Expression of CD175 (Tn), CD175s (sialosyl-Tn) and CD176

(Thomsen-Friedenreich antigen) on malignant human hematopoietic cells

Yi Cao1,2, Anette Merling1, Uwe Karsten3,4, Steffen Goletz4, Michael Punzel5, Regine Kraft3, G€unter Butschak3

and Reinhard Schwartz-Albiez1*

1Division of Cellular Immunology, German Cancer Research Center, Heidelberg, Germany2Laboratory of Molecular and Experimental Pathology, Key Laboratory of Animal Models and Human Disease Mechanisms,Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, China3Max Delbr€uck Center for Molecular Medicine, Berlin-Buch, Germany4Glycotope GmbH, Berlin-Buch, Germany5Institute for Transfusion Medicine, University Hospital, University D€usseldorf, Germany

The expression of the histo-blood group carbohydrate structuresT-nouvelle (Tn, CD175), sialylated Tn (CD175s) and the Thom-sen-Friedenreich disaccharide (TF, CD176) on human leukemiacell lines was analyzed by their reactivity with specific monoclonalantibodies in flow cytometry, immunohistology and immunopreci-pitation. Expression of sialylated CD176 was evaluated by com-parative immunostaining with anti-CD176 antibodies before andafter sialidase treatment. While only few cell lines expressedunmasked CD176, sialylated CD176 was present on all hematopoi-etic cell lines and native lymphocytes examined. CD175 andCD175s are preferentially expressed on erythroblastic leukemiacell lines. CD175s expression in these cells is consistent with thetranscription of the gene encoding the key enzyme a2,6-sialyl-transferase (hST6GalNAc1). The staining intensity was reducedafter methanol pretreatment of cells, indicating that these glycansare partially expressed as constituents of glycosphingolipids.Immunoprecipitation and subsequent Western blotting revealed aseries of distinct high molecular glycoproteins as carriers for thesecarbohydrate antigens. CD34 was identified as major carrier ofCD176 by immunoprecipitation and microsequencing on a KG-1subline enriched for CD176 expression. Incubation of severalCD176-positive cell lines with anti-CD176 antibodies induced apo-ptosis of these cells, an effect not observed with anti-CD175/CD175s antibodies. Since the presence of naturally occurringanti-CD176 antibodies may represent a mechanism of immunosur-veillance against CD176-positive tumor cells, we propose thatsialylation of surface-expressed CD176—among other functions—protects against apoptosis.' 2008 Wiley-Liss, Inc.

Key words: Thomsen-Friedenreich-related antigens (TFRA); mono-clonal antibodies; CD175; CD176; leukemia cells; apoptosis; CD34

Thomsen-Friedenreich-related antigens (TFRA) are a group ofhisto-blood group carbohydrate sequences. The Thomsen-Frieden-reich antigen (TF) occurs in 2 anomers, TF-a (Galb1-3GalNAca1-R, core-1) and TF-b (Galb1-3GalNAcb1-R). The precursor of TF-a is the T-nouvelle (Tn) antigen (GalNAca1-R). TF also occurs ina2,3-sialylated (sTF) and Tn in a2,6-sialylated form (sTn). Tn, sTnand TF were assigned as CD175, CD175s and CD176, respectively,during the 7th Conference on Human Leucocyte DifferentiationAntigens due to their recognition by specific monoclonal antibod-ies.1 CD176 (TF), CD175 (Tn) and CD175s (sTn) occur at very re-stricted sites and in limited amounts in normal adult human tissues,2

and have been reported as onco-developmental antigens expressedon cancer cells3 and fetal tissues.4 In epithelial cells, CD175,CD175s and the a-anomeric form of CD176 are predominantly car-ried by glycoproteins of the mucin type,3 whereas the b-anomericform of CD176 (Galb1-3GalNAcb-R) is carried only by glyco-sphingolipids (type 4 histo-blood group antigens),5 e.g., by asialo-GM1. Accumulation of the short a2,6-sialylated carbohydratesequence of CD175s is indicative of a disturbed capability of the re-spective cells to synthesize elongated O-linked glycan chains. As arule CD175 and CD176 are masked in normal and benign tissuesbut are uncovered during the process of malignant transformation.An estimated up to 90% of carcinomas carry these antigens on theirsurface.6 Several groups have described TFRA expression on leuke-

mias and lymphomas.7–9 The CD176 carbohydrate sequence hasbeen reported as a favorable prognostic marker in T-cell acute lym-phoblastic leukemia.10,11

