FDA Center for Biologics Evaluation & Research€¦ · System, BACTEC®, BacT/Alert ... ¾Ability...

Center for Biologics Evaluation & ResearchCenter for Biologics Evaluation & ResearchFDAFDA

11

Assay ModernizationGood for Industry, Regulators and

Public Health

Assay ModernizationAssay ModernizationGood for Industry, Regulators and Good for Industry, Regulators and

Public Health Public Health

Rajesh K. Gupta, Ph.D.Deputy Director, Division of Product Quality &

Lab Chief, Product Quality Labs OCBQ, CBER, FDA

WCBP-2011, Renaissance Mayflower Hotel, Washington, DC10 January 2011

Rajesh K. Gupta, Ph.D.Rajesh K. Gupta, Ph.D.Deputy Director, Division of Product Quality &Deputy Director, Division of Product Quality &

Lab Chief, Product Quality Labs Lab Chief, Product Quality Labs OCBQ, CBER, FDAOCBQ, CBER, FDA

WCBPWCBP--2011, Renaissance Mayflower Hotel, Washington, DC2011, Renaissance Mayflower Hotel, Washington, DC10 January 201110 January 2011


22

Outline of PresentationOutline of PresentationOutline of PresentationAssay Modernization for Legacy Products

Benefits/NeedsChallengesCBER’s Perspectives

Applications at Division of Product QualityRapid Microbiological Methods (RMM)

Application for Rapid Sterility TestExamples from Work at CBER, Rapid Milliflex®

System, BACTEC®, BacT/Alert®Evaluation for Rapid Detection of Mycoplasma

MS in Calibration of Influenza Ref Reagents

Assay Modernization for Legacy ProductsAssay Modernization for Legacy ProductsBenefits/NeedsBenefits/NeedsChallengesChallengesCBERCBER’’s Perspectivess Perspectives

Applications at Division of Product QualityApplications at Division of Product QualityRapid Microbiological Methods Rapid Microbiological Methods (RMM)(RMM)

Application for Rapid Sterility TestApplication for Rapid Sterility TestExamples from Work at CBER, Rapid MilliflexExamples from Work at CBER, Rapid Milliflex®®

System, BACTECSystem, BACTEC®®, , BacTBacT/Alert/Alert®®

Evaluation for Rapid Detection of MycoplasmaEvaluation for Rapid Detection of MycoplasmaMS in Calibration of Influenza Ref ReagentsMS in Calibration of Influenza Ref Reagents


33

Developments in Analytical MethodsDevelopments in Analytical MethodsDevelopments in Analytical Methods

Technological Development in Analytical Sciences and Instruments

Powerful Tools to Characterize BiologicalsDevelopments in Proteomics and Genomics

Highly Sensitive, Precise and Accurate Methods to Characterize Biologicals and to Assess Purity of Biologicals

Concept of Well Characterized BiologicalsImplemented Modern Analytical MethodsNot Applicable to Complex Biological Products, Vaccines at DP

Technological Development in Analytical Sciences and Instruments

Powerful Tools to Characterize BiologicalsDevelopments in Proteomics and Genomics

Highly Sensitive, Precise and Accurate Methods to Characterize Biologicals and to Assess Purity of Biologicals

Concept of Well Characterized BiologicalsImplemented Modern Analytical MethodsNot Applicable to Complex Biological Products, Vaccines at DP


44

Methods Used for Legacy ProductsMethods Used for Legacy ProductsMethods Used for Legacy Products

At Time of Licensure, Legacy Products Had Suitable and Appropriate Methods

Often Animal-Based Methods (Large Variability)Manual, Need More Resources

Methods and Processes Working for Many YearsNo Need or Incentive to Implement Modern Assays

At Time of Licensure, Legacy Products Had Suitable and Appropriate Methods

Often Animal-Based Methods (Large Variability)Manual, Need More Resources

Methods and Processes Working for Many YearsNo Need or Incentive to Implement Modern Assays


