Extracellular Matrix-Mediated Lung Epithelial Cell ......The three-dimensional extracellular matrix...
Transcript of Extracellular Matrix-Mediated Lung Epithelial Cell ......The three-dimensional extracellular matrix...
Extracellular Matrix-Mediated Lung
Epithelial Cell Differentiation
by
Sharareh Shojaie
A thesis submitted in conformity with the requirements
for the degree of Doctor of Philosophy
Department of Physiology
University of Toronto
© Copyright by Sharareh Shojaie 2016
ii
Extracellular Matrix-Mediated Lung
Epithelial Cell Differentiation
Sharareh Shojaie
Doctor of Philosophy
Department of Physiology
University of Toronto
2016
Abstract
Differentiation of functional lung epithelial cells from pluripotent stem cells holds the potential for
applications in regenerative medicine. However efficient differentiation to proximal and distal lung
epithelial cell populations remains a challenging task. The three-dimensional extracellular matrix
scaffold is a key component that regulates the interaction of secreted factors with cells during
development by often binding to and limiting their diffusion within local gradients. The development
of matrices that can recapitulate the in vivo environment is key for directing lung lineage-specific
differentiation. Here we examined the role of the lung ECM in differentiation of pluripotent cells
in vitro and demonstrate the robust inductive capacity of the native matrix alone using decellularized
adult lung scaffolds. The decellularization procedure was optimized and the scaffolds generated were
carefully characterized to ensure complete removal of resident cells and preservation of the ECM.
Lung scaffolds were recellularized with mouse and rat embryonic stem cell-derived endoderm and
maintained for up to three weeks of culture at air liquid interface, in defined, serum-free medium
conditions. Recellularization of lung scaffolds with endodermal cells resulted in differentiation to
early NKX2-1+/SOX2+ proximal lung progenitor cells and a heterogeneous basal epithelial cell
iii
population, within seven days of culture. Extended culture resulted in robust differentiation to mature
airway epithelia, complete with FOXJ1+/TUBB4A+ ciliated cells and SCGB1A1+ secretory club cells,
with morphological and functional similarities to native airways. Differentiated day 21 cells contained
beating ciliated cells in culture and exhibited functional CFTR protein expression. Heparitinase I, but
not chondroitinase ABC, treatment of scaffolds revealed that the differentiation achieved is dependent
on heparan sulfate proteoglycans (HSPG) and its bound factors on the ECM. This work demonstrates
the importance of a 3-dimensional matrix environment and the role of site-specific cues for directing
differentiation of pluripotent stem cells to lung epithelial cells. This is a valuable step towards
uncovering ECM-mediated signaling during lung specification and offers a platform for modeling
lung development and airway-related diseases using pluripotent stem cells.
iv
Acknowledgments
To my supervisor and mentor, Martin Post —
For taking a chance on me five years ago and giving me the opportunity to explore my love for
research and scientific discovery. For his endless knowledge and expertise that helped guide me
through this exciting project. For fostering my growth in science and in life, while allowing me to
learn from both my triumphs and mistakes. And finally, for his patience and continued support. A
deep and sincere thank you to Martin Post, without whom none of this would have been possible.
To Ian Rogers —
For always being optimistic of my work, and convincing me of its importance.
To my committee members, Herman Yeger, Alek Hinek, Neil Sweezey, and Ian Rogers —
For their invaluable contributions; asking the tough questions that helped me critically analyze and
better my work.
To the talented Cameron Ackerley, Jinxia Wang, and Emily Fox —
For sharing their vision and fundamentally advancing the course of my research.
To my friends and fellow colleagues in the Post Lab, Irene Tseu, Michael Litvack, Behzad Yeganeh,
Leonardo Ermini, Joyce Lee, Sandra Leibel, Angie Griffin, Daochun Luo, Claudia Bilodeau, Sanita
Jandu, and Palma Ottaviani —
For creating a stimulating and engaging work environment, making it fun for me to spend countless
hours there.
To Mélanie Bilodeau, Michael Wong, David Douda, and Saumel Ahmadi —
For sharing their passion for research with me and countless fervent discussions.
To Adrian Le —
For his unwavering motivation and love. For his confidence in me to take on anything and reach my
ambitions.
And finally, to my family, Parvin Jalilvand, Jamshid Shojaie, and Sheilla Shojaie —
For this journey would not have been possible without their support and encouragement. For
teaching me to see the world with a curious mind and appreciate all of its wonder and mystery.
v
Table of Contents
Acknowledgments iv
Table of Contents v
List of Tables viii
List of Figures ix
List of Abbreviations xii
Chapter 1 Introduction 1
1. Introduction 2
1.1 Lung development 2
1.1.1 Developmental stages 2
1.1.2 Lung bud formation 3
1.1.3 Contributors to proximal-distal patterning 6
1.1.4 Current model of epithelial type lineaging 8
1.2 Extracellular Matrix 12
1.2.1 Structural diversity of the ECM 12
1.2.2 Multifunctionality of the ECM 13
1.2.3 Cell-matrix interactions via integrin receptors 15
1.2.4 Matrix Metalloproteinases 17
1.2.5 Biomechanical forces and the ECM 17
1.2.6 Stem cell-matrix interactions 18
1.3 Stem Cells 20
1.3.1 Stem cell characteristics 20
1.3.2 Types of stem cells 21
1.3.3 Adult lung stem cells 23
1.4 Tissue decellularization 25
1.4.1 Overview 25
1.4.2 Decellularization methodologies 25
1.4.3 Cytocompatibility and immunogenicity 27
1.5 Regenerative Medicine 28
1.5.1 Stem cells in regenerative medicine 28
1.5.2 Cell therapy 29
vi
1.5.3 Stem cell tissue engineering 30
1.6 Hypothesis and Objectives 32
Chapter 2 Generation and characterization of decellularized lung scaffolds for embryonic stem cell
differentiation 33
2 33
2.1 Rationale 34
2.2 Introduction 35
2.3 Materials and Methods 36
2.4 Results 41
2.5 Discussion 54
Chapter 3 Early differentiation of stem cell-derived endoderm to basal cells on decellularized lung
scaffolds 57
3 58
3.1 Rationale 58
3.2 Introduction 59
3.3 Materials and Methods 60
3.4 Results 66
3.5 Discussion 83
Chapter 4 Decellularized lung scaffolds direct differentiation of endoderm to functional airway
epithelial cells, with the requirement of matrix-bound heparan sulfate proteoglycans 86
4 87
4.1 Rationale 87
4.2 Introduction 88
4.3 Materials and Methods 89
4.4 Results 96
4.5 Discussion 120
Chapter 5 Summary and Future Directions 122
5 122
5.1 Summary and Concluding Remarks 123
5.2 Future Directions 131
5.2.1 Identifying the role of key matrix proteins in lung specification 131
vii
5.2.2 Characterize basal cell subpopulations and their differentiation potential 131
5.2.3 Direct differentiation to the alveolar linage on decellularized lung scaffolds 131
5.2.4 Determine the regenerative potential of scaffold cultures for in vivo engraftment 132
References 134
Copyright Acknowledgements 149
viii
List of Tables
Table 1-1 Stages of lung development
Table 2-1 Decellularization Solutions
Table 2-2 Antibody List
Table 3-1 RT-PCR primer table
Table 3-2 Antibodies list
Table 4-1 RT-PCR primer table
Table 4-2 Antibodies list
Table 4-3 Analogues embryonic dating of endoderm differentiation on lung scaffold cultures
ix
List of Figures
Figure 1-1 Transcription and growth factors known to regulate lung development
Figure 1-2 Mature lung epithelial cell populations
Figure 1-3 Relay of ECM and GF signaling through cell surface integrin receptors
Figure 2-1 Adult rat lungs are best decellularized using zwitterionic detergent CHAPS in comparison
to treatment with trypsin and ionic detergent SDS
Figure 2-2 Hypertonic CHAPS-based decellularization solution with the addition of EDTA
effectively removes all donor cells while preserving the ECM
Figure 2-3 Decellularized lung scaffolds undergo endonuclease and antimicrobial agent treatment
prior to recellularization
Figure 2-4 Decellularization procedure with endonuclease treatment completely removes all cellular
components
Figure 2-5 Lung scaffolds maintain their architectural structure and strength following
decellularization
Figure 2-6 Major ECM proteins including basement membrane components and elastin are detected
by immuno-staining on decellularized scaffolds
Figure 2-7 Basement membrane protein laminin is maintained on decellularized scaffolds
Figure 2-8 Lung scaffolds support primary rat embryonic epithelial cell adherence and organization
Figure 2-9 Primary embryonic rat epithelial cells maintain lung airway and alveolar phenotype on
scaffolds
Figure 3-1 Decellularized lung scaffolds are repopulated with ES-derived definitive endoderm cells
and cultured at air liquid interface
Figure 3-2 Seeded ES-derived endoderm cells form epithelial structures along the basement
membrane
x
Figure 3-3 Definitive endoderm upregulates early lung markers with culture on lung scaffolds
Figure 3-4 Seeded Endodermal Cells Differentiate to NKX2-1+/SOX2+ Proximal Lung Progenitors
with Culture on Decellularized Scaffolds
Figure 3-5 NKX2-1 progenitor cells increase with longer culture on lung scaffolds
Figure 3-6 Individual matrix proteins do not support lung lineage commitment of seeded endodermal
cells
Figure 3-7 Endoderm culture without lung scaffold does not promote differentiation to a lung
phenotype
Figure 3-8 Epithelial structures positive for basal cell markers are present on early scaffold cultures
Figure 3-9 Basal cells identified on early and mature scaffold cultures are a heterogeneous
population
Figure 3-10 Basal cell population drops with longer culture duration as epithelial structures mature
on scaffolds
Figure 3-11 Extended culture on scaffolds shows a reduction in Ki67+ proliferative cells, while the
proportion of apoptotic cells stained with TUNEL increase
Figure 3-12 Definitive endoderm differentiates to proximal airway progenitors and basal epithelial
cells after 7 days of scaffold culture
Figure 4-1 Endoderm culture on lung scaffolds promotes upregulation of airway epithelial gene
expression
Figure 4-2 Seeded endoderm repopulates entire lung scaffold
Figure 4-3 Immunofluorescent and confocal analysis of differentiation to airway epithelial on scaffold
cultures
Figure 4-4 Proximal and Distal Lung Scaffolds Both Promote Airway Differentiation
xi
Figure 4-5 Scanning and transmission electron microscopy show mature ciliated cell and secretory
cell morphology on scaffold cultures
Figure 4-6 Extended culture on lung scaffolds shows emergence of PAS-positive submucosal gland-
like structures
Figure 4-7 Monociliated cells are found during early differentiation on decellularized lung scaffolds,
resembling pseudoglandular stage of lung development
Figure 4-8 Endoderm-derived secretory cells on decellularized lung scaffolds generate and secrete
SCGB1A1 protein
Figure 4-9 Visualized progression of endoderm to airway epithelial cells on decellularized lung
scaffolds
Figure 4-10 Mature endoderm-derived ciliated cells are motile and beat in culture
Figure 4-11 Differentiated airway epithelial cultures have Functional CFTR Protein expression
Figure 4-12 Enzymatic Treatment of Acellular Scaffolds with Heparitinase I Cleaves Heparan Sulfate
Proteoglycans
Figure 4-13 Organization and differentiation of endodermal cells is dependent on HS proteoglycans
on decellularized lung scaffolds
Figure 4-14 Seeded endoderm differentiates to airway epithelia on heparitinase-treated scaffolds with
addition of scaffold conditioned media
Figure 4-15 Antibody assay identifies HS-bound matrix proteins removed from decellularized
scaffolds after heparitinase I treatment
Figure 5-1 Summary schematic
xii
List of Abbreviations
2i Two-inhibitor
3D Three-dimensional
AKT Thymoma viral proto-oncogene
Alb Albumin
ALI Air liquid interface
AQP5 Aquaporin 5
ASCL1 Achaete-scute family bHLH
transcription factor 1
AT1 Type I alveolar cells
AT2 Type II alveolar cells
BADJ Bronchoalveolar duct junction
BASC Bronchioalveolar stem cell
bHLH Basic helix-loop-helix
BMC Bone marrow cells
BMP Bone morphogenetic protein
BSA Bovine serum albumin
cAMP Cyclic adenosine
monophosphate
CCL3 Chemokine (C-C motif) ligand 3
CDH1 Cadherin 1
CHAPS
3-[(3-cholamidopropyl)
dimethylammonio]-1-
proppanesulfonate
cKIT Kit oncogene
CLDN10 Claudin10
CM Conditioned media
Col-I Collagen I
Col-IV Collagen IV
CS Chondroitin sulfate
CXCL12 Chemokine (C-X-C motif)
ligand 12
CYP2F2 Cytochrome p450
DAB 3,3'-Diaminobenzidine
DAPI 4',6-diamidino-2-phenylindole
DMSO Dimethyl sulfoxide
DNA Deoxyribonucleic acid
dpn Days postnatally
EB Embryoid body
ECM Extracellular matrix
EDTA Ethylenediaminetetraacetic acid
EGTA Ethylene glycol tetraacetic acid
EM Electron microscopy
ENaC Epithelium sodium channel
ESCs Embryonic stem cells
FA Focal adhesion
FACS Fluorescence-activated cell
sorting
FAK Focal adhesion kinase
FBS Fetal bovine serum
FGF Fibroblast growth factor
FGFR2 Fibroblast growth factor
receptor 2
FGFR2IIIb FGFR2, isoform IIIb
FIG Forskolin, 3-isobutyl-1-
methylxanthine, genistein
Fn Fibronectin
FOXA2 Forkhead box A2
FOXJ1 Forkhead box J1
GAGs Glycosaminoglycans
GATA6 Gata binding protein 6
GF Growth facor
GLI GLI-Kruppel family member
GTP Guanosine triphosphate
H&E Hematoxylin and eosin
HBSS Hank’s balanced salt solution
HEPES 4-(2-hydroxyethyl)-1-
piperazineethanesulfonic acid
HES1 Hairy and enhancer of split 1
HGF Hepatocyte growth factor
HS Heparan sulfate
HSC Hematopoietic stem cells
HSPG Heparn sulfate proteoglycan
IBMX 3-isobutyl-1-methylxanthine
ID2 Inhibitor of DNA binding 2
IF Immunofluorescent
IL10 Interleukin 10
iPSC Induced pluripotent stem cells
JNK Jun N-terminal kinase
KLF4 Kruppel-like factor 4
KRT14 Cytokeratin 14
KRT18 Cytokeratin 18
KRT5 Cytokeratin 5
LAP Latency associated peptide
Lmn Laminin
MAPK Mitogen-activated protein
kinase
MEM Minimum essential medium
xiii
MIDAS Metal ion dependent adhesive
site
MMP Matrix metalloproteinases
mRNA Messenger RNA
MSC Mesenchymal stem cells
MUC5AC Mucin 5, subtypes AC
MYCN Myelocytomatosis viral
oncogene neuroblastoma
NE Neuroendocrine
NGFR Nerve growth factor receptor
NKX2-1 NK2 homeobox 1 (also known
as TITF1 and TTF1)
Olig2 Oligodendrocyte transcription
factor 2
PAGE Polyacrylamide gel
electrophoresis
PAS Periodic acid-Schiff
Pax8 Paired box 8
PCR Polymerase chain reaction
PDGF Platelet derived growth factor
PDGFR Platelet derived growth factor
receptor
PDPN Podoplanin
Pdx1 Pancreatic and duodenal
homeobox 1
Pen/Strep Penicillin streptomycin
pKRT Pan cytokeratin
POU5F1 POU domain, class 5
transcription factor 1
pSFTPC pro-surfactant protein C
qPCR Quantitative PCR
RA Retinoic acid
RAR Retinoic acid receptor
RGD Arg-Gly-Asp
Rho Rhodopsin
RIPA Radioimmunoprecipitation
assay
RNA Ribonucleic acid
RT Real-time
SB-10 Sulfobetaine-10
SCGB1A1 Secretoglobin family 1A
member 1
SDS Sodium dodecyl sulfate
SFDM Serum-free differentiation
medium
SFTP Surfactant protein
SHH Sonic hedgehog
SOX2 SRY (sex determining region
Y)-box 2
SOX9 SRY (sex determining region
Y)-box 9
SPDEF SAM pointed domain containing
ETS transcription factor
SPRY Sprouty
TBX T-box
Tg Thyroglobulin
TGFβ1 Transforming Growth Factor-β1
TGFβR1 TGFβ1 heteromeric complex of
type I
TGFβR2 TGFβ1 heteromeric complex of
type II
TIMP1 Tissue inhibitor of
metalloproteinase 1
TJP1 Tight junction-associated
protein
TRP63 Transformation related protein
63
TUBB4A Tubulin beta 4A
TUNEL Transferase (TdT)-mediated
dUTP nick end labeling
UV Ultraviolet
v/v volume/volume
VIM Vimentin
w/v weight/volume
WB Western blot
Chapter 1
Introduction
2
1. Introduction
The ability to extract sufficient amounts of oxygen from the environment has had a huge impact
on the evolution of the respiratory system. In particular, breathing amphibians and mammals with
their high metabolic rates have been forced to evolve a sophisticated organ to meet their oxygen
requirements. To accomplish this, the lung consists of two highly branched tubular systems that
have developed in a coordinated way to carry air and blood. Uncovering the precise signaling
pathways in lung branching morphogenesis and lung cell fate has been challenging. Fundamental
research in developmental biology using increasingly sophisticated techniques for disease
modeling, genetic engineering and regenerative medicine bring us closer to understanding the
underlying mechanisms in lung development and discovering novel therapeutic strategies that
could improve outcomes associated with chronic, idiopathic and congenital respiratory problems.
1.1 Lung development
1.1.1 Developmental stages
Lung development can be subdivided into six distinct stages (Table 1-1)1,2. The early stages of
lung formation comprise the embryonic and pseudoglandular periods, after which the prospective
conductive airways have been formed and the acinar limits can be recognized. During the
pseudoglandular period the primitive airway epithelium starts to differentiate, and
neuroendocrine, ciliated, and goblet cells appear while mesenchymal cells have begun to form
cartilage and smooth muscle cells. In the subsequent canalicular period, the airway branching
pattern is completed, and the prospective gas exchange region starts to develop. During this
period respiratory bronchioli appear, interstitial tissue decreases, vascularization of peripheral
mesenchyme increases, and distal cuboidal epithelium differentiates into type I (AT1) and type
II (AT2) cells. During the saccular period, the growth of the pulmonary parenchyma, the thinning
of the connective tissue between the air spaces, and maturation of the surfactant system are the
most important steps toward ex utero life. Although capable of function, the lung is structurally
in an immature condition at birth. The structures present are smooth-walled transitory ducts and
saccules with thick primitive septa containing a double capillary network. The final two stages
of lung development are alveolarization and microvascular maturation. Human lung development
progresses further in utero compared to mouse lungs. Completion of the saccular stage of
development and continuation into alveolar and microvascular maturation occur after birth in
3
mice, while alveolarization begins at 36 weeks gestation in humans (Table 1-1). The final two
stages of development occur concurrently and are characterized by an increase in the gas
exchange surface area through septation of the alveoli, and by fusion of the dual-layer capillaries
into a single-layer network. One of the important hallmarks of lung development is the signaling
crosstalk between the epithelial and mesenchymal tissue layers. The combination, concentration,
and spatial-temporal localization of a multitude of molecular signaling factors all working in
harmony determine the fate of branching, proliferation, and cellular differentiation of the
developing lung.
1.1.2 Lung bud formation
Lung development starts as an endodermal outgrowth of the ventral foregut around the fourth
week of human development. Genetic studies have implicated several transcription factors,
morphogens, peptide growth factors, and their cognate receptors in specifying the morphogenetic
progenitor field of early and late lung development along the foregut axis, listed in Figure 1-1.
Tightly regulated reciprocal communication between the developing lung endodermal and
mesenchymal components is necessary to orchestrate precise temporal and spatial signaling.
The crucial event during the embryonic stage is the initiation of lung formation at the right place
along the anterior-posterior axis of the foregut. One important transcription factor in this process
is forkhead box A2 (FOXA2)3,4. Foxa2 is expressed in the ventral foregut endoderm before and
immediately at the start of lung bud formation5-7. Targeted ablation of Foxa2 in mice has led to
embryonic death between E6.5 and E9.5 before the onset of lung formation8,9; however, chimeras
rescued for the embryonic-extraembryonic constriction showed that Foxa2 was essential for
foregut and lung formation10. The foregut rapidly elongates into a single tube dividing into a
dorsal esophagus and a ventral trachea, the latter of which bifurcates into the left and right
primary lung buds. In a similar process, the mouse respiratory system develops from a pair of
endodermal buds in the ventral half of the primitive foregut, just anterior to the developing
stomach at 9.5 days of gestation. At this stage, the earliest known lung and thyroid-specific
endoderm marker, homeodomain transcription factor NKX2-1, appears and forms a localized
domain of expression in the anterior foregut11-13. Initial branching starts by division into the right
and left lung buds, invasion into the surrounding mesenchyme, and deposition of a network of
extracellular matrix (ECM) proteins.
4
Lung bud development and subsequent branching is dependent on fibroblast growth factor (FGF)
10 expression in the local mesoderm surrounding the buds and FGF10 receptor (FGFR2IIIb), an
FGFR2 splice variant, in the endoderm. FGF10 is a member of the large family of FGFs essential
to many processes during embryonic development14,15. In the murine lung, Fgf10 messenger
RNA (mRNA) is dynamically expressed in the distal mesenchyme adjacent to the primitive lung
buds16. The importance of FGF10 for lung development was shown in Fgf10-deficient mice that
die at birth because of respiratory failure17,18. Transgenic mice overexpressing a dominant-
negative FGFR2IIIb in the distal lung epithelium show a severe pulmonary defect, forming only
a trachea and two main bronchi, without any lateral branches19. Taken together, these data
indicate that FGF10 signaling through FGFR2IIIb plays a crucial role in the initiation of lung
bud formation. Once a localized source of FGF10 in the mesoderm surrounding branching tips
has been established, this acts as a distal signaling center. There is evidence that Sonic hedgehog
(SHH) and Sprouty (SPRY) are negative regulators20,21, and WNT and Bone morphogenetic
protein (BMP) signaling are positive regulators of this process22-24.
Following elongation of the two buds, in humans the left lung bud will give rise to two main stem
bronchi, and the right lung bud gives rise to three main stem bronchi. In the mouse, the right lung
bud will form four stem bronchi whereas the left lung consists of one stem bronchus. The
secondary bronchi will then extend into the surrounding mesenchyme and start to branch and
rebranch in a process termed branching morphogenesis. This branching is initially highly
stereotyped, while less so in the later stages of lung development25,26.
Transforming Growth Factor-β1 (TGFβ) belongs to a superfamily that includes activin, BMP,
and TGFβ1, 2, and 3. These peptides can exert a variety of biologic effects including regulation
of cell growth, differentiation, and expression of a variety of proteins. In the lung, Tgfβ1 mRNA
and protein are found in the mesenchyme and epithelium, respectively27-29. Addition of
exogenous TGFβ1 to cultured embryonic mouse lung explants and in vivo overexpression of
Tgfβ1 in distal lung epithelial cells resulted in decreased branching morphogenesis, distal
epithelial cell differentiation and formation of the pulmonary vasculature, indicating an
inhibitory role for TGFβ1 during branching morphogenesis30-34. Most, if not all, biologic
receptors35. Signal transduction
requires the formation of a heteromeric complex of type I (TGFβR1) and type II (TGFβR2)
receptors. Inhibition of TGFβR2 signaling stimulated lung morphogenesis in whole lung explant
5
cultures, underlining again the negative effects of TGFβ signaling on branching morphogenesis36.
In vivo studies show that Tgfβ1-null mutants have no gross developmental abnormalities,
however 50% of the null mutants die before E11.5 as a result of defects in yolk sac
vascularization37-39. Tgfβ3-null mutants die after birth with cleft palate and delayed pulmonary
development, and Tgfβ2-deficient mice die after birth and display a lung phenotype with
postnatal collapse of alveoli and terminal airways40. SMAD proteins are downstream effecter
proteins in the TGFβ signaling pathway41. SMAD1-3 proteins are expressed in distal lung
epithelium, and SMAD4 is expressed in both distal lung epithelium and mesenchyme37,42. Down-
regulation of Smad2/3 and Smad4 expression increased branching morphogenesis in cultured
lung explants. Exogenous TGFβ1 did not reverse this inhibitory effect, which is consistent with
TGFβ1 being upstream of SMAD proteins37.
Two additional transcription factors that have been implicated in lung branching morphogenesis
include GATA binding protein 6 (GATA6) and V-Myc avian myelocytomatosis viral oncogene
neuroblastoma derived homolog (MYCN). GATA6 belongs to the GATA family of zinc finger–
containing transcription factors and is expressed in epithelial and mesenchymal cells of the
developing lung bud43,44. GATA6 is essential for endoderm formation as its targeted deletion
resulted in embryonic death due to failure of visceral endoderm formation45,46. In the lung,
GATA6 appears to be important for branching morphogenesis as inhibition of expression in the
lungs results in decreased branching46,47. Expression of a GATA6 engrailed dominant negative
fusion protein in the distal lung epithelium resulted in a lack of alveolar type I cells and a
perturbation in alveolar type II cells together with a reduction in the number of proximal airway
tubules48. On the other hand, overexpression of Gata6 using the Sftpc promoter resulted in
disrupted branching morphogenesis and a lack of distal epithelial cell differentiation49. This
suggests that a balanced Gata6 expression level is important for branching during the
pseudoglandular period of lung development and also during later stages of lung development in
alveolar type I and II cell differentiation. MYCN is a member of the MYC family of proto-
oncogenes, which includes MYCN, MYC, and MYCL, all belonging to the basic helix-loop-
helix (bHLH) class of transcription factors. In the lung, MYCN is expressed in pulmonary
epithelium50,51 and Mycn-null mutant mice die at midgestation51,52. Leaky null mutants for Mycn
survive until the onset of lung development; however, branching morphogenesis is dramatically
reduced, resulting in severe lung hypoplasia50,53. More recently, mice containing a lung-specific
6
Mycn-null mutation showed its critical role during lung development as these mice had abnormal
lungs with a loss of proliferation, increased apoptosis, and reduced branching54.
It is apparent that no one master regulator exists for lung development, rather together they
control downstream effectors that drive and direct lung development55-57. New players in this
dynamic regulatory network are being identified, including micro-RNAs that will undoubtedly
continue to expand our understanding of molecular mechanisms involved in branching
morphogenesis and lung tissue maturation.
1.1.3 Contributors to proximal-distal patterning
As branching proceeds, endoderm-derived epithelial cells will line the airways while the
surrounding mesenchyme will provide the elastic tissue, smooth muscles, cartilage, vascular
system, and other connective tissues. NKX2-1+ primary lung buds give rise to all epithelial cell
phenotypes along the proximo-distal axis, each with different morphologies and patterns of gene
expression58,59 (Figure 1-2). Lineage restriction in the epithelium starts as the lung progresses
from the pseudoglandular to cannalicular phase of lung development.
During mouse lung specification, differentiated cell types begin to appear, with proximal cells
exhibiting mature phenotypes prior to the distal lineage cells. Epithelial cell types of the proximal
lung in the tracheobronchial and bronchiolar lineages are columnar and pseudostratified. Early
basal cells expressing transcription factor Transformation related protein 63 (TRP63) can be
found in the mouse tracheal epithelium as early as E10.5. By E15.5, multiciliated cells expressing
Forkhead box protein J1 (FOXJ1) and Tubulin Beta 4A Class IVa (TUBB4A) appear to line the
airways and by E17.5 secretory club cells expressing Secretoglobin family 1A1 (SCGB1A1)
(also known as Clara/club cell secretory protein), can be detected, predominantly in the more
distal bronchiolar region of the airways60,61. Basal cells function as progenitor cells that can self-
renew and give rise to both secretory cells and ciliated cells60,62. At E13 in the mouse, subsets of
epithelial cells begin to express Achaete-scute homolog 1 (ASCL1), which can be turned off by
NOTCH signaling63,64. Cells that retain ASCL1 expression give rise to pulmonary
neuroendocrine (NE) cells, while cells that downregulate its expression, give rise to secretory
club cells. Mucus cells are also a proximal airway epithelial lineage that play an important role
in airway remodeling during lung disease. SAM pointed domain containing ETS transcription
7
factor (SPDEF), an ETS domain transcription factor, is expressed in these mucous cells, also
known as goblet cells, in the respiratory system and the gut65,66.
The distal lung differentiates after proximal epithelial cell types have been established. Early
developmental studies in murine lungs have shown that between E16-18 in the mouse, the distal
lung is composed of glycogen-rich cuboidal AT2 cells, expressing surfactant proteins (SFTP) 67.
Surfactant containing lamellar bodies can be found by E18 in AT2 cells, and Podoplanin (PDPN)-
and Aquaporin5 (AQP5)-positive AT1 cells can be detected shortly after that60. A recent model
shows evidence for a bi-potential alveolar progenitor cell that can directly give rise to both AT1
and AT2 cells during development68. Over the last two decades regulatory molecules involved in
epithelial morphogenic patterning of the lung have been identified; however, the lineage
relationship among these lung epithelial cells is not entirely understood.
Epithelial transcription factors such as FOXA2, NKX2-1 and GATA6 have been shown to
influence lung epithelial specification. All lung endoderm initially expresses NKX2-1 and it
continues to be expressed in adult bronchiolar and alveolar epithelial type II cells, where it plays
an important role in the regulation of SCGB1A1 and surfactant protein synthesis69. Targeted
disruption of NKX2-1 results in severe hypoplasia of the lung lacking separation of trachea from
the esophagus, arrest of branching morphogenesis, and epithelial cell differentiation at the
pseudoglandular stage13,70. FOXJ1 is a transcription factor of the winged helix–forkhead family,
expressed in various tissues during development. In the developing and adult lung, FOXJ1
expression is restricted to ciliated cells of the bronchial and bronchiolar epithelium71,72. The role
of FOXJ1 in ciliated cell differentiation was clearly demonstrated when it was overexpressed in
distal pulmonary epithelial cells. High levels of Foxj1 expression inhibited branching
morphogenesis and development of distal epithelial cells; however, it enhanced the development
of ciliated cells71 while Foxj1-null mutant mice completely lack respiratory ciliated cells73,74.
SHH does not appear to be involved in regulating proximo-distal epithelial specification since
SFTPC and SCGB1A1 are expressed in Shh-deficient mice75. BMP4 is implicated in lung
epithelial specification; it is expressed in early distal lung tips and at lower levels in the
mesenchyme adjacent to the distal lung buds23,76. Overexpression of BMP4 in the distal
epithelium in vivo resulted in hypoplastic lungs with grossly dilated terminal lung buds separated
by abundant mesenchyme23. In vitro, exogenous BMP4 clearly enhanced peripheral lung
epithelial branching morphogenesis and SFTPC expression77. The secreted BMP antagonist
8
Noggin is expressed in distal mouse lung mesenchyme early in development76. Its overexpression
or that of the dominant-negative BMP receptor dnAlk6 in distal pulmonary epithelium, resulted
in a proximal pulmonary epithelial phenotype. Similar results were obtained when Gremlin,
another BMP antagonist, was overexpressed in the distal lung epithelium78. These studies clearly
indicate a role for BMP4 in proximo-distal epithelial differentiation during lung development.
1.1.4 Current model of epithelial type lineaging
The current model of lung epithelial differentiation depicts a multipotent progenitor population
located at the tip of the growing lung buds. These tip cells are likely maintained by FGF10 and
WNT signaling and lineage tracing experiments suggest that they have the ability to directly give
rise to both proximal and distal epithelial lineages. As the lung buds extend and continue to
branch specific gene expression patterns emerge in the stalk epithelial cells versus the tips, giving
rise to SRY-related HMG-box(SOX)2+ proximal airway progenitors and SOX9+ distal alveolar
progenitors, respectively79,80. SOX2+ cells in the elongating stalk proliferate and give rise to all
epithelial cells of the future bronchi and bronchioles: NE cells, ciliated cells, club cells and goblet
cells60,81. There is also evidence that NOTCH signaling plays a role in specification of bronchial
epithelia64. NOTCH2 receptor mediates the club and ciliated cell fate, while three NOTCH
receptors (NOTCH 1, 2, 3) contribute in an additive way to regulate the abundance of NE cells.
Using an Id2-CreErT2 knock-in mouse strain to lineage trace the bud tip cells, one study suggests
that Inhibitor of DNA binding 2 (ID2) expression, which encodes a bHLH transcription factor,
identifies cells that can give rise to both proximal and distal lineages during the pseudoglandular
stage, and become restricted to generating distal epithelial cells during the canalicular stage82.
The classic model of alveolar epithelial differentiation suggest that AT1 cells arise from AT2
cells. However, recent lineage tracing studies using an inducible Shh-CreEr allele demonstrate
that during lung development both AT1 and AT2 cells can arise directly from a common
progenitor, supporting the idea of a multipotential tip progenitor population68. Many questions
remain regarding the fate of these progenitor cells and whether they truly represent a single
progenitor population or a mixture of subpopulations with restricted differentiation potential.
