Extrahepatic Cancer Suppresses Nuclear Receptor Regulated … · Cancer Therapy: Preclinical...

Cancer Therapy: Preclinical

Extrahepatic Cancer Suppresses Nuclear Receptor–RegulatedDrug Metabolism

Marina Kacevska1,2, Michael R. Downes3, Rohini Sharma1,2, Ronald M. Evans3,Stephen J. Clarke2, Christopher Liddle1, and Graham R. Robertson2

AbstractPurpose: To determine the mechanisms by which tumors situated in extrahepatic sites can cause

profound changes in hepatic drug clearance, contributing to altered drug response and chemotherapy

resistance.

Experimental Design:We studied in wild-type or transgenic CYP3A4 reporter mice implanted with the

murine Engelbreth–Holm–Swarm sarcoma changes in nuclear receptor and hepatic transcription factor

expression and/or function, particularly related to CYP3A gene regulation.

Results: Repression of hepatic CYP3A induction was dramatic and associated with reduced levels of C/

EBPb isoforms, impaired pregnane X receptor, and constitutive androstane receptor function. Unexpect-

edly, extrahepatic tumors strongly reduced nuclear accumulation of retinoid X receptor alpha (RXRa) inhepatocytes, providing a potential explanation for impaired function of nuclear receptors that rely on RXRadimerization. Profiling revealed 38 nuclear receptors were expressed in liver with 14 showing between 1.5-

and four-fold reduction in expression in livers of tumor-bearing animals, including Car, Trb, Lxrb, Ppara,Erra/b, Reverba/b, and Shp. Altered Ppara and g induction of target genes provided additional evidence of

perturbed hepatic metabolic control elicited by extrahepatic tumors.

Conclusions: Extrahepatic malignancy can affect hepatic drug metabolism by nuclear receptor relo-

calization and decreased receptor expression and function. These findings could aid the design of

intervention strategies to normalize drug clearance and metabolic pathways in cancer patients at risk

of chemotherapy-induced toxicity or cancer cachexia. Clin Cancer Res; 17(10); 1–11. �2011 AACR.

Introduction

A major challenge to the effective use of cancer che-motherapy is wide interpatient variability in clearance, andconsequently, induced side effects of cytotoxic drugs. Thereis accumulating evidence that the presence of malignancy isaccompanied by widespread changes in hepatic geneexpression. This is clinically relevant as the liver is respon-sible for an extensive range of metabolic processes. Clinicalstudies have also shown that cancer patients with elevatedinflammatory markers/symptoms induced by their malig-nancy have reduced hepatic drug clearance, leading toworse toxicity from anticancer drugs (1–3). In advancedcancer patients, reduced cytochrome P450 3A4 (CYP3A4)-mediated drug metabolism, as indicated by the erythro-

mycin breath test, resulted in reduced plasma clearance ofthe anticancer drug docetaxel and increased toxicity follow-ing weekly injections. In these clinical studies, reducedCYP3A4 activity correlated with inflammatory markerssuch as CRP and IL-6 (1, 4). The finding of significantlyworse myelosuppression in lymphoma patients withinflammatory (B) symptoms compared with those withoutindicated the clinical relevance of this result (3). CYP3A4 isthe major enzyme involved in the metabolic clearance ofmany commonly used anticancer drugs (5). Furthermore,CYP3A4 is also central to the metabolism of an extensiverange of endogenous compounds, making a significantcontribution to the termination of the action of steroidhormones (6) and bile acid detoxification (7). We havepreviously shown transcriptional repression of CYP3A-mediated drug metabolism in mouse models of extrahe-patic cancer, including sarcoma, melanoma, and breasttumors (8, 9). Repression of the mouse CYP3A4 homo-logue, Cyp3a11 in livers of these tumor-bearing mice wasassociated with elevated circulating IL-6 concentrations aswell as increased expression of the murine acute phaseprotein SAP, indicating a tumor-associated inflammatoryresponse.

Such tumor-induced perturbations in hepatic metabo-lism could also contribute to the development of cancer-related cachexia. The cancer cachexia syndrome (CCS) is

Authors' Affiliations: 1Storr Liver Unit, Westmead Millennium Institute,University of Sydney, Westmead; 2Cancer Pharmacology Unit, ANZACResearch Institute and Concord Hospital, University of Sydney, Concord,New South Wales, Australia; and 3Gene Expression Laboratory, The SalkInstitute, La Jolla, California

Corresponding Author: Christopher Liddle, Storr Liver Unit, WestmeadMillennium Institute, University of Sydney, Westmead, NSW 2145,Australia. Phone: 61-2-9845-6086; Fax: 61-2-9845-8351; E-mail:[email protected]

doi: 10.1158/1078-0432.CCR-10-3289

�2011 American Association for Cancer Research.

ClinicalCancer

Research

www.aacrjournals.org OF1

Research. on April 7, 2020. © 2011 American Association for Cancerclincancerres.aacrjournals.org Downloaded from

Published OnlineFirst April 15, 2011; DOI: 10.1158/1078-0432.CCR-10-3289

http://clincancerres.aacrjournals.org/

generally defined as a hypermetabolic wasting disease,which results in progressive depletion of lipid depotsand skeletal muscle, irrespective of nutritional intake(10). Cachexia occurs in approximately 50% of cancerpatients. However, the incidence of cachexia varies depend-ing on the tumor type, ranging from 70% to 80% inpatients with carcinomas of the pancreas and stomach to8% in patients with cancer of the esophagus (11). Cancercachexia contributes to morbidity and mortality in thesepatients, directly accounting for 20%–30% of all cancerdeaths (12). As a consequence, cachexia is considered a lateevent that once established has no effective treatment (13).The mechanisms of CCS are likely to be complex involvingcross-talk between cytokine and endocrine signaling path-ways with homeostatic regulation of metabolism andenergy balance (10, 14).

Nuclear hormone receptors are a superfamily of tran-scription factors with 48 distinct members identifiedwithin the human genome (15). In addition to the classicsteroidal hormone receptors, other nuclear receptors act asmetabolic sensors that respond to compounds of dietaryorigin, intermediates in metabolic pathways, drugs, andother environmental factors, integrating homeostatic con-trol over many metabolic processes (16–18). For example,aspects of drug metabolism and transport are regulated bypregnane X receptor (PXR) and constitutive androstanereceptor (CAR); energy and glucose metabolism throughperoxisome proliferator-activated receptor gamma(PPARg); fatty acid, triglyceride, and lipoprotein metabo-lism via PPAR alpha (a), delta (d), and g ; reverse choles-terol transport and cholesterol absorption through liver Xreceptor (LXR); and bile acid metabolism through farne-soid X receptor (FXR; refs. 17–19). Given that nuclearreceptors are central to the regulation of these variousmetabolic pathways, an understanding of their overallfunction in tumor-induced metabolic disturbances needsto be developed. Such investigations may aid in under-standing the mechanisms underlying metabolic changes,which impact on drug clearance pathways in cancerpatients and the dysregulated energy balance that producescancer cachexia.

