First Semester Exam Review Topics – Life Characteristics

Biology is all about being Alive!

Know what that means!

O – H – M – R – G&D – E&A

ALIVE!

NOT ALIVE!

First Semester Exam Review Topics – Pyramids

All about Energy!

Who has the energy?

Where from? How?

How much flows “upwards” between the levels?

Can you Name the Levels?

What is wrong with this Diagram?

First Semester Exam Review Topics – Food Webs

Know the energy levels, -vores, -trophs, niche, etc…

What would happen if the area was sprayed the area and the Herbivorous

Insects were wiped out?

What are these Illustrations Called?

What is the Spider? Fox?! Rabbit?

Why is the Toad the most fragile animal here?

Both Benefit!

One Benefits at the expense of

the other!

One Benefits without

affecting the other!

One Consumes the other!

First Semester Exam Review Topics - Symbiosis

First Semester Exam Review Topics – Limiting Factors

Limiting Factors and Seasons that support/control the Producers.What do the Producers require to Thrive?!

First Semester Exam Review Topics – Population Growth

Balance

Small populations are in danger because: (?)

First Semester Exam Review Topics – Human Population

Age Structure Graph

Shows the pattern of

growth of a population.

How many offspring =

How fast the Population will

grow!

Developing Country = Fast Growing Pop.

Slow Growing Developed Country.

Developed Country = Stable Zero

Growth.

Remember! Growth Rate (GR) = Birth Rate (BR) – Death Rate (DR)

First Semester Exam Review Topics – Carbon Cycle

Photosynthesis collects CO2 vs. Cellular Respiration releases CO2 in rough Balance to maintain atmospheric levels.

?!

First Semester Exam Review Topics – Global Warming

Linked to the release of CO2 into the atmosphere which absorbs radiation and traps heat.

Excess CO2 results from Combustion of fossil fuels.

Rapid and Recent Increase in the average temperature of the Earth following the beginning of the Industrial Revolution.

All related to the Greenhouse Effect.

First Semester Exam Review Topics – Nitrogen Cycle

Why is Nitrogen essential to all living things?

What form does that Nitrogen need to be in to become available to the Food Web?

What important plants are especially important in the Nitrogen Cycle and what do they have?

First Semester Exam Review Topics – Bioaccumulation

Pollution affects organisms when it become concentrated enough to damage them.

Producers collect a little of the toxic chemicals, but the higher organisms in the Food Web end up with toxic levels.

Who is affected?

Where is the Toxic Chemical Stored?

How did the environment become exposed?

Why did the Producers not die?

First Semester Exam Review Topics – Dead Zones

Ecosystems SHOULD be in rough Balance! If there is an over-abundance of Nutrient Run-off from farmlands, the algae “Bloom” and this leads to loss of Oxygen – Dead Zones!

Nutrients cause too much Algal Growth, leaving too much dead algae!

Decomposers then Overgrow and use the Oxygen!! Red Tide does Something

Else! Toxic!

First Semester Exam Review Topics – Organic Compounds

Living Things are mostly composed of Organic Compounds.

Organic mean Based on CARBON!!

Carbon is the BFF that holds all of the various atoms together.

Bonds in three dimensions and can form highly complex, large molecules.

Typically, other elements involved in Organic Molecules include H,N, and O = 96+% of all living matter!

First Semester Exam Review Topics – Organic Compounds

There are four (4) basic types of Organic Compounds.

CARBOHYDRATES are Sugars and are universal

energy sources! Photosynthesis!!

LIPIDS are Fats and are good for energy

storage!

Monosaccharides such as Glucose = Blood Sugar!

Benedict’s Test turns Orange

Polysaccharides that store glucose and thus energy.

Starch stores energy in Plants – Iodine test = Black.

Cellulose in Cell Walls of Plants.

Glycogen stores energy in Animals.

Triglyceride with three Fatty Acids.

P

Phospholipid found in

Membranes.

Lipids are Non-Polar and do not dissolve in Water = Insoluble.

Brown Paper Bag Test!!

First Semester Exam Review Topics – Enzyme

First Semester Exam Review Topics – Plasma Membrane

?

?

?

Phospholipid Bilayer Barrier.

Selective Permeability and Homeostasis!

Receptor for Information and Control of the Cell

First Semester Exam Review Topics - Prokaryotes

How do you

KNOW that it is a

“Pro” karyote?

First Semester Exam Review Topics - Eukaryotes

Must Know! Nucleus, Plasma Membrane, Mitochondrion, Food Vacuole, Ribosome and what they do!

Also Must Know! Cell Wall, Vacuole, Chloroplast and what THEY do!

First Semester Exam Review Topics – Cell Organization

CellCell

Cell Cell Cell Cell

CellCellCell

Organize into

TISSUES

Organize into

Blood

NervousConnective

MuscularEpithelial

ORGANS

Organize into

ORGAN ORGAN ORGANORGAN SYSTEM

ORGAN SYSTEMORGAN SYSTEM

ORGAN SYSTEM

Organize into

ORGANISM

First Semester Exam Review Topics - Osmosis

Low concentration

of solutes = lots of water!

