Finding substringsmy $sequence = "gatgcaggctcgctagcggct";#Does this string contain a startcodon?if ($sequence =~ m/atg/) {

print "Yes";} else {

print "No";}

Finding substringsmy $sequence = "gatgcaggctcgctagcggct";#Does this string contain a startcodon?if ($sequence =~ m/atg/) {print "Yes";

} else {print "No";

}=~ is a binding operator and means: perform the following action on

this variable.

The following action m/atg/ in this case is a substring search, with the "m" for "match"' and substring "atg".

Finding substringsmy $sequence = "gatgcaggctcgctagcggct";#Does this string contain a startcodon?if ($sequence =~ m/atg/) {print "Yes";

} else {print "No";

}If the substring occurs, the statement will return TRUE and the if-

block will be executed.

The value of $sequence does not change by the match.

Finding substrings, repeatedmy $sequence = "gatgcaggctcgctagcggct";

my $count = 0;while($sequence =~ m/ggc/g) {

$count++;}

print "$count matches for gcc\n";

m//g

'g' option allows repeated matching, because the position of the last

match is remembered

Finding substrings, repeatedmy $sequence = "gatgcaggctcgctagcggct";

my $count = 0;while($sequence =~ m/ggc/g) {

$count++;}

print "$count matches for gcc\n";

Finding substrings, repeatedmy $sequence = "gatgcaggctcgctagcggct";my $codon = "ggc";

my $count = 0;while($sequence =~ m/$codon/g) {

$count++;}

print "$count matches for $codon\n";

Position after last matchmy $sequence = "gatgcaggctcgctagcggct";my $codon = "ggc";

print "looking for $codon from 0\n";

while($sequence =~ m/$codon/g) {print "found, will continue from: ";print pos($sequence),"\n";

}

Position after last matchmy $sequence = "gatgcaggctcgctagcggct";my $codon = "ggc";

pos($sequence) = 10;print "looking for $codon from 10\n";

while($sequence =~ m/$codon/g) {print "found, will continue from: ";print pos($sequence),"\n";

}

Replacing substringsmy $sequence = "gatgcagaattcgctagcggct";print $sequence,"\n";#Replace the EcoRI site with '******'$sequence =~ s/gaattc/******/;# gatgca******gctagcggct#Replace all the other characters with space$sequence =~ s/[^*]/ /g;print $sequence,"\n";Output:gatgcagaattcgctagcggct ******

Examples of regular expressionss/World/Wur/ replaces World with Wur, making "Hello World" "Hello Wur"s/t/u/ replaces the first 't' with 'u', "atgtag" becomes "augtag"s/t/u/g replaces all 't's with 'u's, "atgtag" becomes "auguag"s/[gatc]/N/g replaces all g,a,t,c's with N, "atgtag" becomes "NNNNNN"s/[^gatc]//g replaces all characters that are not g,a,t or c with nothings/a{3}/NNN/g replaces all 'aaa' with 'NNN', "taaataa" becomes "tNNNtaa"m/sq/i match 'sq', 'Sq', 'sQ' and SQ: case insensitivem/^SQ/ match 'SQ' at the beginning of the stringm/^[^S]/ match strings that do not begin with 'S'm/att?g/ match 'attg' and 'atg'm/a.g/ match 'atg', 'acg', 'aag', 'agg', 'a g', 'aHg' etc.s/(\w+) (\w+)/$2 $1/ swap two words, "one two" => "two one"m/atg(…)*?(ta[ag]|tga)/ matches an ORF

The matched strings are storedmy $text = "This is a piece of text\n";print $text;

$word = 0;while($text =~ /(\w+)\W/g) { $word++; print "word $word: $1\n";}

The matched strings are stored

my $text = "one two";$text =~ /(\w+) (\w+)/g

print "word one:$1 ";print "word two:$2 ";print "complete string: $&";

The matched strings are storedmy $sequence = "gatgcaggctcgctagcggct";

while ($sequence =~ m/([acgt]{3})/g) {print "$1\n";

}

Special characters\t tab\n newline\r return (CR)\b "word" boundary\B not a "word" boundary\w matches any single character classified as a "word" character

(alphanumeric or _)\W matches any non-"word" character\s matches any whitespace character (space, tab, newline)\S matches any non-whitespace character\d matches any digit character, equiv. to [0-9]\D matches any non-digit character\xhh character with hex. code hh

Metacharacters^ beginning of string$ end of string. any character except newline* match 0 or more times+ match 1 or more times? match 0 or 1 times; or shortest match| alternative( ) grouping, or storing[ ] set of characters{ } repetition modifier\ quote or special

Repetitiona* zero or more a'sa+ one or more a'sa? zero or one a's (i.e., optional a)a{m} exactly m a'sa{m,} at least m a'sa{m,n} at least m but at most n a'sa{0,n} at most n a's

