondria, which are the largest source of endogenous ROS production even under physiolog-ical conditions and directly in the organs that have important metabolic functions or are sensitive to oxidative stress. The administered substances did not interfere negatively with the redox state of cells, even, when administered only as herbal extracts, act positively on the level of GSH.

ACKNOWLEDGEMENT

The study was supported by VEGA 1/1236/12 and 1/0648/11.

REFERENCES

1. Fernández-Vizarra, E., Ferrin, G., Peréz-Martos, A., Fer-Ferrin, G., Peréz-Martos, A., Fer-nandéz-Silva, P., Zeviani, M., Enríquez, J. A., 2010: Isolation of mitochondria for biogenetical studies. An update. Mitochondrion, 10, 253—62.

2. Floreani, M., Petrone, M., Debetto, P., Palatini, P., 1997: A comparison between different methods for the determination of reduced and oxidized glutathione in mammalian tissues. Free Radic. Res., 26, 449—455.

3. Rein, D., Lotito, S., Holt, R. R., Keen, C. L., Smitz, H. H., Fraga, C. G., 2000: Epicatechin in human plasma: In vivo determi-nation and effect of chocolate consumption on plasma oxidation status. J. Nutr., 130, 2109S—2114S.

4. Vašková, J., Vaško, L., 2010: Control of secretion of apoli-poproteine B in hepatocytes by polyunsaturated fatty acids (In Slo-vak). Ateroskleróza, 3—4, 42—47.

Fig. 1. Changes in reduced glutathione levels in blood and organs of chickens

* — significant at P < 0.05

58


ABSTRACT

The aim of this study was to investigate changes in selected bio-chemical indices in hand-reared pheasants (Phasianus colchicus) in response to their transport from rearing facilities to pheasantry. Adult pheasants were sampled after 2-hour transport and their blood plasma was analyzed. Increased levels of plasma corticosterone (P = 0.001), alanine aminotransferase (P < 0.001), uric acid (P < 0.001) and lac-tate dehydrogenase (P < 0.001) were found in transported pheasants in comparison with non-transported control birds.

Key words: pheasant; stress; transport; welfare

INTRODUCTION

Transport of pheasants from rearing facilities to pheasantries is a common practice in many European countries (1, 2). The birds are transported by road over various distances and may be exposed to a variety of stressors during transit: catching, crating, sudden change in microclimate conditions, feed and water deprivation, vi-bration, noise, floor space restrictions and social stress due to high animal density. However, effects of transport stress on pheasants are still little known. Changes in some parameters of inner environ-ment in 9-week-old common pheasants transported for 4 hours at different densities were described by S u c h ý et al. (5) and V o s-l á ř o v á et al. (6).

The aim of our study was to assess the stress encountered by captive-reared adult pheasants during transport from rearing facility to pheasantry.

CHANGES IN SELECTED BIOCHEMICAL INDICES IN COMMON PHEASANTS IN RESPONSE TO THEIR TRANSPORT

Voslářová, E., Bedáňová, I., Chloupek, P., Pištěková, V., Chloupek, J., Večerek, V.

University of Veterinary and Pharmaceutical Sciences Brnoaculty of Veterinary Hygiene and Ecology, Palackého tř. 1/3, 612 42 Brno

The Czech Rrepublic

[email protected]


The effects of transport stress on selected biochemical parame-ters were monitored in approximately 1-year old (mean body weight of males 1.06 kg, of females 0.85 kg) common pheasants (Phasia-nus colchicus) transported from the rearing facility to pheasantry. In the rearing facility, the birds were housed in aviaries and fed com-mercial feed appropriate to their age (BŽ 1, BŽ 2 and BŽ).

Blood samples were taken from vena basilica of 20 randomly se-lected pheasants (10 males, 10 females) immediately after their cap-ture in the aviary (control group). Another 20 pheasants (10 males and 10 females) randomly selected from a group of transported pheasants were sampled after simulated transport of pheasants from rearing facility to pheasantry (experimental group). Experi-mental pheasants were placed in heavy duty plastic crates measur-ing 0.5 m × 0.7 m × 0.25 m (width × length × height) at density of approx. 380 cm2.kg-1. Transport crates were loaded in one layer on the floor of the covered vehicle’s cargo hold and exposed to effects of 2-hour driving. Blood samples were taken from both control and experimental group at approximately the same time of a day to avoid possible differences in monitored parameters due to circadian rhythm.