In the present study, we employed the Engelbreth–Holm–Swarm (EHS) sarcoma mouse model, a non-metastatic tumor implanted in the quadriceps muscle toinvestigate the expression and function of hepatic

transcription factors and nuclear receptors, particularlyin the regulation of drug metabolism involving CYP3A-mediated pathways. The EHS tumor model has been pre-viously shown to be associated with a tumor-mediatedinflammatory response, as indicated by increased plasmalevels of acute phase proteins and high circulating cytokineconcentrations (5, 8, 9). Herein, we show an in vivo tumor-mediated inflammatory model exhibiting impaired actionof PXR and CAR in the control of CYP3A expression andmore importantly, altered subcellular distribution of theirobligatory heterodimerization partner retinoid X receptoralpha (RXRa). Furthermore, we show an extensive effect ofextrahepatic tumor on the expression of a number ofhepatic nuclear receptors. Thus, the broad perturbationsof metabolism observed in cancer patients may beexplained by functional impairment of a wide range ofhepatic signaling processes mediated by several nuclearreceptors and associated with tumor-derived inflammatorystimuli.

Materials and Methods

Tumor miceAll animal experimentation was conducted in accor-

dance with the guidelines of the Australian Council onAnimal Care under protocols approved by the WestmeadHospital Animal Ethics Committee. Eight to 10-week-oldmale FVB mice were aseptically inoculated with 0.3 mLsuspension of EHS sarcoma into the right quadricepsmuscle using a 16-gauge needle. Control animals wereinoculated with the vehicle, Dubelcco’s modified Eagle’smedium (DMEM; GIBCO, Invitrogen) containing penicil-lin/streptomycin (GIBCO, Invitrogen). At sacrifice, thetumor mass reached approximately 3 g or 10% of totalbody weight after 2–3 weeks. The liver was immediatelyharvested, snap frozen in liquid nitrogen, and then storedat �80�C for downstream analysis.

Messenger RNA expressionTotal RNA was isolated from frozen mouse liver wedges

using Trizol reagent (Invitrogen). Before cDNA synthesis,RNA was treated with DNAse I (Ambion) according to themanufacturer’s protocol. cDNA was synthesized from 5 mgof total RNA with SuperScript III cDNA First-Strand Synth-esis System, using random hexamer primers and deoxynu-cleotides. Taqman or SYBR green protocols were used toamplify cDNAs of interest by real-time quantitative PCR(QPCR) using the Rotor-Gene 3000 and 6000 (CorbettResearch). mRNA levels were normalized to glyceralde-hyde-3-phosphate dehydrogenase (GAPDH) and 18Sribosomal mRNA expression. Normalization to bothhousekeeping genes gave comparable results and all genesanalyzed are shown with GAPDH normalization. Graphsof mRNA levels are shown as expression relative to astandard curve representing 5-fold dilutions of stock cDNAand are not true concentrations of mRNA abundance.Primers used in these studies were C/ebpb forward AAGCT-GAGCGACGAGTACAAGA, reverse GTCAGCTCCAGCAC-

Translational Relevance

The findings provide insight into the mechanismsunderlying reduced drug clearance in the setting ofcancer and underscore the challenges in therapeuticdrug dosing. This could aid the design of interventionstrategies to normalize drug clearance and metabolicpathways in cancer patients at risk of chemotherapy-induced toxicity or cancer cachexia.

Kacevska et al.

Clin Cancer Res; 17(10) May 15, 2011 Clinical Cancer ResearchOF2




CTTGTG; Hnf4a forward CCGGGCTGGCATGAAG,reverse GACCTCCGCGTGCTGATC; Cyp3a11 forwardTGCTCCTAGCAATCAGCTTGG, reverse GTGCCTAAA-AATGGCAGAGGTT, probe FAM-CCTCTACCGATATGG-GACTCGTAAACATGAACTT-TAMRA; Gapdh forward GTC-GTGGATCTGACGTGCC, reverse TGCCTGCTTCACCA-CCTTCT, probe VIC-CCTGGAGAAACCTGCCAAGTATG-ATGACATTAMRA.

Nuclear receptor expression profilingTotal RNA extracted from livers of control and EHS

tumor-bearing mice, as described above, were profiledfor nuclear receptor expression at the Gene ExpressionLaboratory, Salk Institute, using a real-time PCR–basedhigh-throughput processing technique. Briefly, cDNAwas synthesized from 2 mg of DNase-treated total RNAusing Superscript II reverse transcriptase (Invitrogen). Pri-mers and probes were designed using ABI PrimerExpresssoftware for use in the NIH-funded Nuclear ReceptorSignaling Atlas Project (NURSA) and were subjected toextensive validation. Sequences of primers and probesare available on the (www.NURSA.org) website. High-throughput processing was achieved using a semiauto-mated Beckman liquid handler, followed by an ABI Prism7900HT sequence detection system. Relative mRNA levelswere calculated using the comparative delta-Ctmethod andnormalized against both GAPDH and U36b4 mRNA levelsin the same total RNA samples. Both housekeepers gavecomparable results and only GAPDH normalized data areshown.

Western blot analysisExtraction and preparation of proteins from liver tissue

were carried out as previously described (20). In brief,50 mg of liver tissue was homogenized in ERK Buffer(50 mmol/L HEPES, 150 mmol/L NaCl, 1.5 mmol/LMgCl2, 1 mmol/L EGTA, 10% glycerol, and 0.1% Tri-tonX-100) containing a mix of protease inhibitors (PMSF,DTT, leupeptin, aprotonin, sodium fluoride, and sodiumorthovanadate). Protein concentrations for equal loadingwere determined using the Bio-Rad DC assay kit (Hercules)with bovine serum albumin (BSA) as a standard (Sigma–Aldrich). Extracted protein (20–50 mg) was loaded andresolved on 10% sodium dodecyl sulphate polyacrylamidegel electrophoresis under reducing conditions and thentransferred to polyvinylidine difluoride membranes. Mem-branes were blocked with either skim milk or BSA prior toovernight incubation with primary antibodies at 4�C withgentle agitation. Secondary antibodies were incubated for 1hour at room temperature with gentle agitation. To controlfor variability in protein loading, membranes were eithercut at an appropriate kDa range such that the protein ofinterest and the normalizing protein, b-Actin (clone AC15,Sigma–Aldrich) at 42 kDa could be visualized simulta-neously, stripped, and reprobed for b-Actin or normalizedagainst Coomassie stained protein bands. Proteins detectedby specific antibodies were visualized using a SuperSignalWest Pico chemiluminescence kit (Pierce Endogen) and

exposed to autoradiograph film. Protein expression wasquantified using densitometric analysis.