$mRNAsequence = "aaaauaaaaa";$mRNAsequence =~ m/a{2,}ua{3,}/;

GreedinessPattern matching in Perl by default is greedy, which means that it will try to match as much characters as possible. This can be prevented by appending the ? Operator to the expression

$sequence = "atgtagtagtagtagtag";#This will replace the entire string:s/atg(tag)*//#This will stop matching at the first tag:s/atg(tag)*?//

open SEQFILE, "example1.fasta";my $sequence = "";my $ID = <SEQFILE>;while (<SEQFILE>) {

chomp;$sequence .= $_;

}print $ID;print $sequence,"\n";

#SmaI striction (ccc^ggg)$sequence =~ s/cccggg/ccc^ggg/g;#PvuII striction (cag^ctg)$sequence =~ s/cagctg/cag^ctg/g;my @sequenceFragments = split '\^', $sequence;print "\n", "-"x90, "\n";print "Digested sequence:\n",$sequence,"\n\n";print "-"x90,"\n";

print "Fragments:\n";foreach $fragment(@sequenceFragments) {

print $fragment,"\n";print "-"x90,"\n";

}

>BTBSCRYR Bovine mRNA for lens beta-s-crystallin...tgcaccaaacatgtctaaagctggaaccaaaattactttctttgaagacaaaaactttcaaggccgccactatgacagcgattgcgactgtgcagatttccacatgtacctgagccgctgcaactccatcagagtggaaggaggcacctgggctgtgtatgaaaggcccaattttgctgggtacatgtacatcctaccccggggcgagtatcctgagtaccagcactggatgggcctcaacgaccgcctcagctcctgcagggctgttcacctgtctagtggaggccagtataagcttcagatctttgagaaaggggattttaatggtcagatgcatgagaccacggaagactgcccttccatcatggagcagttccacatgcgggaggtccactcctgtaaggtgctggagggcgcctggatcttctatgagctgcccaactaccgaggcaggcagtacctgctggacaagaaggagtaccggaagcccgtcgactggggtgcagcttccccagctgtccagtctttccgccgcattgtggagtgatgatacagatgcggccaaacgctggctggccttgtcatccaaataagcattataaataaaacaattggcatgc

------------------------------------------------------------------------------------------

Digested sequence:tgcaccaaacatgtctaaagctggaaccaaaattactttctttgaagacaaaaactttcaaggccgccactatgacagcgattgcgactgtgcagatttccacatgtacctgagccgctgcaactccatcagagtggaaggaggcacctgggctgtgtatgaaaggcccaattttgctgggtacatgtacatcctacccc^ggggcgagtatcctgagtaccagcactggatgggcctcaacgaccgcctcagctcctgcagggctgttcacctgtctagtggaggccagtataagcttcagatctttgagaaaggggattttaatggtcagatgcatgagaccacggaagactgcccttccatcatggagcagttccacatgcgggaggtccactcctgtaaggtgctggagggcgcctggatcttctatgagctgcccaactaccgaggcaggcagtacctgctggacaagaaggagtaccggaagcccgtcgactggggtgcagcttccccag^ctgtccagtctttccgccgcattgtggagtgatgatacagatgcggccaaacgctggctggccttgtcatccaaataagcattataaataaaacaattggcatgc

------------------------------------------------------------------------------------------

Fragments:tgcaccaaacatgtctaaagctggaaccaaaattactttctttgaagacaaaaactttcaaggccgccactatgacagcgattgcgactgtgcagatttccacatgtacctgagccgctgcaactccatcagagtggaaggaggcacctgggctgtgtatgaaaggcccaattttgctgggtacatgtacatcctacccc------------------------------------------------------------------------------------------ggggcgagtatcctgagtaccagcactggatgggcctcaacgaccgcctcagctcctgcagggctgttcacctgtctagtggaggccagtataagcttcagatctttgagaaaggggattttaatggtcagatgcatgagaccacggaagactgcccttccatcatggagcagttccacatgcgggaggtccactcctgtaaggtgctggagggcgcctggatcttctatgagctgcccaactaccgaggcaggcagtacctgctggacaagaaggagtaccggaagcccgtcgactggggtgcagcttccccag------------------------------------------------------------------------------------------ctgtccagtctttccgccgcattgtggagtgatgatacagatgcggccaaacgctggctggccttgtcatccaaataagcattataaataaaacaattggcatgc------------------------------------------------------------------------------------------

Exercises

6. Create a script to find the DNA fragments you get after cutting the sequence in the example1.fasta file with AluI and with AvaI

7. Find the open reading frames in the example1.fasta sequence

8. Translate the open reading frames to protein, using the standard genetic code from the Geneticcode database (http://srs.bioinformatics.nl)