For biochemical examinations, the blood samples were stabi-lized by heparin (heparin concentration in blood samples < 1 %). Selected plasma biochemical parameters: glucose, lactate, LDH (lactate dehydrogenase), AST (aspartate aminotransferase), ALT (alanine aminotransferase) and triglycerides, were measured by a KONELAB 20i biochemical analyzer using commercial test kits (Biovendor — Laboratorni medicina a.s., CZ). The plasma corticos-terone level was measured using a commercial Corticosterone EIA Kit (Cayman Chemical, USA).

59

Results were analysed using statistical software Unistat 5.1 by means of an unpaired t-test and in the case of abnormal data (cor-ticosterone, ALT, uric acid, LDH, lactate) by means of a nonpara-metric Mann-Whitney test.


The results of our experiment (Table 1) prove that the stress associated with crating and transfer of pheasants from intensive rearing facilities to pheasantry induces strong changes in biochemical indices in pheasants. We observed no significant differences in the monitored biochemical pa-rameters between pheasant males and females.

The consequences of stress during transport of birds were described mainly in poultry but transportation of pheasants has not been monitored so closely yet. The most important of the monitored parameters is the corticosterone level which is considered to be the major indicator of stress in birds (3, 4). Plasma corticosterone levels were significantly (P = 0.001) higher in transported pheasants in comparison with the non-transported control birds. Besides increased plasma corti-costerone levels we observed also increased levels of ALT (P < 0.001), uric acid (P < 0.001) and LDH (P < 0.001) in 1-year old pheasants as a result of 2-hour transport. When comparing our results with those of S u c h ý et al. (5), who monitored changes in biochemical parameters due to 4-hour-transport in 9-week old pheasants, we can state that adult pheasants coped with their transport worse. When younger pheasants were transported at an appropriate density no stress response was found whereas adult pheasants showed strong stress response even during shorter transport. In con-clusion, it is clear that pheasants, as primarily wild animals with specific rearing requirements, also ha remains still in-complete and requires further research.

ACKNOWLEDGEMENS

This study was supported by the research projectn No. MSM6215 712402.

REFERENCES

1. Draycott, R. A. H., Pock, K. J., Carroll, P., 2002: Sustain-able management of a wild pheasant population in Austria. Z. Jagd-wiss., 48, 34—353.

2. Draycott, R. A. H., Woodburn, M. I. A., Carroll, J. P., Sage, R. B., 2005: Effects of spring supplementary feeding on population density and breeding success of released pheasants Phasianus colchi-cus in Britain. Wildlife Biol., 11, 17—182.

3. Mitchell, M. A., Kettlewell, P. J., 1998: Physiological stress and welfare of broiler chickens in transit: Solutions not problems ! Poult. Sci., 77, 180—1814.

4. Mormede, P., Andanson, S., Auperin, B., Beerda, B., Gue-mene, D., Malmkvist, J. et al., 2007: Exploration of the hypotha-lamic-pituitary-adrenal function as a tool to evaluate animal welfare. Physiol. Behav., 92, 31—339.

5. Suchý, P., Bedáňová, I., Večerek, V., Voslářová, E., Piště-ková, V., Chloupek, P., Vitula, F., 2007: Effects of transport stress and floor space reduction on selected biochemical indices in com-mon pheasant (Phasianus colchicus). Arch. Geflugelkd, 71, 56—61.

6. Voslářová, E., Bedáňová, I., Večerek, V., Pištěková, V., Chloupek, P., Suchý, P., 2006: Changes in haematological profile of common pheasant (Phasianus colchicus) induced by transit to pheasantry. Dtsch. Tierarztl. Woch., 113, 37—378.

Table 1. Selected plasma biochemical parameters in common pheasants after 2-hour transport and in non-transported control pheasants (Mean ± SEM)

Group(n = 20)

Parameter

CORT [ng.ml-1]

AST [mkat.l-1]

ALT [mkat.l-1]

GLU [mmol.l-1]

UA [mkat.l-1]

LDH [mkat.l-1]

LACT[mmol.l-1]

TRIG[mmol.l-1]

Control 10.8 ± 1.65 4.54 ± 0.17 0.13 ± 0.02 19.9 ± 0.13 184.6 ± 14.1 6.78 ± 0.35 6.80 ± 0.34 1.17 ± 0.13

Transport 24.4 ± 3.39 5.20 ± 0.29 0.31 ± 0.09 19.3 ± 0.34 414.8± 20.2 11.7 ± 1.19 5.52 ± 0.38 0.91 ± 0.08