9
Table 1-1 Stages of lung development
Stage
Gestational Age
Main Events
Epithelial
Differentiation Human Mouse
Embryonic 3.5-8 wk 9.5-14.5 days
Formation of lung bud,
trachea, left and right
primary bronchus, and
major airways
Undifferentiated columnar
epithelium
Pseudoglandular
5-17 wk
14.5-16.5
days
Establishment of the
bronchial tree; all
preacinar bronchi are
formed
Proximal: columnar
epithelium; ciliated,
nonciliated, basal,
neuroendocrine cells
Distal: cuboidal
epithelium; precursor type
II cells
Canalicular 16-26 wk 16.5-17.5
days
Formation of the
prospective pulmonary
acinus by narrowing of
terminal buds, and
increase of capillary
bed
Proximal: columnar
epithelium; ciliated,
nonciliated, basal,
neuroendocrine cells
Distal: differentiation of
cuboid type II to squamous
type I cells
Saccular 24-38 wk 17.5-5 dpn
Formation of alveoli
precursors: saccules,
alveolar ducts, and
alveolar air sacs
Proximal: ciliated,
nonciliated club, basal,
neuroendocrine cells
Distal: type I cells flatten
and II cells mature
Alveolar 36-2 ypn 5-30 dpn
Formation of alveoli
by septation of
alveolar air sacs,
thinning of
interalveolar septa
Proximal: columnar
epithelium; ciliated,
nonciliated, basal,
neuroendocrine cells
Distal: mature type I and II
cells mature
Microvascular
Maturation Birth-3 ypn 14-21 dpn
Fusion of the capillary
bed to a single layered
network
dpn: days postnatally, ypn: years postnatally
10
Figure 1-1 Transcription and growth factors known to regulate lung development
Figure 1-1 The anterior foregut begins as a single epithelial tube surrounded by mesoderm. Early
specification of the future trachea and lungs is regulated by the dose and timing of several
transcription and growth factors. Key factors that play a role in early foregut to late proximal and
distal lung lineage specification have been listed under their corresponding stage. Certain
transcription factors such as NKX2-1 and growth factors such as FGF10, SHH and BMP have
been implicated in both early and lung epithelial specification.
Modified from Shojaie, S., et al, Fetal and Neonatal Physiology, 5th Edition, Ch 64 (2016)
11
Figure 1-2 Mature lung epithelial cell populations
Figure 1-2 The main epithelial cell populations of the lung are depicted in this schematic,
including the corresponding protein markers used for their identification. The proximal airway
lineage includes FOXJ1 and TUBB4A positive ciliated cells, ASCL1 and HES1 positive
pulmonary NE cells, TRP63 and KRT5 positive basal cells, and finally SCGB1A1 positive
secretory club cells. Submucosal glands are also found in the upper airways and harbour mucus-
producing goblet cells, not depicted in this schematic. The gas exchange distal region of the lung
is comprised of two types of epithelial cells, AT1 and AT2. Surfactant protein positive AT2 cells
are cuboidal in morphology, and PDPN and AQP5 positive AT1 cells are thin-walled and provide
the gas exchange surface of the alveoli.
Modified from Shojaie, S., et al, Fetal and Neonatal Physiology, 5th Edition, Ch 64 (2016)
12
1.2 Extracellular Matrix
1.2.1 Structural diversity of the ECM
During embryonic patterning individual cells divide, migrate, differentiate, and respond to
environmental cues. The ECM has been implicated in these dynamic processes during
development, maintenance and disease. Cells are continuously connected to the matrix, a
latticework of glycoproteins that in addition to providing structural support, directs tissue
morphogenesis. The ECM provides a specialized microenvironment and regulates cell behavior
by interacting with cell surface receptors. The largest family of receptors which mediate cell
adhesion to matrix proteins are known as integrins. There are several additional cellular receptors
that bind to different matrix components including the elastin receptor and other non-integrin
receptors that bind laminin and elastin83-85. This allows regulation of extracellular and
intracellular signaling emanating from extrinsic factors, including growth factors, hormones, and
biomechanical forces. Proteolysis of the ECM also generates neoepitopes that confer functions
on cells and tissues distinct from those specified by their nonproteolyzed counterparts86,87. To
decipher how the ECM confers numerous different functions, an appreciation of its complex
structure is essential. The ECM is an oligomeric, 3D network composed of four major protein
components: collagens, structural glycoproteins (e.g., fibronectin, laminin, tenascin-C),
proteoglycans (e.g., heparan sulfate (HS), chondroitin sulfate (CS), syndecans), and elastic fibers
(e.g., elastin, microfibrillar proteins)86,88. Matrix proteins are secreted by the epithelial and
stromal cells it surrounds89. Developmental processes including the response of unpatterned
tissue to morphogen gradients are regulated by glycosaminoglycans (GAGs), where the surface
of most cells and the ECM are decorated by HS proteoglycans90,91. These are multifunctional
proteins that engage in numerous cell-matrix interactions and function by binding and regulating
local concentrations of growth factors and morphogens92,93. Not every ECM network contains all
of these components, however, nor does the composition of the ECM remain constant within any
particular tissue. The distribution and organization of the ECM are both dynamic and tissue-
specific.
The distinct composition of the lung ECM gives the lungs their unique porous and elastic
properties. The basement membrane of endoderm-derived organs including the lung contain a
specialized ECM that is composed predominantly of laminin, type IV collagen, and heparan
sulfate proteoglycans94. Laminin is the first intercellular protein produced and has been shown to
13
play a role in numerous aspects of lung morphogenesis by mediating cell adhesion, proliferation,
and epithelial polarization during tubular formation95,96. There are 15 different laminin isoforms
and the embryonic lung has been shown to contain at least four different isoforms, each
potentially serving different functions in during development97,98. Varied laminin isoforms confer
heterogeneity and generate tissue-specific basement membranes, mainly due to variability in the
laminin α chains99. Fibronectin expression peaks during branching and plays a role in cleft
formation between daughter bud tips100, while elastin precursor, tropoelastin, expression is
highest at the peak of septation and is suggested to be a driving force in the maturation of the
alveolar gas exchange regions.
Within the ECM, additional structural and functional diversity is generated through the use of
alternative gene promoters and RNA splicing, and by posttranslational modifications, including
glycosylation and sulfation of newly synthesized matrix proteins101,102. Once secreted into the
extracellular space, ECM proteins require integration into a functional network. Identifying
binding partners for a specific ECM protein is therefore a prerequisite to ascertaining its
biochemical and cell-signaling properties. Accordingly, understanding the biology of a single
ECM component requires an appreciation of the structure and functions of numerous other
affiliated proteins. Due to the number of steps involved in coordinating ECM expression,
secretion, and assembly, deciphering how individual ECM proteins contribute to structural
morphogenesis during developmental processes has been a challenging task.
1.2.2 Multifunctionality of the ECM
Normal development requires precise temporal and spatial coordination of cellular proliferation,
migration, differentiation and programmed cell death (eg. apoptosis). Deciding which of these
programs a cell will ultimately elect is determined, to a large extent, by the ECM. Promotion or
suppression of cellular proliferation by the ECM results in either activation or silencing of genes
involved in the regulation of the cell cycle103-106. To counteract uncontrolled cellular proliferation
and to sculpt or refine developing tissue structures, select cells must be eliminated from
developing tissues. To this end, loss of cell contact with the ECM leads to apoptosis during
development and cellular differentiation107,108. Tissue-specific ECM components also regulate
the transcription of genes associated with specialized differentiated functions, including alkaline
phosphatase expression in osteoblasts, albumin production in hepatocytes, intermediate filament
14
protein expression in keratinocytes109,110 and cleft formation during branching of the developing
lung55.
Both mapping and identifying gene mutations that lead to heritable connective tissue disorders
and the generation of animal models in which ECM genes have been mutated or ablated have
been successfully used to ascertain the functions of individual ECM proteins within specific
tissues. Many of the diseases resulting from ECM gene mutations are due to the defective
structural integrity of specific tissues. There are numerous human diseases related to ECM
protein mutations. Mutations in collagen type VII, collagen type XVII and laminin 332 genes can
cause the skin-blistering disease Epidermolysis Bullosa111,112. Mutations in type I collagen genes
cause Osteogenesis Imperfecta113, and mutations in both collagen I and tenascin-X genes can
cause Ehlers-Danlos syndrome114. In addition to gene defects that alter mechanical properties of
the ECM, mutations in the fibrillin-1 gene that cause Marfan syndrome appear to increase TGF-
β signaling, leading to a cellular disease phenotype115.
Although mutations in ECM genes can produce heritable disorders, animal studies suggest that
many structural ECM glycoproteins are essential for embryonic or fetal development. As a result,
mutations in these genes often cause lethality early in development, complicating the study of
gene function in vivo. Inactivation of the fibronectin gene in mice, for example, results in
embryonic death due to mesodermal, neural tube and vascular developmental defects116, and has
been shown to be required for normal gastrulation117. More targeted studies have provided
information on the role of fibronectin in several developmental processes. Injection of inhibitory
peptides or antibodies into postgastrulation embryos prevents fibronectin-cellular interactions
and disrupts neural crest migration118.
An alternative approach to genetic manipulation for elucidating the role of matrix proteins during
various cellular processes is exposure to agents that perturb protein-cell interactions. Such agents
can include small molecules or protein-specific antibodies that will interfere with the matrix
protein function. Fibronectin-binding antibody or synthetic peptides have demonstrated the
importance of fibronectin-cell interactions during cell migration and normal heart development
in the chick heart119.
Genetic studies have also been useful in revealing unexpected functions for certain matrix
proteins. For instance, ablation of the elastin gene was predicted to cause structural defects in the
15
3D structure of blood vessels. Elastin-null animals, however, die within days of birth as a result
of obstructive arterial disease characterized by proliferation of the subendothelial smooth
muscle120. Thus, elastin exerts an unexpected growth inhibitory role during normal vascular
morphogenesis. Adult elastin haplo-insufficient mice are hypertensive, also as a result of
abnormal vascular development and remodeling121. Results from ECM-mutant animals therefore
demonstrate the important roles ECM components have in both development and in response to
injury.
1.2.3 Cell-matrix interactions via integrin receptors
Integrins are transmembrane receptors composed of 24 αβ heterodimeric members that link the
external ECM environment to the internal cell milieu. Integrin receptors respond to the molecular
composition and physical properties of the ECM and integrate both mechanical and chemical
signals through direct association with the cytoskeleton. The heterodimers are composed of non-
covalently associated 18 α and 8 β subunits122, with distinct protein functions. The α subunit
determines integrin ligand specificity and 9 of the integrin α chains contain an I domain with a
metal ion dependent adhesive site (MIDAS), which comprises the ligand-binding site. The β
subunit connects to the cytoskeleton and affects multiple signaling pathways.
Activation of integrins may stimulate the cell cycle, inhibit apoptosis and change the shape,
polarity and motility of the cell122. The extracellular domain binds to ECM ligands while the
cytoplasmic domain binds to adaptor proteins, mediating “outside-in” and “inside-out”
signaling123. During outside-in signalling, ligand binding leads to separation of the two legs,
allowing the β subunit cytoplasmic domain to bind intracellular proteins such as talin and
kindlins. An example of inside-out signaling is the intracellular activation of talin, leading to its
binding the β subunit and triggering the transition of the integrin heterodimer to a state with high
affinity for extracellular ligands124.
A number of integrins play central roles during fetal and embryonic development. Knockout mice
have been used extensively to elicit the role of integrins during the development of numerous
tissues. During vascular development, α5β1 integrins that recognise the Arg-Gly-Asp (RGD)
peptide motifs in fibronectin play a primary role125. Mutation of α5 leads to early embryonic
lethality due to mesodermal defects and poor vascularization of both the yolk sac and the
16
embryo126, while a β1 mutation manifests as gastrulation defects and pre-implantation
mortality127.
The role of integrins is slowly being uncovered during lung development. The αvβ6 integrin
recognises the latency associated peptide (LAP) that non-covalently binds TGFβ, keeping it from
binding to its receptor. Binding of αvβ6 to TGFβ-LAP, results in the dissociation of the complex
and activation of TGFβ receptors on epithelial cells and alveolar macrophages, leading to
suppression of inflammation. β6 deficient mice develop progressive pulmonary inflammation,
resulting in emphysema128. Re-expression of β6 rescues the pulmonary inflammation
pathology129. Integrin α8β1 is another integrin shown to play a role in lung development. The
integrin α8 deficient mice develop fusion of the medial and caudal lobes of the lung as well as
abnormalities in airway division130. Mice lacking the α3 subunit manifests in lung and kidney
malformations due to aberrant branching morphogenesis131.
The cytoplasmic domain of the integrin does not possess catalytic activity, and therefore specific
adaptors are recruited to the plasma membrane and contribute to signaling events. This is termed
the integrin adhesome and consists of over 232 components that are divided into intrinsic and
transiently associated components. Some of the adhesome molecules are involved in the physical
linking of integrins to the actin cytoskeleton, whereas others are involved in adhesion-mediated
signalling, which affects multiple cellular downstream targets132 (Figure 1-3). This complex
promotes the recruitment and activation of several protein kinases such as focal adhesion kinase
(FAK) and SRC, leading to the activation pathways involving ERK, Jun N-terminal kinase (JNK)
or RHO-family small GTPases. These signalling events are crucial for cellular migration,
proliferation, survival and gene expression133.
There is specificity in the interaction of distinct integrins with regards to their ECM ligands. For
example, certain integrins recognize specific ECM proteins, including fibronectin, vitronectin,
and tenascin-C, which contain a small tripeptide sequence designated RGD. By contrast, β4
integrins interacting with α3-, α6-, and α7-subunits recognize laminins, whereas integrins
composed of the β1-integrin subunit and the α1, α2, α10, or α11 subunit bind collagen123. This
apparent redundancy in ligand binding specificity suggests that integrins might have overlapping
functions.
17
The ECM can function as an organizing centre for signaling complexes comprised of matrix
proteins, secreted or matrix-bound growth factors and their receptors on the cell surface.
Integrins activate several signaling pathways independently, but can also act synergistically with
growth factor receptors. They can activate a latent growth factor by inducing conformational
changes or by presenting it to a protease. Growth factor stimulation can activate FAK, indicating
that integrin and growth factor signaling pathways intersect at focal adhesions (Figure 1-3)134.
Various extracellular growth factors regulate cell migration and dynamics by means of integrin-
mediated signaling. Consistent with this notion, integrin clustering promotes recruitment and
activation of growth-factor receptors within focal adhesion complexes.
1.2.4 Matrix Metalloproteinases
Matrix metalloproteinases (MMP) are a family of 24 proteins, where 6 are associated with cell
membranes or protein transmembrane domains and the remaining are secreted135. Cell-associated
MMPs are responsible for the majority of ECM degradation activity. They are highly regulated
to preserve the integrity of tissues136. ECM remodelling is an important mechanism whereby cell
differentiation can be regulated, including processes such as the establishment and maintenance
of branching morphogenesis and stem cell niches. In the mouse, MMP2, MMP14, and an MMP
inducer, CD147, are constitutively expressed in all five distinct stages of lung development137. In
one model of branching morphogenesis, cleft formation is suggested to be driven by
accumulation of TGFβ, which stimulates ECM deposition and directs branching to either side of
the accumulated ECM. This process is facilitated by TGFβ-mediated inhibition of MMPs. In
support of this hypothesis, TGFβ1 and TGFβ3 inhibit expression of MMP1 and upregulate
expression of TIMP1 in fibroblasts89.
1.2.5 Biomechanical forces and the ECM
The developing embryo is exposed to mechanical forces that maintain and modify cell behavior.
Integrins can serve as mechanoreceptors that transmit forces between the cytoskeleton and the
ECM to maintain structural integrity of tissues138. The majority of integrin-mediated attachments
between ECM fibers and resting cells are to a bundle of actin filaments in the focal adhesion
(FA)139. FAs modulate cellular responses to control proliferation, cytoskeletal remodelling and
migration of cells140.
18
Cells respond to force on integrin-mediated adhesions by remodelling the ECM. For example,
cyclic stretching of fibroblasts and other cell types activates expression of genes for collagens,
fibronectin, and metalloproteinases, and stretched cells assemble a dense ECM that is enriched
in collagen141. Matrix assembly usually occurs in a directional manner according to the applied
force142. Application of force to integrin α5β1 is required for conversion to a state that can be
chemically cross-linked to the fibronectin beneath the cell. Inhibition of cell contractility blocks
cross-linking but can be rescued by application of force from fluid shear stress143. In early
lymphangiogenesis, interstitial fluid pressure stretches lymphatic endothelial cells which
stimulates integrin-dependent proliferation, expanding the lymphatics144.
The idea that integrins detect biomechanical signals is further supported by the finding that FAK
is involved in mechanosensing during cell migration145. Biomechanical force also modulates the
expression and activities of ECM components and proteases including tenascin-C and MMP2,
positive regulators of angiogenesis146. Collectively, these studies indicate that not only do
biomechanical signals influence the ECM and its receptors, but also downstream signals
generated by mechanical force modulate cell adhesion components. Additional studies are clearly
needed to determine how local force differentials modulate cell behavior within the developing
embryo.
1.2.6 Stem cell-matrix interactions
Stem cell maintenance, self-renewal, and cell fate determination in stem cell populations is
depend on the ECM147-150. Matrix-mediated changes in cell adhesion of hematopoietic stem cells
(HSC) in their microenvironment, for example, allows for the self-renewal and subsequent
differentiation of these multipotent progenitors into blood and other cell types151. Therefore
precise cell-matrix interactions act as an important biological switch that dictates stem cell
differentiation or mobilization at specific tissue sites during development and maintenance of
early and adult stem cell populations. Despite overwhelming evidence for the importance of cell-
matrix interactions during development, the molecular mechanisms underlying the cross-talk
between cells and the surrounding matrix and the role each component plays in specification
along the proximal-distal axis of the lung remains largely unknown.
19
Figure 1-3 Relay of ECM and GF signaling through cell surface integrin receptors
Figure 1-3 Tissue stiffness and matrix composition initiate specific signaling pathways that
regulate cell behaviour. The selection of integrins expressed on the cell surface specifies the
signaling pathway due to the differential binding affinity of ECM ligands for integrin receptors.
Integrins, via their cytoplasmic domain, recruit specific adaptor proteins to the plasma
membrane. This in turn can regulate GF receptor signaling. Integrins colocalize at focal adhesion
sites with growth factor receptors and their associated signaling molecules, in response to GF
stimulation. Associated signaling molecules include Src and FAK, as well as cytoskeletal
molecules such as paxillin, talin, and vinculin. ECM, extracellular matrix; GF, growth factor.
Modified from Shojaie, S., et al, Fetal and Neonatal Physiology, 5th Edition, Ch 5 (2016)
20
1.3 Stem Cells
1.3.1 Stem cell characteristics
Stem cells are undifferentiated cell types that have the capability to self-renew and differentiate
into multiple lineages. During homeostasis, stem cells are typically slow-cycling or quiescent.
However, with environmental stimulation, such as tissue damage, stem cells can proliferate
rapidly and give rise to daughter cells referred to as transient amplifying cells. These daughter
cells will continue to proliferate and generate the necessary specialized progenies for tissue repair
and maintenance. Stem cells can undergo symmetric or asymmetric cell division. Symmetric
division gives rise to two identical daughter cells, while in asymmetric division one daughter cell
loses some parental stem cell characteristics and becomes more committed to a specific cell
lineage. A progenitor cell refers to a pluripotent cell that has more limited differentiation potential
and unlike stem cells do not have unlimited self-renewal capabilities.
Historically, stem cells were believed to receive regulatory cues from other cells in the local
environment, defined as the stem cell niche205. Recent studies have shown evidence that some
differentiated progeny of stem cells can themselves contribute to the niche and provide regulatory
feedback to their stem cell parents206. For example, differentiated macrophages in the
hematopoietic system, can home back to the bone marrow and regulate the maintenance of
hematopoietic stem cells in the niche by promoting retention or enhancing their egress into the
bloodstream207.
There is a hierarchy to stem cell differentiation potential. Totipotent cells have the ability to give
rise to all cell types in the body, including the placenta and germ cells. These are the most
primitive cells and exist only in the initial cell divisions after fertilization. The descendents of
totipotent cells are pluripotent cells found in the inner cell mass of the blastocyst. These cells
give rise to embryonic stem cells that can differentiate to every cell type of all germ layers.
Multipotent cells are stem cells with yet more restricted differentiation ability than pluripotent
cells. As stem cell progeny become more committed, the potential to give rise to various cell
lineages becomes more restricted. Eventually leading to unipotency, where a unipotent
progenitor cell can differentiate into one other cell type.
Despite the classical belief that unipotent cells can only give rise to a particular lineage, there is
a growing body of evidence supporting the concept that cells committed to one lineage can in
21
fact give rise to cells outside of their lineage tree. For example, bone marrow stromal cells have
been successfully differentiated to endodermal hepatocytes, mesodermal cardiomyocytes and
ectodermal neuronal cells208-210.
1.3.2 Types of stem cells
1.3.2.1 Embryonic stem cells
Embryonic stem cells are pluripotent cells that can give rise to the three germ layers endoderm,
mesoderm and ectoderm. They are derived from the inner cell mass of a blastocyst within the
first 5-7 days after fertilization211. ESCs transiently exist in the embryo and can be isolated and
maintained in an undifferentiated state indefinitely under pluripotent culture conditions212. There
are several pluripotency markers associated with ESCs including POU domain, class 5
transcription factor 1 (POU5F1) (also known as OCT4), SSEA-1 and NANOG homeobox213.
1.3.2.2 Adult stem cells
Adult stem cells are a diverse group of multipotent cells that reside in stem cell niches across
various tissue types. They have been found in many tissue types including the brain, heart and
lungs, spurring a lot of excitement for their potential use in transplants and regenerative cell
therapy. Most populations have limited differentiation potential to some or all cells of their origin
tissue.
The bone marrow is an abundant source of adult stem cell types with three distinct populations
characterized to date: HSCs, MSCs, and bone marrow-derived tissue committed stem cells. HSCs
are found in the bone marrow and to a lesser extent in peripheral blood and express an array of
markers such as FLK2, SCA1 and c-KIT214. The second bone marrow stem cell population is the
MSC population which can be isolated and maintained in vitro to divide indefinitely. MSCs
express three distinct surface markers (CD73, CD90, CD105) and subpopulations of MSCs have
been described with differing proliferative and morphological characteristics215,216.
The third group of HSC refers to tissue-specific progenitor cells that have been identified in the
bone marrow, often expressing the chemokine (C-X-C motif) receptor 4 (CXCR4). Accounts of
bone marrow cells expressing other tissue-specific markers have been reported217-220.
22
Apart from the bone marrow, there are many accounts of tissue-specific progenitor cell types,
including the lungs. These cells are thought to reside in specific sites (the stem cell niche) and
can remain quiescent until needed for tissue maintenance and response to disease or injury.
1.3.2.3 Perinatal tissue stem cells
The placenta and cord blood are both rich sources of hematopoietic progenitor and HSCs, capable
of differentiating to all blood cell types221. In addition to HSCs, placental tissue is enriched in
MSCs, with multi-lineage differentiation capability222. Human placental MSCs have been
isolated, amplified and differentiated successfully in vitro to different cell types. Other
pluripotent populations successfully isolated from perinatal tissue include amniotic fluid and fetal
membrane stem cells. With successful ex vivo expansion, these populations offer a renewable
stem cell source for regenerative medicine therapeutics.
1.3.2.4 Induced pluripotent stem cells
Adult somatic cells can be genetically reprogrammed to an embryonic stem cell-like state and
are referred to as iPSC. Both mouse and human iPSC have demonstrated pluripotent stem cell
characteristics including the expression of stem cell markers and the ability to give rise to all
three germ layers. This discovery originally demonstrated that fibroblasts could become
pluripotent by viral overexpression of four transcription factors, OCT4, SOX2, cMYC, and
Kruppel-like factor 4 (KLF4) using retroviral transduction223,224.
Since then, numerous methods have been developed to generate iPSCs with increased efficiency
and footprint-free of any viral vector integration. Advances in reprogramming somatic cells have
employed the use of single cassette reprogramming vectors with Cre-Lox mediated transgene
excision225,226, and nonintegrating adenoviruses, although with lower efficiencies227,228. A
collection of nonviral reprogramming techniques have also emerged that use mRNA transfection,
episomal plasmids, and PiggyBac transposon-mediated gene transfer to induce pluripotency229-
232. Selecting the best reprogramming method for producing iPSCs is contingent on the adult cells
being reprogrammed and their downstream application. The use of iPSCs for long-term
translational medicine requires complete footprint-free techniques, regardless of the induced cell
type. Beyond personalized medicine aspirations, iPSC technology is a valuable resource for using
patient cells in disease modeling and drug screening techniques.
23
1.3.3 Adult lung stem cells
Despite low cell turnover in the adult lung, resident epithelial stem cell populations have been
identified that can undergo long-term self-renewal and give rise to different cell types during
homeostatic turnover or injury. Lung stem cell populations range from morphologically naïve
(basal cells) to fully differentiated cells with specialized functions (club cells and AT2 cells).
Lineage tracing techniques have allowed for the investigation of cell phenotype plasticity and
identified several epithelial stem and progenitor lineages in different regions of the adult lung.
1.3.3.1 Proximal airway epithelium
Basal cells in the pseudostratified mucociliary epithelium are morphologically simple cells that
characteristically express TRP63, cytokeratin 5 (KRT5) and cytokeratin 14 (KRT14)62,233,234. In
vivo lineage tracing experiments and injury models have shown that basal cells can undergo long-
term self-renewal and give rise to ciliated and secretory luminal cells during development,
homeostasis and repair. Basal cells are a heterogeneous cell population with variable expression
profiles for KRT5, KRT14, PDPN, and nerve growth factor receptor (NGFR), leading to many
questions regarding their full regenerative capacity. For instance, it is unclear whether
TRP63/KRT5 positive basal cells are all multipotent or if there are subsets with this capability.
This was sparked by the observation that KRT14 expression is upregulated in most KRT5
positive basal cells during repair, suggesting that KRT14 negative basal cells could remain
quiescent235,236.
A recent model of airway basal cell progenitor activity demonstrates that basal cells relay a
forward signal to their progeny, necessary for maintaining their phenotype237. Using a series of
cell ablation and lineage tracing techniques, it was shown that airway basal cells supply a
NOTCH ligand to their daughter cells to maintain a secretory cells phenotype. Without this
forward signal, secretory cells execute a terminal differentiation program and convert into
ciliated cells. Interestingly, one group has suggested the ability of TRP63/KRT5 positive basal
cells to replace alveolar epithelia following H1N1 influenza infection238. Additional clonal
lineage-tracing experiments under both steady-state and reparative conditions are required to
understand the differentiation capability and precise mechanism by which basal cells
differentiate.
24
1.3.3.2 Distal airway epithelium
Using injury models to deplete select epithelial populations, a subset of secretory cells with
progenitor properties were identified and referred to as variant club cells. This subset of the club
cell population expresses SCGB1A1 but not cytochrome p450 (CYP2F2) and were unharmed
from naphthalene-induced injury to the airways239,240. Lineage tracing studies have shown that
SCGB1A1 positive, CYP2F2 negative club cells self-renew and differentiate to secretory and
ciliated cell progeny under both homeostatic turnover and following injury241. Variant club cells
are known to cluster at transition points between the bronchiolar and alveolar regions, referred
to as the bronchoalveolar duct junction (BADJ). This region considered to be a lung stem cell
niche, as another stem cell population referred to as the bronchioalveolar stem cell (BASC) has
been found to reside in this region. BASC cells coexpress markers of both the secretory cells and
AT2 cells, SCGB1A1 and SFTPC respectively242,243. The ability of this population to give rise to
both bronchiolar and alveolar epithelium has been demonstrated both in vivo following
bleomycin-induced injury and in vitro after clonal expansion.
1.3.3.3 Distal alveolar epithelium
AT2 cells are the main stem cell population in adult alveoli. There is overwhelming evidence
that during late development and following injury AT2 cells have the ability to proliferate and
differentiate into AT1 cells. This has been demonstrated using thymidine labeling studies,
immunostaining for proliferative markers and transgenic lineage tagging67,244,245.
Recent evidence has emerged for the existence of additional alveolar stem cells beyond AT2
cells. One example is the KRT14/TRP63 positive basal cells, typically not found in the alveoli,
which have been shown to differentiate to AT1 cells expressing PDPN, but not AT2 cells, in
response to severe H1N1-induced injury238. However, this study did not induce lineage tracing
of the KRT14 positive cells until after initiation of injury, limiting interpretation of the in
vivo differentiation potential of the cells. Another example of an alternative alveolar stem cell
population was identified using flow cytometry to isolate epithelial cells coexpressing the α6 and
β4 integrins without expression of SCGB1A1 or SFTPC246. This progenitor population expands
rapidly in response to lung injury and shows notable multipotent differentiation potential to
airway and alveolar epithelial lineages. Numerous methods for ex vivo clonal expansion of AT2
and other adult lung stem cell types are being developed and their success holds great promise
for cell-based regenerative medicine therapies.
25
1.4 Tissue decellularization
1.4.1 Overview
Decellularization refers to the complete removal of cells and debris from tissue and organs, whilst
preserving the 3D structure, biochemical composition, and biological activity of the tissue ECM.
The goal of decellularization is to maintain the native ECM structural proteins as well as the
GAGs and proteoglycan composition to preserve the cues necessary for cells to thrive following
repopulation of scaffolds in culture. The earliest attempts of decellularizing organs began in the
1970s using various techniques to isolate the ECM from livers, lungs, and kidneys177-179. Both
physical and chemical treatments were used to remove the donor cells and to study the impact of
the remaining matrix proteins on primary cell behaviour in culture. These early studies
demonstrate that basement membrane from different organs exert varying influences on the
morphology and function of seeded cell types.
Over the last decade, interest in using decellularized organs has grown as the innate capacity of
the ECM to better mimic the in vivo environment of different organs is being realized. Natural
scaffolds present numerous advantages over traditional culture conditions including 3D growth
surface, tissue and site-specific cues, better cell survival and adherence, and biocompatibility for
transplantation. By removing immunogenic components, minimizing immune rejection and the
need for immunosuppressive drugs, if done successfully the use of decellularized scaffolds for
tissue engineering presents several advantages over the use of allogenic and xenogeneic
transplant options180.
1.4.2 Decellularization methodologies
Many approaches exist to tissue decellularization from treatments using physical manipulation,
to enzymatic agents, to chemical agents. Most techniques use a combination of treatments with
varying intensities and delivery methods, depending on the mechanical and biological
properties of the tissue. Therefore no ideal decellularization agent exists for all tissue types and
protocols may vary for the same tissue depending on the intended use following ECM isolation.
1.4.2.1 Physical agents
Physical methods aim to lyse and remove cells from the matrix through the use of temperature,
force and pressure. Freeze-thaw cycles disrupt cellular integrity, show limited structural
26
disruption to the ECM, and can minimize the use of chemical treatments181. Cytoprotectants such
as trehalose have been used to limit damage to tissue architecture182. Other physical treatments
use pressure, sonication and electroporation, although sonication and electroporation have been
found to cause disruption to the ECM of aortic tissues183,184.
1.4.2.2 Enzymatic agents
Enzymatic agents commonly used for decellularization include proteases (eg. trypsin, dispases),
esterases (eg. phospholipase A2), and nucleases (eg. DNase and RNase). The use of biologic
agents is advantageous due to their specificity for biologic substrates. Trypsin has been shown to
effectively cleave cell adherent proteins in treated tissue, however prolonged exposure resulted
in damage to ECM collagen fibers185,186. Endonucleases such as DNase and RNase are often used
with or after other decellularization techniques to remove residual DNA from lysed cells187.
Enzyme deactivation due to the presence of natural protease inhibitors released from lysed cells
can be ameliorated by refreshing enzyme solutions periodically or by using protease inhibitors
such as aprotinin188.
1.4.2.3 Chemical agents
Chemical treatments using alcohols, acids, alkalis, detergents and non-isotonic solutions are
common candidates used for tissue decellularization. Although treatment with alcohol such as
methanol and ethanol will remove cellular components by replacing intracellular water and lysing
the cells by dehydration, alcohol alters matrix protein structure and elasticity by crosslinking the
ECM189,190. Similarly, acids and alkali effectively solubilize cytoplasmic components and remove
nuclear material, however not without the catalysis of biomolecules and depletion of matrix
proteins, GAGs and growth factors191,192. Therefore, of the chemical agents used in
decellularization, limited success has been reported with alcohols, acids and alkalis, and recent
protocols have shifted towards the use of detergents.