55

Benefits of Using Modern Assays to Legacy Products

Benefits of Using Modern Assays to Benefits of Using Modern Assays to Legacy ProductsLegacy Products

To Gain Product and Process KnowledgeBetter Control of Consistency in ManufactureImplement Process Analytical Technologies (PAT)Faster Resolutions of Process Problems Fast Implementation of Corrective Actions

Better Methods in Terms of Precision & Accuracy Lower Re-Tests, Less Investigations

Possibilities of Automation – Better Throughput Strong Science and Compliance

To Gain Product and Process KnowledgeBetter Control of Consistency in ManufactureImplement Process Analytical Technologies (PAT)Faster Resolutions of Process Problems Fast Implementation of Corrective Actions

Better Methods in Terms of Precision & Accuracy Lower Re-Tests, Less Investigations

Possibilities of Automation – Better Throughput Strong Science and Compliance


66

Why Implement Modern Assays to Legacy Products?

Why Implement Modern Assays to Why Implement Modern Assays to Legacy Products?Legacy Products?

Do it before Someone Else Does it (Academia or Others), Example, Rotavirus Vaccine

Reactive Response, Caught Unaware, Product Delays, Embarrassment

Proactive ResponsePlanning & Discussions with Regulatory Authorities, Better & Informed Risk/Benefit Analysis

Faster Regulatory Decisions during Problems Outdated Instrumentations/Reagents

Not Available or No Vendor Support

Opportunities for Product and Process Improvements and Risk Mitigation StrategiesPotential New Products in Market

Do it before Someone Else Does it (Academia or Others), Example, Rotavirus Vaccine

Reactive Response, Caught Unaware, Product Delays, Embarrassment

Proactive ResponsePlanning & Discussions with Regulatory Authorities, Better & Informed Risk/Benefit Analysis

Faster Regulatory Decisions during Problems Outdated Instrumentations/Reagents

Not Available or No Vendor Support

Opportunities for Product and Process Improvements and Risk Mitigation StrategiesPotential New Products in Market


77

Challenges in Implementing Modern Assays to Legacy Products

Challenges in Implementing Modern Assays Challenges in Implementing Modern Assays to Legacy Productsto Legacy Products

Establishing Comparability and Correlation with Current Highly Variable Methods

Current Method as Surrogate to Clinical Experience Change in Specifications for New Method

Lack of Clear Regulatory GuidanceFear of Unknown, Fear of Theoretical Risks

Potential Misunderstanding of InformationPublic’s Misconception about the Product

Resources and Expertise Not Available at All ManufacturersLoss of Knowledge & Expertise During Acquisitions and Mergers

Emotional Attachments to Legacy MethodsShort Term Economic/Business Aspects

Establishing Comparability and Correlation with Current Highly Variable Methods

Current Method as Surrogate to Clinical Experience Change in Specifications for New Method

Lack of Clear Regulatory GuidanceFear of Unknown, Fear of Theoretical Risks

Potential Misunderstanding of InformationPublic’s Misconception about the Product

Resources and Expertise Not Available at All ManufacturersLoss of Knowledge & Expertise During Acquisitions and Mergers

Emotional Attachments to Legacy MethodsShort Term Economic/Business Aspects


88

CBER’s PerspectivesCBERCBER’’s Perspectivess Perspectives

CBER Supports Implementing New Technologies and Methods to Legacy ProductsEquivalent Methods 21 CFR 610.9

“Assurances Equal to or Greater Than”Discuss Plans, Strategies and Contingencies

Method Validation & Comparability StudiesTransition Plans during ImplementationRisk Mitigation Strategies

CBER Supports Implementing New Technologies and Methods to Legacy ProductsEquivalent Methods 21 CFR 610.9

“Assurances Equal to or Greater Than”Discuss Plans, Strategies and Contingencies

Method Validation & Comparability StudiesTransition Plans during ImplementationRisk Mitigation Strategies