Significance (P) 0.001 > 0.05 < 0.001 > 0.05 < 0.001 < 0.001 0.008 > 0.05

CORT — corticosterone; AST — aspartate aminotransferase; ALT — alanine aminotransferase; GLU — glucoseUA — uric acid; LDH — lactate dehydrogenase; LACT — lactate; TRIG — triglycerides

60


ABSTRACT

The aim of this study was to investigate the susceptibility of coag-ulase-negative staphylococci (CNS) isolated during spontaneous fer-mentation of wild boar sausages to antimicrobials penicillin, oxacil-lin, ampicillin, amoxicillin, enrofloxacine, tetracycline, lincomycin, erythromycin, gentamycin, vancomycin and streptomycin. Sausages were sampled on days 0, 14, 21, 35, 43 and 60 of maturation and monitored for total viable count, lactic acid bacteria, enterococci, enterobacteria, Escherichia coli, yeasts, moulds and staphylococci. Each sampling day 15—20 colonies (total of 120 strains) were ran-domly selected from manitol salt agar. Only 25 isolates were Gram positive, coagulase-negative cocci which were subjected to antimi-crobial susceptibility tests by means of disk diffusion and epsilom-eter (E) method using Mueller Hinton agar and CLSI interpretative breakpoints. All the strains were susceptible to penicillin, oxacillin, ampicillin, amoxicillin, enrofloxacine, gentamycin, vancomycin and streptomycin. In total 16 CNS strains (64 %) showed resistance to tetracycline, erythromycin or lincomycin. Results of this preliminary research indicate a significant prevalence of resistant CNS in sponta-neously fermented wild boar sausages.

Key words: antimicrobial resistance; coagulase-negative staphylo-cocci; wild boar sausages

ANTIMICROBIAL RESISTANCE OF COAGULASE-NEGATIVE STAPHYLOCOCCI ISOLATED FROM SPONTANEOUSLY FERMENTED

WILD BOAR SAUSAGES

Zdolec, N.1, Dobranić, V.1, Filipović, I.1, Marcincakova, D.2

1University of Zagreb, Faculty of Veterinary Medicine, Department of Food HygieneTechnology and Safety, Heinzelova 55, 10 000 Zagreb,

Croatia2University of Veterinary Medicine and Pharmacy

Department of Pharmacology and Toxicology, Komenskeho 73, 041 81 KošiceThe Slovak Republic

[email protected]

INTRODUCTION

The prudent use of antibiotics in veterinary medicine and agri-culture is an important factor of spreading antimicrobial resistance through food production chain. In addition to spread of resistant zoonotic foodborne pathogens, there is also possibility that food-related commensal bacteria or opportunistic pathogens are carri-ers of resistance genes and therefore a potential hazard to humans. Fermented food products could be an ideal vehicle for antimicrobial resistance transfer from animals, environment or humans through food chain, because these products are not thermally treated and are naturally rich in indigenous microbiota (15). Lactic acid bac-teria (LAB) and coagulase-negative staphylococci (CNS) are the main microbial groups in meat fermentation, giving the products favourable sensorial characteristics. However, during last decade the hazard potential of these bacteria was assessing in relation to antimicrobial resistance, production of enterotoxins or biogenic amines (11). In general, low occurrence of hazards determinants was found in food CNS and LAB, but the presence of resistance genes is still the reason for concern (16). There are many studies dealing with resistance of LAB or CNS in meat products from farm animals, but data on natural microbiota resistance in meat products from wildlife is limited.

Thus, the aim of this study was to provide preliminary informa-

61

tion on antimicrobial susceptibility/resistance of CNS from sponta-neously fermented wild boar sausages produced in Croatia.


Wild boar meat sausages were produced following the tradition-al procedure (13). Sausages were sampled on days 0, 14, 21, 35, 43 and 60 of maturation and monitored for total viable count (PCA, 30 °C, 72 hours), lactic acid bacteria (MRS, 30 °C, 48 hours, an-aerobically) enterococci (Enterococcus agar, 44 °C, 24 hours), en-terobacteria (VRBG agar, 37 °C, 24 hours), Escherichia coli (Coli ID, 37 °C, 24 hours), yeasts, moulds (Yeast extract glucose chlor-amphenicol agar, 25 °C, 5 days) and staphylococci (Manitol Salt Agar, 37 °C, 24—48 hours). Each sampling day 15—20 colonies (total of 120 strains) were randomly selected from manitol salt agar, gram stained, and tested for coagulase (Bactident Coagulase, Merck, Germany) and catalase (Bactident Katalase, Merck). Only Gram positive, coagulase-negative and catalase positive cocci were subjected to antimicrobial susceptibility tests by means of disk dif-fusion and epsilometer (E) test using Mueller Hinton agar. Disc diffusion test was performed for penicillin (6 μg), oxacillin (1 μg), ampicillin (10 μg), amoxicillin (25 μg), enrofloxacine (5 μg), tetra-cycline (30 μg), lincomycin (15 μg), erithromycin (15 μg), genta-mycin (10 μg), vancomycin (30 μg) and streptomycin (500 μg).