Ionic, non-ionic and zwitterionic detergents have been used across all tissue types for
decellularization. Ionic detergents such as sodium dodecyl sulfate (SDS), sodium deoxycholate,
and Triton X-200 are commonly used decellularization agents due to their effective ability to
solubilize cytoplasmic membranes, lipids, and nuclear components180,193. Ionic detergents are
strong and frequently used to denature and unravel proteins for polyacrylamide gel
electrophoresis, and therefore will disrupt protein covalent bonds and deplete certain ECM
27
proteins during decellularization. SDS has been found to denature collagen, reduce GAGs by
50%, and significantly reduce ECM growth factor content172,191. Ionic detergents can also be
difficult to remove from the remaining matrix and if left behind can affect cytocompatibility.
Therefore protocols using ionic detergents tend to limit the exposure to multiple washes at low
concentration, low durations and reduced temperatures.
Non-ionic detergents (eg. Triton X-100, Tween 20, octyl glucoside) are considered to be gentle
detergents that can solubilize proteins without major disruption to the native protein structure and
enzymatic activity. Success of non-ionic detergents in decellularization protocols has been
variable across tissue types, likely due to the difference in tissue density and cellularity173,194,195.
Contradicting results have been reported for decellularization of porcine versus rat aortic tissue
using Triton X-100, highlighting the variability seen across tissue sources and delivery
methods196,197. Several studies have identified non-ionic detergents as the preferred method for
preserving the basement membrane components following decellularization of ligament and
porcine urinary bladder tissue198,199.
Zwitterionic detergents have a net zero electrical charge and therefore do not disrupt the native
state of proteins during treatments. Two commonly used zwitterionic detergents used in tissue
decellularization are 3-[(3-cholamidopropyl) dimethylammonio]-1-proppanesulfonate (CHAPS)
and sulfobetaine-10 (SB-10). Multiple groups have shown that CHAPS preserves GAGs and
elastin during decellularization of pulmonary tissue while still removing 95% of nuclear
material174,200. One study has surprisingly reported collagen disruption in bladder tissue following
CHAPS treatment, while non-ionic detergents Triton X-100 and ionic detergent sodium
deoxycholate showed less disruption199.
Ethylenediaminetetraacetic acid (EDTA) and ethylene glycol tetraacetic acid (EGTA) are
chelating agents that bind divalent metal cations at cell-adhesion sites of the ECM and effectively
cause cell dissociation. These agents are very commonly used with other enzymatic agents or
detergents to enhance decellularization and ensure complete removal of cellular
components175,194,201.
1.4.3 Cytocompatibility and immunogenicity
To ensure viability of the remaining tissue following decellularization, scaffolds will need to be
cytocompatible for repopulation and biocompatible for transplantation. The presence of residual
28
decellularizing agents, particularly ionic detergents, has been shown to cause severe cellular
toxicity and prevent optimal, if any, cellular adherence and growth on scaffolds194,202. Optimal
washing of decellularized scaffolds will need to be verified to ensure that remaining scaffolds do
not contain high concentrations of toxic decellularizing agents. Biocompatibility is dependent on
removal of all antigenic material including residual DNA from lysed donor cells and the alpha-
Gal epitope expressed on most xenogeneic mammalian tissues203,204. Complete decellularization
can be assessed using quantitative assays for DNA and alpha-Gal removal, and certify
biocompatibility.
1.5 Regenerative Medicine
Regenerative medicine refers to the study and application of innovative approaches in tissue
engineering and molecular biology to repair and replace cells, tissues and organs. Despite
advances in critical care medicine and interventional therapies, there is an immediate need for
alternative options for the repair and replacement of lung tissue apart from lung transplantation.
Two major aims of research in regenerative medicine are to understand the underlying repair
mechanisms within tissues to better target and promote healthy regeneration, and secondly to
develop cell therapy techniques that can harness the repair and replacement potential of
exogenous stem cells. Regenerative medicine holds huge potential for the development of such
novel therapies using directed differentiation techniques to generate functional proximal airway
and distal alveolar epithelial cells.
1.5.1 Stem cells in regenerative medicine
Stem cells continue to receive a lot of attention in regenerative medicine due to their ability to
directly contribute to different cell lineages or to create a pro-regenerative milieu for local
progenitor cells to start the repair process152,153 (see section 1.5). As our understanding of stem
cell biology and tissue repair mechanisms improves, so does the ability to create a
microenvironment that recapitulates developmental processes and lineage specification. Stem
cell niches are tissue-specific environments where stem cells reside. Recreating these niche
environments allows us to regulate proliferation and differentiation into specific daughter cells154.
A key strategy is to transplant stem cells or their differentiated derivatives as therapy. An
alternative to cell transplantation is to promote tissue-resident stem cells to regenerate by
manipulating their microenvironment in vivo. Targeted activation of endogenous stem cells
29
requires an understanding of the molecular pathways that normally control stem cell function and
how those signals might have changed in the setting to injury or disease. Regenerative medicine
is a highly multi-discipline field and requires efforts from stem cell biologists, developmental
biologist, tissue repair experts and clinicians to name a few. Despite challenges, headways have
been made in creating functional tissue using stem cells. Some examples outside of the lung
include insulin producing islet cells for treatment of type I diabetes155, repair of cardiac tissue
following myocardial infarction156, and oligodendrocyte precursor cell regeneration for
developing remyelination therapies in multiple sclerosis157.
1.5.2 Cell therapy
Cell therapy refers to the use of cells as treatment in the clinic and is typically administered to a
patient through an injection. In addition to the use of HSC transplantation for the treatment of
cancers of the blood or bone marrow, currently the main candidates for cell therapy applications
involve bone marrow cells (BMC) and bone marrow stromal cells, also referred to as
mesenchymal stem cells (MSC). BMCs and MSCs are readily harvested from donors and patients
for use in allogeneic and autologous therapies. So far, both cell types have shown good safety
profiles in human clinical trials. There is a substantial amount of evidence showing the ability of
MSCs to suppress inflammation and activate endogenous repair mechanisms through indirect
effects on immune cells and tissue-specific stem cells158,159. Other studies however have shown
that administered MSCs can only persist for short periods in the body160,161.
Recent success with stem cell research has opened the door to the potential use of stem cells as
therapy. The use of embryonic stem cells (ESCs) and somatic cells that are induced to a
pluripotent state (iPSC) continues to be explored. This is due to in vitro scalability and multi-
differentiation abilities of pluripotent stem cells. ESC-derived cell therapy applications include
clinical trials for Parkinson disease, spinal cord injury, macular degeneration, diabetes, and heart
disease162-164, while iPSCs have been used in one human experimental procedure for macular
degeneration in Japan. Cell-based gene therapy is another feature to cell therapy that promises
the use of a host’s own cells, after genetic manipulations, to deliver a therapeutic protein or DNA
to the patient165. This can be achieved by replacing a malfunctioning gene within the cells affected
by the condition. Due to the host’s own cells being used as the vehicle for gene delivery, this
technique circumvents immunological barriers often associated with viral-based vectors. Recent
30
milestones reached in HIV treatment using ex vivo gene therapy approaches is an example of the
promise this technique holds for the future166.
Although the promise of using stem cells seems favourable for the near future, many questions
remain as to the feasibility of such techniques today. Cell distribution, survival, function and
overall clinical benefit in each unique disease setting must be understood. Due to outstanding
questions, safety precautions, and regulatory barriers widespread availability of stem cell-based
cell therapies are at least a few years away.
1.5.3 Stem cell tissue engineering
Tissue engineering is a branch of regenerative medicine that combines cells with scaffolds and
biologically active molecules to generate functional tissues. The goal of tissue engineering is to
assemble tissue constructs that can restore, maintain, or improve impaired tissue or whole organs.
Artificial skin and cartilage are examples of engineered tissue that have been approved by the
FDA, although with limited use in human patients today167. Success in tissue engineering relies
on our understanding of how individual cells respond to signals, other cell types and surrounding
matrix to organize into tissues and organisms. As discussed in section 1.2, in addition to structural
support, the molecular components of ECM have a profound effect on the biology of stem cells
in regulating quiescence, proliferation, and cell fate. Therefore, a key step in creating artificial
tissue is selecting a scaffold that can best create the environment required for the target cell types
to thrive. Substrate stiffness and elasticity are two ECM parameters that have been used to
demonstrate this importance on cell behavior and stem cell fate. Collagen coated substrates that
are relatively stiff promote maximal cell spreading and drive enrichment of focal adhesions and
in turn assembly of a cytoskeleton with stress fiber components, while culture of cells on soft
gels promotes formation of a diffuse and less organized cytoskeleton168.
Scaffolds can be generated using a wide array of sources including proteins, plastics, and natural
organs. Novel approaches to tissue engineering using three-dimensional (3D) printing to print
scaffolds with high-precision deposition of proteins show promise in generating custom tissue-
specific scaffolds. Printed scaffolds lack the complexity of natural ECM, but show promise in
generating simple scaffold models of liver, kidney, and bone169,170.
Tissue decellularization is the process of removing donor cells from organs and maintaining the
ECM as scaffold for repopulation with cells for tissue engineering (see section 1.4). It is not
31
surprising that complex 3D matrices are increasingly used in vitro to replace traditional two-
dimensional cultures for recapitulation of tissue-specific microenvironments and directing
differentiation of stem cells. Scaffolds are often supplemented with cocktails of cytokines and
growth factors to promote tissue development. The use of existing scaffolds by decellularizing
donor organs has been reported for bioengineering of numerous mesenchymal and endoderm-
derived organs such as heart, liver, kidney and lung tissues171-176. This approach holds great
promise for using scaffolds from large animal donors such as porcine and sheep or
cadaveric/discarded human tissue and combining it with a patient’s own cells to make customized
tissue constructs or organs. If successful, these bioengineered organs would be available in
abundance compared to viable donor organs for transplantation, and would not be rejected by the
patient’s immune system.
32
1.6 Hypothesis and Objectives
Introduction
This thesis describes the role of the lung extracellular matrix in stem cell-derived endoderm lung
epithelial differentiation. The major goals of the research were: (1) To establish an in vitro
scaffold culture system using decellularized lung, suited for the study of lung cell-matrix
interactions, and (2) To characterize the potential of the lung ECM to promote differentiation of
seeded stem cell-derived endoderm to mature, functional airway epithelia.
The signaling components required for lung specification of progenitor cells requires, in addition
to growth factors, a 3D matrix setting that can recapitulate the right microenvironment and
mediate the interaction of the cells with the surrounding milieu. Human and animal studies have
shown that pluripotent stem cells respond to environmental cues and can differentiate into the
lung lineage. However, the reported efficiencies have been low and differentiated cell
functionality has been limited. Furthermore, the ECM has rarely been incorporated as a key
differentiation factor in promoting lung epithelial cell fate.
Hypothesis
Decellularized lung scaffolds support lung lineage differentiation of embryonic stem cell-derived
endodermal cells.
Objectives
1. To develop a decellularization protocol that isolates an intact 3-dimensional extracellular
matrix lung scaffold to support epithelial cell culture
2. To determine whether decellularized lung scaffolds can support the differentiation of stem
cell-derived endodermal cells to lung progenitor cells
3. To characterize the multi-differentiation potential of seeded endodermal cells driven by
decellularized lung scaffolds
Chapter 2
Generation and characterization of decellularized lung
scaffolds for embryonic stem cell differentiation
2
34
2.1 Rationale
Cell adherence, proliferation, gene expression and differentiation are strongly influenced by
matrix composition and structure. The development of matrices that can recapitulate the in vivo
environment is key for directing lineage-specific differentiation. Synthetic and simple scaffold
substitutes cannot recapitulate native tissue-specific ECM, while decellularized tissues have been
shown to better capture this environment. We attempted to generate decellularized lung and
characterize its ability to support extended culture of primary lung epithelial cells, and potentially
provide a platform for lung-lineage stem cell differentiation.
Objective of the study: To develop a decellularization protocol that generates lung scaffolds
capable of supporting lung epithelial cell culture.
Summary of Results: Decellularization was carried out using three different agents: enzymatic
treatment with trypsin, chemical treatments with CHAPS or SDS detergents. Large variability
was found in the extent of cell removal and structural changes of the lung ECM. CHAPS was
selected as the best decellularizing agent and the solution was further optimized with the addition
of hypertonicity and chelating agent EDTA. Removal of all resident cells was confirmed by tissue
staining, electron microscopy (EM) and DNA analysis. Immunofluorescent (IF) confocal
analysis, Western blot (WB) analysis, EM, and tensile testing confirmed preservation of ECM
ultrastructure and protein composition. Recellularization of scaffolds with primary fetal rat lung
epithelial cells resulted in cell adherence and formation of structures reminiscent of epithelial
cells during early development. After 21 days of culture, recellularization of scaffolds led to re-
establishment of epithelial structures positive for distal cells expressing cytokeratin 18 (KRT18)
and pSFTPC and proximal cells expressing SCGB1A1 and TUBB4A.
Conclusions: The present study identifies an efficient and effective protocol to generate
decellularized lung scaffolds that can support lung epithelial cell culture and could potentially be
used to study stem cell differentiation towards the lung lineage.
35
2.2 Introduction
Regenerative medicine has become one of the major frontiers in the treatment of diseased tissues,
and its progress is in large due to the rapid recognition of the potential for stem cells as therapeutic
options. The use of stem cells in lung engineering has generated wide enthusiasm, however the
actual development of functional lung tissue with pluripotent cells has been limited. Growth
factor and matrix requirements for driving stem cell populations to differentiate into lung cell
lineages with high efficiency are not well understood, and this is one of the major challenges of
engineering lung tissue. The interaction of stem cells with the surrounding matrix environment
is crucial for cell fate. Cell adherence, proliferation, migration, gene expression and
differentiation are strongly influenced by matrix composition and structure148,247. The
development of matrices that can recapitulate the in vivo environment is a key component for
directing stem cell differentiation.
One of the most challenging aspects of lung tissue engineering is creating an artificial matrix that
has similar biological composition and physiological functions to native lung tissue.
Recapitulating an ECM that supports immunity, the mechanical function of breathing and the
physiology of gas exchange certainly make this a complex task. The lung ECM is comprised of
various collagen proteins that are associated with matrix components such as laminin, elastin,
fibronectin, and proteoglycans, within a 3D ultrastructure that give the lung its distinct elastic
and porous properties248. Polymers and biomaterials such as Matrigel, Gelfoam, and collagen
have been used as matrix substitutes for cell culture, however none have been successful in
reproducing the complexity of the lung ECM180,249,250.
There is a substantial amount of evidence suggesting that decellularized donor organs can be used
as the ideal scaffolds for tissue engineering. These scaffolds can provide the appropriate 3D
microenvironment for organ-specific differentiation251-253. The use of scaffolds developed from
decellularized tissue has been reported for the trachea in humans, and for the heart, liver, kidney,
and lungs in rodents171,172,175,176,254. In the case of lungs, decellularized rat tissue was successfully
repopulated with primary lung epithelial and endothelial cells and the engineered lobe was
capable of gas exchange for seven hours following orthotopic transplantation175,176. This
demonstrates the feasibility of this approach for ex vivo lung tissue development using acellular
lung scaffolds repopulated with stem cell-derived lung progenitor cells or fully differentiated
lung epithelial cells. The ability to scale up lung scaffold production using human cadaveric or
36
xenogeneic sources could expand the therapeutic options available for lung tissue replacement.
Such scaffolds can be seeded with cells derived from the patient’s own autologous cells to
generate new segments of functional lung tissue or for processing and repopulating lungs
marginally unsuitable for transplantation.
The decellularization process must effectively remove all immunogenic cellular components
while preserving the natural composition and ultrastructure of the ECM. No universal
decellularization protocol is available that results in the complete removal of cellular
components, preserves the ECM and also can support stem cell culture for lung lineage
specification. This chapter compares the efficacy of three decellularizing agents on rodent lung
tissue and the optimal decellularization technique is identified. The resultant scaffold is
characterized and demonstrated to support extended culture of primary lung epithelial cells.
2.3 Materials and Methods
Decellularization
All animal experiments were approved and carried out in accordance with the animal care
committee guidelines of the Hospital for Sick Children Research Institute. To start
decellularization, the lungs were accessed by opening the thoracic cavity using a median
sternotomy. A small incision was made through diaphragm to cause the lungs to retract, reducing
the chance of damaging the tissue. The inferior vena cava was ligated with a suture and a small
incision was made in the left atrium to commence perfusion. The lungs were perfused through
the right ventricle using heparinized Hank’s balanced salt solution (HBSS)- solution to facilitate
removal of blood. Following perfusion, the trachea was exposed, separated from the esophagus,
and cannulated with a plastic catheter near the thyroid cartilage. Using a gravity perfusion setup
at 20cm of H2O, lavages were carried out with different decellularization solutions. The lungs
were filled to total lung capacity for one minute followed by removal of the catheter from the
trachea to allow the fluid to flow out of the lungs. This was repeated for eight cycles, followed
by 10 rinses with PBS.
Decellularization was attempted using six variations of decellularization solutions (Table 2-1).
The lungs were decellularized with sequential tracheal lavages with decellularization solution,
followed by extensive rinsing with phosphate buffered saline (PBS) (10-15 lavages). Lungs were
37
then removed from the animal and exposed to 90U/ml Benzonase endonuclease (Novagen,
70664-3) for 12 hours while on a rotator at room temperature to remove cellular components.
Scaffolds were then treated with antimicrobial agents, 200U/mL penicillin streptomycin
(Pen/Strep) (Gibco, 15140) and 25μg/mL amphotericin B (Gibco, 15290) for 6 hours at room
temperature to prepare for recellularization. Thick vibratome sections (Leica) of acellular lung
were generated at approximately 350μm and conditioned with culture media prior to
recellularization.
Isolation of primary fetal rat lung epithelial cells
Time pregnant Wistar rats were euthanized by an excess of carbon dioxide on day 19 of gestation.
Fetal lungs were dissected and excess adherent tissues were removed. The lungs were rinsed
twice in cold HBSS and transferred to a glass petridish. The lungs were minced into very fine
pieces, washed twice with HBSS, and centrifuged at 100xg for one minute. The lung tissue was
trypsinized with 0.125% Trypsin (v/v) (GIBCO), 0.002% DNAse (w/v) (Worthington) in HBSS,
in a trypsinizing flask under constant stirring for 20 minutes in a 37°C water bath. After
trypsinization, the cells were neutralized in Minimum essential medium (MEM) + 5% (v/v) fetal
bovine serum (FBS) (with 50μg/mL gentamycin) and then centrifuged in a 50 mL centrifuge tube
at 450g for 5 minutes. The cell pellet was resuspended in 30 mL of MEM + 0.1% (w/v)
collagenase and incubated for 15 minutes in a 37°C water bath. An equal amount of MEM + 5%
FBS was added to the cell suspension and centrifuged at 450g for 5 minutes. The cell pellet was
resuspended in MEM + 5% FBS and seeded into 75-cm2 tissue culture flasks (15mL per flask)
and incubated for one hr in 5% CO2 incubator at 37°C to allow fibroblast cells to adhere. After
this incubation period, the floating cells from the flasks were transferred to a 50mL tube and the
flasks were washed with MEM to collect all floating cells. The collected cells were centrifuged
at 450g for 5 minutes, and then reseeded into a second set of 75-cm2 tissue culture flasks (15mL
per flask) and incubated for one hr in 5% CO2 incubator at 37°C to allow the remaining fibroblast
cells to adhere. The floating cells were collected as before and centrifuged at 450g for 5 minutes.
The collected cells were resuspended in 35mL MEM and washed 4 times by centrifugation (200g
for 3 minutes) and resuspension. After the final wash, cells were resuspended in MEM + 5 %
FBS and seeded into 75-cm2 tissue culture flasks (approximately 10mL per flask) and placed in
the 5% CO2 incubator at 37°C to allow the epithelial cells to adhere overnight. After 24 hrs of
isolation, the epithelial cells were trypsinized and seeded onto decellularized lung scaffolds.
38
Recellularization of thick scaffold sections
Thick sections of decellularized lung were transferred to Nucleopore hydrophobic floating
membranes (8μm pore size, Whatman, 110614) and seeded with 100,000 cells/section primary
rat E19 epithelial cells and maintained for up to 21 days using MEM+10% FBS (v/v). Media was
changed every 48 hours for up to 21 days.
DNA Assay
DNA was extracted from decellularized lung scaffolds using a chloroform/phenol extraction
method. DNA was measured by ultraviolet (UV) absorbance at 260nm in microplates using a
SpectraMax Absorbance Microplate Reader equipped with SoftMax Pro Data Acquisition &
Analysis software.
Tensile Testing
Natural and decellularized sections of lung underwent tensile testing using Mach-1 Motion setup
and software (Biosyntech). Sample sections (1-2cm2 cross-sectional area and 500μm thick) were
stretched until break point to assess the ultimate tensile strength, represented by stress-strain
curves.
Histological Analysis
Cell-scaffold cultures were fixed in 4% (w/v) paraformaldehyde (PFA) (w/v) at 4°C for 8 hours.
Samples were paraffin embedded and sectioned at 5μm. Sections were rehydrated and standard
hematoxylin and eosin staining and Hart’s elastin stain was performed.
Immunostaining
Cell-scaffold cultures were fixed in 4% (w/v) PFA at 4°C for 8 hours. Samples were paraffin
embedded and sectioned at 5μm. Sections were rehydrated and heat-induced epitope retrieval
with citrate buffer (pH 6.0) was performed. Slides were then blocked for one hour with 5% (v/v)
normal donkey serum and 1% (w/v) bovine serum albumin (BSA) (w/v) in PBS for 1 hour at
room temperature. Samples were then incubated with primary antibodies at 4°C overnight in
humidified chamber, and detected using Alexa Fluor conjugated secondary antibodies
(Invitrogen) for one hour at room temperature. Nuclei were counterstained using 4',6-diamidino-
39
2-phenylindole (DAPI) (Invitrogen). Details of antibodies are provided in the Table 2-1. Images
were captured with Leica CTRMIC 6000 confocal microscope and Hamamatsu C910013
spinning disc camera (Leica Microsystems Inc.), and analyzed with Volocity software
(PerkinElmer).
Immunoblot Analysis
Fifty μg of solubilized extracellular matrix supernatant in radioimmunoprecipitation assay
(RIPA) buffer, and 1μg of purified laminin protein as positive control, were separated on a 5%
(w/v) SDS-polyacrylamide gel electrophoresis (PAGE) gel. Proteins were transferred to
nitrocellulose paper (Millipore) and blocked with 3% (v/v) milk in PBS plus 0.1% (v/v) Tween-
20. The membranes were then incubated overnight at 4°C with anti-laminin antibody (Table 2-
2) at 1:1000 dilution in 1% (v/v) PBS-milk containing 0.2% (v/v) Tween-20. Blots were then
incubated for 1 hour with secondary antibody conjugated with peroxidase, and were developed
using chemiluminescent substrates (PerkinElmer) according to the manufacturer’s instructions
and imaged on X-ray film.
Electron Microscope Analysis
Samples were fixed in 2.5% (v/v) glutaraldehyde in 0.1M phosphate buffer pH7.4. Transmission
EM specimens were post-fixed in 1% (w/v) osmium tetroxide, dehydrated in an ascending series
of acetone, infiltrated and embedded in Epon Araldite prior to polymerization at 60° C overnight.
Ultrathin sections were then cut and mounted on grids, and stained with uranyl acetate and lead
citrate prior to microscopy (JEOL, JEM1011) and image acquisition was completed using a CCD
camera (AMT corp.). Scanning EM samples were post-fixed in osmium tetroxide, dehydrated in
an ascending series of ethanol and critical point dried. Samples were then mounted on aluminum
stubs using double-sided carbon tape. Samples were rendered conductive with a thin coat of gold
palladium using a sputter coater and examined and photographed in a field emission scanning
EM (JEOL, JSM 6700F).
Statistical Analysis
Statistical comparisons were performed using unpaired t-tests. P-value of 0.05 or less was
considered significant.
40
Table 2-1 Decellularization Solutions
Decellularization Solution Components Buffer Total
Lavages
1 Trypsin 0.1% (v/v) trypsin PBS 10
2 SDS 0.1% (v/v) SDS PBS 10
3 CHAPS 8mM (w/v) CHAPS PBS 10
4 CHAPS with EDTA 8mM (w/v) CHAPS 25mM
(w/v) EDTA
PBS
with 1M NaCl 8
5 CHAPS with EDTA 16mM (w/v) CHAPS 25mM
(w/v) EDTA
PBS
with 1M NaCl 8
6 CHAPS with EDTA 16mM (w/v) CHAPS 50mM
(w/v) EDTA
PBS
with 1M NaCl 8
Table 2-2 Antibody List
Target Host, Conjugation Company Catalogue
Number
Application,
Dilution
Primary Antibodies
Collagen I Rabbit, non-conjugated Abcam ab34710 IF, 1:200
Collagen IV Rabbit, non-conjugated Abcam ab6586 IF, 1:200
Fibronectin Rabbit, non-conjugated Abcam ab23750 IF, 1:200
HSPG Rat, non-conjugated Abcam ab2501 IF, 1:100
pan-KRT Rabbit, non-conjugated DAKO ZO622 IF, 1:800
KRT18 Rabbit, non-conjugated Abcam ab53280 IF, 1:1000
Laminin Rabbit, non-conjugated Novus
Biologicals NB300-144
IF, 1:200
WB, 1:1000
SCGB1A1 Goat, non-conjugated Santa Cruz sc-9772 IF, 1:1000
TUBB4A Mouse, non-conjugated BioGenex MU178-UC IF, 1:500
VIM Mouse, non-conjugated DAKO M072529 IF, 1:100
Secondary Antibodies
Goat IgG Donkey, Alexa Fluor 647 Invitrogen A-31573 1:200
Goat IgG Donkey, Alexa Fluor 488 Invitrogen A-21202 1:200
Mouse IgG Donkey, Alexa Fluor 488 Invitrogen A-11055 1:200
Rabbit IgG Donkey, Alexa Fluor 546 Invitrogen A-11056 1:200
Rat IgG Goat, Alexa Fluor 488 Invitrogen A-11006 1:200
41
2.4 Results
Hypertonic CHAPS-based solution is the best candidate for rodent lung decellularization
To evaluate the decellularization efficacy of commonly used agents on lung tissue we subjected
adult mouse and rat lungs to three different treatments: (1) enzymatic treatment with trypsin, (2)
chemical treatment with zwitterionic detergent CHAPS, and (3) chemical treatment with ionic
detergent SDS. Decellularization was administered using a three step approach by first perfusing
the lungs to remove blood, followed by treatment with the decellularizing agent through
sequential airway lavages, and finally by extensive rinsing of tissue with PBS.
Following decellularization, the lungs were dissected from the neck and chest cavity and
processed to examine the extent of decellularization. Hematoxylin and eosin (H&E) staining and
DAPI fluorescent staining of tissue sections was used to analyze removal of resident cells and
gross structural integrity of the remaining ECM (Figure 2-1). All decellularizing agents were
prepared in PBS solution and PBS-only treated lungs were used as control for comparison.
Treatment with 0.1% (v/v) trypsin had a modest disruptive effect on cell lysis and removal from
the tissue, as intact nuclei were observed both with the H&E stain and DAPI stain on histological
sections. Treatment with 8mM (w/v) CHAPS or 0.1% (w/v) SDS was more effective at removing
resident cells, although with varying consequence to the tissue structure. Despite effective
removal of cells, large cavities and tear-like structures were found following SDS treatment,
while treatment with CHAPS was consistently best in preserving the gross structure of the
remaining ECM. Based on these results, CHAPS detergent was selected as the base for further
optimization of lung decellularization.
Although treatment of lung tissue with CHAPS alone was effective at removing most resident
cells, to achieve complete decellularization with tissue devoid of all cellular components several
variations to the CHAPS solution were tested for optimization. Due to the ability of hypertonic
solutions to aid in removal of cellular components with minimal disruption to the ECM188, the
decellularization solutions were prepared and tested using a hypertonic PBS buffer containing1M
NaCl. Chelating agent EDTA was also added at 25mM or 50mM concentration and CHAPS was
tested at 8mM or 16mM concentration (Figure 2-2).
42
Based on histological analysis, the optimal decellularization solution for adult mouse and rat lung
tissue was identified as 8mM CHAPS, 25mM EDTA and 1M NaCl. In the interest of matrix
preservation, the higher concentration 16mM CHAPS with 50mM EDTA was not selected as the
lower solution was sufficient for achieving complete decellularization. Following
decellularization the lung scaffolds were treated with Benzonase nuclease to remove remnant
cellular components from the lysed cells. Scaffolds were then treated with an antimicrobial
cocktail for decontamination prior to use in any cell culture experiments (Figure 2-3).
43
Figure 2-1 Adult rat lungs are best decellularized using zwitterionic detergent CHAPS in
comparison to treatment with trypsin and ionic detergent SDS
Figure 2-1 Tissue sections from adult rat lungs following decellularization. H&E staining (left
panel) and DAPI fluorescent staining (right panel) are used to visualize the extend of cellular
removal and gross tissue integrity. Decellularized tissues were compared to PBS-treated controls
(top panel). Treatment with 0.1% (v/v) trypsin did not achieve sufficient decellularization as cell
nuclei were still intact, while both 8mM (w/v) CHAPS and 0.1% (w/v) SDS were more effective
at removing resident cells. Trypsin and SDS treatment both caused damage to overall tissue
structure (arrow heads), while CHAPS treatment best preserved tissue structure. All images are
at 200x magnification.
PBS Control
0.1% Trypsin
8mM CHAPS
0.1% SDS
H&E DAPI
44
Figure 2-2 Hypertonic CHAPS-based decellularization solution with the addition of EDTA
effectively removes all donor cells while preserving the ECM
Figure 2-2 Tissue sections from adult rat lungs following decellularization compared to PBS-
treated controls (top panel). H&E staining (left panel) and DAPI fluorescent staining (right panel)
are used to visualize the extend of cellular removal and gross tissue integrity. All combinations
of the CHAPS and EDTA decellularization solution were effective at removing cellular
components as apparent by the lack of intact nuclei in the stained tissue sections. Treatment with
the lowest concentration combination of 8mM CHAPS and 25mM EDTA was sufficient at
removing resident cells (middle panel). All images are at 400x magnification.
H&E DAPI
PBS Control
8mM CHAPS
8mM CHAPS
25mM EDTA
8mM CHAPS
50mM EDTA
16mM CHAPS
25mM EDTA
45
Figure 2-3 Decellularized lung scaffolds undergo endonuclease and antimicrobial agent
treatment prior to recellularization
Figure 2-3 Photographic representation of a natural lung (left panel) and an acellular lung (right
panel) following decellularization with CHAPS-based solution. Two additional treatment steps
for cell culture preparation are specified: Benzonase nuclease treatment, followed by
antimicrobial agents.
Natural
lung
Decellularized
lung
Tissue perfusion
Decellularization solution8mM CHAPS, 25mM EDTA, 1M NaCl
PBS rinse
Benzonase nuclease
Antimicrobial agents
Recellularization
46
Decellularization protocol preserves the lung ultrastructure and matrix protein
composition
The lung scaffolds were characterized further for their structure and composition following
decellularization. Benzonase treatment was highly effective at removing remnant nuclear
components. Histological analysis showed no positive DAPI staining, while DNA analysis
showed less than 20ng/mL of DNA remaining on the decellularized scaffolds (Figure 2-4).
Electron microscopy, tensile testing and tissue staining for matrix proteins were carried out to
confirm ECM integrity.
High-magnification scanning EM analysis of scaffolds confirmed the absence of host cells on
treated scaffolds (Figure 2-5A). EM micrographs also revealed that the ultrastructure of the
alveolar septae and the delicate microvessels surrounding the alveoli were maintained. Tensile
testing analysis was used to compare the mechanical properties of decellularized scaffolds with
natural lung. The stress-strain plot from the analysis showed a similar tensile strength profile
between the two tissues, although as expected decellularized scaffolds had lower peak strength
(Figure 2-5B). Preserved matrix protein composition was confirmed using IF staining and
confocal microscopy for collagen I, collagen IV, laminin, HS proteoglycans, and fibronectin
(Figure 2-6A). Elastin protein was visualized using Hart’s elastin stain and found intact at the
alveolar septa and tips of decellularized scaffolds (Figure 2-6B).
Laminin is a large trimeric glycoprotein that is a major component of the basement
membrane. It is important for branching morphogenesis, cell adherence and epithelial cell
function97. Close characterization of laminin protein on decellularized scaffolds was carried
out using Western blot analysis and immunogold labelling for TEM analysis (Figure 2-7).
Laminin was found preserved on decellularized scaffolds after 10 rinses and was detected by
gold staining lining the remaining basement membrane on scaffolds.
47
Figure 2-4 Decellularization procedure with endonuclease treatment completely removes
all cellular components
Figure 2-4 (A) Corresponding H&E and DAPI staining of natural and acellular lung tissue
sections show the absence of cellular material including nuclei following decellularization. Scale
bars=50μm. (B) Removal of DNA following Benzonase treatment of decellularized scaffolds
was confirmed with DNA measurement. Mean ± SEM, n=3, *p<0.01.