99

Examples from DPQ on Implementing & Evaluating Modern Methods

Examples from DPQ on Implementing & Examples from DPQ on Implementing & Evaluating Modern MethodsEvaluating Modern Methods

Rapid Microbiological MethodsSterility TestingMycoplasma Testing

Calibration of Influenza Vaccine Potency Reagents

MALDI-TOF/TOFIsotope Dilution MS – Triple Quadrupole MS (Vaccine 26, 2008, 2510)

Rapid Microbiological MethodsSterility TestingMycoplasma Testing

Calibration of Influenza Vaccine Potency Reagents

MALDI-TOF/TOFIsotope Dilution MS – Triple Quadrupole MS (Vaccine 26, 2008, 2510)


1010

DisclaimerDisclaimerDisclaimer

These methods are being or have been evaluated at CBER. Use of alternate methods requires Demonstration of Equivalency to current method (21 CFR 610.9) and Requires a Supplement to the Biologics License Application (BLA). Evaluation of these methods by CBER does not in any way endorse a particular technology or instrumentation by FDA.Approaches used in Demonstration of Equivalency may not be the only Approaches. Alternate Approaches Demonstrating Equivalency or Superiority Scientifically and Statistically are also Acceptable.

These methods are being or have been evaluated at CBER. Use of alternate methods requires Demonstration of Equivalency to current method (21 CFR 610.9) and Requires a Supplement to the Biologics License Application (BLA). Evaluation of these methods by CBER does not in any way endorse a particular technology or instrumentation by FDA.Approaches used in Demonstration of Equivalency may not be the only Approaches. Alternate Approaches Demonstrating Equivalency or Superiority Scientifically and Statistically are also Acceptable.


1111

Why Alternate Sterility Tests?Why Alternate Sterility Tests?Why Alternate Sterility Tests?Manufacturing Aspects

Faster Screening of Raw Materials/In-Process Faster Resolution of Process Problems (PAT)

Fast Implementation of Corrective ActionsChanging Nature of Products (Biologicals)

Shorter Shelf LivesSmaller Quantities Available to Test

Emergency Use (Influenza Pandemic)

Manufacturing AspectsFaster Screening of Raw Materials/In-Process Faster Resolution of Process Problems (PAT)

Fast Implementation of Corrective ActionsChanging Nature of Products (Biologicals)

Shorter Shelf LivesSmaller Quantities Available to Test

Emergency Use (Influenza Pandemic)


1212

What Rapid Sterility Test May Need?What Rapid Sterility Test May Need?What Rapid Sterility Test May Need?

Equivalent Methods 21 CFR 610.9“Assurances Equal to or Greater Than”Equivalent or Higher Sensitivity, Accuracy, Precision (Method Validation)

Rapid (Reduced Time, ≤ 7 Days) Not More Complex, Easy to PerformAutomation

Equipment Qualification (IQ,OQ, PQ)Ability to Detect Stressed Organisms“Ideally” Detect a Single Viable Contaminant

Equivalent Methods 21 CFR 610.9“Assurances Equal to or Greater Than”Equivalent or Higher Sensitivity, Accuracy, Precision (Method Validation)

Rapid (Reduced Time, ≤ 7 Days) Not More Complex, Easy to PerformAutomation

Equipment Qualification (IQ,OQ, PQ)Ability to Detect Stressed Organisms“Ideally” Detect a Single Viable Contaminant


1313

BacT/ALERT 3D

Dilute Microorganisms in Fluid A. Spike Different Levels s in 10 ml Fluid A with & without 100 ppm Thimerosal.