Nuclear and cytoplasmic extract preparationsPreparation of nuclear and cytoplasmic protein extracts

was made using the ProteoExtract Subcellular ProteomeExtraction Kit (Calbiochem, MERCK; catalogue no.539790) as per the manufacturer’s instructions. Fifty milli-grams of frozen liver tissue was homogenized by 2–4 passesusing a plastic pestle fit for a 1.5 mL microcentrifuge tube.All buffers were provided in the kit and all procedures wereconducted on ice.

Immunofluorescent detection of RXRaParaffin-fixed liver wedges from control and tumor-bear-

ing mice were cut on a microtome (Leica RM2121RT),3 mm thick and mounted onto Superfrost Plus slides(Menzel-Glaser). Following paraffin removal, tissues werepermeabilized with PBS/(0.1%) Triton X-100 for15 minutes, washed, and incubated with the following;Image-iT FX signal enhancer (Invitrogen; catalogue no.I36933) for 30 minutes, Background Buster (Innovex Bios-ciences; catalogue no. NB306) for 10 minutes, and Strep-tavidin and Biotin for 15minutes each (Vector LaboratoriesInc.; catalogue no. SP-2002). Tissue was then blocked for 1hour in 2% goat serum with 0.1% cold fish skin gelatine(Sigma—Aldrich; catalogue no. G7765)/phosphate-buf-fered saline Tween-20 (PBST) before an overnight incuba-tion with a 1:100 dilution of anti-rabbit RXRa antibody(Santa Cruz Biotechnology; catalogue no. sc-553) in ahumidified chamber at 4�C. Following PBST washes, slideswere incubated for 30 minutes with anti-rabbit secondaryantibody (ABCAM, Sapphire Biosciences; catalogue no.Ab6012) at 1:800 dilution and then for another 30minuteswith Streptavidin/AlexaFluor 555 (Invitrogen, MolecularProbes; catalogue no. S32355) at 1:1,000 dilution, lightprotected. Nuclei staining was conducted using DAPI (Invi-trogen; catalogue no. D21490). Slides were coverslippedusing Prolong Gold antifade reagent (Invitrogen, Molecu-lar Probes; catalogue no. P36934) and visualized with aLeica BMBL uprightmicroscope and Spot Advanced version4.1 software (Diagnostic Instruments, Sterling Heights).Negative controls followed all outlined procedures exceptRXRa antibody treatment.

Functional assessment of CAR and PXRTen to 12-week-old male FVB mice hemizygous for the

�13kb CYP3A4/lacZ transgene (21), with or without EHStumor, were administered single daily i.p. injections ofpregnenolone-16a-carbonitrile (PCN; 40 mg/kg/d) or1,4-Bis[2-(3,5-dichloropyridyloxy)]benzene (TCPOBOP;1 mg/kg/d) over 3 days. Control mice received the ligandvehicle corn oil. Ligand injections were conducted after 2–3weeks of tumor growth and 3 days before the due harvestdate. PCN was purchased from MP Biomedicals, Inc.,TCPOBOP from Maybridge Chemical Company. CAR-and PXR-induced CYP3A4 transgene expression in liverwedges were macroscopically detected and quantified

Impact of Cancer on Hepatic Metabolism

www.aacrjournals.org Clin Cancer Res; 17(10) May 15, 2011 OF3




using X-gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyra-noside) staining, (Astral Pty. Ltd.) and ONPG (O-nitro-phenyl-b-D-galactopyranoside) assays, (Sigma–Aldrich),respectively. These procedures have been previouslydescribed (21).

Functional assessment of PPARa and PPARgTumor-bearing and nontumor male FVB mice were

injected with PPARa and PPARg receptor specific agonistsWy-14643 (Saphire Biosciences, Cayman Chemicals; cata-logue no. 190-70820) at 100 mg/kg/d and troglitazone(Cayman Chemical; catalogue no. 71750) at 150 mg/kg/dfor 3 days before harvest. Ligand doses were chosen on thebasis of existing literature (22–24). Control animals wereadministered 100 mL of the vehicle consisting of 1.5%carboxymethylcellulose (CMC) and 0.2% Tween 20 insterile water. Hepatic PPARa and PPARg activities in pre-sence of tumor were assessed by analyzing the mRNAlevel of target gene induction following ligand activationusing real-time QPCR. Target genes assessed for PPARaincluded Cyp4a14 forward GACGCTCCATACCCA, reverseGCCAGAAACGTGGGT, Hmg-CoA reductase forwardCTTGTGGAATGCCTT, reverse AGCCGAAGCAGCACAT-GAT and Cpt1a, forward CTTCAATACTTCCCGCATCC,reverse CTGCTGTCCTTGACGTGTTG and for PPARg in-cluded, Lpl forward GCTGGTGGGAAATGATGTG, reverseTGGACGTTGTCTAGGGGGTA and Cd36 forward TTGTA-CCTATACTGTGGCTAAATGAGA, reverse CTTGTGTTTTG-AACATTTCTGCTT.

Data analysis and statisticsQuantitative data were expressed as mean � SEM. Sta-

tistical analyses between control and tumor groups were

conducted using the unpaired Student’s t-test. Significancewas established at P � 0.05.

Results

The EHS tumor mouse modelThe EHS tumor is a transplantable mouse xenograft

tumor that spontaneously arose in a ST/Eh strain mouse(25). The expression profile of EHS using cDNA micro-arrays has identified the tumor as derived from the parietalendoderm (26) and the tumor itself has been used widelyas a cell culture substrate that mimics an extracellularmatrix. Once implanted, the EHS tumors were grown for2–3 weeks such that excessive tumor burden injurious togeneral animal health was avoided. These tumor-bearingmice have been previously reported to exhibit reduced drugmetabolism with decreased CYP3A-mediated enzymeactivity. Furthermore, decreased CYP3A enzyme activitywas shown to correlate with reduced hepatic Cyp3a proteinand mRNA expression, encompassing both the humanizedCYP3A4 reporter transgene and its endogenous mousehomologue, Cyp3a11 (8, 9). Thus, Cyp3a mRNA levelsare a suitable surrogate of CYP3A-mediated metabolism.In the present study, the EHS mice exhibited similardecreased Cyp3a expression.

Impact of cancer on constitutive regulators of CYP3ADecreased mRNA expression of CYP3A suggested the

EHS tumor affects transcription factors responsible for theirregulation in the liver. The impact of malignancy on majorconstitutive CYP3A regulators showed no statistically sig-nificant changes in mRNA for HNF4a, CCAAT enhancer–binding protein (C/EBP)b (Fig. 1A); or C/EBPa, HNF3g ,

012345

Control Tumor

Control Tumor

C/ENPβ LAP

C/EBPβ LIP

β-Actin

β-Actin

HNF4α

Control Tumor

Rel

ativ

e C

/EB

Pβ

mR

NA

exp

ress

ion

Tot

al li

ver

prot

ein

(ban

d de

nsiti

es)

Tot

al li

ver

HN

F4α

prot

ein

(ban

d de

nsiti

es)

Rel

ativ

e H

NF

4αm

RN

A e

xpre

ssio

n

A Bi.i.

ii. ii.