48
Figure 2-5 Lung scaffolds maintain their architectural structure and strength following
decellularization
Figure 2-5 (A) Scanning electron microscope analysis following decellularization show the
surface of acellular lung scaffolds with intact matrix architecture. Scale bar=100μm, scale bar of
inset=10μm. (B) Tensile testing represented by stress versus strain plots of natural and
decellularized scaffolds characterizes mechanical properties of scaffolds. Acellular scaffolds
have a similar tensile strength curve profile, although with a lower overall peak strength, to
natural lungs.
49
Figure 2-6 Major ECM proteins including basement membrane components and elastin
are detected by immuno-staining on decellularized scaffolds
Figure 2-6 (A) Natural (top panel) and acellular lungs (lower panel) were examined for ECM
protein composition. Immunostaining shows presence of intact collagen I (Col-I), collagen IV
(Col-IV), laminin (Lmn), heparan sulfate proteoglycans (HSPG), and fibronectin (Fn), while
DAPI staining is absent from decellularized tissue. Scale bars=25μm. (B) Hart’s elastin stain
shows intact elastin fibers in scaffolds following decellularization. Scale bar=25μm.
50
Figure 2-7 Basement membrane protein laminin is maintained on decellularized scaffolds
Figure 2-7 (A) Immunoblot analysis for basement membrane-protein laminin following 5, 10,
and 20 washes after decellularization shows that scaffolds maintain laminin protein composition
for up to 10 rinses. Ponceau stain was used as loading control; presented Ponceau positive band
is 50kDa. (B) Transmission EM analysis shows decellularized scaffolds with positive
immunogold staining for laminin (black arrowheads). Scale bar=500nm.
51
Decellularized scaffolds support primary lung epithelial cell adherence and phenotype
To determine whether decellularized lung scaffolds could be used for cell culture studies, primary
fetal rat lung epithelial cells were isolated and used to assess cell adherence, organization and
phenotype on the scaffolds. To setup cell-matrix cultures, thick sections of rat lung scaffolds
were generated and seeded directly with freshly isolated primary lung epithelial cells. To better
recapitulate the lung microenvironment, cultures were seeded and kept at air liquid interface
(ALI) for up to three weeks in supportive media (Figure 2-8A).
Decellularized lungs were kept in cold PBS for a maximum of one week following antimicrobial
treatment. To generate thick sections of scaffolds, individual lobes were embedded in low melting
point agarose and sectioned completely with a vibratome to generate 350μm thick segments of
decellularized tissue. Each lung section was placed on a hydrophobic floating membrane to create
ALI. Lung epithelial cells were spun down and resuspended in a small volume of culture media
and seeded directly onto each section.
Seeded primary cells successfully repopulated the scaffolds. Several cell densities ranging from
104 to 106 cells per scaffold culture were tested. The optimal cell density that resulted in
significant recellularization with optimal organization was identified as 100,000 cells per scaffold
segment. Tissue analysis of day 21 cultures showed pKRT+ epithelial cells that had organized
into tubular structures (Figure 2-8B). Despite enriching for epithelial cells by selectively
removing fibroblasts during isolation and plating, cells expressing mesenchymal marker
vimentin (VIM)+ were found in cell-matrix cultures. Epithelial structures expressing either distal
or proximal markers were identified (Figure 2-9). Distal lung epithelial cell markers KRT18 and
proSFTPC were detected, while other regions expressed proximal lung epithelial cell markers
SCGB1A1 and TUBB4A. Primary cells isolated from their in vivo environment often lose their
phenotype after a short period in culture, however seeded cells were able to maintain their
differentiated state following 21 days of in vitro culture on lung scaffolds.
52
Figure 2-8 Lung scaffolds support primary rat embryonic epithelial cell adherence and
organization
Figure 2-8 (A) Schematic representation of recellularization setup. Isolated primary rat fetal
(E19) epithelial cells are seeded on thick sections (350μm) of acellular lung scaffold and cultured
on a floating hydrophobic polycarbonate membrane to achieve an air-liquid interface. Cultures
were maintained up to 21 days. (B) Tissue sections of day 21 cell-matrix cultures with H&E
staining (left image) and IF staining (right image) for pKRT, and mesenchymal cell marker VIM.
Tissue sections show recellularization of scaffolds with primary cells and organization of pKRT+
epithelial cells into tubular structures. Both images at 200x magnification.
53
Figure 2-9 Primary embryonic rat epithelial cells maintain lung airway and alveolar
phenotype on scaffolds
Figure 2-9 Immunofluorescent staining and confocal analysis of tissue sections from day 21 cell-
matrix cultures. Epithelial structures express markers of both distal alveolar lineage and proximal
airway lineage. The two left images show KRT18+ and pSFTPC+ alveolar epithelial cells, while
the two right images show SCGB1A1+ and TUBB4A+ airway epithelial cells.
KRT18 DAPI TUBB4A DAPIpSFTPC DAPI SCGB1A1 DAPI
54
2.5 Discussion
Cell therapy and tissue engineering applications in the lung have been limited compared to other
organs. Efforts in lung regeneration have focused on the use of artificial scaffolds and simple
two-dimensional culture systems. Such approaches can capture certain microscopic features of
the airway and alveolar architecture, but have not produced matrices that can support lung lineage
differentiation and tissue that is capable of lung function255,256. Use of decellularized scaffolds
for tissue replacement in the respiratory system was first described in 2008 using a decellularized
human donor trachea, seeded with epithelial cells and MSCs derived from the recipient254. This
and other proof of concept studies demonstrate the feasibility of using acellular lungs for tissue
regeneration and replacement175,176.
The present study assessed the feasibility of generating decellularized lung scaffolds with the
ability to support lung epithelial cell culture, and potentially provide a platform for lung-lineage
stem cell differentiation. Decellularization was carried out using three different agents:
enzymatic treatment with trypsin, chemical treatments with CHAPS, and SDS detergents. Large
variability was found in the extent of cell removal and structural changes to the lung ECM.
Although trypsin has shown promising results in decellularization of heart tissue for aortic valve
tissue engineering, it had limited success in this setting with modest removal of resident lung
cells and a disruptive effect to the ECM187,257. Ionic detergent SDS is one the most widely used
decellularizing agents, however it proved to be too harsh and therefore inferior to the milder
zwitterionic detergent CHAPS for achieving optimal lung decellularization. These observations
highlight the importance of identifying and optimizing a tissue-specific protocol. Due to tissue
differences in cell density and matrix composition, there is no universal method for
decellularization of all organs. Although removal of resident cells from different types of tissues
can be a relatively easy task, generating viable tissue scaffolds notably requires the more complex
task of preserving the extracellular matrix. The ultrastructure of the matrix, specific ECM
proteins and matrix bound growth factors may provide site-specific cues for progenitor cells,
therefore it is important to develop a protocol that best preserves this environment. The end-goal
of generating decellularized lung tissue is to obtain a native-like scaffold for repopulation with
mature lung cells or their precursors. Partial cell removal, significant disruption to the ECM or
incomplete removal of decellularizing agents after treatment will undoubtedly hinder any further
application of scaffolds for cell culture and tissue engineering.
55
Following histological analysis of treated lungs, CHAPS was selected as the best decellularizing
agent and the solution was further optimized with the addition of hypertonicity and chelating
agent EDTA. Removal of all resident cells was confirmed by tissue staining and DNA analysis.
Scanning EM micrographs confirmed that despite complete decellularization, the ECM
ultrastructure of the large airways, vessels and alveolar regions were kept intact. Immunostaining
for major matrix proteins confirmed that collagen I, collagen IV, laminin, fibronectin and HS
proteoglycans were intact on scaffolds. The number of lavages during decellularization, however,
was found to affect the amount of protein left intact. Basement membrane protein laminin was
found to decrease with increased number of lavages, therefore 10 was set as the limit in the
protocol to minimize ECM disruption. Biomechanical integrity of the matrix was assessed by
tensile testing, and surprisingly despite removal of cellular components the tensile strength
curves of natural and decellularized lung had comparable curve profiles, although an average of
22% reduction in peak tensile strength was measured for the acellular tissue.
Other published work have also identified CHAPS to be the best reagent for generating
decellularized lung scaffolds175,176. In previous studies, lungs were decellularized after complete
removal from the animal, using a bioreactor to continuously circulate large volumes of
decellularizing agents for several hours. In this study, rapid decellularization was achieved in
approximately 20 minutes using short tracheal lavages with the lungs remaining in situ.
To test biocompatibility of the scaffolds generated using this protocol, we attempted to
recellularize lung scaffolds with primary rat fetal lung epithelial cells. Thick sections of scaffolds
were generated and seeded directly with freshly-isolated primary cells. Cells were seeded and
maintained at air liquid interface to better mimic the lung environment. This approach allowed
us to setup cell-matrix cultures consistently between batches and monitor cell adherence, survival
and phenotype on scaffolds with varying cell densities and culture durations. We observed that
within seven days of culture, seeded cells engrafted on scaffolds and started to form structures
reminiscent of lung epithelial cells during early development. Most importantly after 21 days of
culture, recellularization of scaffolds led to reestablishment of both proximal and distal epithelial
cell populations. Interestingly, epithelial structures were formed with either distal cells
expressing KRT18 and pSFTPC, or proximal cells expressing SCGB1A1 and TUBB4A. No
tubular structures were identified that contained both airway and alveolar epithelial cells types.
This suggests that although lung scaffolds support both populations, region-specific differences
56
are created during cell-matrix culture favoring one population over the other. Despite the
difficulty of culturing such cells in standard conditions in vitro, seeded pulmonary epithelial cells
thrived on scaffolds258.
We have demonstrated that lung scaffolds generated by this protocol can be used in an in vitro
culture system that supports primary rat fetal lung epithelial cells. Decellularized scaffolds are
suitable for lung epithelial cell culture, suggesting that this environment may be poised for
promoting lung lineage specification of progenitor cells.
57
Chapter 3
Early differentiation of stem cell-derived endoderm to basal
cells on decellularized lung scaffolds
58
3
3.1 Rationale
In Chapter 2, we found that decellularized lung scaffolds can support primary lung epithelial cells
phenotypes for extended periods in culture. This generated the hypothesis that there may be site-
specific cues on lung scaffolds that can support the adherence of stem cell-derived endodermal
cells and create an environment that better mimics the lung micro-environment during
development in comparison to two-dimensional in vitro cultures.
Objective of study: To determine whether decellularized lung scaffolds can support and promote
the culture and differentiation of stem cell-derived endodermal cells.
Results: Recellularization of lung scaffolds with sorted mouse ESC-derived endoderm resulted
in engraftment and broad repopulation of scaffolds. Seeded cells organized and differentiated to
NKX2-1+/SOX2+ proximal airway progenitor cells. Heterogeneous basal cell populations
expressing an array of basal cell markers (TRP63, KRT5, KRT14, PDPN, NGFR) emerge as
early as 4 days of culture on scaffolds. The basal cell population drops gradually with longer
culture durations. This occurs in parallel with an increase in apoptotic activity and a decrease in
proliferation. Individual matrix proteins, matrix substitute Matrigel, and decellularized kidney
scaffolds did not support differentiation of seeded endoderm to the lung lineage.
Conclusions: Decellularized lung scaffolds support ESC-derived endoderm and promote
differentiation to airway progenitor cells. The initial abundance of heterogeneous basal cells
followed by a gradual reduction in this population suggests that basal cells may be precursors to
other emerging lung epithelial cells on the scaffold.
59
3.2 Introduction
Recellularization of lung scaffolds has been attempted with numerous cell types including
epithelial cell lines (A549 or C10), endothelial cells, MSCs, and lung cell digests175,176,259,260.
These studies have achieved success in creating rudimentary “lung equivalents” with partial
function and are bringing us closer to generating viable grafts for tissue replacements. Some
studies have engineered lungs using decellularized scaffolds seeded with primary epithelial and
endothelial cells for transplantation. These engineered lungs were grafted into
pneumonectomized adult rats and showed partial gas exchange capability for short periods in
vivo175,176.
Although these proof-of-concept studies show promise for lung tissue regeneration, future
application of a decellularization strategy requires a renewable, autologous source of pulmonary
epithelium for repopulation of scaffolds. Resident lung stem cells or iPSCs are candidates that
could be used for this purpose. Lineage restriction of pluripotent stem cells is a dynamic process
mediated by many environmental components that include growth factors, cell-matrix
interactions, cell-cell signaling, and mechanical forces88,148. The interaction of the ECM with
stem cell populations and the role of the ECM in promoting tissue-specific lineage restriction is
not entirely understood. Several studies have attempted to promote differentiation of embryonic
and induced pluripotent stem cells to lung epithelial cells with the addition of soluble growth
factors in monolayer cultures261-267. Repopulation of decellularized scaffolds has been used as
an end-point assay in some of these studies, to assess the regenerative potential of the pre-
differentiated cells261,263-265. No reports have assessed the inductive capacity of the lung ECM
alone during early lung specification. The capacity of decellularized lung scaffolds to promote
differentiation to a lung epithelial phenotype and the feasibility to use this as a natural scaffold
for the development of functional lung tissue using pluripotent cells are important questions that
remain unanswered.
Chapter 2 demonstrated the capacity of lung scaffolds for supporting and maintaining
primary lung epithelial phenotypes. In this study, we examine the consequence of culturing
ESC-derived endoderm on decellularized scaffolds in supportive media, without the addition
of inductive growth factors. Early differentiation of seeded cells is characterized for
formation of epithelial structures and upregulation of lung progenitor markers.
60
Differentiation of endoderm on lung scaffolds is also compared to culture on other matrix
protein substitutes.
3.3 Materials and Methods
ESC culture and endoderm induction
Mouse ESC lines (R1 (Nkx2-1mCherry)268, G4 (dsRed-MST), and129/Ola (Bry-GFP/Foxa2-
hCD4) were maintained below passage 40, in the pluripotent state under feeder-free, serum-free
culture using two-inhibitor (2i) conditions269. Endoderm induction was achieved using a four day
embryoid body (EB) culture method with activin A treatment using serum-free differentiation
medium (SFDM)270. Single cells were seeded at a 20,000 cells/ml density in low adherent plates
(Nunc, Roskilde, Denmark) to allow for EB formation for 48 hours. Day 2 EBs were collected
and reseeded at 1:2 density in SFDM supplemented with 50ng/ml activin A for an additional 48
hours. Day 4 EBs were harvested and sorted by fluorescence activated cell sorting for Kit
oncogene (cKIT)+ and CXCR4+ cells representing definitive endoderm.
Anterior endoderm was generated for use in real-time (RT) polymerase chain reaction (PCR) as
a control. Anteriorization was achieved by seeding sorted definitive endoderm cells as a
monolayer on gelatin coated 6-well plates in SFDM supplemented with 10μM SB431542 (Sigma,
431542) and 100ng/ml NOGGIN (R&D Systems, 1967-NV/CF) for 24hours. Anteriorization
was confirmed using RT-PCR analysis showing a reduction in Forkhead box A3 (FOXA3)
expression (posterior endoderm).
Decellularization and recellularization
For a detailed description of decellularized scaffold generation for stem cell culture, please refer
to section 2.3. In summary: rat lungs were decellularized using a CHAPS-based decellularization
solution followed by a rapid wash and decontamination protocol to remove cellular material.
Thick sections (350μM) of lung scaffolds were generated using a vibratome and placed on
hydrophobic floating membranes in culture (Whatman #110614) to achieve ALI culture
conditions. Scaffolds were seeded with 100,000 sorted definitive endoderm cells
(cKIT+/CXCR4+) and maintained for up to 21 days using SFDM, with no additional growth
factor supplementation.
61
Flow cytometry and cell sorting
For definitive endoderm, day 4 EBs were dissociated using TrypLE express (Gibco), for 3
minutes at 37°C. Single cell suspensions were labeled with cKIT and CXCR4 antibodies (Table
3-2) in sort buffer (HBSS- supplemented with 2% (v/v) fetal bovine serum and 10mM 4-(2-
hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) buffer) for 20 minutes on ice. Cells
were sorted using AriaII-GC (BD Biosciences) and data analysis was carried out using Diva (BD
Biosciences) and FlowJo (TreeStar) software.
For identification of mcherry positive cells differentiated on scaffolds, day 7, 14, and 21
cultures were dissociated to isolate seeded cells for flow cytometric quantification. Cell-scaffold
tissue cultures were incubated in an elastase solution (1mg/mL elastase in SFDM with 2% FBS,
at 37°C for 30 minutes. Tissue was spun to remove elastase, and placed in FBS with 2.5% (v/v)
DNAse and minced for one minute at 4°C, followed by vigorous shaking for 2 minutes to aid in
releasing of cells. SFDM was added to mixture, and minced tissue was filtered using a pre-wetted
20μm nylon mesh filter. Cellular recovery using this method were as follows, day 7 cultures:
3.63x105 ± 1.1x104 (n=3), day 14 cultures: 4.55x105 ± 5.3x104 (n=3), day 21 cultures: 9.43x105
± 1.9x104 (n=3). Cells were collected into Sort Buffer and analyzed for mcherry expression using
a MoFlo (Beckman Coulter) apparatus and Diva (BD Biosciences) software.
Kidney scaffold decellularization
Adult mouse kidneys were sectioned to 1000μm using a vibratome (Leica). Sections were soaked
in 0.1% (w/v) SDS using a peristaltic pump supplying fresh SDS at a flow rate range of 0.4-0.8
rpm for 72 hours. Decellularized kidney scaffolds were soaked in 100x pen/strep for 1 hour to
remove any contaminates. Scaffolds were then washed with PBS and SFDM prior to seeding
with sorted cKIT+/CXCR4+ endodermal cells.
Endoderm culture on isolated matrix proteins
Sorted endodermal cells were seeded onto isolate matrix proteins and cultured under the same
conditions as with seeded lung scaffolds in SFDM, at air liquid interface using the hydrophobic
floating membranes (Whatman, 110614). Matrix proteins used include mouse laminin (BD,
354232), human fibronectin (BD, 356008), rat-tail collagen I (BD, 356236), and mouse collagen
62
IV (BD, 354233). Matrix proteins were diluted to 10μg/mL and applied to the floating
membranes prior to seeding with endoderm. For Matrigel (BD, 356230), a thick coat (200μl) was
placed on floating membranes and allowed to gel prior to seeding with endoderm.
Real time quantitative PCR
RNA was extracted from cell-scaffold cultures using PicoPure RNA Isolation Kit (Life
Technologies), and cDNA synthesis was carried out with 1μg of RNA using SuperScript III
Reverse Transcriptase (Invitrogen), according to the manufacturer’s protocol. Ten micrograms
of template cDNA was used for real-time PCR (40 cycles of amplification) using SYBR GreenER
quantitative PCR (qPCR) SuperMix with murine specific primer sets (Table 3-1). Analysis was
performed using StepOnePlus qPCR (Applied Biosystems). Gene expression was normalized to
RNA Polymerase II and expressed relative to selected positive (adult tissue, E13 lung) or negative
controls (definitive endoderm).
Histological analysis
Cell-scaffold cultures were fixed in 4% (w/v) PFA at 4°C for 8 hours. Samples were paraffin
embedded and sectioned at 5μm. Slides were rehydrated and standard hematoxylin and eosin
staining was performed.
Immunostaining
Cell-scaffold cultures were fixed in 4% (w/v) PFA at 4°C for 8 hours. Samples were paraffin
embedded and sectioned at 5μm. Sample sections were rehydrated and heat-induced epitope
retrieval with citrate buffer was performed. Slides were then blocked for one hour with 5% (v/v)
normal donkey serum and 1% (w/v) BSA in PBS for 1 hour at room temperature. Samples were
then incubated with primary antibodies at 4°C overnight in humidified chamber, and detected
using Alexa Fluor conjugated secondary antibodies (Invitrogen) for one hour at room
temperature. Nuclei were counterstained using DAPI (Invitrogen). Details of antibodies are
provided in Table 3-2. Images were captured with Leica CTRMIC 6000 confocal microscope
and Hamamatsu C910013 spinning disc camera (Leica Microsystems Inc.), and analyzed with
Volocity software (PerkinElmer).
63
For immunohistochemical staining for Ki67, sections were rehydrated and heat-induced antigen
retrieval with citrate buffer was performed. Sections were immunostained for Ki67 expression
using a standard procedure with a Ki67 primary antibody diluted in blocking buffer and incubated
overnight at 4°C in humidified chamber. Slides were washed thoroughly with PBS and primary
antibody was detected using biotinylated rabbit anti-rat secondary antibody (Jackson
ImmunoResearch) diluted 1:200, followed by ABC kit (from Vector). The color was developed
by addition of diaminobenzidine (DAB) (Sigma) and counterstained with Mayer’s hematoxylin
(Sigma, H9627).
For transferase (TdT)-mediated dUTP nick end labeling (TUNEL) of apoptotic cells, tissue slides
were rehydrated and antigen retrieval was completed as stated above. Assay was completed as
per manufacturer’s protocol using TUNEL enzyme (Roche, 11767305001) and TUNEL Label
Mix (Roche, 11767291910).
Electron microscope analysis
Samples were fixed in 2.5% (v/v) glutaraldehyde in 0.1M phosphate buffer pH7.4. Transmission
EM specimens were post-fixed in osmium tetroxide, dehydrated in an ascending series of
acetone, infiltrated and embedded in Epon Araldite prior to polymerization at 60° C overnight.
Ultrathin sections were then cut and mounted on grids, and stained with uranyl acetate and lead
citrate prior to microscopy (JEOL, JEM1011) and image acquisition was completed using a CCD
camera (AMT corp.). Scanning EM samples were post-fixed in osmium tetroxide, dehydrated in
an ascending series of ethanols and critical point dried. Samples were then mounted on aluminum
stubs using double-sided carbon tape. Samples were rendered conductive with a thin coat of gold
palladium using a sputter coater and examined and photographed in a field emission scanning
EM (JEOL, JSM 6700F).
Statistical analysis
Statistical comparisons were performed using unpaired t-tests. For multiple comparisons of more
than two groups, one-way ANOVA was used with Dunnett’s test for significance. P-value of
0.05 or less was considered significant.
64
Table 3-1 RT-PCR primer table
Gene Primer Source, Catalogue Number / sequence
Alb CCTAGGAAGAGTGGGCACCAAGTGT AGCAGAGAAGCATGGCCGCCTTTC
Foxa2 AAAGTATGCTGGGAGCCGTGAA CGCGGACATGCTCATGTATGTGTT
Foxa3 Qiagen, QT01657705
Krt5 Qiagen, QT01060325
Nkx2-1 TATGCTTCATGGCCCTGAACT TTTCCTATCTCCAGCGTCTGTCCT
Olig2 AATGCGCGATGCGAAGCTCTTT AAGCCCACGTTGTAATGCAGGT
Pax8 TCGACTCACAGAGCAGCAGCAGT AGGTTGCGTCCCAGAGGTGTATT
Pdx1 Qiagen, QT00102235
Sox2 Qiagen, QT01539055
Sox9 Qiagen, QT00163765
Tg Qiagen, QT00116592
Trp63 Qiagen, QT00197904
65
Table 3-2 Antibodies list
Target Host, Conjugation Company Catalogue
Number
Application,
Dilution
Primary Antibodies
CDH-1 Mouse, non-conjugated BD Biosciences 610181 IF, 1:100
c-KIT Rat, PE-Cy7 BD Biosciences 558163 FACS, 1:100
Collagen IV Rabbit, non-conjugated Abcam ab6586 IF, 1:200
CXCR4 Rat, APC BD Biosciences 558644 FACS, 1:100
FOXA2 Mouse, non-conjugated Abcam ab60721 IF, 1:200
Ki67 Rat, non-conjugated DAKO M7249 IHC, 1:100
pan-KRT Rabbit, non-conjugated DAKO ZO622 IF, 1:800
KRT5 Rabbit, non-conjugated Abcam ab24647 IF, 1:1000
KRT14 Rabbit, non-conjugated ThermoFisher PA5-28002 IF, 1:500
Laminin Rabbit, non-conjugated Novus Biologicals NB300-144 IF, 1:200
NKX2-1 Rabbit, non-conjugated Abcam ab76013 IF, 1:200
NGFR Rabbit, non-conjugated Abcam ab8874 IF, 1:500
PDPN Rabbit, non-conjugated Abcam ab109059 IF, 1:200
POU5F1 Rabbit, non-conjugated Cell Signaling 2788-s IF, 1:200
SOX2 Goat, non-conjugated R&D Systems AF2018 IF, 1:400
SOX9 Goat, non-conjugated R&D Systems AF3075 IF, 1:400
TRP63 Mouse, non-conjugated Santa Cruz sc-8431 IF, 1:200
Secondary Antibodies
Goat IgG Donkey, Alexa Fluor 647 Invitrogen A-31573 1:200
Goat IgG Donkey, Alexa Fluor 488 Invitrogen A-21202 1:200
Mouse IgG Donkey, Alexa Fluor 488 Invitrogen A-11055 1:200
Rabbit IgG Donkey, Alexa Fluor 546 Invitrogen A-11056 1:200
Rat IgG Goat, Alexa Fluor 488 Invitrogen A-11006 1:200
FACS: Fluorescence-activated cell sorting; IF: Immunofluorescent staining
66
3.4 Results
Endodermal cells organize into epithelial structures and express early lung-lineage
markers on decellularized scaffolds
During embryonic development, lung-specific endoderm progenitors originate from definitive
anterior endoderm found in the developing foregut271,272. Therefore, definitive endoderm was
generated from mouse ESCs using a 4-day embryoid body induction protocol with activin A
treatment270,273 (Figure 3-1A). Flow cytometric analysis showed that over 50% of ESCs were
induced to definitive endoderm as apparent by the coexpression of cKIT and CXCR4 (Figure 3-
1B). Transmission EM analysis of sorted and unsorted endoderm cultures reflected the
heterogeneity of unsorted cells (Figure 3-1C).
Both unsorted and endoderm-sorted cells were seeded onto thick sections of decellularized
scaffolds. Cell-scaffold cultures were setup in a similar manner to primary epithelia
recellularization experiments, and maintained under air liquid interface conditions (Figure 2-
8A). Tissue analysis of day 7 cultures showed organization of seeded endodermal cells into
tubular structures. Sorted cells formed single-cell layered epithelial-like structures surrounding a
lumen, while unsorted cultures showed limited organization and contained an abundance of
apoptotic cells (Figure 3-1C). Furthermore, unsorted cell cultures showed several POU5F1+
(OCT4) regions of pluripotent cells (Figure 3-1C) in day 7 cultures. Based on these early
recellularization studies, subsequent experiments were carried out with sorted definitive
endoderm.
Seeded endoderm cells presented a pattern of organization reminiscent of the developing lung,
lined by basement membrane proteins collagen IV and laminin (Figure 3-2A). Day 21 scaffold
cultures were negative for pluripotency marker POU5F1 and maintained definitive endoderm
transcription factor FOXA2 expression (Figure 3-2B). Tubule structures were formed, and over
half of the seeded population co-expressed pan-epithelial cell markers Cadherin 1 (CDH1) and
panKRT. In contrast to seeded scaffolds, endodermal cells cultured on membranes alone at ALI
did not form epithelial structures, nor express any lung epithelial cell markers (Figure 3-2B).
RT-PCR analysis showed maintenance of endoderm transcription factor Foxa2 expression for
the duration of culture on scaffolds (Figure 3-3A). Nkx2-1 is an important transcriptional
67
regulator of the lung and is considered one of the earliest markers for emergence of lung-specific
endodermal cells11,13. There was upregulation of Nkx2-1 after 7 days of culture on scaffolds, and
this expression was maintained for up to 21 days in culture. Proximal (Sox2) and distal (Sox9)
epithelial progenitor markers were both detected at the mRNA level, although Sox2 levels were
greater (Figure 3-3A).
NXK2-1 is not specific to lung development as it is also a transcriptional regulator during thyroid
and forebrain formation274. However, relative to expression of adult tissue, thyroid lineage
markers Thyroglobulin (Tg) and Paired box 8 (Pax8) and neuroectoderm marker
Oligodendrocyte transcription factor 2 (Olig2) were hardly detected in seeded scaffold cultures
(Figure 3-3B). Expression of posterior endoderm lineage markers such as Albumin
(Alb) (liver), Pancreatic and duodenal homeobox 1 (Pdx1) (pancreas), and Foxa3 (posterior
endoderm) was also not noted in lung scaffold cultures (Figure 3-3B).
68
Figure 3-1 Decellularized lung scaffolds are repopulated with ES-derived definitive
endoderm cells and cultured at air liquid interface
Figure 3-1 (A) Definitive endoderm induction (FOXA2+, cKIT+ & CXCR4+) is achieved with
48hr treatment of ES-derived embryoid bodies with 50ng/ml of Activin A. (B) Endodermal cells
are sorted for cKIT and CXCR4 using fluorescence-activated cell sorting to obtain an enriched
population. (C-E) both sorted and unsorted endoderm population was seeded onto scaffolds. (C)
Transmission EM of definitive endoderm. Sorted cells appear more uniform compared to
unsorted cells which include apoptotic cells and debris. (D) H&E staining of scaffold cultures
reveals organization of sorted endodermal cells into tubular structures, superior to seeded
unsorted population (day 7). Scale bar=50μm. (E) Confocal micrograph of immunostained
scaffold cultures reveals POU5F1+ (OCT4) pluripotent cells in unsorted population after 7 days.
69
Figure 3-2 Seeded ES-derived endoderm cells form epithelial structures along the basement
membrane
Figure 3-2 (A) Seeded endodermal cells repopulate scaffolds and organize into tubular
structures. Immunostaining for collagen IV and laminin shows that these scaffold proteins line
the developing cellular (DAPI positive) structures. (B) Immunostaining analysis demonstrates
that endodermal cells seeded on lung scaffolds maintain definitive endoderm marker FOXA2 and
do not express pluripotency marker POU5F1. Structures are positive for epithelial cell markers
CDH1 and panKRT. In contrast to cells seeded on scaffolds, endodermal cells cultured at ALI
without the support of the lung matrix do not form organized structures and do not express
epithelial cell markers. Scale bar represents 25μm.
70
Figure 3-3 Definitive endoderm upregulates early lung markers with culture on lung
scaffolds
Figure 3-3 (A) Real-time PCR analysis reveals an upregulation of Foxa2 and lung progenitor
marker Nkx2-1 expression. Expression is presented relative to E13.5 mouse lungs, mean ±
SEM, n=4 experiments. Proximal airway progenitor marker Sox2 and distal alveolar
progenitor marker Sox9 were both detected, n=4 experiments; with extended culture (day
21), Sox2 expression is upregulated. (B) Real time-PCR analysis shows that relative to
expression of adult tissue (mean ± SEM, n=4 experiments), thyroid lineage makers Tg and
Pax8, and neuroectoderm marker Olig2 are hardly detected in seeded scaffolds after 7, 14,
and 21 days of culture. Expression of additional endoderm lineage markers including Pdx1
(pancreas), Foxa3 (posterior endoderm), and Alb (liver) are also marginally detected.
71
Seeded endodermal cells differentiate to NKX2-1+/SOX2+ early proximal lung
progenitors
Using an Nkx2-1mCherry ESC line with a nondisruptive mCherry reporter gene knockin268, we were
able to capture the lung epithelial progenitor population as it emerged with culture on the
scaffolds. IF confocal analysis showed the presence of NKX2-1+/SOX2+/TRP63+ airway basal
stem cells in day 7 cultures (Figure 3-4A). A minor population of distal lineage NKX2-1+/SOX9+
progenitor cells was also detected. By day 21, majority of the emerging NKX2-1+ cells co-
expressed SOX2, while staining of SOX9 was not detected, indicating lineage restriction to the
proximal airway275,276 (Figure 3-4B).
Flow cytometric quantification revealed that 9.8% of cells expressed mCherry at day 7, and this
percentage increased to 46.4% with extended culture on scaffolds at day 21 (Figure 3-5). Elastase
treatment was used to retrieve cells from scaffolds for flow cytometric analysis. Approximately
9.43 × 105 cells (n=3) were recovered from each day 21-scaffold culture using this method, and
each seeded scaffold culture generated approximately 4.38 × 105 NKX2-1+ cells (n=3) at day 21.
We conclude that decellularized lung scaffolds are able to support the adherence and organization
of seeded endodermal cells and promote the upregulation of lung progenitor marker NKX2-1,
with preference for the proximal airway lineage.
To determine whether individual matrix proteins can promote lung-lineage differentiation with
ALI culture, we seeded endodermal cells on floating membranes coated with either collagen I,
collagen IV, fibronectin, laminin, or matrix substitute Matrigel (Figure 3-6A). RT-PCR analysis
showed the upregulation of all endodermal lineage markers Pax8, Foxa3, Pdx1, and
neuroectoderm marker Olig2 on single matrix proteins compared with decellularized lung
scaffolds (Figure 3-6B).
Analysis of day 21 cultures by tissue staining showed that no individual matrix protein or
Matrigel was able to promote organization into epithelial structures comparable to that achieved
with lung scaffolds (Figure 3-7A). High-magnification transmission EM analysis confirmed this
observation, showing limited organization and lung lineage specification of endoderm on
individual matrix proteins (Figure 3-7B).