Filter the inoculum through the Milliflex Funnel Unit & incubate with TSA/SDA/SBA media cassettes for up to 3-5 days

Place the membrane onto the detection tower and initiate detection and enumeration. Spray ATP releasing Reagent & Bioluminescence Reagent onto membrane by means of a Milliflex Rapid Autospray Station

Photons are detected by the system via a photon counting imaging tube coupled to a CCD camera. The photons generated by the ATP bioluminescence reaction are captured, and a picture displayed on the computer monitor.

Compendia Sterility Test

Rapid Milliflex BACTEC FX

Inoculate directly into the FTM/TSB media and incubate the bottle at appropriate temperatures. Monitor turbidity for 14 days.

Inoculate directly to the Standard aerobic and

anaerobic media.

Incubate the culture media bottle at 33oC temperature in BACTEC FX system. The culture vials sensor was monitored for increase in its fluorescence units, which is proportional to the amount of CO2 produced by the growth of microorganisms. BACTEC FX monitors and detects the fluorescent unit every 10 minutes.

Inoculate directly to the iASTand iNST media.

Incubate the culture media bottle at 33oC temperature in BacT/ALERT 3D system. Microorganisms multiply in the media, generating CO2. As CO2 increases the sensor in the bottle turns a lighter color. Measuring reflected light, BacT/ALERT monitors and detects color changes in the sensor every 10 minutes.

Filter the inoculum through Steritest™ Equinox Pump and incubate with FTM/TSB liquid culture media.

Incubate the canister at appropriate temperatures and monitor turbidity for 14 days

Direct inoculation method

Rapid Microbial Methods

Filtration method


1414

A

B

A1A1 C

DDB1B1B1

C1C1C1

D1D1D1

Rapid Milliflex Detection and Isolation of P.acnes in a Thimerosal Matrix (0.01%) using SBA & TSA Plates

Rapid Milliflex Detection and Isolation of Rapid Milliflex Detection and Isolation of P.acnesP.acnes in a in a Thimerosal Matrix (0.01%) using SBA & TSA PlatesThimerosal Matrix (0.01%) using SBA & TSA Plates

TSATSATSA TSATSATSA

SBASBASBA SBASBA


1515

Detection of Spiked Organisms (1 CFU) by Compendial Filtration Method vsRapid Milliflex Detection System

Detection of Spiked Organisms (1 CFU) by Compendial Filtration MDetection of Spiked Organisms (1 CFU) by Compendial Filtration Method ethod vsvsRapid Milliflex Detection SystemRapid Milliflex Detection System


1616

Summary – ATP Bioluminescence TechnologySummary Summary –– ATP Bioluminescence TechnologyATP Bioluminescence Technology

A Promising Alternative to Compendial Sterility Test for Filterable Biological ProductsIncorporates Same Membrane Filtration Method Used in 21 CFR 610.12 and USP <71> Methods Detected Spiked Organisms in Fluid A within 1-5 Days. In General, Solid Media, TSA, SDA and SBA showed Growth of Spiked Organisms Faster (Within 5 Days) Compared to Liquid Culture MediaSBA Supported Growth of Spiked Organisms in Presence of Thimerosal and also After Treating Organisms with ATP-Bioluminescence ReagentsCBER is Ready to Implement this Method for Lot Release

A Promising Alternative to Compendial Sterility Test for Filterable Biological ProductsIncorporates Same Membrane Filtration Method Used in 21 CFR 610.12 and USP <71> Methods Detected Spiked Organisms in Fluid A within 1-5 Days. In General, Solid Media, TSA, SDA and SBA showed Growth of Spiked Organisms Faster (Within 5 Days) Compared to Liquid Culture MediaSBA Supported Growth of Spiked Organisms in Presence of Thimerosal and also After Treating Organisms with ATP-Bioluminescence ReagentsCBER is Ready to Implement this Method for Lot Release


1717

Detection of Spiked Organisms (1 CFU) by Compendial Direct Inoculation vsBACTEC & BacT/Alert