0%

Higher concentration

of solutes = less water!

i.e., 10%

Movement of Water to maintain Equilibrium. Uncontrolled.

First Semester Exam Review Topics – Membrane Transport

Passive Transport

always flows High

↓Low

“with” the conc.

gradient.

Active Transport

always forces from Low

↓High

Need ATP to move

“against” the conc. gradient.

ATP!

First Semester Exam Review Topics - Photosynthesis

Plants Require CO2 and H2O!!! They then use those Reactants to produce Glucose!!

Stomata Control Everything since they determine TRANSPIRATION and delivery of the Reactants!!

First Semester Exam Review Topics – Cellular Respiration

If O2 present = Aerobic!

If O2 NOT present = Anaerobic!

36-38 ATP!

2 ATP

Fermentation in cytoplasm

Efficient /

Eukaryotes / Oxygen!

Inefficient / Yeast and

Bacteria / Sealed Up.

PPP

N

N

N

N

NH2

Adenine

First Semester Exam Review Topics – ATP

Adenosine Triphosphate. THE Basic Energy Carrying Molecule of Cells. Can pass energy on to other molecules to drive Metabolism via the third Phosphate Group. Cycles back and forth with ADP.

Universal Energy Source means that Enzymes and various Chemical Reactions can become specialized to use THIS molecule. Little Variation = Same Shapes!

ATP!

ADPRespiration Metabolism

First Semester Exam Review Topics – Fermentation

Fermentation is Anaerobic!! Useful Process for many different Foods. All are sealed during their Production!

Alcoholic Fermentation

produces CO2 =

Bubbly!!

Lactic Acid Fermentation leaves a sour taste as the

pH changes – Goes Down!!

Psst!! CO2!

Fluffy with CO2 holes!!

Remember! What happens to Muscle as a result of Lactic Acid Fermentation?

First Semester Exam Review Topics – DNA Structure

DeoxyriboNucleic Acid

THE Genetic Material carries

Information of the Organism.

Stable as a Double Helix protecting the information on the Inside.

Building Blocks are Nucleotides.

Bases represent the information and always form Complementary

Base Pairs.

A T

G C

Complementary Base Pairs!

This Illustration shows the copying of DNA. What is this process called and what is the final product? Why is it “Semi-Conservative”?

If DNA Strand G C T A T T C G C A C G T A A C G T AOther Strand isC G A T A A G C G T G C A T T G C A T

First Semester Exam Review Topics – RNA

How is RNA different from DNA:

Structurally?

Bases?

Function?

Location?

What is this Process called?

If DNA Strand G C T A T T C G C A C G T A A C G T A

RNA Strand is C G A U A A G C G U G C A U U G C A U

What is the Original Sequence Called?

First Semester Exam Review Topics – Protein Synthesis

DNA Transcription RNA Translation Protein

First Semester Exam Review Topics - Translation

CCTTACGGTCGCTTTTTACGGGTAATTGGAATGCCAGCGAAAAATGCCCATTAA

GGAAUGCCAGCGAAAAAUGCCCAUUAA

Met Pro Ala Lys Asn Ala His STOP

mRNA Genetic Code

NOW – Have an Amino Acid Chain. What has to happen to get a functional

Protein?

Usually caused during Meiosis! Random!

Usually caused during Replication (=Error) OR as a result of exposure to

damaging Mutagens (=radiation, chemicals, etc…). Random and

Constant.

CAG↓

Q = Glu

CAA↓

Q = GluSame = Silent

AAG↓

K = LysProblem!

TAG↓

STOPDisaster!

Delete AG↓

Only 2?!Disaster!

First Semester Exam Review Topics - Mutation

First Semester Exam Review Topics – Cell Cycle

The Production of new cells should be tightly controlled!

Daughter Cells are only made when there is space during

Growth and Healing.

Cells have to “shut-down” DNA as Chromosomes!

Most Cells Do Not Divide as they are specialized to function. G0 cells are “working” and typically cannot do

Mitosis.

DNA is Chromatin and in Use!

In Mitosis, all of the Daughter Cells are Genetically Identical (barring Mutation), but since they “Express” different genes in different ways, they can “Differentiate” into very different cellis: e.g., Muscle and

Nerve Cells that are very active (lots of Mitochondria!), or Connective Tissue Cells, etc…

First Semester Exam Review Topics – Cancer

The Cell Cycle is controlled by Genes just like everything else! If those genes are mutated, then the Cell Cycle will be affected.

Those Daughter Cells SHOULD stop growing when they contact each other (Contact Inhibition!) and then shift to

G0 and get to Work!.

IF the Cell Cycle is disrupted (e.g., by mutated Oncogenes), this process

cannot stop when it SHOULD!

Cancer is caused by Mutation. Major causes include UV Radiation (Ozone is Important!!), Smoking (Don’t do it!), Viruses (new vaccines

can prevent!), and Replication Errors (No Fix There).

Controlled growth.

UNControlled growth.

First Semester Exam Review Topics – Cell Division/Mitosis

First Semester Exam Review Topics – Cell Division/Mitosis

Asexual

Identical

Clone

Daughter Cells

Growth/Dev.

Do not need to know the four Phases, but need to be able to

recognize the parts and put the phases in order.