To examine the ability of scaffolds derived from other organs in promoting lung lineage
specification, we seeded decellularized mouse kidney scaffolds (mesoderm germ layer origin)
72
with definitive endoderm. Kidney scaffolds were seeded in the same culture setup under ALI as
lung scaffolds. Numerous attempts of kidney scaffold recellularization with definitive endoderm
at varied densities did not repopulate the scaffolds (Figure 3-7C). Definitive endoderm did not
adhere and proliferate, suggesting that kidney-derived ECM is distinct from lung-derived ECM
in its ability to support and promote endoderm-lineage specification.
73
Figure 3-4 Seeded Endodermal Cells Differentiate to NKX2-1+/SOX2+ Proximal Lung
Progenitors with Culture on Decellularized Scaffolds
Figure 3-4 (A-B) Immunostaining of day 7 cultures shows the presence of NKX2-
1+/SOX2+/TRP63+ co-expressing airway basal stem cells. A small population of distal lineage
NKX2-1+/SOX9+ progenitor cells is also present at this time point. Top panel scale bar represents
13μm; bottom panel scale bar represents 25μm. (B) Immunostaining of day 21 cultures for
NKX2-1, SOX2, and SOX9 reveals that the majority of NKX2-1+ cells co-express SOX2, while
SOX9 protein expression is rare. Scale bar represents 50μm.
74
Figure 3-5 NKX2-1 progenitor cells increase with longer culture on lung scaffolds
Figure 3-5 NKX2-1mcherry+ cells are quantified with flow cytometry. The proportion of NKX2-
1+ cells increases with extended culture up to 46.42% ± 3.6% at day 21, n=3 experiments.
75
Figure 3-6 Individual matrix proteins do not support lung lineage commitment of seeded
endodermal cells
Figure 3-6 (A) Schematic representation of alternate scaffold recellularization. Sorted
endodermal cells are seeded on floating membranes coated with specific matrix proteins or
Matrigel and cultured at air-liquid interface in base supportive media. (B) Real-time PCR analysis
reveals upregulation of other endodermal lineage (Pax8, Foxa3, Pdx1) and neuroectoderm
(Olig2) markers with culture of definitive endoderm on individual matrix proteins compared with
lung scaffolds. Gene expression is presented relative to definitive endoderm; mean ± SEM, n=3
experiments.
76
Figure 3-7 Endoderm culture without lung scaffold does not promote differentiation to a
lung phenotype
Figure 3-7 (A-B) H&E staining and transmission EM of seeded endodermal cells reveal the
inability of individual matrix proteins and Matrigel to promote differentiation to lung epithelial
cells. H&E scale bar=50μm, EM scale bar=2μm. (C) Decellularized kidney scaffolds seeded with
definitive endoderm and cultured at air liquid interface cannot support the adherence,
proliferation, and differentiation of sorted endodermal cells. Scale bar=50μm.
77
Early endoderm-scaffold culture promotes the emergence of a heterogeneous basal cell
population
Basal cells found in the mouse trachea and human airways are considered to be the adult lung stem
cell population. They can undergo rapid expansion and differentiate to more specialized progeny when
needed during homeostasis and in response to injury61. Basal cells expressing TRP63, KRT5 and
KRT14 have been shown give rise to ciliated and club cell lineages both in vivo and in vitro culture
systems62,235,277-279. To determine whether basal cells are an early progenitor population emerging
from seeded endodermal cells on lung scaffolds, cell-scaffold cultures at various time points were
stained for a panel of known basal cell markers: TRP63, KRT5, KRT14, PDPN, and NGFR.
IF confocal analysis showed that many epithelial structures positive for basal cell marker TRP63 co-
expressed KRT5, PDPN, NGFR or KRT14 after 7 days of culture (Figure 3-8). Basal cell populations
appeared to be heterogeneous, with some expressing only TRP63, while others were positive for both
TRP63 and KRT5. A rarer population of TRP63-/KRT5+ cells was also identified on scaffolds (Figure
3-9A). The emergence of different basal cell populations during early (day 4-7) and late (day 14-21)
time points in culture are summarized in Figure 3-9B. Transmission EM micrographs of day 7
cultures show an abundance of unspecialized cells lining epithelial structures, likely representative of
basal cell morphology at this time point (Figure 3-9C).
Real-time PCR analysis of day 4, 7, 14, and 21 scaffold cultures showed upregulation Trp63 and Krt5
expression at day 7 of culture (Figure 3-10A). This expression remained high compared to
endodermal cells, but dropped gradually with longer culture durations. This drop in gene expression
was paralleled in IF tissue staining for TRP63+/KRT5+ basal cells in cultured tissue segments (Figure
3-10B). With longer duration, the number of basal cells decreased and the morphology of the epithelial
structures changed. In early day 4 and day 7 cultures, smaller sporadic structures were found and with
extended culture the structures appeared to elongate and started to resemble mature mouse airways
lined with TRP63+/KRT5+ basal cells (Figure 3-10B). These results were consistent with previously
published work on the progenitor activity of airway basal cells62,280,281, suggesting that multipotent
TRP63+ basal stem cells in early cultures may be differentiating to specialized secretory and ciliated
cells lining the developing airway structures.
Longer culture on scaffolds also resulted in a decline in cell proliferation, as apparent with a
reduction in Ki67+ cells (Figure 3-11A). Day 7 cultures resembled highly proliferative mouse
embryonic lungs, while day 21 cultures resembled adult lung tissue with completely
78
differentiated epithelial cells. This decrease in proliferation occurred in parallel with an increase
in the number of apoptotic cells at day 21 compared to day 7 (Figure 3-11B). Apoptosis was
detected using TUNEL staining of tissue.
79
Figure 3-8 Epithelial structures positive for basal cell markers are present on early
scaffold cultures
Figure 3-8 Immunofluorescent confocal images of day 7 seeded scaffold cultures. Epithelial
structures positive for at least two early basal cell markers are identified (arrow heads). Basal cell
populations identified include: TRP63+/KRT5+, PDPN+/TRP63+, NGFR+/TRP63+ and
KRT14+/NGFR+. Scale bar=25μm.
80
Figure 3-9 Basal cells identified on early and mature scaffold cultures are a heterogeneous
population
Figure 3-9 (A) Immunofluorescent confocal images of day 7 and 14 scaffold cultures for TRP63
and KRT5 basal cell markers. Basal cells positive for one or both markers can be identified,
KRT5+/TRP63- (arrowhead), KRT5+/TRP63+ (arrow), KRT5-/TRP63+ (double arrowhead).
Scale bar=50μm. (B) Summary of basal cell populations at different time points of scaffold
culture, “+”: found in culture, “-”: not found in culture. (C) Transmission electron micrograph of
day 7 epithelial cells on scaffold cultures. Structures lack specialized cell characteristics at this
time point. Left scale bar=4μm, right scale bar=2μm.
81
Figure 3-10 Basal cell population drops with longer culture duration as epithelial structures
mature on scaffolds
Figure 3-10 (A) Real-time PCR analysis reveals upregulation of basal cell markers Trp63 and
Krt5 at seven days of scaffold culture. Expression of both genes drops with longer culture
duration; mean ± SEM, n=3 experiments. (B) Immunofluorescent confocal images for TRP63+
and KRT5+ expression at different time points on scaffolds. Basal cells become more organized
with longer culture duration and start to resemble mature airway structures lined with
TRP63+/KRT5+ basal cells.
82
Figure 3-11 Extended culture on scaffolds shows a reduction in Ki67+ proliferative cells,
while the proportion of apoptotic cells stained with TUNEL increase
Figure 3-11 Immunostaining for Ki67 shows a decline in proliferation with progressive
differentiation of seeded cells to airway epithelia from day 7 to day 21 (scale bar represents
25μm); mean ± SEM, n=3 experiments. (B) TUNEL staining for identification of apoptotic cells
on tissue sections was completed for different time points. Cell counts of immunostained sections
shows the percentage of apoptotic (TUNEL+) cells at days 7, 14, and 21 cultures. Scale bars
represent 25μm. Mean ± SEM, n=3 experiments.
83
3.5 Discussion
Recent reports have had success with promoting differentiation of pluripotent stem cells to
NKX2-1+ lung progenitor cells using monolayer cultures and supplementation with inductive
factors263,266,267,270,273,282. However, there have been no reports of the differentiation potential of
natural lung ECM alone in promoting lung lineage restriction, without the use of exogenous
factors. In this study we showed that decellularized scaffolds alone directed differentiation of
definitive endoderm to NKX2-1+/SOX2+ proximal lung progenitor cells and showed the
emergence of a heterogeneous population of mainly TRP63+ basal cells (Figure 3-12). Lung
progenitors were detected at day 7 of culture and were in abundance by day 21, with
approximately 46% of all cells expressing NKX2-1. This rise could be due to the preferential
expansion of NKX2-1+ cells on scaffolds or apoptosis of cells that are not committed to the lung
lineage. Although few NKX2-1+/SOX9+ cells were also detected after at 7 days, they disappeared
with longer duration of culture, suggesting that differentiation to the distal lineage perhaps
requires additional inductive factors after NKX2-1+ specification on scaffolds.
Interestingly, this distinct ability of decellularized lung scaffolds to differentiate endoderm into
airway progenitor cells with limited contamination from other endoderm lineages was further
restated by endoderm culture on individual matrix proteins (fibronectin, laminin, collagen I,
collagen IV) and ECM substitute Matrigel. Unlike lung scaffold cultures, an upregulation of
thyroid, pancreas and liver epithelial cell markers was noted in these cultures. Furthermore,
decellularized kidney scaffolds were not successful in supporting endoderm culture and
consequently tissue-specific differentiation. This suggests that a mesoderm-derived organ like
the kidneys cannot readily support adherence and differentiation of cells from a different germ
layer, such as endoderm.
Lineage tracing experiments have shown that basal cells can undergo long-term self-renewal and
give rise to ciliated and secretory luminal cells when required 62,233,234. In this study, endoderm-
derived basal cells were found in abundance in early proliferative day 7 cultures. However, the
basal cell population declined steadily with extended culture, parallel with a decline in
proliferative activity on scaffolds. Basal cells are a heterogeneous cell population with diverse
expression profiles of TRP63, KRT5, KRT14, PDPN, and NGFR235,236. This heterogeneity was
also found on scaffold cultures, leading to questions regarding the regenerative capacity and
differentiation ability of different basal cell subpopulations. The initial abundance followed by a
84
fall in cell numbers with extended culture on scaffolds, suggests that basal cells could be
progenitor cells that with extended culture undergo a terminal differentiation program and give
rise to specialized lung epithelial cells.
This culture setup provides a means to examine early endoderm specification to NKX2.1+
lung-specific progenitor cells. Lineage restriction to SOX2+ proximal airway-progenitor cells
was observed with the emergence of a heterogeneous basal stem cell population.
We conclude that decellularized lung scaffold cultures provide a 3D in vitro platform to
better understand early cell-matrix signaling during proximal lineage lung specification.
85
Figure 3-12 Definitive endoderm differentiates to proximal airway progenitors and basal
epithelial cells after 7 days of scaffold culture
Figure 3-12 Schematic representation summarizing this chapter’s characterization of early
endoderm differentiation on lung scaffolds. Seven day of endoderm culture on decellularized
lung without the addition of exogenous growth factors resulted in differentiation to NKX2-
1+/SOX2+ airway progenitors and a heterogeneous TRP63+ basal cell population.
86
Chapter 4
Decellularized lung scaffolds direct differentiation of endoderm to
functional airway epithelial cells, with the requirement of matrix-
bound heparan sulfate proteoglycans
87
4
4.1 Rationale
Three-dimensional cultures supplemented with various morphogens and growth factors have
shown some success in promoting differentiation of pluripotent cells to the lung lineage. In
Chapter 3 we found that decellularized lung scaffolds promote the differentiation of stem cell-
derived endodermal cells to proximal airway progenitor cells as early as seven days of ALI
culture, without the need for exogenous inductive factors. We believe that decellularized lung
scaffolds could drive further differentiation of proximal progenitors to mature airway epithelial
cells and that growth factor-binding ECM proteins such as chondroitin sulfate and heparan sulfate
proteoglycans may be involved in mediating this matrix-guided differentiation.
Objective of study: To characterize the multi-differentiation potential of seeded endodermal cells
driven by decellularized lung scaffolds.
Results: Extended culture of ESC-derived endoderm on decellularized scaffolds resulted in the
formation of fully differentiated luminal airway structures with TRP63+/KRT5+ basal cells,
SCGB1A1+ club cells, and FOXJ1+/TUBB4A+ beating ciliated cells. This was achieved with
notable morphological and functional resemblance to native airway epithelia. Differentiated day
21 cells exhibited functional cystic fibrosis transmembrane conductance regulator (CFTR)
protein expression. Disruption of HS proteoglycans on lung scaffolds using heparitinase-I
enzymatic treatment resulted in a complete loss of organization and differentiation.
Conclusions: Here we report the robust differentiation of embryonic stem cell-derived endoderm
to mature, functional airway epithelial cells using defined, serum-free culture on decellularized
lung scaffolds at air liquid interface. We demonstrate the importance of a 3D matrix environment
with site-specific cues that are bound to heparan-sulfate proteoglycans, necessary for achieving
differentiation to airway epithelial cells on lung scaffolds.
88
4.2 Introduction
Directed differentiation of pluripotent cells to the lung lineage is dependent on precise signaling
events in the microenvironment88,148. Due to the dynamic nature of this process it has been
challenging to mimic the precise events of lung organogenesis in vitro to generate mature
functional lung epithelial cells. Recent reports have used step-wise lineage restriction strategies
with soluble growth factor supplementation of two-dimensional cultures to achieve lung
differentiation261-266. In these reports, pluripotent cells, whether embryonic or induced pluripotent
stem cells, were first differentiated to the definitive endoderm germ layer. Endodermal cells were
subsequently pushed to an anterior endoderm fate and thereafter to lung progenitor cells, as
identified by the expression of NKX2-1. These lung progenitors were further differentiated to
proximal airway or distal alveolar lung epithelial cells with continued growth factor
supplementation. Such two-dimensional strategies have had some success in generating lung
epithelial cells, however there are several limitations including low efficiencies, possible
contamination from other endodermal lineages, lack of a 3D structure, and in some instances use
of undefined culture conditions with serum supplementation.
Repopulation of decellularized scaffolds has been used as an end-point assay to assess
regenerative potential of pre-differentiated cells261,263-265. A recent report has demonstrated the
importance of the matrix environment for maintaining lung progenitor identity, but again using
pre-differentiated NKX2-1+ lung progenitor cells and growth factor-supplemented culture media,
precluding assessment of the scaffolds alone on differentiation261. No reports have assessed the
inductive capacity of the ECM alone during lung specification.
Lung development involves the division, migration, gene expression and differentiation of
individual cells in response to environmental cues. The ECM is a complex and dynamic structure
that in addition to providing mechanical support can guide tissue morphogenesis by integrating
and regulating these processes267,273. The lung ECM can be used as a natural platform for
endoderm culture to better mimic the in vivo lung developmental milieu. In chapter 3 we
demonstrated the ability of decellularized lung scaffolds to promote differentiation of seeded
endoderm to NKX2-1+ lung progenitor cells and to a heterogeneous population of basal stem
cells. In this study we examine the potential of these scaffolds to direct differentiation of seeded
cells to mature, fully functional lung epithelial cell populations. We uncover an important role
89
for matrix-bound heparan sulfate proteoglycans in supporting endoderm culture on scaffolds and
for achieving differentiation to airway epithelial cells.
4.3 Materials and Methods
ESC culture and endoderm induction
Mouse ESC lines (R1 (Nkx2-1mCherry), G4 (dsRed-MST), and129/Ola (Bry-GFP/Foxa2-
hCD4) were maintained below passage 40, in the pluripotent state under feeder-free, serum-free
culture using 2i conditions268,269. Endoderm induction was achieved using a four day EB culture
method with activin A treatment using serum-free differentiation medium SFDM270. Single cells
were seeded at a 20,000 cells/ml density in low adherent plates (Nunc, Roskilde, Denmark) to
allow for EB formation for 48 hours. Day 2 EBs were collected and reseeded at 1:2 density in
SFDM supplemented with 50ng/ml activin A for an additional 48 hours. Day 4 EBs were
harvested and sorted by fluorescence activated cell sorting for cKIT+/CXCR4+ cells representing
definitive endoderm.
Anterior endoderm was generated for use in RT-PCR analysis as a control. Anteriorization was
achieved by seeding sorted definitive endoderm cells as a monolayer on gelatin coated 6-well
plates in SFDM supplemented with 10μM SB431542 (Sigma, 431542) and 100ng/ml NOGGIN
(R&D Systems, 1967-NV/CF) for 24hours. Anteriorization was confirmed using RT-PCR
analysis showing a reduction in Foxa3 expression (posterior endoderm).
Decellularization and recellularization
For a detailed description of decellularized scaffold generation for stem cell culture, please refer
to section 2.3. Briefly: rat lungs were decellularized using a CHAPS-based decellularization
solution followed by a rapid wash and decontamination protocol to remove cellular material.
Thick sections (350μM) of lung scaffolds were generated using a vibratome and placed on
hydrophobic floating membranes in culture (Whatman #110614) to achieve ALI culture
conditions. Scaffolds were seeded with 100,000 sorted definitive endoderm cells
(cKIT+/CXCR4+) and maintained for up to 21 days using SFDM, with no additional growth
factor supplementation.
Fluorescence activated cell sorting
90
For definitive endoderm, day 4 EBs were dissociated using TrypLE express (Gibco), for 3
minutes at 37°C. Single cell suspensions were labeled with cKIT and CXCR4 antibodies in sort
buffer (HBSS- supplemented with 2% (v/v) fetal bovine serum and 10mM HEPES buffer) for 20
minutes on ice. Cells were sorted using an AriaII-GC cell sorter (BD Biosciences) and data
analysis was carried out using Diva (BD Biosciences) and FlowJo (TreeStar) software.
Histological analysis
Cell-scaffold cultures were fixed in 4% (w/v) PFA at 4°C for 8 hours. Samples were paraffin
embedded and sectioned at 5μm. Slides were rehydrated and standard hematoxylin and eosin and
periodic acid-Schiff (PAS) stainings were performed.
Real time quantitative PCR
RNA was extracted from cell-scaffold cultures using PicoPure RNA Isolation Kit (Life
Technologies) and cDNA synthesis was carried out with 1μg of RNA using SuperScript III
Reverse Transcriptase (Invitrogen), according to the manufacturer’s protocol. Ten micrograms
of template cDNA was used for real-time PCR (40 cycles of amplification) using SYBR GreenER
qPCR SuperMix with murine specific primer sets (Table 4-1). Analysis was performed using
StepOnePlus qPCR (Applied Biosystems). Gene expression was normalized to RNA Polymerase
II and expressed relative to selected positive (adult tissue, E13 lung) or negative controls
(definitive and anterior endoderm).
Immunostaining
Cell-scaffold cultures were fixed in 4% (w/v) PFA at 4°C for 8 hours. Samples were paraffin
embedded and sectioned at 5μm. Sample sections were rehydrated and heat-induced epitope
retrieval with citrate buffer (pH 6.0) was performed. Slides were then blocked for one hour with
5% (v/v) normal donkey serum and 1% (w/v) BSA in PBS for 1 hour at room temperature.
Samples were then incubated with primary antibodies at 4°C overnight in humidified chamber,
and detected using Alexa Fluor conjugated secondary antibodies (Invitrogen) for one hour at
room temperature. Nuclei were counterstained using DAPI (Invitrogen). Details of antibodies are
provided in Table 4-2. Images were captured with Leica CTRMIC 6000 confocal microscope
91
and Hamamatsu C910013 spinning disc camera (Leica Microsystems Inc.), and analyzed with
Volocity software (PerkinElmer).
Immunoblot analysis
For SCGB1A1 detection, 50μg of day 21 cell-scaffold culture media, and adult rat lung lysate as
positive control, were separated on a 3%–12% (w/v) gradient SDS-PAGE gel (Invitrogen).
Proteins were transferred to nitrocellulose paper (Millipore) and blocked with 3% (v/v) milk in
PBS plus 0.1% (v/v) Tween-20. The membranes were then incubated overnight at 4°C with anti-
SCGB1A1 antibody (Table 4-2) at 1:1000 dilution in 1% (v/v) PBS-milk containing 0.2% (v/v)
Tween-20. Blots were then incubated for 1 hour with secondary antibody conjugated with
peroxidase, and were developed using chemiluminescent substrates (PerkinElmer) according to
the manufacturer’s instructions and imaged on X-ray film.
Electron microscope analysis
Samples were fixed in 2.5% (v/v) glutaraldehyde in 0.1M phosphate buffer pH7.4. Transmission
EM specimens were post-fixed in 1% (w/v) osmium tetroxide, dehydrated in an ascending series
of acetone, infiltrated and embedded in Epon Araldite prior to polymerization at 60° C overnight.
Ultrathin sections were then cut and mounted on grids, and stained with uranyl acetate and lead
citrate prior to microscopy (JEOL, JEM1011) and image acquisition was completed using a CCD
camera (AMT corp.). Scanning EM samples were post-fixed in osmium tetroxide, dehydrated in
an ascending series of ethanol and critical point dried. Samples were then mounted on aluminum
stubs using double-sided carbon tape. Samples were rendered conductive with a thin coat of gold
palladium using a sputter coater and examined and photographed in a field emission scanning
EM (JEOL, JSM 6700F).
Efflux assay
Iodide efflux from differentiated cultures following cyclic adenosine monophosphate (cAMP)
agonist stimulation was measured periodically to assess CFTR channel activity. Day 21 scaffold
cultures were loaded with sodium iodide solution (3.0mM KNO3, 2.0mM Ca(NO3)2, 11mM
glucose, 20mM HEPES, 136mM NaI) in a 6-well plate for 1h at 37°C, for iodide uptake (three
cell-scaffold cultures were pooled for each assay) measurements. Samples were then washed 10
92
times with wash solution (3.0mM KNO3, 2.0mM Ca(NO3)2, 11mM glucose, 20mM HEPES,
136mM NaNO3) and epithelium sodium channel (ENaC)-specific inhibitor amiloride (100μM).
The last wash was collected as a blank reading, followed by eight sequential readings of cAMP-
stimulated halide flux using 300μl of wash solution containing FIG (10μM forskolin, 100μM 3-
isobutyl-1-methylxanthine, and 50μM genistein). Each reading represented 1 minute of exposure
to FIG wash solution. Vehicle dimethyl sulfoxide (DMSO) was used as a negative control
reading. Solutions from each one-minute time point were collected into a 96 well plate and
absolute iodide electrode potential value (mV) was measured using a halide-selective
microelectrode (Lazar Research Laboratories). Readings were recorded using Digidata 1320A
Data Acquisition System and Clampex 8.1 software. Using a calibration curve, recorded mV
values were converted to iodide concentration in μM.
Enzymatic treatment of scaffolds
Decellularized scaffolds were treated with Heparitinase I solution (0.1M sodium acetate, 10mM
calcium acetate, 10mU heparitinase I (Amsbio, 100704)) for 4 hours at 37°C. Enzymatic activity
was confirmed by UV spectral analysis of treated scaffolds at 232nm for HS disaccharides in the
wash supernatant, as well as Tomato-lectin staining (Vector Laboratories, B-1175 1:500 dilution;
detection with PE-conjugated Streptavidin, Biolegend, 405203 1:200 dilution) of the untreated
and treated scaffolds. Alternatively, scaffolds were treated with chondroitinase ABC solution
(0.4M Tris-HCl buffer pH8.0, 0.4M sodium acetate, 0.1% (w/v) BSA, 5mU chondroitinase ABC
(Amsbio, 100330-1A) for 1 hour at 37°C. Enzymatic activity was confirmed by immunoblot
analysis for removal of CS proteoglycans from treated scaffolds. Following enzymatic treatment,
scaffolds were rinsed first with PBS (containing penicillin-streptomycin and amphotericin B) for
one hour, followed by SFDM media. Sorted endodermal cells were seeded on scaffolds and
cultured at air liquid interface as previously described.
Lung matrix conditioned media preparation
Decellularized lung scaffolds were treated with Heparitinase I (Amsbio 100704) as described
above. Following treatment, scaffolds were rinsed with PBS five times (10mL of solution total).
The post-rinse PBS was collected, filtered through a 0.2μM filter to remove debris, and added at
a 1:10 (PBS:media) ratio to SFDM base differentiation media for “rescue” culture experiments
with Heparitinase-treated scaffolds.
93
Protein profiler array
A protein antibody array (R&D Systems, ARY015) was used to identify candidate analytes
remaining on decellularized scaffolds, as per manufacturer’s instructions. Briefly, following
decellularization, scaffolds treated with or without heparitinase I were homogenized in PBS with
protease inhibitors. After homogenization, 1% (v/v) triton X-100 was added to samples. Samples
underwent one freeze-thaw cycle and were then centrifuged at 10,000g for 5 minutes to remove
cellular debris. Protein concentration was determined using Bradford protein assay (Bio-rad).
Sample lysates were diluted (300μg of protein per sample), mixed with a cocktail of biotinylated
detection antibodies, and incubated overnight with the protein array membrane. Streptavidin-
HRP and chemiluminescent detection reagents were used for detection. A signal was generated
at each capture spot on membrane, corresponding to the amount of protein bound. Pixel density
for each spot was detected and quantified using ImageJ open access software.
Statistical analysis
Statistical comparisons were performed using unpaired t-tests. For multiple comparisons of
more than two groups, one-way ANOVA was used with Dunnett’s test for significance. P-value
of 0.05 or less was considered significant.
94
Table 4-1 RT-PCR primer table
Gene Primer Source, Catalogue Number / sequence
Aqp5 TATCCATTGGCTTGTCGGTCAC TCAGCGAGGAGGGGAAAAGCAAGTA
Cftr Qiagen, QT00114604
Foxj1 Qiagen, QT00111097
Muc5ac Qiagen, QT01196006
Scgb1a1 TCCGCTTCTGCAGAGATCTG TGAAGAGAGCAACAGCTTTG
Sftpb Qiagen, QT01537529
Sftpc Qiagen, QT00109424
Trp63 Qiagen, QT00197904
95
Table 4-2 Antibodies table
Target Host, Conjugation Company Catalogue
Number
Application,
Dilution
Primary Antibodies
CDH1 Mouse, non-conjugated BD Biosciences 610181 IF, 1:100
CFTR Rabbit, non-conjugated Abcam Ab181782 IF, 1:200
c-KIT Rat, PE-Cy7 BD Biosciences 558163 FACS, 1:100
CLDN10 Rabbit, non-conjugated Santa Cruz sc-25710 IF, 1:350
CXCR4 Rat, APC BD Biosciences 558644 FACS, 1:100
FOXJ1 Goat, non-conjugated Santa Cruz sc-54371 IF, 1:200
KRT5 Rabbit, non-conjugated Abcam ab24647 IF, 1:1000
SCGB1A1 Goat, non-conjugated Santa Cruz sc-9772 IF, 1:1000
WB, 1:1000
TJN1 Rabbit, non-conjugated Invitrogen 40-2200 IF, 1:200
TRP63 Mouse, non-conjugated Santa Cruz sc-8431 IF, 1:200
TUBB4A Mouse, non-conjugated BioGenex MU178-UC IF, 1:500
Secondary Antibodies
Goat IgG Donkey, Alexa Fluor 647 Invitrogen A-31573 1:200
Goat IgG Donkey, Alexa Fluor 488 Invitrogen A-21202 1:200
Mouse IgG Donkey, Alexa Fluor 488 Invitrogen A-11055 1:200
Rabbit IgG Donkey, Alexa Fluor 546 Invitrogen A-11056 1:200
Rat IgG Goat, Alexa Fluor 488 Invitrogen A-11006 1:200
FACS: Fluorescence-activated cell sorting; IF: Immunofluorescent staining; WB: Western blot
96
4.4 Results
Prolonged culture of endodermal cells on lung scaffolds promotes differentiation to
multiciliated cells and secretory club epithelial Cells
To determine whether NKX2-1+/SOX2+ cells cultured on lung scaffolds alone differentiate
further to mature epithelia, seeded cells were examined for expression of proximal and distal lung
epithelial cell markers. RT-PCR analysis showed upregulated gene expression of proximal
airway epithelia Foxj1 (ciliated cell), Scgb1a1 (club cell), Trp63 (basal cell), and Cftr (Figure 4-
1A), while expression of distal lung epithelial cell markers Aqp5 (type I alveolar cell
marker), Sftpb, and Sftpc (type II alveolar cell markers) were much lower (Figure 4-1B).
Tissue staining of day 21 culture sections obtained from various tissue depths showed that
decellularized scaffolds were completely repopulated after seeding, and formed structures
resembling mouse airways in the adult lung (Figure 4-2). IF confocal microscopy of day 21
scaffold cultures revealed ciliated cells (FOXJ1+, TUBB4A+), club cells (Claudin10 (CLDN10)+,
SCGB1A1+), and basal cells (TRP63+, KRT5+) (Figure 4-3). Quantification of cells with positive
immunostaining for lung lineage markers revealed 24.3% TUBB4A+, 21.1% SCGB1A1+, and
21.7% TRP63+ cells at 21 days of culture on scaffolds. Compared to day 7 cultures, there was a
gradual reduction in the proportion of basal cells in day 14 and day 21 cultures. This observation
parallels temporal Trp63 and Krt5 mRNA expression levels in scaffold cultures, observed in the
previous chapter (Figure 3-10A). With extended culture, proportion of ciliated cell and club cell
populations rise as the basal cell population drops (Figure 4-3A).
Decellularized scaffolds were generated from both upper airway and alveolar lung regions
(Figure 4-4). Comparable cellular organization and differentiation to proximal lung epithelial
cells was achieved on lung scaffolds generated from both regions. With the exception of a small
NKX2-1+/SOX9+ distal progenitor population detected only at day 7, no distal epithelial cells
were found in culture at day 14 and day 21 of scaffold culture.
EM analysis was used for high-magnification morphological analysis of differentiated epithelia
(Figure 4-5A-C). Seeded cells resembled that of native mouse airways (Figure 4-5D-E), where
mature multiciliated cells were present among nonciliated secretory cells with rounded apical
surfaces. Both scanning and transmission EM analyses revealed tight junction-coupled
97
pseudostratified columnar epithelial sheets reminiscent of adult airway epithelial structures.
Close examination of mature cultures also revealed the presence of pit structures reminiscent of
emerging submucosal glands that function to adjust the flow of fluid and mucus secretions in the
proximal segments of the respiratory tracts283-285. Scaffold cultures showed an upregulation of
mucin-producing cell marker mucin 5, subtypes AC (Muc5ac) with prolonged culture (Figure 4-
6A). Numerous gland-like orifices were discovered with scanning EM analysis, and a strong
PAS-positive stain was apparent in the developed submucosal tubules (Figure 4-6B-C).
Decellularized scaffolds derived from mouse lungs seeded with definitive endodermal cells
produced similar results to that obtained with rat lung scaffolds. Differentiation of definitive
endoderm to airway epithelia using rat lung scaffolds was reproducible with two additional
mouse ESC lines: G4 and 129/Ola, as well as a rat ESC line (DAc8). Overall, decellularized adult
lung scaffolds promote efficient differentiation of stem cell-derived definitive endoderm to
airway epithelial cells.
98
Figure 4-1 Endoderm culture on lung scaffolds promotes upregulation of airway epithelial
gene expression
Figure 4-1 (A) RT-PCR analysis reveals the expression of airway epithelial genes Foxj1,
Scgb1a1, Trp63, and Cftr. (B) Alveolar epithelial markers Aqp5, Sftpb, and Sftpc were
detected at much lower levels, although Aqp5 and Sftpb increased with extended culture.
Gene expression is presented relative to adult lungs, mean ± SEM, n=4 experiments, ∗p <
0.001.
99
Figure 4-2 Seeded endoderm repopulates entire lung scaffold
Figure 4-2 Hematoxylin and eosin staining of day 21 tissue sections generated from various
depths shows repopulation of entire decellularized scaffolds. Seeded cells show structures typical
of adult mouse airway epithelia.
100
Figure 4-3 Immunofluorescent and confocal analysis of differentiation to airway
epithelial on scaffold cultures
101
Figure 4-3 Immunofluorescent and confocal analysis of differentiation to airway
epithelial on decllularized lung scaffolds
IF staining and confocal microscopic analysis of day 21 cell-matrix cultures showed mature
airway epithelial populations. (A) IF tissue stain showing TUBB4A+ ciliated cells (green),
SCGB1A1+ club cells (red) and KRT5+ basal cells (yellow). Scale bar represents 50μm. Cell
proportions were quantified as percent of total cell population by cell counts from three
experiments at days 7, 14, and 21. A reduction in basal cell population is seen with extended
culture, while ciliated and club cells expand with longer culture duration. Mean ± SEM, n = 3
experiments. (B) Immunostaining of day 21 cultures for additional airway lineage markers shows
the presence of ciliated cells and club cells positive for markers: TUBB4A+,CLDN10+ (left
image), and FOXJ1+, SCGB1A1+ (right image). Scale bars=25μm. CLDN10+ represents
secretory club cells, and FOXJ1+ represents ciliated cells.