Resistant isolates were further tested with qualitative-quantitative E-test. Results were interpreted according to Clinical and Labora-tory Standard Institute (2010) document M100-S20.


Results of microbial analyses during the maturation of wild boar sausages are presented in Table 1. Total vi-able count and LAB increased during the maturation, while yeasts, moulds and staphylococci decreased, as previously re-ported in different kinds of Croatian traditionally fermented sausages (13, 14, 15). The most interesting finding was an unusual overgrowth of CNS by halophylic bacilli on MSA which were determined as Bacillus pumilus. This species is known as soil bacteria, and probably contaminated the wild boar meat during manipulation. The presence of Bacillus pumilus in fermented meat products is unusual, and accord-ing to our results, it disabled the isolation of CNS from MSA after 35th day of sausage maturation. Literature data report the strong antifungal and antibacterial properties of B. pumi-lus (1, 2, 9). We could assume that this antimicrobial capac-ity was expressed in sausages and influenced the population of fungi and/or staphylococci.

Thus, from among 120 MSA colonies selected, only 25

Table 1. Results of microbiological analyses and pH of wild boar sausages during the maturation (log10 CFU.g–1)

Parameter Day 0 Day 14 Day 21 Day 35 Day 43 Day 60

Total viable count 5.84 6.54 6.81 8.08 6.71 6.69

Lactic acid bacteria 5.58 7.77 6.39 7.69 6.30 6.60

Coagulase-negative staphylococci

6 5.6 3 3 < 2 < 2

Yeast and moulds 5.69 5.65 4.69 4.40 4.14 4.00

Enterobacteria/E. coli 2 1.84 < 1 n.t. n.t. n.t.

Enterococci < 1 < 1 n.t. n.t. n.t. n.t.

pH 5.7 5.06 5.04 5.17 5.17 4.97

n. t. — not tested

Table 2. Zone diameter/MIC of 16 resistant strains

Strain No.Zone diameter (mm)/MIC (μg.ml-1)

Tetracycline Erythromycin Lincomycin

1, 11, 12 10—12/24—32

2, 6, 7, 10, 12, 13, 16 0—12/16—96

3, 4, 5, 7, 8, 9, 14, 15, 16 0/n. t.

n. t. — not tested

62

(found on sampling days 0, 14, 21, and 35) were Gram posi-tive, coagulase-negative and catalase positive staphylococci which were further tested for antimicrobial susceptibility. All strains were susceptible to penicillin, oxacillin, ampicil-lin, amoxicillin, enrofloxacine, gentamycin, vancomycin and streptomycin, while resistance to tetracycline, erythromycin and lincomycin was detected in 3, 7 and 9 strains, respective-ly (Table 2). Three strains were resistant to two antibiotics (TET-ERY; ERY-LIN phenotype).

Tetracycline, erythromycin and lincomycin resistant CNS are frequently isolated from different fermented sausage (4, 6, 11, 12). Recently, M a r t y et al. (7, 8) showed that S. xy-losus strains from spontaneously fermented wildlife meat sausages possess lower antimicrobial resistance compared to commercial S. xylosus starter strains. Our results indicate that relatively high rate of CNS isolates possess phenotypic antimicrobial resistance (16 of 25 tested; 64 %), that was also reported in staphylococci from other wildlife meat and/or products (10). These preliminary results support the need for more extensive research to provide relevant data for risk as-sessment related to antimicrobial resistance in wildlife meat microbiota.

ACKNOWLEDGEMENT

The study was supported by the Ministry of Science, Education and Sport of the Republic of Croatia (grant 053-0531854-1851, 053-0531854-1853). The authors would like to acknowledge the technical assistance of Ana Konjević.

REFERENCES

1. Aunpad, R., Na-Bangchang, K., 2007: Pumilicin 4, a novel bacteriocin with anti-MRSA and anti-VRE activity produced by newly isolated bacteria Bacillus pumilus strain WAPB4. Curr. Micro-biol., 55, 308—313.