Detection of Spiked Organisms (1 CFU) by Compendial Direct InocuDetection of Spiked Organisms (1 CFU) by Compendial Direct Inoculation lation vsvsBACTEC & BacT/AlertBACTEC & BacT/Alert


1818

Detection of Spiked Organisms (10 CFU) in Presence of Thimerosal

Detection of Spiked Organisms Detection of Spiked Organisms (10 CFU)(10 CFU) in in Presence of ThimerosalPresence of Thimerosal

0/3 0/70/7C.albicans

1/3 (7)0/70/7M.luteus

0/3 0/70/6A.niger

3/3 (3)1/8 (10)8/8 (1-2)C.sporogenes

2/2 (2-4)0/90/8P.aeroginosa

3/3 (5-7)0/87/7 (4-5)P.acnes

1/3 (3)0/50/3B.subtilis

0/3 0/85/5 (3)B.vulgatus

0/30/40/4S.halstedii

3/3 (3-7)0/20/2S.pyogenes

2/3 (2)0/41/2 (1)S.aureus

Direct inoculationBacT/ALERT 3DBACTEC FX

10 CFU/10ml Matrix

Organisms


1919

SummaryBACTEC & BacT/ALERT Systems

SummarySummaryBACTEC & BacT/ALERT SystemsBACTEC & BacT/ALERT Systems

Not as Sensitive as Membrane Filtration Method with Regard to Detection of Lower Spike (0.1 CFU) and Detection of Organisms in Presence of ThimerosalSimilar to Direct Inoculation Method with Regard to Time Taken to Detect Spiked Organisms No Growth in Presence of Matrix containing Thimerosal for Most Microorganisms. Developed For Clinical Application, Containing 40 to 50 ml Medium, Compared to 100 ml Medium in Direct Inoculation Method Modifications For Application to Sterility Testing Required

Not as Sensitive as Membrane Filtration Method with Regard to Detection of Lower Spike (0.1 CFU) and Detection of Organisms in Presence of ThimerosalSimilar to Direct Inoculation Method with Regard to Time Taken to Detect Spiked Organisms No Growth in Presence of Matrix containing Thimerosal for Most Microorganisms. Developed For Clinical Application, Containing 40 to 50 ml Medium, Compared to 100 ml Medium in Direct Inoculation Method Modifications For Application to Sterility Testing Required


2020

Rapid Methods for Detection of Mycoplasma

Rapid Methods for Detection of Rapid Methods for Detection of MycoplasmaMycoplasma

Hybrid MethodsStandard culture (CFR, EP) followed by PCR (BioReliance’s HyMy Method)

From 28 days to 14 daysOnly Broth Cultivable Mycoplasma

MDCK cells with PCRResults in 5 – 7 daysBroth Cultivable and Non-cultivable Mycoplasma

Membrane Filtration Type with PCR and TMA (Transcription-Mediated Amplification)

Hybrid MethodsStandard culture (CFR, EP) followed by PCR (BioReliance’s HyMy Method)

From 28 days to 14 daysOnly Broth Cultivable Mycoplasma

MDCK cells with PCRResults in 5 – 7 daysBroth Cultivable and Non-cultivable Mycoplasma

Membrane Filtration Type with PCR and TMA (Transcription-Mediated Amplification)


2121

Experimental design for Mycoplasma Detection MethodsPrepare Mycoplasma Stock in Broth Culture, Determine CFU/ml

Inoculation of diluted Inoculation of diluted Mycoplasma strains into Mycoplasma strains into

Culture mediumCulture medium

Sampling of cultures on days 0 / 3 / 7 / 14 for DNA isolationSampling of cultures on days 0 / 3 / 7 / 14 for DNA isolation

Inoculation of diluted Mycoplasma Inoculation of diluted Mycoplasma strains into MDCK cellsstrains into MDCK cells

Filtration of Diluted Filtration of Diluted Mycoplasma Strains through Mycoplasma Strains through MilliPROBEMilliPROBE™™ filter Devices.filter Devices.