00.5

11.5

22.5

Control Tumor 0

0.2

0.4

0.6

0.8

Control Tumor

00.10.20.30.40.5

C/EBP (LAP)

C/EBP(LIP)

ControlTumor

* *

Figure 1. Expression of constitutive transcriptional regulators of CYP3A genes in livers of EHS tumor-bearing mice. A, relative mRNA levels of C/EBPb (i)and HNF4a (ii) showing no significant difference in their expression between tumor bearing and control animals (n ¼ 8). B, Western blot analysis oftotal hepatic C/EBPb (i) and HNF4a (ii) protein. Western blots are normalized against b-actin and protein changes are quantified by densitometric assessmentof protein bands. *P < 0.05.

Kacevska et al.





and albumin D-site binding protein (DBP; data notshown) in tumor-bearing mice as compared with con-trols. Western blot analysis showed changes in total C/EBPb protein, whereas HNF4a protein levels were notaltered between the control and tumor groups (Fig. 1B).C/EBPb has a number of isoforms including C/EBPb liveractivating protein (LAP) and C/EBPb liver inhibitoryprotein (LIP). These isoforms have different roles inthe regulation of CYP3A genes (27) and changes inthe LIP/LAP ratio have been shown to be responsiblefor the IL-6-mediated repression of CYP3A4 in hepaticand nonhepatic cultured cells (28). In our in vivo tumormodel, there was no difference in the LIP/LAP ratio toexplain a similar mechanism of basal CYP3A repression.As determined by densitometric analysis of westernblots, both isoforms were decreased equally in the pre-sence of tumor [Fig. 1B (i)]. Nonetheless, significantrepression of both C/EBPb isoforms in tumor-bearingmouse livers may potentially impact on CYP3A basallevels.

Tumor-bearing mice exhibit impaired PXR and CARfunctionThe predominant inductive transcriptional regulators of

CYP3A genes are the nuclear receptors PXR and CAR. Onceactivated by their ligands, these receptors heterodimerizewith RXRa and bind to cis-acting elements in CYP3A genesto enhance transcription. Using real-time PCR analysis,tumor-bearing animals showed a significant decrease in

CAR expression and a trend toward PXR and RXRa repres-sion that did not attain statistical significance (data notshown, see Fig. 5 for a summary of profiledNR expression).To investigate the impact of tumor growth on hepatic PXRand CAR, their functional activity in the presence of theEHS sarcoma was examined. Activation of PXR and CARwas achieved by administration of PCN and TCPOBOP,respectively, and these agonists were used to determine theintegrity of PXR- and CAR-mediated CYP3A induction. Inaddition, mice incorporating a �13 kb CYP3A4/lacZ reg-ulatory transgene were employed providing a direct read-out of the function of the humanCYP3A4 gene promoter invivo.

Confirming our previous findings, X-Gal staining ofliver wedges without ligand treatment showed reducedbasal transcription of the CYP3A4 transgene in tumor-bearing mice (Fig. 2A and 3A; ref. 8). Following PXRand CAR activation by PCN and TCPOBOP, respectively,control mice exhibited substantial CYP3A4 induction asdetermined by both the X-Gal staining and the ONPGassays, whereas induction by both PCN and TCPOBOPwas significantly abrogated in the tumor-bearing cohort(Fig. 2A, 2B and Fig. 3A, 3B). Similarly, endogenousmouse hepatic Cyp3a11 and Cyp2b10 mRNA levelswere induced by TCPOBOP in the controls with asignificantly lower induction in tumor-bearing mice(Fig. 3C and 3D). Following PCN treatment, the appar-ent induction of the endogenous mouse Cyp3a11 geneexhibited a trend toward a decreased degree of induction

Figure 2. PXR activity in presenceof extrahepatic EHS tumor. Malemice harboring the �13 kbCYP3A4/lacZ transgene weretreated with corn oil vehicle orPCN as described in theexperimental procedures. A,hepatocytes exhibiting transgeneexpression are visualized as theblue stained areas on the cut liversurface after X-gal histochemicalstaining. B, transgene expressionas determined by b-galactosidaseactivity in total liver lysates usingthe ONPG assay. The units ofb-galactosidase activity are givenas absorbance at 420 nm/mg ofprotein per minute. C, basal andPCN-induced mouse endogenousCyp3a11 mRNA expression inlivers of control and tumor-bearinganimals. Graphs express themean� SEM for n ¼ 8/9 animals pergroup. (***,P � 0.001; *, P < 0.05)

B

A

C

Control Tumor bearing Tumor bearingControl

+ PCN

+ PCN

– PCN

– PCN + PCN– PCN0

0.2

0.4

0

0.6

0.875

60

45

30

15

ControlTumor

ControlTumor

β-ga

lact

osid

ase

activ

ityat

1 h

our

(Abs

420n

m/m

g pr

otei

n/m

in)

Rel

ativ

e C

yp3a

11 m

RN

Aex

pres

sion






in the tumor mice. However, no statistical significancewas reached when compared with the inductionpotential of activated PXR in the control animals(Fig. 2C).

Cytoplasmic accrual of RXRa protein in tumor miceFollowing an acute inflammatory response, hepatic

RXRa protein has been reported to undergo cytoplasmicrelocalization, leading to decreased nuclear RXRa levels(29, 30). To investigate whether the presence of extra-hepatic tumor has similar effects, RXRa localization wasexamined by Western blot and immunofluorescence inliver sections. Total cellular content of RXRa protein wasfound to be equivalent between the groups (Fig. 4A).However, nuclear abundance of RXRa in the livers oftumor-bearing mice was substantially decreased,whereas in the cytoplasmic fraction was increased rela-tive to controls (Fig. 4B). To confirm the apparentcytoplasmic retention of RXRa in tumor-bearing mice,immunofluorescence staining was carried out on liversections (Fig. 4C). In control animals, RXRa was clearlylocalized predominantly in the nucleus within hepato-cytes. In tumor-bearing mice, most RXRa was retained inthe cytoplasm.