102
Figure 4-4 Proximal and Distal Lung Scaffolds Both Promote Airway Differentiation
Figure 4-4 Decellularized sections from both the proximal (A) and distal (B) regions of the lungs
were generated and seeded with sorted endodermal cells. Tissue and IF staining show that both
scaffold sources promoted differentiation to airway ciliated (TUBB4A) and club (SCGB1A1)
cells. Scale bars represent 25μm.
103
Figure 4-5 Scanning and transmission electron microscopy show mature ciliated cell and
secretory cell morphology on scaffold cultures
Figure 4-5 (A) Scanning EM image of the surface epithelia of day 21 cultures displays mature
tight junction-coupled (white arrowhead) ciliated and nonciliated cells with similar morphology
to native mouse airways (D). (B-C) Transmission EM analysis of day 21 tissue sections confirms
the presence of tight junction-coupled (white arrowhead) ciliated cells (ci), club cells (cc), and
basal cells (bc), secretory cells (se), comparable to native mouse airways (E).
Scale bars: (A) 2.5μm, (B) 4μm, (C) 2μm, (D) 5μm, (E) 2μm.
104
Figure 4-6 Extended culture on lung scaffolds shows emergence of PAS-positive
submucosal gland-like structures
Figure 4-6 (A) RT-PCR analysis reveals upregulation of secretory cell marker Muc5ac in seeded
cells with extended culture. Gene expression is presented relative to adult lung; mean ± SEM,
n=3 experiments. (B) Scanning EM analysis reveals the presence of pit structures with ciliated
and secretory cells lining the orifice. Scale bar=5μm. (C) Pit structures present on epithelial
surfaces show a strong PAS positive stain suggestive of mucin-producing cells lining these
structures. Scale bar=50μm.
105
Morphological progression of scaffold-seeded endoderm to airway epithelial cells
resembles natural lung differentiation
The progression of epithelial cell differentiation in developing mouse airways was examined
using electron microscopy at different time points, spanning from the embryonic (E13), to
pseudoglandular (E15), to canalicular (E17) stages of lung development (Figure 4-7A).
Morphological hallmarks were identified and compared to progressive differentiation of
endodermal cells to mature airway epithelial cells on decellularized scaffolds (Figure 4-7B). At
embryonic day13 of lung development, epithelial structures contain undifferentiated columnar
cells without any features of ciliated or secretory cells. At the pseudoglandular stage, there was
an emergence of monociliated cells that disappeared by the cannalicular stage. These single
ciliated cells were found in day 7 of endoderm-derived scaffold cultures and the monociliated
projections could be visualized by scanning and transmission EM micrographs (Figure 4-7B).
As development progressed into the cannalicular period in the mouse, short cilia were visible by
SEM on single cells surrounded by round cells lacking the microvilli and apical projections
characteristic of maturing nonciliated cells286,287. Differentiation of airway secretory cells was
also initiated at this stage, where rounded cells containing characteristic intracellular granules
were visualized by TEM288. Differentiation of endoderm to early secretory cells was observed at
14 days of culture on lung scaffolds (Figure 4-8A). By 21 days of scaffold culture, differentiated
club cells were identified containing mature secretory vesicles and microvilli lining the cell
surface (Figure 4-8B). SCGB1A1 (club/Clara cell secretory protein) was detected by Western
blot analysis in the culture media suggesting that mature club cells were synthesizing and
secreting SCGB1A1 into the airway structures (Figure 4-8C).
Using a combination of SEM, TEM and IF confocal microscopy, the progressive lung lineage
specification of ESC-derived endodermal cells to fully differentiated airway epithelial cells was
captured from recellularization at day 0 to day 21 of culture on decellularized scaffolds (Figure
4-9). This temporal analysis captures the development of tight junction-coupled lung progenitor
cells expressing basal cell marker TRP63 at day 4, to mature TUBB4A+ multiciliated and
SCGB1A1+ secretory club cells lining differentiated airway structures at day 21 of culture.
Ultrastructural morphologic evaluation was used to designate similar embryonic dating to
endoderm differentiation on lung scaffold cultures (Table 4-3).
106
Table 4-3 Analogues embryonic dating of endoderm differentiation on lung scaffold
cultures
Endoderm
Scaffold
Culture
Mouse Lung
Developmental Stage
(days)
Airway Epithelium Characteristics
Day 4 Embryonic
(9.5-14.5) Undifferentiated columnar epithelium
Day 7
Pseudoglandular
(14.5-16.5)
Emergence of monociliated cells,
surrounded by undifferentiated cells
Day 14 Canalicular
(16.5-17.5)
Short multiciliated cells, surrounded by
maturing non-ciliated cells. Early
secretory cells containing intracellular
granules and apical microvilli
Day 21 Postnatal to adult
Established airway structures
containing multiciliated cells and club
cells with mature secretory vesicles
107
Figure 4-7 Monociliated cells are found during early differentiation on decellularized lung
scaffolds, resembling pseudoglandular stage of lung development
Figure 4-7 (A) Progression of lung development at embryonic (E13), pseudoglandular (E15) and
canalicular stages is visualized with scanning (top panel) and transmission (bottom panel)
microscopy. Monociliated cells are present (arrow heads) during the pseudoglandular stage and
disappear by the end of the canalicular stage, where multiciliated cells are starting to emerge. (B)
Monociliated cells are present at day 7 of endoderm-scaffold cultures (arrow head). Early
epithelial cells have formed tight junctions (double arrow head). Lu, lumen; ci, ciliated cell;
se, secretory cell.
108
Figure 4-8 Endoderm-derived secretory cells on decellularized lung scaffolds generate
and secrete SCGB1A1 protein
Figure 4-8 (A) Transmission EM of day 14 cultures shows early secretory cells on scaffold
cultures. (B) Day 21 cultures show characteristic secretory vesicles inside differentiated Club
cells with microvilli lining the cell surface. (C) Western blot of d21 culture media shows
secreted SCGB1A1 that is not detected in media of endodermal cells cultured without
decellularized lung scaffold. Coomassie stain is used as loading control. ba, basal cell; ci, ciliated
cell; cl, club cell.
Day 21
Day 14
ba
seci
Lu
ci cl
Lu
ba
A
B
SCGB1A1
Coomassie Stain
10KDa
Lung
Scaffold
No
Scaffold
in Culture Media
C
109
Figure 4-9 Visualized progression of endoderm to airway epithelial cells on decellularized
lung scaffolds
TRP63 SCGB1A1 TUBB4 KRT5D
ay 4
SEMTEMD
ay 7
Day
14
Day
21
Day
0A B C D
110
Figure 4-9 Visualized progression of endoderm to airway epithelial cells on decellularized
lung scaffolds
(A-B) Electron micrographs of the progression of definitive endoderm cells to differentiated
airway epithelial cells. (C-D) Immunofluorescent confocal images of definitive endoderm cells
to differentiated airway epithelial cells; staining for basal cell markers TRP63 (left panel, green)
and KRT5 (right panel, red), club cell marker SCGB1A1 (left panel, red), and ciliated cell marker
TUBB4A (right panel, green).
Seeded cells appear to organize into structures and form tight junctions with four days of culture
on lung scaffolds, with some populations expressing basal cell marker TRP63. Day 7 cultures
mark the appearance of monociliated cells and many TRP63+ epithelial cell structures. Day 14
cultures show the emergence of TUBB4A+ multiciliated cells and by 21 days, mature airway
epithelial structures are present with the addition of SCGB1A1+ secretory club cells.
111
Differentiated airway epithelial cultures consist of mature cells with CFTR function
To assess functionality of differentiated cells, we examined day 21 cultures for ciliary activity
and functional expression of CFTR protein. Fundamental to airway mucociliary function,
differentiated ciliated epithelial cells contained the appropriate 9+2 dynein arms of respiratory
cilia (Figure 4-10). Furthermore, these epithelial cells displayed coordinated beating in culture
(Movie 4-1).
Mature differentiated epithelial sheets had established junctional complexes that were clearly
identifiable with EM analysis (Figure 4-5A) and IF staining for tight junction-associated protein,
TJP1 (Figure 4-11A). Stacked confocal images showed polarized CFTR expression on the apical
cell membranes, a characteristic feature of functional airway epithelial cells required for chloride
and water transport in the airways (Figure 4-11B). To test CFTR channel function on mature
scaffold cultures, we used a cAMP-stimulated halide flux assay. Iodide efflux from scaffold
cultures after cAMP agonist stimulation was measured periodically to assess channel activity.
Differentiated day 21 cells showed peak iodide efflux within the first minute of CFTR channel
stimulation, demonstrating robust expression of functional CFTR protein in mature scaffold
cultures (Figure 4-11C).
112
Figure 4-10 Mature endoderm-derived ciliated cells are motile and beat in culture
Figure 4-10 (A) H&E staining of day 21 scaffold cultures shows a sheet of ciliated cells lining a
luminal structure. Scale bar represents 25μm. (B) Transmission EM image of cilia shows
formation of the appropriate 9+2 dynein arms of motile respiratory cilia. Scale bar represents
100nm. (C) Light microscope still image of mature beating cilia in culture. Dashed line represents
the apical side of ciliated cells facing the lumen (Lu) side of scaffold culture. Ciliary activity
causes a swirl effect on the culture media immediately above the apical surface of the
epithelium.
113
Figure 4-11 Differentiated airway epithelial cultures have Functional CFTR Protein
expression
Figure 4-11 (A) IF staining of cell cultures shows mature epithelial sheets with established tight
junctions, represented by positive TJP1 staining of CDH1+ epithelial cells. Scale bar represents
50μm. (B) Stacked confocal images (X-Z plane) show polarized CFTR expression on the apical
cell membranes. Scale bar represents 25μm. (C) Iodide flux was measured after cAMP agonist-
induced CFTR activity in day 21 scaffold cultures. cAMP agonists, forskolin and 3-isobutyl-1-
methylxanthine, and a CFTR potentiator, genistein (together as forskolin, 3-isobutyl-1-
methylxanthine (IBMX), and genistein) (FIG), were added (0 min, red arrow) and replaced
periodically for 8 minutes while iodide flux was measured every minute. Peak efflux, 70.6 ±
7.7μM, was reached immediately with addition of FIG at 1 min. No efflux was detected with
added vehicle control (DMSO). n=3 experiments; mean ± SEM.
114
Organization and differentiation of endodermal cells is dependent on scaffold heparan
sulfate proteoglycans and its bound factors
To better understand the ECM inductive signals present in decellularized lungs, we selectively
cleaved and removed two major growth factor-binding matrix proteins, HS and CS94,289-291.
Decellularized scaffolds were subjected to enzymatic degradation with heparitinase-I or
chondroitinase ABC to selectively cleave HS or CS and release any bound factors.
Immunostaining of scaffolds and spectral UV analysis of incubation solution after heparitinase
or chondroitinase ABC-treatment confirmed HS or CS cleavage on scaffolds, respectively
(Figure 4-12A-B). Presence of basement membrane proteins laminin and collagen IV was
evaluated by IF microscopy to ensure their preservation following enzymatic treatments (Figure
4-12C-D). Enzyme-treated scaffolds were seeded with definitive endoderm and cultured under
ALI conditions as before for up to 21 days.
Tissue staining of day 21 enzyme-treated scaffold cultures showed that CS-cleavage did not
hinder lung-lineage differentiation of endodermal cells, while HS-cleavage on scaffolds resulted
in a complete loss of organization and differentiation (Figure 4-13A). SEM analysis showed a
lack of epithelial morphology and tight junction coupling of seeded cells in heparitinase I-treated
scaffolds, while chondroitinase ABC-treated cultures resembled untreated controls (Figure 4-
13B). This suggested that the essential cues in decellularized scaffolds that promote lung lineage
differentiation are bound to HS proteoglycans
Interestingly, endodermal cells seeded onto heparitinase-treated scaffolds and cultured in a media
supplemented with the supernatant of treated scaffolds, referred to as ‘scaffold conditioned
media’ (CM), resulted in airway differentiation of seeded cells, indistinguishable from untreated
control scaffolds (Figure 4-14A). IF analysis of CM differentiated cultures showed the presence
of TUBB4A+/ FOXJ1+ ciliated cells and CLDN10+/ SCGB1A1+ (Figure 4-14B). This suggested
that scaffold CM contains the factors that are bound to HS proteoglycans on decellularized
scaffolds and have the remarkable ability to promote airway-lineage differentiation. This further
validated the notion that the ability of decellularized scaffolds to promote differentiation to an
airway phenotype is dependent on HS proteoglycans and the factors that are bound to these matrix
proteins.
115
In an attempt to identify candidate factors that are bound to HS proteoglycans and are cleaved
after enzyme treatment, we used a proteome profiler antibody array to characterize heparitinase
I-treated decellularized lungs. Using a commercially available array, we detected 31 proteins that
remained on lung scaffolds after decellularization (Figure 4-15). As an initial screen, a
comparison of the protein profile from scaffolds treated with or without heparitinase I identified
several candidate proteins that were removed and found in the wash supernatant after enzyme
treatment: CXCL12, serpinE1, PDGF-AB, HGF, MMP8, FGF2, proliferin, IL10, and CCL3. The
identified candidate proteins may play a role in modulating cell-matrix interactions or lung
endoderm specification, however the array profile is by no means an exhaustive list and a more
in-depth analysis to parse out the HS-bound inductive factors is required.
116
Figure 4-12 Enzymatic Treatment of Acellular Scaffolds with Heparitinase I Cleaves
Heparan Sulfate Proteoglycans
Figure 4-12 (A) Natural, acellular and heparitinase I-treated acellular scaffolds were stained for
heparan sulfate using biotinylated tomato lectin. Immunostaining reveals the effective cleavage
of heparan sulfate proteoglycans following heparitinase I treatment. Scale bar=25μm. (B)
Cleaved heparan sulfate from scaffolds is detected in the remaining supernatant following
heparitinase I treatment using UV spectral analysis for optical density at 232nm. This confirms
the efficacy of the enzymatic treatment and removal of heparan sulfate proteoglycans from
scaffolds. N=3 experiments; mean ± SEM, *p<0.01. (C-D) Immunostaining for laminin and
collagen IV reveals that the basement membrane remains intact following enzymatic treatment
with heparitinase-I and chondroitinase ABC. Scale bar=50μm.
117
Figure 4-13 Organization and differentiation of endodermal cells is dependent on HS
proteoglycans on decellularized lung scaffolds
Figure 4-13 (A) Acellular scaffolds were recellularized after heparitinase-I or chondroitinase
ABC treatment. H&E staining of day 21 seeded scaffold cultures show limited organization and
differentiation in the heparitinase I-treated group, while chondroitinase ABC-treated cultures
resemble control groups. Scale bar represents 50μm. (B) Scanning EM analysis of cultures show
a lack of epithelial morphology and tight junction coupling of seeded cells in heparitinase I-
treated scaffolds, where cells appear rounded with no resemblance to a lung phenotype. Scale bar
represents 10μm.
118
Figure 4-14 Seeded endoderm differentiates to airway epithelia on heparitinase-treated
scaffolds with addition of scaffold conditioned media
Figure 4-14 (A) H&E of decellularized scaffold cultures treated with heparitinase I. Left image
shows lack of organization and differentiation of seeded endoderm after 21 days of ALI culture
on treated scaffolds. Seeded cells differentiate to airway epithelia with the addition of scaffold
conditioned media on heparitinase-treated scaffolds. (B) Immunofluorescent confocal
microscopy shows TUBB4A+/ FOXJ1+ ciliated cells and CLDN10+/ SCGB1A1+ club cells in day
21 cultures with scaffold conditioned media on heparitinase-treated scaffolds.
119
Figure 4-15 Antibody assay identifies HS-bound matrix proteins removed from
decellularized scaffolds after heparitinase I treatment
Figure 4-15 Proteome profiler antibody array detects 31 proteins from the array profile that are
remaining on lung scaffolds (black). Comparison of the protein profile from decellularized
scaffolds treated with or without heparitinase I revealed several HS-bound proteins that are
removed from scaffolds and found in the wash supernatant after enzyme treatment (red
rectangles): CXCL12, serpinE1, PDGF-AB, HGF, MMP8, FGF2, proliferin, IL10, and CCL3.
Data presented are average of two arrays from separate experiments.
1
10
100
1000
10000!
SDF-1
Ost
eopo
ntin
Cyr
61
Serpin
E1
DLL
4
PDGF-A
A
DPPIV
PDGF-A
B
Lept
in
HB-E
GF
Pentra
xin-
3
MCP-1
HGF
Endog
lin
Angiopo
ietin
-1
Plate
let f
acto
r 4
IGFBP
-1
Col
lage
n XV
III
PIG
F-2
IGFBP
-2
Endot
helin
-1
Coa
gulatio
n fa
ctor
III
MM
P-8
IGFBP
-3
FGF a
cidic
CXC
L16
MM
P9
IL-1
alph
a
FGF b
asic
Prolifer
in
IL-1
0
MIP
-1alph
a
Decellularized Lung Decellularized Lung + Heparitinase I
Me
an
Pix
el D
en
sity
120
4.5 Discussion
Lineage restriction of pluripotent cells is dependent on the interaction of niche components in the
microenvironment, where growth-factor signaling, cell-cell contact, and cell-matrix interactions
combine and control stem cell fate. Growth factors are a salient component of directing cellular
identity, and the ECM plays an important role in controlling growth factor availability by often
binding and regulating local concentrations in space and time92-94,148,271. Because of the complex
nature of these interactions during lung development, in vitro differentiation of pluripotent stem
cells to functional airway epithelial cell populations remains a challenging task.
Here we report the robust differentiation of embryonic stem cell-derived endoderm to mature,
functional airway epithelial cells using defined, serum-free culture on decellularized lung
scaffolds at air liquid interface. In chapter 3 it was demonstrated that decellularized scaffolds
alone directed differentiation of definitive endoderm to NKX2-1+/SOX2+/TRP63+ lung
progenitor cells as early as 7 days of culture. This progenitor population expanded with longer
duration and formed fully differentiated airway structures with basal cells, club cells, and beating
ciliated cells. This was achieved with notable morphological and functional resemblance to
native airway epithelia and mouse lung developmental stages. Thus, decellularized lung scaffold
cultures provide a 3D in vitro platform to better understand cell-matrix signaling during lung
development and an efficient approach for generating mature airway epithelia from pluripotent
stem cells.
Recent reports have had success with promoting differentiation of stem cell-derived NKX2-1+
lung progenitor cells to airway263,266,267,270,273,282 or alveolar11,13,261,263-265 epithelial cells by
supplementing monolayer cultures with inductive factors such as FGF2, WNT3a, and BMP4.
However, monolayer protocols have achieved lung differentiation to a limited repertoire of
functional epithelial cells lacking relevant 3D tissue structure, with low efficiencies, potential
contamination from other endodermal lineages, and in some cases with undefined culture
conditions using fetal bovine serum. This study is the first to demonstrate the efficient generation
of stem cell-derived mature airway structures with CFTR function differentiated with extended
culture on decellularized lung scaffolds alone.
Matrix-associated HS and CS proteoglycans are major modulators of growth factor binding and
signaling on the ECM surface and function by stabilizing FGF/FGFR complexes, increasing local
121
gradients, and promoting FGF internalization and processing94,274,289,292. Specification to the
airway lineage in our model was found to be dependent on HS proteoglycans and bound factors
remaining on scaffolds. Using a proteome profiler antibody array as an initial screen, we showed
that numerous proteins remain on scaffolds after decellularization. A list of potential candidates
implicated in lung specification was identified using this method, although the array profile is
not an exhaustive list and a more in-depth analysis is required to parse out the HS-bound proteins
present on scaffolds that are essential for differentiation.
Given the role of the ECM in integrating and mediating inductive signals in a 3D setting and our
success with the efficient differentiation of embryonic stem cell-derived endodermal cells to
functional airway epithelia, decellularized lung scaffolds are an attractive in vitro platform for
lung airway engineering.
122
Chapter 5
Summary and Future Directions
5
123
5.1 Summary and Concluding Remarks
While tissue engineering is a highly desirable long-term goal for lung regeneration, it remains
burgeoning. One of the most challenging aspects of lung tissue generation is creating an artificial
matrix that has similar biological composition and physiological functions to native lung tissue.
As reviewed in Chapter 1, it is clear that no master regulator exists for lung development, rather
numerous transcription factors and morphogens together control downstream effectors that drive
and direct this process55-57. Normal development requires precise temporal and spatial
coordination of cellular processes and deciding which program a cell will ultimately elect is
determined, to a large extent, by the ECM103-106.
Recapitulating an ECM that supports immunity, the mechanical function of breathing and the
physiology of gas exchange certainly makes for a complex task. Many reports have demonstrated
the use of natural scaffolds generated from decellularized organs in tissue regeneration proof-of-
concept studies171,172,175,176,254. Despite the growing acceptance of using decellularized tissue in
regenerative medicine approaches, there are limited studies that examine the direct role of the
ECM in tissue-specific differentiation of pluripotent stem cells. The studies presented in this
thesis focus on generating viable lung scaffolds and characterizing their subsequent contribution
to lineage restriction of definitive endoderm germ cells following recellularization. This work
demonstrates the capacity of decellularized lung scaffolds to direct differentiation of endoderm
to mature functional airway epithelia, with the requirement of matrix-bound heparan sulfate
proteoglycans (Figure 5-1).
In chapter 2, decellularization of adult mouse and rat lungs was carried out using three different
approaches: enzymatic treatment with trypsin, chemical treatments with CHAPS, and SDS
detergents. We demonstrated that milder zwitterionic CHAPS detergent, with the addition of
hypertonicity and chelating agent EDTA, best achieved decellularization. Tissue staining,
immunofluorescent confocal analysis, electron microscopy, DNA analysis, WB analysis and
tensile testing confirmed cellular removal and preservation of the ECM following lung
decellularization. Despite optimization of the protocol with CHAPS, it was noted that
preservation of the matrix was dependent on the frequency of lavages. With more lavages, there
was a gradual decrease in basement membrane protein laminin detected by immunoblot. This
demonstrated that even exposure to milder decellularizing agents may disrupt the ECM protein
composition and careful characterization is necessary to ensure the isolated scaffold can
124
nonetheless support cell culture. CHAPS has also been identified by other groups as the best
reagent for lung decellularization, however, our technique and delivery is distinct from other
published work. Previous studies have performed decellularization by removing the lungs and
using a bioreactor to circulate large volumes of decellularizing agents for several hours175,176. In
this study, complete decellularization was achieved rapidly and economically in approximately
20 minutes using short tracheal lavages with the lungs remaining in situ.
Biocompatibility of the scaffolds was confirmed using an in vitro ALI culture system. Thick
sections of decellularized lung were seeded with primary rat fetal lung epithelial cells and
maintained in culture for 21 days. Despite difficulty in culturing primary lung epithelial cells in
standard conditions in vitro, seeded pulmonary epithelial cells thrived on scaffolds258.
Recellularization led to reestablishment of both proximal and distal epithelial cell populations.
Epithelial structures formed with distal cells expressing KRT18 and pSFTPC, or proximal cells
expressing SCGB1A1 and TUBB4A. No tubular structures were identified that contained both
airway and alveolar epithelial cells types. This suggests that although lung scaffolds support both
populations, region-specific differences are created during cell-matrix culture favoring one
population over the other. We concluded that this optimized decellularization process and ALI
culture system can support lung epithelial cell culture and could be suitable as a platform for stem
cell differentiation towards the lung lineage.
Repopulation of decellularized scaffolds is increasingly used as an end-point assay to assess
regenerative potential of pre-differentiated cells261,263-265. A recent report has demonstrated the
importance of the matrix environment for maintaining lung identity using pre-differentiated
NKX2-1+ lung progenitor cells and growth factor-supplemented culture media. Although these
reports demonstrate the feasibility of using lung scaffolds in tissue engineering applications, none
have assessed the inductive capacity of the ECM alone during early lung specification. In chapter
3, we revealed the exciting ability of lung decellularized scaffolds to promote differentiation of
definitive endoderm germ cells to NKX2-1+/SOX2+ proximal lung progenitor cells. Lung
progenitors were detected at day 7 of culture and were in abundance by day 21, with
approximately 46% of all cells expressing NKX2-1. It is unclear whether the rise in lung
progenitors with extended culture is the result of preferential expansion of Nkx2-1+ cells or due
to increased apoptosis of cells that are not committed to the lung lineage. Although limited
NKX2-1+/SOX9+ alveolar progenitor cells were found on scaffolds at 7 days, they disappeared
125
with longer duration of culture suggesting that differentiation to the distal lineage perhaps
requires additional inductive factors after NKX2-1+ specification on scaffolds.
This distinct ability of decellularized lung to differentiate endoderm into airway progenitors was
further restated by the lack of differentiation achieved with seeded individual matrix proteins
(fibronectin, laminin, collagen I, collagen IV) and ECM substitute Matrigel. Interestingly,
decellularized kidney scaffolds did not support cell adherence or tissue-specific differentiation.
To generate kidney scaffolds, due to its composition and higher density, an SDS-based solution
was used to achieve decellularization, in contrast to lung decellularization that was achieved
using a CHAPS-based solution (data not shown). This was a limitation in the direct comparison
of decellularized lung versus kidney scaffolds for endoderm culture. However, despite failure to
support endodermal cell culture, these kidney scaffolds have been shown to support both ESC-
derived mesodermal cells and also nephron progenitor cells in culture and differentiation (data
not shown). Therefore, the inability of kidney scaffolds to support endoderm was likely due to
the kidney matrix microenvironment, and not due to SDS exposure during the decellularization
process. These observations, suggested that mesoderm-derived kidney scaffolds biologically
differ from lung scaffolds in their ability to support endoderm lineage differentiation.
Decellularized scaffolds derived from mouse lungs seeded with mouse definitive endodermal
cells produced similar results to that obtained with rat lung scaffolds. Furthermore, differentiation
of definitive endoderm to airway epithelia using rat lung scaffolds was reproducible with a
rat ESC line (DAc8). This demonstrated the conserved nature of the interaction between lung
scaffolds and cell lines derived from both species.
Recent reports have had success with promoting differentiation of pluripotent stem cells to
NKX2-1+ lung progenitor cells using monolayer cultures and supplementation with inductive
factors263,266,267,270,273,282. Stem cell-derived lung progenitors have also been further differentiated
towards airway263,266,267,270,273,282 or alveolar11,13,261,263-265 epithelial cells using additional
supplementation with high concentrations of inductive factors such as FGF2, WNT3a, and
BMP4. These studies demonstrate the feasibility of using different stem cell sources in lung tissue
differentiation. Although promising, monolayer differentiation protocols using different
cocktails of growth factors have achieved lung differentiation to a limited repertoire of functional
epithelial cells lacking relevant 3D tissue structure261,263. Some protocols have reported low
efficiencies with potential contamination from other endodermal lineages such as Alb+ liver cells,
126
while other studies have used undefined culture conditions with FBS supplementation264,273. In
chapter 4, we further investigated the potential of decellularized scaffolds without
supplementation of exogenous factors, to promote differentiation of NKX2-1+ lung progenitors
into mature airway epithelia.
Extended culture of seeded cells resulted in expansion of progenitor populations and formed fully
differentiated airway structures by 21 days of culture complete with TRP63+/KRT5+ basal cells,
SCGB1A1+ club cells, and FOXJ1+/TUBB4A+ beating ciliated cells. This was achieved with
notable morphological and functional resemblance to native airway epithelia and mouse lung
developmental stages. Importantly, mature epithelial cells had established junctional complexes
and expressed functional CFTR protein, demonstrated using a modified iodide efflux assay.
Interestingly, scaffolds generated from both the upper airway and alveolar lung regions directed
differentiation to airway epithelial cells, with comparable cellular organization and
differentiation. With the exception of a small NKX2-1+/SOX9+ distal progenitor population
detected at day 7, no traces of mature AT1 and AT2 epithelial cells were found in culture at day
14 and day 21 on scaffolds derived from the alveolar regions. This suggested that seeded
endodermal cells similarly adhere to basement membrane proteins found in both regions of the
lungs. The basement membrane throughout the adult lung is comprised of collagen IV, laminin,
HSPG and CS87, 88. Following cell adherence, newly synthesized matrix proteins are likely
secreted and deposited by seeded cells, though this was not confirmed in this study. While seeded
endodermal cells were restricted to the lung lineage, the lack of differentiation from NKX2-
1+/SOX9+ distal progenitors to mature alveolar epithelia is likely due to the requirement of
additional inductive factors, not present on decellularized scaffolds.
A key finding of this work was identifying basal stem cells as the likely progenitors giving rise
to the other airway epithelial cell populations on early scaffold cultures. Lineage tracing
experiments have shown that basal cells can undergo long-term self-renewal and give rise to
ciliated and secretory luminal cells both in vivo and in vitro cultures62,233,234. In this study, cells
expressing TRP63 were found as early as 4 days of endoderm culture on scaffolds. Basal cells
are a heterogeneous cell population with diverse expression profiles of TRP63, KRT5, KRT14,
PDPN, and NGFR235,236. This heterogeneity was found on scaffold cultures, leading to questions
regarding the regenerative capacity and differentiation ability of identified subpopulations. Basal
cells were found in abundance in early proliferative day 7 cultures, while their presence declined
127
steadily with extended culture. This fall occurred in parallel with a decline in proliferative cells
and with the rise of differentiation to ciliated and club cells. The initial abundance followed by a
fall in cell numbers, suggests that basal cells could be the precursor cells that undergo a terminal
differentiation program and give rise to mature airway epithelia with extended culture. We
concluded that decellularized lung scaffold cultures provide a 3D in vitro platform to better
understand cell-matrix signaling during lung development and an efficient approach for
generating mature airway epithelia from pluripotent stem cells.
In the 3D scaffold culture model, endoderm was maintained at air-liquid interface for the entire
duration (from seeding to day 21) of culture. Although air-liquid interface has been demonstrated
to support lung epithelial differentiation in vitro, especially mucociliary epithelium, the majority
of lung development and airway epithelial cell differentiation occurs in utero, prior to any
exposure to air flow267,288. Therefore, our 3D culture model is limited in its ability to mimic the
developmental milieu of lung development, since the bulk of lung lineage specification in situ
occurs under a submerged setting. Future work could examine the effect of different oxygen
levels, air-flow exposure, and mechanical fetal breathing simulation on lineage specification of
endoderm on scaffolds. It is important to note that our differentiation approach is also limited by
the absence of any mesodermal cells such as endothelial cells, pericytes, and interstitial
fibroblasts. As described in Chapter 1, the cross-talk between the lung epithelium and
mesenchymal components mediates branching morphogenesis and establishes proximal-distal
patterning59. It is interesting, however, that the environment recapitulated by lung scaffolds alone
was sufficient to drive differentiation into mature airway epithelium in vitro. This suggests that
some inductive factors secreted by non-epithelial layers including growth factors may be present
on adult lung scaffolds following decellularization.
The ECM plays an important role in controlling growth factor availability during development
and homeostasis by often binding and regulating local concentrations in space and time92-94,148,271.
A significant finding of this work was the importance of matrix heparan sulfate proteoglycans
and their bound factors in promoting lung differentiation. Specification to the airway lineage in
our model was found to be dependent on HS proteoglycans and bound factors remaining on
scaffolds. Using the proteome profiler array, 31 proteins were identified on lung scaffolds
following decellularization. From this list, nine proteins were found to have
been depleted with exposure to heparitinase I. FGF2 and FGF7 (HGF) were among those
128
identified and are known to have a role in natural lung development and lineage restriction in
vitro265, 267, 268. CXCR4 ligand, CXCL12 (also known as SDF1), was also found among the
proteins bound to HSPG on lung scaffolds. CXCR4 is expressed in embryonic endoderm and
was used to identify ESC-derived definitive endoderm. Interactions between CXCR4+
endodermal cells and its ligand found on lung scaffolds may have a role in cell-matrix crosstalk
in our culture setup. Other candidates including matrix metalloproteinase MMP8, together with
cytokines involved in chemotactic and anti-inflammatory activity, CCL3 and IL10, were also
identified. These cytokines are known to affect the microenvironment during repair and tissue
remodeling. To determine whether these candidates are important for lung differentiation in our
culture setup, their interactions can be inhibited using antibodies or selective inhibitors in future
work. This array profile was by no means an exhaustive list and a more in-depth analysis to parse
out the HS-bound inductive factors is required. High-resolution mass spectrometric analysis
and/or larger proteome profiler arrays containing over 500 proteins can be used to reveal other
HS-bound differentiation factors essential to lung differentiation. Given the role of the ECM in
integrating and mediating inductive signals in a 3D setting and our success with the efficient
differentiation of embryonic stem cell-derived endodermal cells to functional airway epithelia,
decellularized lung scaffolds are an attractive in vitro platform for the study of cell-matrix
interactions and for lung airway engineering. It is unclear whether the differentiation activity
characterized on decellularized scaffolds follows the natural progression of endoderm
specification in lung development or whether it represents a reparative pathway activated during
lung tissue injury. We have noted elements of both in the lung scaffold cultures. Step-wise
specification of definitive endoderm to early NKX2-1+ lung progenitors and thereafter to SOX2+
airway progenitors is reminiscent of developmental processes that have been described in the
lung81, 276. However, the upsurge of a heterogeneous basal cell population and high proliferative
activity noted early on scaffold cultures, followed by a drop in TRP63+ basal cells with the
emergence of mucociliary epithelium, is indicative of lung tissue repair in response to injury62,
235. Therefore the differentiation undertaken by endodermal cells on lung scaffolds could
encompass two distinct pathways of lung development and repair, or perhaps the fundamental
interactions that occur during development and repair are not divergent in nature; at least not in
this culture setup using decellularized lung scaffolds.