Isolation of NA material from Isolation of NA material from culture dilutions from filter culture dilutions from filter

membranes (0.1membranes (0.1μμ))

Dilute Culture to Required Titers (10 / 1 / 0.1 CFU/ml)

10 1 0.1 NC

10

1

0.1

NC10 1 0.1 NC

34.2110.8711.1811.55

32.411.6012.3511.26

36.5711.8510.8611.48

35.2136.3935.6133.23

03714

1010.1NC

Mycoplasma Spike (CFU/ml)

CT Mycoplasma hominis 27545Days

Regular DNA MethodRegular DNA Method

10 1 0.1 PC NC

TMA MethodologyTMA Methodology


2222

Mycoplasma Reference Strains Selected for Evaluation of Rapid MethodsMycoplasma Reference Strains Selected for Evaluation of Rapid MeMycoplasma Reference Strains Selected for Evaluation of Rapid Methodsthods

25204AvianM. synoviae

29052SwineM. hyorhinis

27545HumanM. hominis

23064HumanM. salivarium

23714HumanM. orale

25523BovineM. bovis

17981SwineM. hyorhinis

23206SwineAcholeplasma laidlawii

19610AvianM. gallisepticum

15531HumanM. pneumoniae

27556Insect/plantSpiroplasma citri

19989HumanM. fermentans

23838BovineM. arginini

Source (ATCC)OriginSpecies


2323

16S rRNA Gene as Universal Mycoplasma Genetic Marker16S rRNA Gene as Universal Mycoplasma Genetic Marker16S rRNA Gene as Universal Mycoplasma Genetic Marker

CGGATAACGCTTGCAACCTATGGGCGAATGGGTGAGTAACACGM. synoviae

CGGATAACGCTTGCAACCTATGGGCGAATGGGTGAGTAACACGM. bovis

CGGATAACGCTTGCAACCTATGGGCGAACGGGTGAGTAACACGM. gallisepticum

CGGATAACGCTTGCGACCTATGGGCGAATGGGTGAGTAACACGM. hominis

CGGATAACGCTTGCAACCTATGGGCGAATGGGTGAGTAACACGM. fermentans

CGGATAACGCTTGCGACCTATGGGCGAATGGGTGAGTAACATGM. arginini

CGGATAACGCTTGCGACCTATGGGCGAATGGGTGAGTAACACGM. salivarium

CGGATAACGCTTGCCCCCTATGGGCGAACGGGTGAGTAACACGA. laidlawii

CGGATAACGCTTGCGACCTATGAGCGAATGGGTGAGTAACACGM. hyorhinis

CGGATAACGCTTGCGACCTATGGGCGAATGGGTGAGTAACACGM. orale

Primer BCGGATAACGCTTGCGACCTATG

Primer AGGCGAATGGGTGAGTAACACG

Species

SYBR Green TechnologySYBR Green TechnologySYBR Green Technology

Mycoplasma PCR AssayMycoplasma PCR AssayMycoplasma PCR Assay

Universal Mycoplasma primers described by Wong-Lee and LovettUniversal Mycoplasma primers described by WongUniversal Mycoplasma primers described by Wong--Lee and LovettLee and Lovett

PCR primers (Amplicon Size Range 430-464 bp)PCR primers (Amplicon Size Range 430PCR primers (Amplicon Size Range 430--464 464 bpbp))


2424

Summary – Rapid Mycoplasma MethodsSummary Summary –– Rapid Mycoplasma MethodsRapid Mycoplasma Methods

Combining PCR with Culture Method Reduces Test Time from 28 to 14 DaysMDCK Cells with QPCR for Detection of Live Mycoplasma an Alternate (in 5 – 7 Days)

Further Studies on Validation Ongoing

Filtration Method with TMA and PCR Technologies Seems Promising (< 2 Days)