Impact of tumor on hepatic nuclear receptorsuperfamily

Nuclear receptors are pivotal regulators of many meta-bolic processes, including energy homeostasis and drugmetabolism (17–19). Livers from control mice and micebearing the EHS tumor were profiled at the mRNA level forall 49 murine nuclear receptor superfamily members usinghigh-throughput real-time QPCR. Sixteen out of the 40nuclear receptors expressed in the liver showed significantdifferential expression in tumor-bearing animals (Fig. 5A).Interestingly, with the exception of HNF4g and VDR, allchanges in nuclear receptor levels in the presence of extra-hepatic tumor revealed decreased expression. Of thesechanges, when broadly categorized on the basis ofreceptor’s physiological ligands and potential functions,5 nuclear receptors belonged to the endocrine receptorfamily, 4 belonged to the adopted orphan receptor family,and 7 to the true orphan nuclear receptors (Fig. 5B).

Nuclear receptors, PPARa and PPARg , which are predo-minantly involved in lipid and carbohydrate homeostasiswere further examined at the functional level. Administra-tion of PPARa and PPARg receptor specific ligands, Wy-14643 and troglitazone, respectively, showed evidence ofrepressed receptor function in presence of extrahepatic

A

B C D

Control Tumor bearing Tumor bearingControl

+ TCPOBOP–TCPOBOP

0

0.5

1

1.5

2

2.5

*

*0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

*

***

0

1

2

3

4

5

6

**

0.0034

0.0014

–TCPOBOP +TCPOBOP –TCPOBOP +TCPOBOP –TCPOBOP +TCPOBOP

ControlTumor

ControlTumor

ControlTumor

β-ga

lact

osid

ase

activ

ity a

t10

min

(A

bs42

0nm

/mg

prot

ein/

min

)

Rel

ativ

e C

yp3a

11 m

RN

Aex

pres

sion

Rel

ativ

e C

yp2b

10 m

RN

A

expr

essi

on

Figure 3. CAR activity in presence of extrahepatic EHS tumor. Male mice harboring the �13 kb CYP3A4/lacZ transgene were treated with corn oil vehicle orTCPOBOP as described in the experimental procedures. A, hepatocytes exhibiting transgene expression are visualized as the blue stained areas on the cutliver surface after incubation with X-gal. Staining intensity reflects the degree of CYP3A4 transgene expression. B, CYP3A4/lacZ transgene expression asdetermined by b-galactosidase activity in total liver lysates using the ONPG assay. The units of b-galactosidase activity are given as the absorbance at420 nm/mg of protein per minute. C, basal and TCPOBOP-induced mouse endogenous Cyp3a11 mRNA expression in livers of control and tumor animals. D,basal and TCPOBOP-induced mouse endogenous Cyp2b10 mRNA expression in livers of control and tumor animals. Graphs express the mean � SEM forn ¼ 8/9 animals per group. (***, P � 0.001; *, P < 0.05)

Kacevska et al.





tumor (Fig. 6). Well-characterized PPARa and PPARg targetgenes examined all showed significant induction by ligandtreatment in control nontumor bearing mice. The responsewas reduced for the PPARa target genes, Hmg-CoA andCpt1a in tumor mice, whereas Cyp4a14 was robustlyinduced (Fig. 6A). The induction of PPARg target genesalso showed a mixed response in tumor mice, with Cd36exhibiting impaired induction, whereas no change ininduction of Lpl was observed (Fig. 6B). Evidence ofchanges in PPARa and PPARg target gene expression in

tumormice provide supportive evidence of disturbed hepa-tic function, particularly related to lipid and glucose meta-bolism.

Discussion

These studies show that profound changes in hepaticdrug clearance in tumor-bearing mice can be due to broadsuppression of the transcriptional regulators of genesencoding drug clearance proteins such as PXR and CAR.

Figure 4. Altered nuclear andcytoplasmic distribution of liverRXRa protein in presence ofextrahepatic tumor. A, Westernblot analysis of total hepatic RXRaprotein in control (n ¼ 7) andtumor-bearing (n ¼ 8) groups. Arepresentative Western blot ofRXRa normalized against b-Actinis shown together with thedensitometric measure of proteinband quantification. B, Westernblot analysis of nuclear andcytoplasmic liver protein extractsfor RXRa localization in livers ofcontrol versus EHS tumor animals.Representative blots with 50 mg ofnuclear or cytoplasmic proteins ineach lane are shown withcorresponding Coomassie stainsof each membrane to confirmequal protein loading. C,immunofluorescent imaging ofRXRa (i–iii), DAPI nuclear staining(iv–vi), and an overlay image ofboth RXRa fluorescence and DAPI(vii–ix) in hepatocytes of controlmice (top panel) and tumor mice(second panel). Bottom panelshows a negative control lackingRXRa antibody. Images arecaptured at �40 objective.

Control

RXRα

A

B

C

RXRα

Anti-RXRα

Con

trol

Tum

orA

b N

egat

ive

DAPI Merge

×40

β-Actin

Commassie

Tumor

Control Tumor

Nuclear

Control

Control

21.5

0.50

1

Tota

l liv

er R

XA

αpr

otei

n (b

and

dens

ities

)

Tumor

Tumor

Cytoplasmic






This is linked to a reduction in their expression, impairedfunction, and perhaps more importantly to a concomitantcytoplasmic accumulation of RXRa. Because RXRa inter-acts with 13 other nuclear receptors, the resulting cumu-lative changes may underlie more general hepaticperturbations in metabolic pathways and energy balancethat are associated with the CCS.

It has been recognized that inflammatory mediatorsassociated with a broad range of disease states can represshepatic transcription factors such as C/EBPa and HNF4a(31) as well as the major regulators of drug metabolism,

PXR, CAR, and their dimerization partner RXRa (31–33).Such repression can lead to profound changes in theexpression of important drug metabolizing enzymes, suchas CYP3As, also known to be altered under diverse patho-logical conditions (34, 35). However, studies that examinethe mechanistic link between disease and decreased expres-sion of drug metabolizing enzymes have commonlyemployed LPS, turpentine, or direct administration ofcytokines to elicit or mimic acute inflammatory states.Little information is available regarding alterations in tran-scription factors, nuclear receptors, and important drugmetabolizing enzymes in complex disease settings invol-ving a chronic inflammatory response, such as is oftenobserved in cancer patients. Thus, these studies provide thefirst mechanistic information concerning CYP3A repres-sion using an in vivo cancer model. We show only signifi-cantly decreased CAR mRNA levels in tumor-bearing miceas opposed to the broad transcriptional repression of manytranscription factors under acute inflammatory conditions.However, the function of both CAR and PXR was impaired,as determined by CYP3A4 regulatory transgene inductionin the presence of the EHS tumor. In tumor-bearing mice,both PXR and CAR ligands failed to induce CYP3A4 trans-gene expression to the same extent as in control animals.Functional CAR impairment was further confirmed by thereduced degree of induction of mouse Cyp3a11 andCyp2b10 expression in response to TCPOBOP. The obser-vation that the decrease in PXR-mediated Cyp3a11 induc-tion in tumor mice was not as great as that seen with theCYP3A4 transgene could be due to species-specific differ-ences in PXR DNA-binding elements between mouseCyp3a11 and human CYP3A4. To date, no transcriptionalenhancer equivalent to the human CYP3A4 xenobiotic-responsive element (XREM; ref. 36) has been identifiedin the mouse Cyp3a gene cluster. Nonetheless, evidence ofimpaired CAR and PXR function may provide a partialexplanation for repression of CYP3A-mediated metabo-lism. Furthermore, their functional impairment could alsopotentially impact on a number of important drug meta-bolizing and disposition enzymes as well as contributing toperturbed energy balance (37).