This differentiation strategy generates a renewable source of functional airway epithelial cells in
a 3D matrix setting that can be further examined for regenerative potential in vivo. Seeded
129
decellularized lung scaffolds from human or xenogeneic sources can be used for generation of
lung epithelia that may be valuable for airway repair and regeneration and can serve as a platform
for drug discovery in human airway-related diseases such as cystic fibrosis.
130
Figure 5-1 Summary schematic
Section of
Decellularized Lung
ESC
DefinitiveEndoderm
- Heparitinase I + Heparitinase I
Airway Epithelium Undifferentiated Cellsday 21
day 0
Heparan Sulfate Proteoglycans
131
5.2 Future Directions
5.2.1 Identifying the role of key matrix proteins in lung specification
As reviewed in Chapter 1 and the work presented in this thesis, cell-matrix interactions play a
fundamental role in cell fate, yet many questions remain. To investigate the role of different
matrix proteins in differentiation to early lung precursors and airway epithelial cells, inhibition
of cell-matrix interactions could be done by targeting and inhibiting select integrin receptor
signaling. This inhibition can be achieved using cell adhesive peptides or monoclonal antibodies
specific to integrin receptors and their protein ligands293,294. Targeted integrin receptors could
include α6β4 (laminin), α1β1 and α2β1 (collagen), and α5β1 (fibronectin). Compromised
scaffolds should be characterized for overall structure using tissue staining, electron microscopy,
and mechanical integrity using elastic measurements prior to recellularization. Following ALI
culture of seeded compromised scaffolds, adherence, proliferation, and differentiation could be
characterized to identify key matrix proteins involved in lung-lineage specification and to better
understanding these interactions during development.
5.2.2 Characterize basal cell subpopulations and their differentiation potential
In vivo lineage tracing experiments and injury models have shown that basal cells can undergo
long-term self-renewal and give rise to ciliated and secretory cells during development,
homeostasis and repair. Due to their heterogeneity with variable expression profiles for KRT5,
KRT14, PDPN, and NGFR, questions regarding the regenerative capacity and expandability of
basal cell subpopulations remain. Our findings suggest that early TRP63+ basal cells are the
progenitor cells that give rise to fully differentiated ciliated and club cell populations on scaffolds.
Transcription factor Trp63 is required for basal cells identity during cellular specification, and
future work could employ CRISPR technology to target its expression and in turn disrupt the
emergence of basal cells on scaffolds. Subsequent recellularization experiments would determine
whether an initial basal cell identity is required for generation of mature airway epithelial cell
populations on decellularized scaffolds, and help elucidate the differentiation pathway taken by
seeded endodermal cells to become functional airway epithelial cells.
5.2.3 Direct differentiation to the alveolar linage on decellularized lung scaffolds
This work has demonstrated robust endoderm differentiation into mature airway epithelial cell
populations using lung scaffold cultures, however no distal alveolar cell characteristics and
132
protein expression was detected, beyond NKX2-1 expression. This suggested that perhaps
differentiation to the distal lineage requires additional inductive factors following NKX2-1
specification on scaffolds. We have preliminary work that demonstrates a shift to distal identity
with continuous supplementation of scaffold cultures using select growth factors that have been
implicated in alveologenesis261,263,265. Growth factors added to culture media at distinct intervals
included FGF2, FGF7, FGF10, Wnt3a, retinoid acid, and dexamethasone. Under such conditions,
we observed an increase in Sftpc mRNA and positive proSFTPC immunostaining of tissue
sections, following three weeks of scaffold culture. Large glycogen deposits and structures
reminiscent of multivesicular bodies typically found in type II epithelial cells were visualized
with TEM. Future work will need to focus on optimizing the dosage and duration of exposure to
specific growth factors to promote differentiation to a more mature alveolar epithelial population.
Presence of mature lamellar bodies and quantification of surfactant production in culture will be
used to assess differentiation and cellular function. Furthermore, future work could examine the
effect of different oxygen levels, submerged culture, air-flow exposure, and mechanical fetal
breathing simulation on lineage specification of endoderm on lung scaffolds.
5.2.4 Determine the regenerative potential of scaffold cultures for in vivo engraftment
Assessing the capacity of differentiated scaffold constructs to incorporate and revascularize in
vivo is an important next step for the use of decellularized scaffold applications in regenerative
medicine. Initial experiments could be performed by implanting the scaffold culture into the
greater omentum fat pad of young postnatal or adult mice. Cultures could be generated from sex-
mismatched autologous ESC lines for easy identification of cells after implantation. For example
endoderm generated from the male-derived mouse C2 ESC line can be seeded and differentiated
on lung scaffolds, and implanted into the lungs of female C57BL/6 stain mice. Transplantation
can be done with scaffolds alone, early day 7 cultures, or mature day 21 cultures containing
differentiated airway epithelia. These proof-of-concept experiments will look for any signs of
rejection or incorporation and revascularization of transplants.
Future transplantation experiments could implant scaffold cultures directly into the distal lung
parenchyma, as described previously in adult mice295. Briefly, a thoracotomy is performed and
the left lobe of the lung is mobilized. An injection of PBS is given into the lung parenchyma to
create a reservoir for the scaffold. The scaffold is then injected into the site using an
angiocatheter. Transplants can be removed and examined 7 days and 21 days after surgery.
133
Tissue could be analyzed for signs of inflammation, proliferation, revascularization, and lung
differentiation. If the scaffolds are tolerated well in healthy mice studies, the capacity of these
cells to improve function in an injury model could be examined thereafter.
134
References
1. Have-Opbroek, Ten, A. A. W. Lung development in the mouse embryo. Experimental
Lung Research 17, 111–130 (1991).
2. Perl, A.-K. T. & Whitsett, J. A. Molecular mechanisms controlling lung morphogenesis.
Clinical Genetics 56, 14–27 (1999).
3. Ang, S.-L. et al. The formation and maintenance of the definitive endoderm lineage in the
mouse: involvement of HNF3/forkhead proteins. Development 119, 1301–1315 (1993).
4. Kaestner, K. H. & Knochel, W. Unified nomenclature for the winged helix/forkhead
transcription factors. Genes & Development 14, 142–146 (2000).
5. Monaghan, A. P., Kaestner, K. H., Grau, E. & Schütz, G. Postimplantation expression
patterns indicate a role for the mouse forkhead/HNF-3 alpha, beta and gamma genes in
determination of the definitive endoderm, chordamesoderm and neuroectoderm.
Development 119, 567–578 (1993).
6. Stahlman, M. T. Temporal–spatial distribution of hepatocyte nuclear factor-3beta in
developing human lung and other foregut derivatives. The Journal of Histochemistry and
Cytochemistry 46, 955–962 (1998).
7. Zhou, L., Lim, L., Costa, R. H. & Whitsett, J. A. Thyroid transcription factor-1, hepatocyte
nuclear factor-3beta, surfactant protein B, C, and clara cell secretory protein in developing
mouse lung. The Journal of Histochemistry and Cytochemistry 44, 1183–1196 (1996).
8. Ang, S.-L. & Rossant, J. HNF-3beta is essential for node and notochord formation in
mouse development. Cell 78, 561–574 (1994).
9. Weinstein, D. C. et al. The Winged-Helix Transcription Factor HNF-3B Is Required for
Notochord Development in the Mouse Embryo. Cell 78, 575–588 (1994).
10. Dufort, D., Schwartz, L., Harpal, K. & Rossant, J. The transcription factor HNF3beta is
required in visceral endoderm for normal primitive streak morphogenesis. Development
125, 3015–3025 (1998).
11. Kimura, S. et al. The T/ebp Null Mouse: Thyroid-Specific Enhancer-Binding Protein is
Essential for the Organogenesis of the Thyroid, Lung, Ventral Forebrain, and Pituitary.
Genes & Development 10, 60–69 (1996).
12. Lazzaro, D., Price, M., De Felice, M. & Di Lauro, R. The transcription factor TTF-1 is
expressed at the onset of thyroid and lung morphogenesis and in restricted regions of the
foetal brain. Development 113, 1093–1104 (1991).
13. Minoo, P., Su, G., Drum, H., Bringas, P. & Kimura, S. Defects in Tracheoesophageal and
Lung Morphogenesis in Nkx2.1(-/-) Mouse Embryos. Developmental Biology 209, 60–71
(1999).
14. Goldfarb, M. Functions of fibroblast growth factors in vertebrate development. Cytokine &
Growth Factor Reviews 7, 311–325 (1996).
15. Ornitz, D. M. & Itoh, N. Fibroblast growth factors. genome Biology 2, 3005.1–3005.12
(2001).
16. Bellusci, S., Grindley, J., Emoto, H., Itoh, N. & Hogan, B. L. Fibroblast growth factor 10
(FGF10) and branching morphogenesis in the embryonic mouse lung. Development 124,
4867–4878 (1997).
17. Min, H. et al. Fgf-10 is required for both limb and lung development and exhibits striking
functional similarity to Drosophila branchless. Genes & Development 12, 3156–3161
(1998).
18. Sekine, K. et al. Fgf10 is essential for limb and lung formation. Nature Genetics 21, 138–
141 (1999).
19. Peters, K., Werner, S., Liao, X., Wert, S. E. & Whitsett, J. Targeted expression of a
dominant negative FGF receptor blocks branching morphogenesis and epithelial
135
differentiation of the mouse lung. EMBO 13, 3296–3301 (1994).
20. Tefft, D. et al. mSprouty2 inhibits FGF10-activated MAP kinase by differentially binding
to upstream target proteins. Am. J. Physiol. Lung Cell Mol. Physiol. 283, L700–6 (2002).
21. Bellusci, S. et al. Involvement of Sonic hedgehog (Shh) in mouse embryonic lung growth
and morphogenesis. Development 124, 53–63 (1997).
22. Weaver, M., Dunn, N. R. & Hogan, B. L. Bmp4 and Fgf10 play opposing roles during
lung bud morphogenesis. Development 127, 2695–2704 (2000).
23. Bellusci, S., Henderson, R., Winnier, G., Oikawa, T. & Hogan, B. L. Evidence from
normal expression and targeted misexpression that bone morphogenetic protein (Bmp-4)
plays a role in mouse embryonic lung morphogenesis. Development 122, 1693–1702
(1996).
24. Okubo, T. & Hogan, B. L. M. Hyperactive Wnt signaling changes the developmental
potential of embryonic lung endoderm. J. Biol. 3, 11 (2004).
25. Metzger, R. J., Klein, O. D., Martin, G. R. & Krasnow, M. A. The branching programme
of mouse lung development. Nature 453, 745–750 (2008).
26. Short, K., Hodson, M. & Smyth, I. Spatial mapping and quantification of developmental
branching morphogenesis. Development 140, 471–478 (2013).
27. Heine, U. I., Munoz, E. F., Flanders, K. C., Roberts, A. B. & Sporn, M. B. Colocalization
of TGF-beta 1 and collagen I and III, fibronectin and glycosaminoglycans during lung
branching morphogenesis. Development 109, 29–36 (1990).
28. Pelton, R. W., Johnson, M. D., Perkett, E. A., Gold, L. I. & Moses, H. L. Expression of
transforming growth factor-beta 1, -beta 2, and -beta 3 mRNA and protein in the murine
lung. American Journal of Respiratory cell and molecular biology 5, 522–530 (1991).
29. Pelton, R. W., Saxena, B., Jones, M., Moses, H. L. & Gold, L. I. Immunohistochemical
Localization of TGFbeta1, TGFbeta2,andTGFbeta3
intheMouseEmbryo:ExpressionPatternsSuggestMultiple Roles during Embryonic
Development. The Journal of Cell Biology 115, 1091–1105 (1991).
30. Bragg, A. D., Moses, H. L. & Serra, R. Signaling to the epithelium is not sufficient to
mediate all of the effects of transforming growth factor beta and bone morphogenetic
protein 4 on murine embryonic lung development. Mechanisms of Development 109, 13–
26 (2001).
31. Serra, R. pRb is necessary for inhibition of N-myc expression by TGF-beta1 in embryonic
lung organ cultures. Development 121, 3057–3066 (1995).
32. Serra, R., Pelton, R. W. & Moses, H. L. TGFbeta1 inhibits branching morphogenesis and
N-myc expression in lung bud organ cultures. Development 120, 2153–2161 (1994).
33. Zeng, X., Gray, M., Stahlman, M. T. & Whitsett, J. A. TGF-beta1 Perturbs Vascular
Development and Inhibits Epithelial Differentiation in Fetal Lung In Vivo. Developmental
Dynamics 221, 289–301 (2001).
34. Zhou, L., Dey, C. R., Wert, S. E. & Whitsett, J. A. Arrested Lung Morphogenesis in
Transgenic Mice Bearing an SP-C–TGF-beta1 Chimeric Gene. Developmental Biology
175, 227–238 (1996).
35. Wrana, J. L., Attisano, L., Wieser, R., Ventura, F. & Massague, J. Mechanism of
activation of the TGF-beta receptor. Nature 370, 341–347 (1994).
36. Zhao, J. et al. Abrogation of Transforming Growth Factor-b Type II Receptor Stimulates
Embryonic Mouse Lung Branching Morphogenesis in Culture. Developmental Biology
180, 242–257 (1996).
37. Zhao, J., Lee, M., Smith, S. & Warburton, D. Abrogation of Smad3 and Smad2 or of
Smad4 Gene Expression Positively Regulates Murine Embryonic Lung Branching
Morphogenesis in Culture. Developmental Biology 194, 182–195 (1998).
38. Dickson, M. C. et al. Defective haematopoiesis and vasculogenesis in transforming growth
136
factor-beta1 knock out mice. Development 121, 1845–1854 (1995).
39. Shull, M. M. et al. Targeted disruption of the mouse transforming growth factor-β1 gene
results in multifocal inflammatory disease. Nature 359, 693–699 (1992).
40. Sanford, L. P. et al. TGFbeta2 knockout mice have multiple developmental defects that are
non- overlapping with other TGFbeta knockout phenotypes. Development 124, 2659–2670
(1997).
41. Attisano, L. & Lee-Hoeflich, S. T. The Samds. genome Biology 2, 3010.1–3010.8 (2001).
42. Dick, A. & Risau, W. Expression of Smad1 and Smad2 During Embryogenesis Suggests a
Role in Organ Development. Developmental Dynamics 1998, 293–305 (1998).
43. Keijzer, R. et al. The transcription factor GATA6 is essential for branching morphogenesis
and epithelial cell differentiation during fetal pulmonary development. Development 128,
503–511 (2001).
44. Morrisey, E. E. GATA-6: A Zinc Finger Transcription Factor That Is Expressed in
Multiple Cell Lineages Derived from Lateral Mesoderm. Developmental Biology 177,
309–322 (1996).
45. Koutsourakis, M., Langeveld, A., Patient, R., Beddington, R. & Grosveld, F. The
transcription factor GATA6 is essential for early extraembryonic development.
Development 126, 723–732 (1999).
46. Morrisey, E. E. et al. GATA6 regulates HNF4 and is required for differentiation of
visceral endoderm in the mouse embryo. Genes & Development 12, 3579–3590 (1998).
47. Keijzer, R. & Post, M. in Lung Development (Gaultier, C., Bourbon, J. R. & Post, M.) 1
(Oxford University Press, 1999).
48. Yang, H., Lu, M. M., Zhang, L., Whitsett, J. A. & Morrisey, E. E. GATA6 regulates
differentiation of distal lung epithelium. Development 129, 2233–2246 (2002).
49. Koutsourakis, M. et al. Branching and differentiation defects in pulmonary epithelium
with elevated Gata6 expression. Mechanisms of Development 105, 105–114 (2001).
50. Moens, C. B., Auerbach, A. B., Conlon, R. A., Joyner, A. L. & Rossant, J. A targeted
mutation reveals a role for N-myc in branching morphogenesis in the embryonic mouse
lung. Genes & Development 6, 691–704 (1992).
51. Stanton, B. R., Perkins, A. S., Tessarollo, L., Sassoon, D. A. & Parada, L. F. Loss of N-
myc function results in embryonic lethality and failure of the epithelial component of the
embryo to develop. Genes & Development 6, 2235–2247 (1992).
52. Charron, J. et al. Embryonic lethality in mice homozygous for a targeted disruption of the
N-myc gene. Genes & Development 6, 2248–2257 (1992).
53. Moens, C. B., Stanton, B. R., Parada, L. F. & Rossant, J. Defects in heart and lung
development in compound heterozygotes for two different targeted mutations at the N-myc
locus. Development 119, 485–499 (1993).
54. Okubo, T. Nmyc plays an essential role during lung development as a dosage-sensitive
regulator of progenitor cell proliferation and differentiation. Development 132, 1363–1374
(2005).
55. Goss, A. M. et al. Wnt2/2b and b-Catenin Signaling Are Necessary and Sufficient to
Specify Lung Progenitorsin the Foregut. Developmental Cell 17, 290–298 (2009).
56. Liu, Y., Martinez, L., Ebine, K. & Abe, M. K. Role for mitogen-activated protein kinase
p38α in lung epithelial branching morphogenesis. Developmental Biology 314, 224–235
(2008).
57. Shu, W. et al. Wnt/β-catenin signaling acts upstream of N-myc, BMP4, and FGF signaling
to regulate proximal–distal patterning in the lung. Developmental Biology 283, 226–239
(2005).
58. M Weaver, N. R. D. A. B. L. M. H. Bmp4 and Fgf10 play opposing roles during lung bud
morphogenesis. 1–10 (2000).
137
59. Morrisey, E. E. & Hogan, B. L. M. Preparing for the First Breath: Geneticand Cellular
Mechanisms in Lung Development. Developmental Cell 18, 8–23 (2010).
60. Rock, J. R. & Hogan, B. L. M. Epithelial Progenitor Cells in Lung Development,
Maintenance, Repair, and Disease. Annu. Rev. Cell Dev. Biol. 27, 493–512 (2011).
61. Hogan, B. L. M. et al. Repair and Regeneration of the Respiratory System: Complexity,
Plasticity,and Mechanisms of Lung Stem Cell Function. Stem Cell 15, 123–138 (2014).
62. Rock, J. R. et al. Basal cells as stem cells of the mouse trachea and human airway
epithelium. Proceedings of the National Academy of Sciences 106, 12771–12775 (2009).
63. Sunday, M. E. Pulmonary Neuroendocrine Cells and Lung Development. Endocr. Pathol.
7, 173–201 (1996).
64. Morimoto, M., Nishinakamura, R., Saga, Y. & Kopan, R. Different assemblies of Notch
receptors coordinate the distribution of the major bronchial Clara, ciliated and
neuroendocrine cells. Development 139, 4365–4373 (2012).
65. Guseh, J. S. et al. Notch signaling promotes airway mucous metaplasia and inhibits
alveolar development. Development 136, 1751–1759 (2009).
66. Chen, G. et al. SPDEF is required for mouse pulmonary goblet cell differentiation and
regulates a network of genes associated with mucus production. J. Clin. Invest. 119, 2914–
2924 (2009).
67. Adamson, I. Y. & Bowden, D. H. Derivation of type 1 epithelium from type 2 cells in the
developing rat lung. Lab Invest 32, 736–745 (1975).
68. Desai, T. J., Brownfield, D. G. & Krasnow, M. A. Alveolar progenitor and stem cells in
lung development, renewal and cancer. Nature 1–16 (2014). doi:10.1038/nature12930
69. Reynolds, S. D., Reynolds, P. R., Pryhuber, G. S., Finder, J. D. & Stripp, B. R.
Secretoglobins SCGB3A1 and SCGB3A2 Define Secretory Cell Subsets in Mouse and
Human Airways. American Journal of Respiratory and Critical Care Medicine 166, 1498–
1509 (2002).
70. Yuan, B. et al. Inhibition of Distal Lung Morphogenesis in Nkx2.1(-/-) Embryos.
Developmental Dynamics 217, 180–190 (2000).
71. Tichelaar, J. W., Wert, S. E., Costa, R. H., Kimura, S. & Whitsett, J. A. HNF-3/forkhead
homologue-4 (HFH-4) is expressed in ciliated epithelial cells in the developing mouse
lung. The Journal of Histochemistry and Cytochemistry 47, 823–832 (1999).
72. Blatt, E. N., Yan, X. H., Wuerffel, M. K., Hamilos, D. L. & Brody, S. L. Forkhead
transcription factor HFH-4 expression is temporally related to ciliogenesis. American
Journal of Respiratory cell and molecular biology 21, 168–176 (1999).
73. Brody, S. L., Yan, X. H., Wuerffel, M. K., Song, S.-K. & Shapiro, S. D. Ciliogenesis and
left-right axis defects in forkhead factor HFH-4-null mice. American Journal of
Respiratory cell and molecular biology 23, 45–51 (2000).
74. Chen, J., Knowles, H. J., Hebert, J. L. & Hackett, B. P. Mutation of the mouse hepatocyte
nuclear factor/forkhead homologue 4 gene results in an absence of cilia and random left-
right asymmetry. J. Clin. Invest. 102, 1077–1082 (1998).
75. Pepicelli, C. V., Lewis, P. M. & Mcmahon, A. P. Sonic hedgehog regulates branching
morphogenesis in the mammalian lung. Current Biology 8, 1083–1086 (1998).
76. Weaver, M., Yingling, J. M., Dunn, N. R., Bellusci, S. & Hogan, B. L. Bmp signaling
regulates proximal-distal differentiation of endoderm in mouse lung development.
Development 126, 4005–4015 (1999).
77. Shi, W., Zhao, J., Anderson, K. D. & Warburton, D. Gremlin negatively modulates BMP-4
induction of embryonic mouse lung branching morphogenesis. Am. J. Physiol. Lung Cell
Mol. Physiol. 280, L1030–L1039 (2001).
78. Lu, M. M. et al. The bone morphogenic protein antagonist gremlin regulates proximal-
distal patterning of the lung. Developmental Dynamics 222, 667–680 (2001).
138
79. Chang, D. R. et al. Lung epithelial branching program antagonizes alveolar differentiation.
Proceedings of the National Academy of Sciences 110, 18042–18051 (2013).
80. Rockich, B. E. et al. Sox9 plays multiple roles in the lung epithelium during branching
morphogenesis. Proceedings of the National Academy of Sciences 110, E4456–64 (2013).
81. Tompkins, D. H. et al. Sox2 Is Required for Maintenance and Differentiation of
Bronchiolar Clara, Ciliated, and Goblet Cells. PLoS ONE 4, e8248 (2009).
82. Rawlins, E. L., Clark, C. P., Xue, Y. & Hogan, B. L. M. The Id2+ distal tip lung
epithelium contains individual multipotent embryonic progenitor cells. Development 136,
3741–3745 (2009).
83. Hinek, A. Biological roles of the non-integrin elastin/laminin receptor. Biol. Chem. 377,
471–480 (1996).
84. Mochizuki, S., Brassart, B. & Hinek, A. Signaling pathways transduced through the elastin
receptor facilitate proliferation of arterial smooth muscle cells. J. Biol. Chem. 277, 44854–
44863 (2002).
85. Heino, J. & Käpylä, J. Cellular receptors of extracellular matrix molecules. Curr. Pharm.
Des. 15, 1309–1317 (2009).
86. Kim, S. H., Turnbull, J. & Guimond, S. Extracellular matrix and cell signalling: the
dynamic cooperation of integrin, proteoglycan and growth factor receptor. Journal of
Endocrinology 209, 139–151 (2011).
87. McGowan, S. E. Extracellular matrix and the regulation of lung development and repair.
FASEB J. 6, 2895–2904 (1992).
88. Daley, W. P., Peters, S. B. & Larsen, M. Extracellular matrix dynamics in development
and regenerative medicine. Journal of Cell Biology 121, 255–264 (2008).
89. Eickelberg, O. et al. Extracellular matrix deposition by primary human lung fibroblasts in
response to TGF-beta1 and TGF-beta3. Am. J. Physiol. Lung Cell Mol. Physiol. 276,
L814–824 (1999).
90. Princivalle, M. & De Agostini, A. Developmental roles of heparan sulfate proteoglycans: a
comparative review in Drosophila, mouse and human. Int. J. Dev. Biol. 46, 267–278
(2002).
91. Sun, C. et al. Selectivity in glycosaminoglycan binding dictates the distribution and
diffusion of fibroblast growth factors in the pericellular matrix. Open Biology 6, (2016).
92. Alberti, K. et al. Functional immobilization of signaling proteins enables control of stem
cell fate. Nat Meth 5, 645–650 (2008).
93. Peerani, R. et al. Niche-mediated control of human embryonic stem cell self-renewal and
differentiation. The EmBO journal 26, 4744–4755 (2007).
94. Thompson, S. M., Jesudason, E. C., Turnbull, J. E. & Fernig, D. G. Heparan sulfate in lung
morphogenesis: The elephant in the room. Birth Defects Res. C Embryo Today 90, 32–44
(2010).
95. Kadoya, Y., Mochizuki, M., Nomizu, M., Sorokin, L. & Yamashina, S. Role for laminin-
α5 chain LG4 module in epithelial branching morphogenesis. Developmental Biology 263,
153–164 (2003).
96. Isakson, B. E., Lubman, R. L., Seedorf, G. J. & Boitano, S. Modulation of pulmonary
alveolar type II cell phenotype and communication by extracellular matrix and KGF.
American Journal of pathology 281, C1291–9 (2001).
97. Schuger, L., O'Shea, S., Rheinheimer, J. & Varani, J. Laminin in lung development: effects
of anti-laminin antibody in murine lung morphogenesis. Developmental Biology 137, 26–
32 (1990).
98. Nguyen, N. M. & Senior, R. M. Laminin isoforms and lung development: All isoforms are
not equal. Developmental Biology 294, 271–279 (2006).
99. Lentz, S. I., Miner, J. H., Sanes, J. R. & Snider, W. D. Distribution of the ten known
139
laminin chains in the pathways and targets of developing sensory axons. J. Comp. Neurol.
378, 547–561 (1997).
100. Arai, H. et al. Loss of EDB+ fibronectin isoform is associated with differentiation of
alveolar epithelial cells in human fetal lung. The American Journal of Pathology 151, 403–
412 (1997).
101. Hering, T. M., Wirthlin, L., Ravindran, S. & McAlinden, A. Changes in type II
procollagen isoform expression during chondrogenesis by disruption of an alternative 5'
splice site within Col2a1 exon 2. Matrix Biol. 36, 51–63 (2014).
102. Sabri, A., Farhadian, F., Contard, F., Samuel, J. L. & Rappaport, L. Fibronectin expression
in the cardiovascular system. Herz 20, 118–126 (1995).
103. Streuli, C. H. Integrins and cell-fate determination. Journal of Cell Biology 122, 171–177
(2008).
104. Boudreau, N., Werb, Z. & Bissell, M. J. Suppression of apoptosis by basement membrane
requires three-dimensional tissue organization and withdrawal from the cell cycle.
Proceedings of the National Academy of Sciences 93, 3509–3513 (1996).
105. Zhu, X. & Assoian, R. K. Integrin-dependent activation of MAP kinase: a link to shape-
dependent cell proliferation. Molecular and Biology of the Cell 6, 273–282 (1995).
106. Dike, L. E. & Ingber, D. E. Integrin-dependent induction of early growth response genes in
capillary endothelial cells. Journal of Cell Biology 109, 2855–2863 (1996).
107. Ma, Z., Myers, D. P., Wu, R. F., Nwariaku, F. E. & Terada, L. S. p66Shc mediates anoikis
through RhoA. The Journal of Cell Biology 179, 23–31 (2007).
108. Frisch, S. M. & Screaton, R. A. Anoikis mechanisms. Curr. Opin. Cell Biology 13, 555–
562 (2001).
109. Mackie, E. J. & Ramsey, S. Modulation of osteoblast behaviour by tenascin. Journal of
Cell Biology 109, 1597–1604 (1996).
110. Adams, J. C. & Watt, F. M. Fibronectin inhibits the terminal differentiation of human
keratinocytes. Nature 340, 307–309 (1989).
111. Bruckner-Tuderman, L. Blistering skin diseases: models for studies on epidermal-dermal
adhesion. Biochem. Cell. Biol. 74, 729–736 (1996).
112. Tamai, K., Kaneda, Y. & Uitto, J. Molecular therapies for heritable blistering diseases.
Trends Mol Med 15, 285–292 (2009).
113. Basel, D. & Steiner, R. D. Osteogenesis imperfecta: Recent findings shed new light on this
once well-understood condition. Genet Med 11, 375–385 (2009).
114. Prockop, D. J. Collagens: molecular biology, disease, and potentials for therapy. Annu Rev
Physiol 64, 403–434 (1995).
115. Ramirez, F. & Dietz, H. C. Extracellular Microfibrils in Vertebrate Development and
Disease Processes. J. Biol. Chem. 284, 14677–14681 (2009).
116. George, E. L., Georges-Labouesse, E. N., Patel-King, R. S., Rayburn, H. & Hynes, R. O.
Defects in mesoderm, neural tube and vascular development in mouse embryos lacking
fibronectin. Development 119, 1079–1091 (1993).
117. Ramos, J. W. & DeSimone, D. W. Xenopus Embryonic Cell Adhesion to Fibronectin:
Position-specific Activation of RGD/Synergy Site-dependent Migratory Behavior at
Gastrulation. The Journal of Cell Biology 134, 227–240 (1996).
118. Bronner-Fraser, M. An antibody to a receptor for fibronectin and laminin perturbs cranial
neural crest development in vivo. Developmental Biology 117, 528–536 (1986).
119. Linask, K. K., Manisastry, S. & Han, M. Cross Talk between Cell–Cell and Cell–Matrix
Adhesion Signaling Pathways during Heart Organogenesis: Implications for Cardiac Birth
Defects. Microsc Microanal 11, 200–208 (2005).
120. Li, D. Y. et al. Elastin is an essential determinant of arterial morphogenesis. Nature 293,
276–280 (1998).
140
121. Li, D. Y. et al. Novel arterial pathology in mice and humans hemizygous for elastin. J.
Clin. Invest. 102, 1783–1787 (1998).
122. Hynes, R. O. Integrins: Bidirectional, Review Allosteric Signaling Machines. Cell 110,
673–687 (2002).
123. Lowell, C. A. & Mayadas, T. N. in Integrin and cell adhesion molecules: methods and
protocols 757, 369–397 (Humana Press, 2012).
124. Hohenester, E. ScienceDirectSignalling complexes at the cell-matrix interface. Current
Opinion in Structural Biology 29, 10–16 (2014).
125. Astrof, S. & Hynes, R. O. Fibronectins in vascular morphogenesis. Angiogenesis 12, 165–
175 (2009).
126. Yang, J. T., Rayburn, H. & Hynes, R. O. Embryonic mesodermal defects in alpha-5
integrin-deficient mice. Development 119, 1093–1105 (1993).
127. Stephens, L. E. et al. Deletion of B1 integrins in mice results in inner cell mass failureand
peri-implantation lethality. Genes & Development 9, 1883–1895 (1995).
128. Huang, X.-Z. et al. Inactivation of the Integrin beta-6 Subunit Gene Reveals a Role of
Epithelial Integrins in Regulating Inflammation in the Lungs and Skin. The Journal of Cell
Biology 133, 921–928 (1996).
129. Morris, D. G. et al. Loss of integrin alpha-v-beta-6-mediated TGF-beta activation causes
Mmp12-dependent emphysema. Nature 422, 169–173 (2003).
130. Benjamin, J. T. et al. The role of integrin α8β1 in fetal lung morphogenesis and injury.
Developmental Biology 335, 407–417 (2009).
131. Kreidberg, J. A. et al. Alpha 3 beta 1 integrin has a crucial role in kidney and lung
organogenesis. Development 122, 3537–3547 (1996).
132. Winograd-Katz, S. E., Fassler, R., Geiger, B. & Legate, K. R. The integrin adhesome:
from genes and proteins to human disease. Nature Reviews Molecular Cell Biology 15,
273–288 (2014).