Only Detects DNA & RNA in Mycoplasma CellsSpeciation with PCR Methods Using MicroSyq ID

Combining PCR with Culture Method Reduces Test Time from 28 to 14 DaysMDCK Cells with QPCR for Detection of Live Mycoplasma an Alternate (in 5 – 7 Days)

Further Studies on Validation Ongoing

Filtration Method with TMA and PCR Technologies Seems Promising (< 2 Days)

Only Detects DNA & RNA in Mycoplasma CellsSpeciation with PCR Methods Using MicroSyq ID


2525

Use of MS in Generation & Calibration of Influenza Vaccine Reagents

Use of MS in Generation & Calibration Use of MS in Generation & Calibration of Influenza Vaccine Reagentsof Influenza Vaccine Reagents

Generation of Antibodies in Sheep to Purified Bromelain Cleaved HA

Establish ID & Purity of HA by MALDI-TOF/TOFCalibration of Primary Liquid Standard of Inactivated Purified Whole Virus

Determine HA Content Involving MALDI-TOF/TOFIsotope Dilution MS – Triple Quadrupole MS (CDC)

Generation of Antibodies in Sheep to Purified Bromelain Cleaved HA

Establish ID & Purity of HA by MALDI-TOF/TOFCalibration of Primary Liquid Standard of Inactivated Purified Whole Virus

Determine HA Content Involving MALDI-TOF/TOFIsotope Dilution MS – Triple Quadrupole MS (CDC)


2626

Influenza Antigen Protein Identification by MALDI TOF/TOFInfluenza Antigen Protein Identification by MALDI TOF/TOFInfluenza Antigen Protein Identification by MALDI TOF/TOF

ABI 4800 MALDI TOF/TOF

Reduction Alkylation Trypsin Digestion

Peptides Tryptic Peptides Spotted on to MALDI Plate with Matrix (Alpha cyno-4-hydroxy-cinnamic acid)

Individual Protein Bands Excised and Washed.

Database search

MS/MS spectrum


2727

Summary – MS in Preparation & Calibration of Influenza Vaccine Potency Reagents

Summary Summary –– MS in Preparation & Calibration MS in Preparation & Calibration of Influenza Vaccine Potency Reagentsof Influenza Vaccine Potency Reagents

Use of MALDI TOF/TOF Establish Identity & Purity of Immunogen for SheepEstablish Identity of SDS-PAGE Bands for Quantitation of HA in Primary Liquid Standard

Triple Quadrupole Tandem Mass Spectrometer for Quantitation of HA in Primary Liquid Standard (Under Evaluation)

Use of MALDI TOF/TOF Establish Identity & Purity of Immunogen for SheepEstablish Identity of SDS-PAGE Bands for Quantitation of HA in Primary Liquid Standard

Triple Triple QuadrupoleQuadrupole Tandem Mass Spectrometer for Tandem Mass Spectrometer for Quantitation of HA in Primary Liquid Standard Quantitation of HA in Primary Liquid Standard (Under Evaluation)(Under Evaluation)


2828

AcknowledgementsAcknowledgementsAcknowledgementsSeema ParveenSimleen KaurSelwyn David WilsonHyesuk KongStephanie LandsmanJames L. KenneyWilliam McCormickVladimir ChizhikovDmitriy VolokhovJerry WeirMaryna EichelbergerMichail AltermanMelkamu Getie-Kebtie

Seema ParveenSimleen KaurSelwyn David WilsonHyesuk KongStephanie LandsmanJames L. KenneyWilliam McCormickVladimir ChizhikovDmitriy VolokhovJerry WeirMaryna EichelbergerMichail AltermanMelkamu Getie-Kebtie

FDA Center for Biologics Evaluation & Research€¦ · System, BACTEC®, BacT/Alert ... ¾Ability...

Documents

Transcript of FDA Center for Biologics Evaluation & Research€¦ · System, BACTEC®, BacT/Alert ... ¾Ability...