A

BEndocrineReceptors

AdoptedReceptors

OrphanReceptors

MR LXRβ ERRαTRβ PPARα ERRβ

RARα RXRβ REVERBαAR CAR REVERBβ

VDR SHPHNF4γ

No change

1.2–2.5 fold decrease

>2.5 fold decrease

1.5–3 fold increase

SHP,

ERRγTRβ1,

Fold change in tumor mice

VDR, HNF4γ

LXRβ, RARα,RXRβ, MR, AR, PPARα, CAR, ERRα/β,Reverbα/β

LXRα,PPARγ/δ,

RARβ/γ, FXR,PXR, GR,

TRα, LRH-1,TR2/4, RORα/γ,Coup-TF I/II/III,

NOR1, TRβ2,HNF4α, PGC1αGCNF, RXRα/γ

Figure 5. Differential expression of nuclear receptors in livers of micebearing extra-hepatic EHS tumor. A, pie chart showing the expression foldchange of all detected nuclear receptors expressed in livers of tumor-bearing mice as compared with control mice. Varying fold changes aredenoted as different colored segments with green representingdownregulation and red representing upregulation. B, a tabular listing ofaltered nuclear receptor expression under the broadly classifiedphysiological/functional subgroups. Five endocrine, 4 adopted orphan,and 7 true orphan receptors exhibit altered mRNA expression. Foldchanges with P � 0.05 were considered significant (n ¼ 5 per group).

0

1

2

3

4

–Trog +Trog0

0.1

0.2

0.3

0.4

0.5

–Wy +Wy0

0.5

1

1.5

2

–Trog +Trog

PPARγ

0

0.1

0.2

0.3

0.4

0.5

–Wy +Wy

Cyp4a14 Hmg-CoA Cpt1α Lpl Cd36

PPARα

Rel

ativ

e m

RN

A e

xpre

ssio

n

0.0001

0.001

0.01

0.1

1

10

–Wy +Wy

ControlTumor

ControlTumor

*

*

BA

Figure 6. Activity of hepatic PPARa and PPARg in presence of extrahepatic EHS tumors. Basal and induced target gene expression for PPARa (A) and PPARg(B). Induced gene expression in nontumor controls and tumor-bearing mice as achieved by treatment with Wy-14643 (þWy) for PPARa activation andtroglitazone (þTrog) for PPARg activation (n ¼ 6–9 per group). *, P < 0.05 denotes a significant change in gene expression in control versus tumor groupsfollowing ligand activation.

Kacevska et al.





Decreased nuclear and increased cytoplasmic RXRa seenwith Western blot analysis and immunofluorescence sug-gest that in the presence of cancer the activity of RXRa isdecreased. RXRa is the obligate heterodimerization partnerof class II nuclear receptors, such as PXR, CAR, VDR, PPARs,FXR, RAR, TR, and LXR (18). Therefore, cytoplasmic reten-tion of RXRamay contribute to the functional impairmentof PXR and CAR seen in tumor-bearing animals. Further-more, as the obligate heterodimerization partner of class IINRs, decreased nuclear availability of RXRa widens thescope of tumor-mediated perturbations in the liver, beyonddrug metabolism. Reduced nuclear availability of RXRa,which has been previously showed only in acute inflam-mation (29, 38) suggests that similar pathways could alsobe operative in the presence of cancer exhibiting a chronicinflammatory phenotype. Thus, tumor-mediated inflam-matory signaling in the liver is likely to influence nuclearreceptor function, resulting in dysregulated metabolic pro-cesses. The role of specific cytokines in this process could beexplored with blocking antibodies or other interventions todisrupt downstream signaling pathways. Such an approachwould distinguish between direct effects of cytokines fromcompensatory changes in overall metabolic balance asso-ciated with tumor growth.The potential for the hepatic expression of nuclear

receptors to be altered by extrahepatic cancer has not beenpreviously considered. In the present study, all 49 mousenuclear receptors were profiled in an attempt to gain abetter understanding of affected metabolic pathways.Tumor effects were observed among 16 endocrine, adoptedorphan, and orphan receptors, with themajority of affectednuclear receptors showing decreased expression. Changesin endocrine nuclear receptors can have complex andprofound effects on physiology and energy metabolism.Altered MR, TRb, RARa, AR, and VDR seen in tumor-bearing animals implies alterations in electrolyte and fluidbalance, metabolic rate and oxidative metabolism, cellphysiology, reproductive function, and general homeosta-sis (39–42). Repression of orphan nuclear receptors such asReverb a and b, which have a diverse function in regulatingcell physiology and circadian rhythm (43) indicates broadtumor-related disturbances in hepatic physiology.Decreased expression of PPARa, LXRb, and CAR intumor-bearing mice translates into disturbed regulationof fatty acid oxidation, cholesterol homeostasis and, asdiscussed above, xenobiotic metabolism. Impaired CARaction may also contribute to perturbed energy balanceas it has been shown to play a role in adaptation tometabolic stress (37). Functional assessment of hepaticPPARa and PPARg showed some impairment of theiraction for selected but not all target genes and providedfurther evidence of tumor effects on nuclear receptor activ-ity. It would be interesting to carry out expression profilingbymicroarray analysis of livers from tumor-bearingmice tocharacterize the impact of altered nuclear receptors onhepatic metabolism in cancer.Ligands that modulate nuclear receptor activity have

significant potential in therapeutic applications. From

our studies, we can speculate that enhancing the activationof the nuclear receptors PXR or CAR prior to chemotherapymay ameliorate toxicity in those patients showing poordrug metabolism. It is even more appealing to speculatethat targeted therapies focused on RXR function may pro-vide novel means of restoring not only pathways in drugmetabolism but also other vital hepatic functions regulatedby its essential binding. RXR is activated by its endogenousligand 9-cis retinoic acid (44) and several RXR-selectiveagonists known as "rexinoids" have been developed (45,46). It has yet to be determined if rexinoid treatment willresult in increased nuclear availability in tumor mousehepatocytes to allow heterodimerization with other classII nuclear receptors.