133. Zaidel-Bar, R., Itzkovitz, S., Ma'ayan, A., Iyengar, R. & Geiger, B. Functional atlas of the
integrin adhesome. Nature Cell Biology 9, 858–867 (2007).
134. Nieves, B. et al. The NPIY motif in the integrin 1 tail dictates the requirement for talin-1
in outside-in signaling. Journal of Cell Biology 123, 1216–1226 (2010).
135. Yong, V. W. Metalloproteinases: Mediators of Pathology and Regeneration in the CNS.
Nat Rev Neurosci 6, 931–944 (2005).
136. Overall, C. M. & Lopez-Otin, C. Strategies for mmp inhibition in cancer: innovations for
the post-trial era. Nat Rev Cancer 2, 657–672 (2002).
137. Fan, Q., Kadomatsu, K., Uchimura, K. & Muramatsu, T. Embigin/basigin subgroup of the
immunoglobulin superfamily: different modes of expression during mouse embryogenesis
and correlated expression with carbohydrate antigenic markers. Develop. Growth Differ.
40, 277–286 (1998).
138. Ingber, D. E. Cellular mechanotransduction: putting all the pieces together again. The
FASEB Journal 20, 811–827 (2006).
139. Petit, V. & Thiery, J. P. Focal adhesions: structure and dynamics. Biology of the Cell 92,
477–494 (2000).
140. Butcher, D. T., Alliston, T. & Weaver, V. M. A tense situation: forcing tumour
progression. Nat Rev Cancer 9, 108–122 (2009).
141. Chiquet, M., Renedo, A. S., Huber, F. & Fluck, M. How do fibroblasts translate
mechanical signals into changes in extracellular matrix production? Matrix Biology 22,
73–80 (2003).
142. Nguyen, T. D. et al. Effects of Cell Seeding and Cyclic Stretch on the Fiber Remodeling in
an Extracellular Matrix–Derived Bioscaffold. Tissue Engineering Part A 15, 957–963
(2009).
141
143. Friedland, J. C., Lee, M. H. & Boettiger, D. Mechanically Activated IntegrinSwitch
Controls alpha5beta1 function. Science 323, 642–644 (2009).
144. Planas-Paz, L. et al. Mechanoinduction of lymph vessel expansion. The EmBO journal 31,
788–804 (2011).
145. Wang, H.-B., Dembo, M., Hanks, S. K. & Wang, Y. Focal adhesion kinase is involved in
mechanosensing during fibroblast migration. Proceedings of the National Academy of
Sciences 98, 11295–11300 (2001).
146. Jones, P. L. et al. Altered hemodynamics controls matrix metalloproteinase activity and
tenascin-C expression in neonatal pig lung. AJP: Lung Cellular and Molecular Physiology
282, L26–L35 (2002).
147. Guilak, F. et al. Control of Stem Cell Fate by Physical Interactions with the Extracellular
Matrix. Stem Cell 5, 17–26 (2009).
148. Discher, D. E., Mooney, D. J. & Zandstra, P. W. Growth Factors, Matrices, and Forces
Combine and Control Stem Cells. Science 324, 1673–1677 (2009).
149. Chang, C. & Werb, Z. The many faces of metalloproteases: cell growth, invasion,
angiogenesis and metastasis. Trends Cell Biol. 11, S37–S43 (2001).
150. Heissig, B. et al. Recruitment of Stem and Progenitor Cells from the Bone Marrow Niche
Requires MMP-9 Mediated Release of Kit-Ligand. Cell 109, 625–637 (2002).
151. Li, Z. & Li, L. Understanding hematopoietic stem-cell microenvironments. Trends in
Biochemical Sciences 31, 589–595 (2006).
152. Kotton, D. N. et al. Bone marrow-derived cells as progenitors of lung alveolar epithelium.
Development 128, 5181–5188 (2001).
153. Forbes, S. J. & Rosenthal, N. Preparing the ground for tissue regeneration: from
mechanism to therapy. Nature Medicine 20, 857–869 (2014).
154. Badylak, S. F. Regenerative medicine and developmental biology: the role of the
extracellular matrix. Anat Rec B New Anat 287, 36–41 (2005).
155. Agulnick, A. D. et al. Cells differentiated in vitro from human embryonic stem cells
function in macroencapsulation. Stem Cells Transl Med. 4(10):1214-22. (2015).
156. Ni, N. C., Li, R.-K. & Weisel, R. D. The promise and challenges of cardiac stem cell
therapy. Semin. Thorac. Cardiovasc. Surg. 26, 44–52 (2014).
157. Williams, A. Central nervous system regeneration--where are we? QJM 107, 335–339
(2014).
158. Glenn, J. D. & Whartenby, K. A. Mesenchymal stem cells: Emerging mechanisms of
immunomodulation and therapy. World J Stem Cells 6, 526–539 (2014).
159. Sarukhan, A., Zanotti, L. & Viola, A. Mesenchymal stem cells: myths and reality. Swiss
Med Wkly 145, w14229 (2015).
160. Eggenhofer, E., Luk, F., Dahlke, M. H. & Hoogduijn, M. J. The life and fate of
mesenchymal stem cells. Front Immunol 5, 148 (2014).
161. Haar, von der, K., Lavrentieva, A., Stahl, F., Scheper, T. & Blume, C. Lost signature:
progress and failures in in vivo tracking of implanted stem cells. Appl. Microbiol.
Biotechnol. 99, 9907–9922 (2015).
162. Trounson, A. & McDonald, C. Stem Cell Therapies in Clinical Trials: Progress and
Challenges. Cell Stem Cell 17, 11–22 (2015).
163. Ratcliffe, E., Glen, K. E., Naing, M. W. & Williams, D. J. Current status and perspectives
on stem cell-based therapies undergoing clinical trials for regenerative medicine: case
studies. British Medical Bulletin 108, 73–94 (2013).
164. Kimbrel, E. A. & Lanza, R. Current status of pluripotent stem cells: moving the first
therapies to the clinic. Nat Rev Drug Discov 14, 681–692 (2015).
165. Naldini, L. Gene therapy returns to centre stage. Nature 526, 351–360 (2015).
166. Dey, R. & Pillai, B. Cell-based gene therapy against HIV. Gene Ther 22, 851–855 (2015).
142
167. Trounson, A. & DeWitt, N. D. Pluripotent stem cells progressing to the clinic. Nature
Reviews Molecular Cell Biology 17, 194–200 (2016).
168. Wang, M. D. A. Y.-L. Stresses at the Cell-to-Substrate Interface during Locomotion of
Fibroblasts. Biophysical Journal 76, 2307–2316 (1999).
169. Brunello, G. et al. Powder-based 3D printing for bone tissue engineering. Biotechnology
advances (2016). doi:10.1016/j.biotechadv.2016.03.009
170. Hussein, K. H., Park, K.-M., Kang, K.-S. & Woo, H.-M. Biocompatibility evaluation of
tissue-engineered decellularized scaffolds for biomedical application. Mater Sci Eng C
Mater Biol Appl 67, 766–778 (2016).
171. Ott, H. C. et al. Perfusion-decellularized matrix: using nature's platform to engineer a
bioartificial heart. Nature Medicine 14, 213–221 (2008).
172. Uygun, B. E. et al. Organ reengineering through development of a transplantable
recellularized liver graft using decellularized liver matrix. Nature Medicine 16, 814–820
(2010).
173. Nakayama, K. H., Batchelder, C. A., Lee, C. I. & Tarantal, A. F. Decellularized rhesus
monkey kidney as a three-dimensional scaffold for renal tissue engineering. Tissue
Engineering Part A 16, 2207–2216 (2010).
174. O'Neill, J. D. et al. Decellularization of human and porcine lung tissues for pulmonary
tissue engineering. The Annals of Thoracic Surgery 96, 1046–55– discussion 1055–6
(2013).
175. Petersen, T. H. et al. Tissue-engineered lungs for in vivo implantation. Science 329, 538–
541 (2010).
176. Ott, H. C. et al. Regeneration and orthotopic transplantation of a bioartificial lung. Nature
Medicine 16, 927–933 (2010).
177. Rojkind, M. et al. Connective tissue biomatrix: Its isolation and utilization for long-term
cultures of normal rat hepatocytes. The Journal of Cell Biology 87, 255–263 (1980).
178. Lwebuga-Mukasa, J. S., Ingbar, D. H. & Madri, J. A. Repopulation of a human alveolar
matrix by adult rat type II pneumocytes in vitro. A novel system for type II pneumocyte
culture. Exp. Cell Res. 162, 423–435 (1986).
179. Meezan, E., Hjelle, J. T., Brendel, K. & Carlson, E. C. A simple, versatile, nondisruptive
method for the isolation of morphologically and chemically pure basement membranes
from several tissues. Life Sci. 17, 1721–1732 (1975).
180. Gilbert, T. W., Sellaro, T. L. & Badylak, S. F. Decellularization of tissues and organs.
Biomaterials (2006). doi:10.1016/j.biomaterials.2006.02.014
181. Cebotari, S. et al. Detergent decellularization of heart valves for tissue engineering:
toxicological effects of residual detergents on human endothelial cells. Artif Organs 34,
206–210 (2010).
182. Pulver et al. Production of organ extracellular matrix using a freeze-thaw cycle employing
extracellular cryoprotectants. Cryo Letters 35, 400–406 (2014).
183. Azhim, A., Syazwani, N., Morimoto, Y., Furukawa, K. S. & Ushida, T. The use of
sonication treatment to decellularize aortic tissues for preparation of bioscaffolds. J
Biomater Appl 29, 130–141 (2014).
184. Phillips, M., Maor, E. & Rubinsky, B. Nonthermal irreversible electroporation for tissue
decellularization. J Biomech Eng 132, 091003 (2010).
185. Brown, B. N. et al. Comparison of three methods for the derivation of a biologic scaffold
composed of adipose tissue extracellular matrix. Tissue Engineering Part C: Methods 17,
411–421 (2011).
186. Prasertsung, I., Kanokpanont, S., Bunaprasert, T., Thanakit, V. & Damrongsakkul, S.
Development of acellular dermis from porcine skin using periodic pressurized technique.
J. Biomed. Mater. Res. Part B Appl. Biomater. 85, 210–219 (2008).
143
187. Grauss, R. W. et al. Histological evaluation of decellularised porcine aortic valves: matrix
changes due to different decellularisation methods. Eur J Cardiothorac Surg 27, 566–571
(2005).
188. Crapo, P. M., Gilbert, T. W. & Badylak, S. F. An overview of tissue and whole organ
decellularization processes. Biomaterials 32, 3233–3243 (2011).
189. Levy, R. J. et al. Inhibition of cusp and aortic wall calcification in ethanol- and aluminum-
treated bioprosthetic heart valves in sheep: background, mechanisms, and synergism. J.
Heart Valve Dis. 12, 209–16– discussion 216 (2003).
190. Lumpkins, S. B., Pierre, N. & McFetridge, P. S. A mechanical evaluation of three
decellularization methods in the design of a xenogeneic scaffold for tissue engineering the
temporomandibular joint disc. Acta Biomater 4, 808–816 (2008).
191. Reing, J. E. et al. The effects of processing methods upon mechanical and biologic
properties of porcine dermal extracellular matrix scaffolds. Biomaterials 31, 8626–8633
(2010).
192. Sasaki, S. et al. In vivo evaluation of a novel scaffold for artificial corneas prepared by
using ultrahigh hydrostatic pressure to decellularize porcine corneas. Mol. Vis. 15, 2022–
2028 (2009).
193. Zhou, J. et al. Impact of heart valve decellularization on 3-D ultrastructure,
immunogenicity and thrombogenicity. Biomaterials 31, 2549–2554 (2010).
194. Rieder, E. et al. Decellularization protocols of porcine heart valves differ importantly in
efficiency of cell removal and susceptibility of the matrix to recellularization with human
vascular cells. J. Thorac. Cardiovasc. Surg. 127, 399–405 (2004).
195. Choi, J. S. et al. Bioengineering endothelialized neo-corneas using donor-derived corneal
endothelial cells and decellularized corneal stroma. Biomaterials 31, 6738–6745 (2010).
196. Grauss, R. W., Hazekamp, M. G., van Vliet, S., Gittenberger-de Groot, A. C. & DeRuiter,
M. C. Decellularization of rat aortic valve allografts reduces leaflet destruction and
extracellular matrix remodeling. J. Thorac. Cardiovasc. Surg. 126, 2003–2010 (2003).
197. Liao, J., Joyce, E. M. & Sacks, M. S. Effects of decellularization on the mechanical and
structural properties of the porcine aortic valve leaflet. Biomaterials 29, 1065–1074
(2008).
198. Vavken, P., Joshi, S. & Murray, M. M. TRITON-X is most effective among three
decellularization agents for ACL tissue engineering. J. Orthop. Res. 27, 1612–1618
(2009).
199. Faulk, D. M. et al. The effect of detergents on the basement membrane complex of a
biologic scaffold material. Acta Biomater 10, 183–193 (2014).
200. Petersen, T. H., Calle, E. A., Colehour, M. B. & Niklason, L. E. Matrix Composition and
Mechanics of Decellularized Lung Scaffolds. Cells Tissues Organs 195, 222–231 (2012).
201. Zhang, A. Y. et al. Tissue-engineered intrasynovial tendons: optimization of
acellularization and seeding. J Rehabil Res Dev 46, 489–498 (2009).
202. Wang, Q. et al. The preparation and comparison of decellularized nerve scaffold of tissue
engineering. J Biomed Mater Res A 102, 4301–4308 (2014).
203. Xu, H. et al. A porcine-derived acellular dermal scaffold that supports soft tissue
regeneration: removal of terminal galactose-alpha-(1,3)-galactose and retention of matrix
structure. Tissue Engineering Part A 15, 1807–1819 (2009).
204. Choi, Y. C. et al. Decellularized extracellular matrix derived from porcine adipose tissue
as a xenogeneic biomaterial for tissue engineering. Tissue Engineering Part C: Methods
18, 866–876 (2012).
205. Morrison, S. J. & Spradling, A. C. Stem cells and niches: mechanisms that promote stem
cell maintenance throughout life. Cell 132, 598–611 (2008).
206. Hsu, Y.-C., Li, L. & Fuchs, E. Transit-amplifying cells orchestrate stem cell activity and
144
tissue regeneration. Cell 157, 935–949 (2014).
207. Chow, A. et al. Bone marrow CD169+ macrophages promote the retention of
hematopoietic stem and progenitor cells in the mesenchymal stem cell niche. J Exp Med
208, 261–271 (2011).
208. Sato, Y. et al. Human mesenchymal stem cells xenografted directly to rat liver are
differentiated into human hepatocytes without fusion. Blood 106, 756–763 (2005).
209. Quevedo, H. C. et al. Allogeneic mesenchymal stem cells restore cardiac function in
chronic ischemic cardiomyopathy via trilineage differentiating capacity. Proceedings of
the National Academy of Sciences 106, 14022–14027 (2009).
210. Lee, J., Abdeen, A. A. & Kilian, K. A. Rewiring mesenchymal stem cell lineage
specification by switching the biophysical microenvironment. Sci Rep 4, 5188 (2014).
211. Thomson, J. A. et al. Embryonic stem cell lines derived from human blastocysts. Science
282, 1145–1147 (1998).
212. Nichols, J. & Smith, A. Pluripotency in the embryo and in culture. Cold Spring Harbor
Perspectives in Biology 4, a008128 (2012).
213. Hyslop, L. A., Armstrong, L., Stojkovic, M. & Lako, M. Human embryonic stem cells:
biology and clinical implications. Expert Rev Mol Med 7, 1–21 (2005).
214. de Kruijf, E.-J. F. M. et al. Repeated hematopoietic stem and progenitor cell mobilization
without depletion of the bone marrow stem and progenitor cell pool in mice after repeated
administration of recombinant murine G-CSF. Hum. Immunol. 68, 368–374 (2007).
215. Devine, S. M., Cobbs, C., Jennings, M., Bartholomew, A. & Hoffman, R. Mesenchymal
stem cells distribute to a wide range of tissues following systemic infusion into nonhuman
primates. Blood 101, 2999–3001 (2003).
216. Krause, D. S. et al. Multi-organ, multi-lineage engraftment by a single bone marrow-
derived stem cell. Cell 105, 369–377 (2001).
217. Kucia, M. et al. Cells expressing early cardiac markers reside in the bone marrow and are
mobilized into the peripheral blood after myocardial infarction. Circulation Research 95,
1191–1199 (2004).
218. Kucia, M. et al. Cells enriched in markers of neural tissue-committed stem cells reside in
the bone marrow and are mobilized into the peripheral blood following stroke. Leukemia
20, 18–28 (2006).
219. Kucia, M., Ratajczak, J., Reca, R., Janowska-Wieczorek, A. & Ratajczak, M. Z. Tissue-
specific muscle, neural and liver stem/progenitor cells reside in the bone marrow, respond
to an SDF-1 gradient and are mobilized into peripheral blood during stress and tissue
injury. Blood Cells Mol. Dis. 32, 52–57 (2004).
220. Gomperts, B. N. et al. Circulating progenitor epithelial cells traffic via CXCR4/CXCL12
in response to airway injury. J. Immunol. 176, 1916–1927 (2006).
221. Saudemont, A. & Madrigal, J. A. Immunotherapy after hematopoietic stem cell
transplantation using umbilical cord blood-derived products. Cancer Immunol.
Immunother. (2016). doi:10.1007/s00262-016-1852-3
222. Matikainen, T. & Laine, J. Placenta--an alternative source of stem cells. Toxicol. Appl.
Pharmacol. 207, 544–549 (2005).
223. Takahashi, K. & Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic
and adult fibroblast cultures by defined factors. Cell 126, 663–676 (2006).
224. Takahashi, K. et al. Induction of pluripotent stem cells from adult human fibroblasts by
defined factors. Cell 131, 861–872 (2007).
225. Chang, C.-W. et al. Polycistronic lentiviral vector for ‘hit and run’ reprogramming of adult
skin fibroblasts to induced pluripotent stem cells. Stem Cells 27, 1042–1049 (2009).
226. Somers, A. et al. Generation of transgene-free lung disease-specific human induced
pluripotent stem cells using a single excisable lentiviral stem cell cassette. Stem Cells 28,
145
1728–1740 (2010).
227. Stadtfeld, M., Nagaya, M., Utikal, J., Weir, G. & Hochedlinger, K. Induced pluripotent
stem cells generated without viral integration. Science 322, 945–949 (2008).
228. Zhou, W. & Freed, C. R. Adenoviral gene delivery can reprogram human fibroblasts to
induced pluripotent stem cells. Stem Cells 27, 2667–2674 (2009).
229. Warren, L. et al. Highly efficient reprogramming to pluripotency and directed
differentiation of human cells with synthetic modified mRNA. Cell Stem Cell 7, 618–630
(2010).
230. Chen, G. et al. Chemically defined conditions for human iPSC derivation and culture. Nat
Meth 8, 424–429 (2011).
231. Chou, B.-K. et al. Efficient human iPS cell derivation by a non-integrating plasmid from
blood cells with unique epigenetic and gene expression signatures. Cell Res 21, 518–529
(2011).
232. Woltjen, K. et al. piggyBac transposition reprograms fibroblasts to induced pluripotent
stem cells. Nature 458, 766–770 (2009).
233. Paul, M. K. et al. Dynamic changes in intracellular ROS levels regulate airway basal stem
cell homeostasis through Nrf2-dependent Notch signaling. Cell Stem Cell 15, 199–214
(2014).
234. Cole, B. B. et al. Tracheal Basal Cells. The American Journal of Pathology 177, 362–376
(2010).
235. Hong, K. U., Reynolds, S. D., Watkins, S., Fuchs, E. & Stripp, B. R. Basal cells are a
multipotent progenitor capable of renewing the bronchial epithelium. The American
Journal of Pathology 164, 577–588 (2004).
236. Wansleeben, C., Bowie, E., Hotten, D. F., Yu, Y.-R. A. & Hogan, B. L. M. Age-related
changes in the cellular composition and epithelial organization of the mouse trachea. PLoS
ONE 9, e93496 (2014).
237. Pardo-Saganta, A. et al. Parent stem cells can serve as niches for their daughter cells.
Nature 523, 597–601 (2015).
238. Kumar, P. A. et al. Distal Airway Stem Cells Yield Alveoli In Vitro and during Lung
Regeneration following H1N1 Influenza Infection. Cell 147, 525–538 (2011).
239. Reynolds, P. R. RAGE and tobacco smoke: insights into modeling chronic obstructive
pulmonary disease. 1–11 (2012). doi:10.3389/fphys.2012.00301/abstract
240. Reynolds, S. D. et al. Conditional clara cell ablation reveals a self-renewing progenitor
function of pulmonary neuroendocrine cells. Am. J. Physiol. Lung Cell Mol. Physiol. 278,
L1256–63 (2000).
241. Rawlins, E. L. et al. The Role of Scgb1a1. Stem Cell 4, 525–534 (2009).
242. Kim, C. F. B. et al. Identification of Bronchioalveolar Stem Cells in Normal Lung and
Lung Cancer. Cell 121, 823–835 (2005).
243. Lee, J.-H. et al. Lung stem cell differentiation in mice directed by endothelial cells via a
BMP4-NFATc1-thrombospondin-1 axis. Cell 156, 440–455 (2014).
244. Xu, X. et al. Evidence for type II cells as cells of origin of K-Ras-induced distal lung
adenocarcinoma. Proceedings of the National Academy of Sciences 109, 4910–4915
(2012).
245. Barkauskas, C. E. et al. Type 2 alveolar cells are stem cells in adult lung. J. Clin. Invest.
123, 3025–3036 (2013).
246. Chapman, H. A. et al. Integrin α6β4 identifies an adult distal lung epithelial population
with regenerative potential in mice. J. Clin. Invest. 121, 2855–2862 (2011).
247. Nelson, T. J. et al. Repair of Acute Myocardial Infarction by Human Stemness Factors
Induced Pluripotent Stem Cells. Circulation 120, 408–416 (2009).
248. Roth-Kleiner, M. & Post, M. Similarities and dissimilarities of branching and septation
146
during lung development. Pediatr. Pulmonol. 40, 113–134 (2005).
249. Lutolf, M. P. & Hubbell, J. A. Synthetic biomaterials as instructive extracellular
microenvironments for morphogenesis in tissue engineering. Nat Biotech 23, 47–55
(2005).
250. Cortiella, J. et al. Influence of Acellular Natural Lung Matrix on Murine Embryonic Stem
Cell Differentiation and Tissue Formation. Tissue Engineering Part A 16, 2565–2580
(2010).
251. Furth, M. E., Atala, A. & Van Dyke, M. E. Smart biomaterials design for tissue
engineering and regenerative medicine. Biomaterials 28, 5068–5073 (2007).
252. Badylak, S. F. Xenogeneic extracellular matrix as a scaffold for tissue reconstruction.
Transpl. Immunol. 12, 367–377 (2004).
253. Nichols, J. E., Niles, J. A. & Cortiella, J. Design and development of tissue engineered
lung: Progress and challenges. Organogenesis 5, 57–61 (2009).
254. Macchiarini, P. et al. Clinical transplantation of a tissue-engineered airway. The Lancet
372, 2023–2030 (2008).
255. Sugihara, H., Toda, S., Miyabara, S., Fujiyama, C. & Yonemitsu, N. Reconstruction of
alveolus-like structure from alveolar type II epithelial cells in three-dimensional collagen
gel matrix culture. The American Journal of Pathology 142, 783–792 (1993).
256. Lin, Y. M., Boccaccini, A. R., Polak, J. M., Bishop, A. E. & Maquet, V. Biocompatibility
of poly-DL-lactic acid (PDLLA) for lung tissue engineering. J Biomater Appl 21, 109–118
(2006).
257. Yang, M., Chen, C.-Z., Wang, X.-N., Zhu, Y.-B. & Gu, Y. J. Favorable effects of the
detergent and enzyme extraction method for preparing decellularized bovine pericardium
scaffold for tissue engineered heart valves. J. Biomed. Mater. Res. Part B Appl. Biomater.
91, 354–361 (2009).
258. Sporty, J. L., Horálková, L. & Ehrhardt, C. In vitro cell culture models for the assessment
of pulmonary drug disposition. Expert Opin Drug Metab Toxicol 4, 333–345 (2008).
259. Daly, A. B. et al. Initial binding and recellularization of decellularized mouse lung
scaffolds with bone marrow-derived mesenchymal stromal cells. Tissue Engineering Part
A 18, 1–16 (2012).
260. Wallis, J. M. et al. Comparative assessment of detergent-based protocols for mouse lung
de-cellularization and re-cellularization. Tissue Engineering Part C: Methods 18, 420–432
(2012).
261. Ghaedi, M. et al. Human iPS cell-derived alveolar epithelium repopulates lung
extracellular matrix. J. Clin. Invest. 123, 4950–4962 (2013).
262. Green, M. D. et al. Generation of anterior foregut endoderm from human embryonic and
induced pluripotent stem cells. Nature Biotechnology 1–7 (2011). doi:10.1038/nbt.1788
263. Huang, S. X. L. et al. efficient generation of lung and airway epithelial cells from human
pluripotent stem cells. Nature Biotechnology 32, 84–91 (2014).
264. Jensen, T. et al. A rapid lung de-cellularization protocol supports embryonic stem cell
differentiation in vitro and following implantation. Tissue Engineering Part C: Methods
18, 632–646 (2012).
265. Longmire, T. A. et al. Efficient derivation of purified lung and thyroid progenitors from
embryonic stem cells. Cell Stem Cell 10, 398–411 (2012).
266. Mou, H. et al. Generation of Multipotent Lung and Airway Progenitors from Mouse ESCs
and Patient-Specific Cystic Fibrosis iPSCs. Cell Stem Cell 10, 385–397 (2012).
267. Wong, A. P. et al. Directed differentiation of human pluripotent stem cells into mature
airway epithelia expressing functional CFTR protein. Nature Biotechnology 30, 876–882
(2012).
268. Bilodeau, M., Shojaie, S., Ackerley, C., Post, M. & Rossant, J. Identification of a Proximal
147
Progenitor Population from Murine Fetal Lungs with Clonogenic and Multilineage
Differentiation Potential. Stem Cell Reports 3, 634–649 (2014).
269. Ying, Q.-L. et al. The ground state of embryonic stem cell self-renewal. Nature 453, 519–
523 (2008).
270. Gouon-Evans, V. et al. BMP-4 is required for hepatic specification of mouse embryonic
stem cell–derived definitive endoderm. Nature Biotechnology 24, 1402–1411 (2006).
271. Murry, C. E. & Keller, G. Differentiation of Embryonic Stem Cells to Clinically Relevant
Populations: Lessons from Embryonic Development. Cell 132, 661–680 (2008).
272. Zorn, A. M. & Wells, J. M. Vertebrate Endoderm Development and Organ Formation.
Annu. Rev. Cell Dev. Biol. 25, 221–251 (2009).
273. Kubo, A. et al. Development of definitive endoderm from embryonic stem cells in culture.
Development 131, 1651–1662 (2004).
274. Kimura, J. & Deutsch, G. H. Key Mechanisms of Early Lung Development. Pediatric and
Developmental Pathology 10, 335–347 (2007).
275. Perl, A.-K. T. et al. Conditional Recombination Reveals Distinct Subsets of Epithelial
Cells in Trachea, Bronchi, and Alveoli. American Journal of Respiratory cell and
molecular biology 33, 455–462 (2005).
276. Que, J., Luo, X., Schwartz, R. J. & Hogan, B. L. M. Multiple roles for Sox2 in the
developing and adult mouse trachea. Development 136, 1899–1907 (2009).
277. Musah, S., Chen, J. & Hoyle, G. W. Repair of tracheal epithelium by basal cells after
chlorine-induced injury. Respiratory Research 13, 107 (2012).
278. Whitsett, J. A., Haitchi, H. M. & Maeda, Y. Intersections between Pulmonary
Development and Disease. American Journal of Respiratory and Critical Care Medicine
184, 401–406 (2011).
279. Schoch, K. G. A subset of mouse tracheal epithelial basal cells generates large colonies in
vitro. AJP: Lung Cellular and Molecular Physiology 286, 631L–642 (2003).
280. Hong, K. U., Reynolds, S. D., Watkins, S., Fuchs, E. & Stripp, B. R. Basal Cells Are a
Multipotent Progenitor Capable of Renewing the Bronchial Epithelium. American Journal
of pathology 164, 577–588 (2004).
281. Zuo, W. et al. distal airway stem cells are essential for lung regeneration. Nature 1–16
(2014). doi:10.1038/nature13903
282. Gilpin, S. E. et al. Enhanced Lung Epithelial Specification of Human Induced Pluripotent
Stem Cells on Decellularized Lung Matrix. The Annals of Thoracic Surgery In press, 1–9
(2014).
283. Engelhardt, J. F., Schlossberg, H., Yankaskas, J. R. & Dudus, L. Progenitor cells of the
adult human airway involved in submucosal gland development. Development 121, 2031–
2046 (1995).
284. Smolich, J. J., Stratford, B. F., Maloney, J. E. & Ritchie, B. C. New features in the
development of the submucosal gland of the respiratory tract. Journal of Anatomy 127,
223–238 (1978).
285. Kahwa, C., Balemba, O. & Assey, R. The pattern of ciliation and the development of the
epithelial lining of the respiratory tract in the neonatal kid: a scanning electron microscopic
study. Small Rumin. Res. 37, 27–34 (2000).
286. Herbst, R. et al. [Scanning electron microscope study of the lung epithelium of the rabbit
during ontogenesis]. Z Mikrosk Anat Forsch 93, 736–750 (1979).
287. Toskala, E., Smiley-Jewell, S. M., Wong, V. J., King, D. & Plopper, C. G. Temporal and
spatial distribution of ciliogenesis in the tracheobronchial airways of mice. Am. J. Physiol.
Lung Cell Mol. Physiol. 289, L454–9 (2005).
288. Karnati, S. et al. Postnatal development of the bronchiolar club cells of distal airways in
the mouse lung: stereological and molecular biological studies. Cell and Developmental
148
Biology 364, 543–557 (2016).
289. Shannon, J. M. et al. Chondroitin sulfate proteoglycans are required for lung growth and
morphogenesis in vitro. Am. J. Physiol. Lung Cell Mol. Physiol. 285, L1323–L1336
(2003).
290. Thompson, S. M. et al. Novel ‘phage display antibodies identify distinct heparan sulfate
domains in developing mammalian lung. Pediatr Surg Int 23, 411–417 (2007).
291. Toriyama, K., Muramatsu, H., Muramatsu, T., Torii, S. & Hoshino, T. Evaluation of
heparin-binding growth factors in rescuing morphogenesis of heparitinase-treated mouse
embryonic lung explants. Differentiation 61, 161–167 (1997).
292. Izvolsky, K. I. et al. Heparan sulfate–FGF10 interactions during lung morphogenesis.
Developmental Biology 258, 185–200 (2003).
293. Coraux, C., Meneguzzi, G., Rousselle, P., Puchelle, E. & Gaillard, D. Distribution of
laminin 5, integrin receptors, and branching morphogenesis during human fetal lung
development. Developmental Dynamics : an official publication of the American
Association of Anatomists 225, 176–185 (2002).
294. Kapp, T. G., Rechenmacher, F., Sobahi, T. R. & Kessler, H. Integrin modulators: a patent
review. Expert Opin. Ther. Patents 23, 1273–1295 (2013).
295. Andrade, C. F., Wong, A. P., Waddell, T. K., Keshavjee, S. & Liu, M. Cell-based tissue
engineering for lung regeneration. AJP: Lung Cellular and Molecular Physiology 292,
L510–L518 (2006).
149
Copyright Acknowledgements
Chapter 1 is modified from published works (1) and (2).
Chapter 2 is modified from published works (3) and (4).
Chapters 3 and 4 are modified from published work (3).
Published papers
(1) Shojaie, S., Leibel, S., Post, M. (2016). The Extracellular Matrix in Development. Polin &
Abman & Rowitch & Benitz. Fetal and Neonatal Physiology, 5th Edition, Ch5. Philadelphia:
Elsevier Saunders.
(2) Shojaie, S., Post, M. (2016). Molecular mechanisms of lung development and lung branching
morphogenesis. Polin & Abman & Rowitch & Benitz. Fetal and Neonatal Physiology, 5th
Edition, Ch64. Philadelphia: Elsevier Saunders.
(3) Shojaie, S., Ermini, L., Ackerley, C., Wang, J., Chin, S., Yeganeh, B., Bilodeau, M., Sambi,
M., Rogers, I., Rossant, J., Bear, C.E., Post, M. (2015). Acellular lung scaffolds direct
differentiation of endoderm to functional airway epithelial cells: requirement of matrix-bound
HS proteoglycans. Stem Cell Reports 4, 419-30. doi: 10.1016/j.stemcr.2015.01.004.
(4) Shojaie, S., Lee, J., Ackerley, C., Post, M. (2016). Generation of ESC-derived mouse airway
epithelial cells using decellularized lung scaffolds. J Vis Exp 111. doi: 10.3791/54019