2. Bottone, E. J., Peluso, R. W., 2003: Production by Bacillus pumilus (MSH) of an antifungal compound that is active against Mucoraceae and Aspergillus species: preliminary report. J. Med. Mi-crobiol., 52, 69—74.

3. Clinical and Laboratory Standards Institute, 2010: Perfor-mance Standards for Antimicrobial Susceptibility Testing. Twentieth Informational Supplement. CLSI document M100-S20. Wayne, PA.

4. Even, S., Leroy, S., Charlier, C., Zakour, N. B., Chacornac, J. P., Lebert, I. et al., 2010: Low occurrence of safety hazards in co-agulase negative staphylococci isolated from fermented foodstuffs. Int. J. Food Microbiol., 139, 87—95.

5. Kozačinski, L., Zdolec, N., Hadžiosmanović, M., Cvrtila, Ž., Filipović, I., Majić, T., 2006: Microbial flora of the Croatian tra-ditionally fermented sausage. Arch. Lebensmittelhyg., 57, 141—147.

6. Martin, B., Garriga, M., Hugas, M., Bover-Cid, S., Veciana-Nogués, M. T., Aymerich, T., 2006: Molecular, technological and safety characterization of Gram-positive catalase-positive cocci from slightly fermented sausages. Int. J. Food Microbiol., 107, 148—158.

7. Marty, E., Buchs, J., Eugster-Meier, E., Lacroix, C., Mei-le, L., 2010: Biodiversity of indigenous Staphylococcus species in spontaneously fermented Swiss sausages and characterization of presumed starter strains. Poster session, presented at the 69th annual assembly of the SSM, ETH Zurich.

8. Marty, E., Buchs, J., Eugster-Meier, E., Lacroix, C., Meile, L., 2012: Identification of staphylococci and dominant lactic acid bac-teria in spontaneously fermented Swiss meat products using PCR-RFLP. Food Microbiol., 29, 157—166.

9. Munimbazi, C., Bullerman, L. B., 1998: Isolation and par-tial characterization of antifungal metabolites of Bacillus pumilus. J. Appl. Microbiol., 84, 959—968.

10. Pipová, M., Jevinová, P., Kmeť, V., Regecová, I., Marušková, K., 2012: Antimicrobial resistance and species identification of staphylococci isolated from the meat of wild rabbits (Oryctolagus cuniculus) in Slovakia. Eur. J. Wildl. Res., 58, 157—165.

11. Resch, M., Nagel, V., Hertel, C., 2008: Antibiotic resis-tance of coagulase-negative staphylococci associated with food and used in starter cultures. Int. J. Food Microbiol., 127, 99—104.

12. Simeoni, D., Rizzotti, L., Cocconcelli, P., Gazzola, S., Del-laglio, F., Torriani, S., 2008: Antibiotic resistance genes and iden-tification of staphylococci collected from the production chain of swine meat commodities. Food Microbiol., 25, 196—201.

13. Zdolec, N., Hadžiosmanović, M., Kozačinski, L., Cvrtila, Ž., Filipović, I., Leskovar, K., Vragović, N., Budimir, D., 2007: Home-made fermented sausages — microbiological quality. Meso, 9, 318—324.

14. Zdolec, N., Hadžiosmanović, M., Kozačinski, L., Cvrtila, Ž., Filipović, I., Škrivanko, M., Leskovar, K., 2008: Microbial and physicochemical succession in fermented sausages produced with bacteriocinogenic culture of Lactobacillus sakei and semi-purified bacteriocin mesenterocin Y. Meat Sci., 80, 480—487.

15. Zdolec, N., Filipović, I., Cvrtila Fleck, Ž., Marić, A., Janku-loski, D., Kozačinski, L., Njari, B., 2011: Antimicrobial susceptibil-ity of lactic acid bacteria isolated from fermented sausages and raw cheese. Vet. Arhiv, 81, 133—141.

16. Zdolec, N., 2012: Lactobacilli — functional starter cultures for meat applications. In Peres Campos, A. I., Mena, A. L.: Lacto-bacillus: Classification, Uses and Health Implications. Nova Publish-ers, New York.

FOLIA - UVLF€¦ · DEPARTMENT OF FOOD HYGIENE AND TECHNOLOGY STATE VETERINARY AND FOOD...

Documents

Transcript of FOLIA - UVLF€¦ · DEPARTMENT OF FOOD HYGIENE AND TECHNOLOGY STATE VETERINARY AND FOOD...