In summary, our findings suggest that extrahepatictumors can decrease transcriptional expression of hepaticCYP3A genes in part by reductions in C/EBPb protein andimpaired function of PXR and CAR. Furthermore, ourresults suggest that decreased nuclear availability of RXRamay explain impaired activity of both CAR and PXR andlead to functional impairment of other nuclear receptor-regulated pathways that rely on RXRa heterodimerization.Thus, altered hepatic nuclear receptor function may be onemechanism underlying tumor-mediated cancer cachexia,which involves a complex array of perturbed metabolicfunctions. With a better understanding of the mechanisticlinks between extrahepatic tumors and impaired nuclearreceptor action in the liver, therapies based on inhibiting orstimulating specific nuclear receptors represents a promis-ing intervention approach to potentially reduce aberranttoxic side effects associated with anticancer treatments andpossibly aid in the prevention of metabolic abnormalitiesthat lead to cancer cachexia. Although this study hasfocused on such processes in the context of cancer, thefindings of altered basal transcription factors and impairedhepatic nuclear receptor action may be relevant to manyother clinical settings involving chronic inflammation andcachexia.

Disclosure of Potential Conflicts of Interest

The authors have no conflicts of interest to declare.

Grant Support

This work was supported, in whole or in part, by National Health andMedicalResearchCouncilofAustralia ProjectGrants 352419(G.R.Robertson,S.J. Clarke, and C. Liddle) and 402493 (C. Liddle andM.Downes). This workwas also supported by an Environmental Protection Agency SuperfundProgram Grant P42 ES10337 (to R.M. Evans) in addition to funds fromthe Samuel Waxman Cancer Research Foundation, the Salk Center for Nutri-tional Genomics, the LeonaM. & Harry B. Helmsley Charitable Trust, and theHoward Hughes Medical Research Institute. M. Kacevska is the recipient offinancial support from the Haematology and Oncology Trust Fund ConcordRG Hospital and a Concord Hospital Volunteers PhD Scholarship.

The costs of publication of this article were defrayed in part by thepayment of page charges. This article must therefore be hereby markedadvertisement in accordance with 18 U.S.C. Section 1734 solely to indicatethis fact.

Received December 22, 2010; revised March 9, 2011; accepted March 15,2011; published OnlineFirst April 15, 2011.






References1. Rivory LP, Slaviero KA, Clarke SJ. Hepatic cytochrome P450 3A drug

metabolism is reduced in cancer patients who have an acute-phaseresponse. Br J Cancer 2002;87:277–80.

2. Slaviero KA, Clarke SJ, McLachlan AJ, Blair EY, Rivory LP. Populationpharmacokinetics of weekly docetaxel in patients with advancedcancer. Br J Clin Pharmacol 2004;57:44–53.

3. Sharma R, Cunningham D, Smith P, Robertson G, Dent O, Clarke SJ.Inflammatory (B) symptoms are independent predictors of myelosup-pression from chemotherapy in Non-Hodgkin Lymphoma (NHL)patients—analysis of data from a British National Lymphoma Inves-tigation phase III trial comparing CHOP to PMitCEBO. BMC Cancer2009;9:153.

4. Slaviero KA, Clarke SJ, Rivory LP. Inflammatory response: anunrecognised source of variability in the pharmacokinetics andpharmacodynamics of cancer chemotherapy. Lancet Oncol2003;4:224–32.

5. Kacevska M, Robertson GR, Clarke SJ, Liddle C. Inflammation andCYP3A4-mediated drug metabolism in advanced cancer: impact andimplications for chemotherapeutic drug dosing. Expert Opin DrugMetab Toxicol 2008;4:137–49.

6. Brian WR, Sari MA, Iwasaki M, Shimada T, Kaminsky LS, GuengerichFP. Catalytic activities of human liver cytochrome P-450 IIIA4expressed in Saccharomyces cerevisiae. Biochemistry 1990;29:11280–92.

7. Stedman C, Robertson G, Coulter S, Liddle C. Feed-forward regula-tion of bile acid detoxification by CYP3A4: studies in humanizedtransgenic mice. J Biol Chem 2004;279:11336–43.

8. Charles KA, Rivory LP, Brown SL, Liddle C, Clarke SJ, Robertson GR.Transcriptional repression of hepatic cytochrome P450 3A4 gene inthe presence of cancer. Clin Cancer Res 2006;12:7492–7.

9. Sharma R, Kacevska M, London R, Clarke SJ, Liddle C, Robertson G.Downregulation of drug transport and metabolism in mice bearingextra-hepatic malignancies. Br J Cancer 2008;98:91–7.

10. Skipworth RJ, Stewart GD, Dejong CH, Preston T, Fearon KC. Patho-physiology of cancer cachexia: much more than host-tumour inter-action?Clin Nutr 2007;26:667–76.

11. DewysWD, Begg C, Lavin PT, Band PR, Bennett JM, Bertino JR, et al.Prognostic effect of weight loss prior to chemotherapy in cancerpatients. Eastern Cooperative Oncology Group. Am J Med 1980;69:491–7.

12. Bruera E.ABC of palliative care. Anorexia, cachexia, and nutrition.BMJ 1997;315:1219–22.

13. Fearon KC. Cancer cachexia: developing multimodal therapy for amultidimensional problem. Eur J Cancer 2008;44:1124–32.

14. Stephens NA, Skipworth RJ, Fearon KC. Cachexia, survival and theacute phase response. Curr Opin Support Palliat Care 2008;2:267–74.

15. Maglich JM, Sluder A, Guan X, Shi Y, McKee DD, Carrick K, et al.Comparison of complete nuclear receptor sets from the human,Caenorhabditis elegans and Drosophila genomes. Genome Biol2001;2:RESEARCH0029.

16. Sonoda J, Pei L, Evans RM. Nuclear receptors: decoding metabolicdisease. FEBS Lett 2008;582:2–9.

17. Evans RM. The nuclear receptor superfamily: a rosetta stone forphysiology. Mol Endocrinol 2005;19:1429–38.

18. Karpen SJ. Nuclear receptor regulation of hepatic function. J Hepatol2002;36:832–50.

19. Francis GA, Fayard E, Picard F, Auwerx J. Nuclear receptors and thecontrol of metabolism. Ann Rev Physiol 2003;65:261–311.

20. Ip E, Farrell GC, Robertson G, Hall P, Kirsch R, Leclercq I. Central roleof PPARalpha-dependent hepatic lipid turnover in dietary steatohe-patitis in mice. Hepatology 2003;38:123–32.

21. Robertson GR, Field J, Goodwin B, Bierach S, TranM, Lehnert A, et al.Transgenic mouse models of human CYP3A4 gene regulation. MolPharmacol 2003;64:42–50.

22. Li X, Hansen PA, Xi L, Chandraratna RA, Burant CF. Distinct mechan-isms of glucose lowering by specific agonists for peroxisomal pro-liferator activated receptor gamma and retinoic acid X receptors. J BiolChem 2005;280:38317–27.

23. Sigrist S, BedouchaM, Boelsterli UA. Down-regulation by troglitazoneof hepatic tumor necrosis factor-alpha and interleukin-6 mRNAexpression in a murine model of non-insulin-dependent diabetes.Biochem Pharmacol 2000;60:67–75.

24. Compe E, Drane P, Laurent C, Diderich K, Braun C, Hoeijmakers JH,et al. Dysregulation of the peroxisome proliferator-activated receptortarget genes by XPD mutations. Mol Cell Biol 2005;25:6065–76.

25. Swarm RL. Transplantation of a murine chondrosarcoma inmice of different inbred strains. J Natl Cancer Instit 1963;31:953–75.

26. Futaki S, Hayashi Y, Yamashita M, Yagi K, Bono H, Hayashizaki Y,et al. Molecular basis of constitutive production of basement mem-brane components. Gene expression profiles of Engelbreth-Holm-Swarm tumor and F9 embryonal carcinoma cells. J Biol Chem2003;278:50691–701.

27. Martinez-Jimenez CP, Jover R, Donato MT, Castell JV, Gomez-Lechon MJ. Transcriptional regulation and expression of CYP3A4in hepatocytes. Curr Drug Metab 2007;8:185–94.

28. Jover R, Bort R, Gomez-Lechon MJ, Castell JV. Down-regulation ofhuman CYP3A4 by the inflammatory signal interleukin-6: molecularmechanism and transcription factors involved. FASEB J 2002;16:1799–801.

29. Ghose R, Zimmerman TL, Thevananther S, Karpen SJ. Endotoxinleads to rapid subcellular re-localization of hepatic RXRalpha: a novelmechanism for reduced hepatic gene expression in inflammation.Nucl Recept 2004;2:4.

30. Zimmerman TL, Thevananther S, Ghose R, Burns AR, Karpen SJ.Nuclear export of retinoid X receptor alpha in response to interleukin-1beta-mediated cell signaling: roles for JNK and SER260. J Biol Chem2006;281:15434–40.

31. Ruminy P, Gangneux C, Claeyssens S, ScotteM, DaveauM, Salier JP.Gene transcription in hepatocytes during the acute phase of a sys-temic inflammation: from transcription factors to target genes.Inflamm Res 2001;50:383–90.

32. Beigneux AP, Moser AH, Shigenaga JK, Grunfeld C, Feingold KR.Reduction in cytochrome P-450 enzyme expression is associatedwith repression of CAR (constitutive androstane receptor) and PXR(pregnane X receptor) in mouse liver during the acute phase response.Biochem Biophy Res Commun 2002;293:145–9.

33. Pascussi JM, Gerbal-Chaloin S, Pichard-Garcia L, Daujat M, FabreJM, Maurel P, et al. Interleukin-6 negatively regulates the expressionof pregnane X receptor and constitutively activated receptor in pri-mary human hepatocytes. Biochem Biophys Res Commun 2000;274:707–13.

34. Morgan ET. Impact of infectious and inflammatory disease on cyto-chrome P450-mediated drug metabolism and pharmacokinetics. ClinPharmacol Ther 2009;85:434–8.

35. Renton KW. Regulation of drug metabolism and disposition duringinflammation and infection. Expert Opin Drug Metab Toxicol2005;1:629–40.

36. Goodwin B, Hodgson E, Liddle C. The orphan human pregnane Xreceptor mediates the transcriptional activation of CYP3A4 by rifam-picin through a distal enhancer module. Mol Pharmacol 1999;56:1329–39.

37. Maglich JM, Lobe DC, Moore JT. The nuclear receptor CAR (NR1I3)regulates serum triglyceride levels under conditions of metabolicstress. J Lipid Res 2009;50:439–45.

38. Ghose R, Mulder J, von Furstenberg RJ, Thevananther S, Kuipers F,KarpenSJ.Rosiglitazoneattenuates suppressionofRXRalpha-depen-dent gene expression in inflamed liver. J Hepatol 2007;46:115–23.

39. Gombart AF, Luong QT, Koeffler HP. Vitamin D compounds: activityagainst microbes and cancer. Anticancer Res 2006;26:2531–42.

40. Poon MM, Chen L. Retinoic acid-gated sequence-specific transla-tional control by RARalpha. Proc Natl Acad Sci U S A 2008;105:20303–8.

41. Szafran AT, Szwarc M, Marcelli M, Mancini MA. Androgen receptorfunctional analyses by high throughput imaging: determination ofligand, cell cycle, and mutation-specific effects. PLoS ONE 2008;3:e3605.

Kacevska et al.





42. Vlaeminck-Guillem V, Wemeau JL. Physiology and pathophysiologyof thyroid hormone receptors: the contributions of murine models.Ann Endocrinol (Paris) 2000;61:440–51.

43. Burris TP. Nuclear hormone receptors for heme: REV-ERBalpha andREV-ERBbeta are ligand-regulated components of the mammalianclock. Mol Endocrinol 2008;22:1509–20.

44. Heyman RA, Mangelsdorf DJ, Dyck JA, Stein RB, Eichele G, EvansRM, et al. 9-cis retinoic acid is a high affinity ligand for the retinoid Xreceptor. Cell 1992;68:397–406.

45. Altucci L, Leibowitz MD, Ogilvie KM, de Lera AR, Gronemeyer H. RARand RXR modulation in cancer and metabolic disease. Nat Rev DrugDiscov 2007;6:793–810.

46. Takamatsu K, Takano A, Yakushiji N, Morohashi K, Morishita K,Matsuura N, et al. The first potent subtype-selective retinoid X recep-tor (RXR) agonist possessing a 3-isopropoxy-4-isopropylphenyla-mino moiety, NEt-3IP (RXRalpha/beta-dual agonist). Chem MedChem 2008;3:780–7.






Published OnlineFirst April 15, 2011.Clin Cancer Res Marina Kacevska, Michael R. Downes, Rohini Sharma, et al. Regulated Drug Metabolism

−Extrahepatic Cancer Suppresses Nuclear Receptor

Updated version

10.1158/1078-0432.CCR-10-3289doi:

Access the most recent version of this article at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

SubscriptionsReprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. (CCC)Click on "Request Permissions" which will take you to the Copyright Clearance Center's

.http://clincancerres.aacrjournals.org/content/early/2011/05/06/1078-0432.CCR-10-3289To request permission to re-use all or part of this article, use this link



http://clincancerres.aacrjournals.org/lookup/doi/10.1158/1078-0432.CCR-10-3289

http://clincancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://clincancerres.aacrjournals.org/content/early/2011/05/06/1078-0432.CCR-10-3289


Extrahepatic Cancer Suppresses Nuclear Receptor Regulated … · Cancer Therapy: Preclinical...

Documents

Transcript of Extrahepatic Cancer Suppresses Nuclear Receptor Regulated … · Cancer Therapy: Preclinical...