Although our knowledge about the functional role of these carbo-hydrates is still sparse, several observations point to a possibleinvolvement in adhesion processes and interactions with immunecells. The expression of CD176 on colon carcinomas may be func-tionally involved in the invasive and metastatic properties of thesecells.12 Mucins carrying CD175s inhibit natural killer cell cytotoxic-ity.13 CD175s was proposed to be a ligand for the B-cell specific lec-tin and activation antigen CD22/Siglec-2.14 On the other hand, it isknown that galectin-1, a lectin recognizing terminal galactose, isable to induce apoptosis.15 Thus recognition of CD176 on opposingcells may transfer signals to galectin-1-carrying target cells.

A systematic and comprehensive analysis of TFRA expressionon human hematopoietic cells including their carrier moleculeshas not yet been performed. The objectives of this study weretherefore (i) to determine the extent to which all 4 TFRA (CD175and CD176 in sialylated and non-sialylated form) are expressedon normal and malignant human lymphocytes, (ii) to obtain infor-mation about their carrier molecules, (iii) to tentatively investigatethe function of CD175s and CD176 expression on hematopoieticcells. To analyze the molecule in their complex environment of anintact cell surface we used several monoclonal antibodies specificfor CD175/CD175s and CD176 and measured their bindingbehavior with and without sialidase pretreatment of the cells. Firstinsights into the transcriptional regulation of CD175s are obtainedby reverse transcriptase PCR data of ST6GalNAc I mRNA levels,the key glycosyltransferase for TFRA synthesis.

Material and methods

Culture and isolation of cells

Human leukemia cell lines derived from acute myelogenousleukemia (KG-1, KG-1a, HL-60), erythroblastic cell leukemia(TF1, K562), pro-monocytic leukemia (U937), B-cell acutelymphoblastic leukemia (REH, Nalm-6), hairy cell leukemia(JOK-1), Burkitt lymphoma (Raji), plasmocytoma (U266) and T-

This manuscript is dedicated to G€unter Pasternak on the occasion of his75th birthday.Abbreviations: mAb, monoclonal antibody; NDVS, Newcastle Disease

Virus sialidase; PAA, polyacrylamide; PBS, phosphate-buffered saline;PNA, peanut agglutinin; SDS-PAGE, sodium dodecyl polyacrylamide gelelectrophoresis; sTF, sialosyl TF; sTn, sialosyl Tn; TF, Thomsen-Frieden-reich antigen; TFRA, Thomsen-Friedenreich-related antigens; Tn, T-nou-velle antigen; VCN, Vibrio cholerae neuraminidase (sialidase).Grant sponsor: Tumorzentrum Heidelberg-Mannheim.*Correspondence to: Division of Cellular Immunology, German

Cancer Research Center, Im Neuenheimer Feld 580, Heidelberg 69120,Germany. Fax:149-6221-423737. E-mail: r.s-albiez@dkfz.deReceived 1 February 2007; Accepted after revision 16 January 2008DOI 10.1002/ijc.23493Published online 8 April 2008 in Wiley InterScience (www.interscience.

wiley.com).

Int. J. Cancer: 123, 89–99 (2008)

' 2008 Wiley-Liss, Inc.

Publication of the International Union Against Cancer

cell leukemia (Molt-3, Jurkat, CEM-C7) were used in this study.All cell lines except TF1 were maintained in RPMI 1640 medium(Gibco-BRL, Paisley, Scotland) supplemented with 5% fetal calfserum. Cell line TF1 was cultured in RPMI 1640 medium with10% fetal calf serum and 10 ng/ml IL-3 (Pepro Tech Inc., RockyHill, NJ).

Normal peripheral blood lymphocytes of healthy donors andleukemia cells from peripheral blood of patients were preparedfrom heparinized blood by Ficoll density gradient centrifugation.Leukemia cells derived from bone marrow were obtained frombone marrow aspirates as previously described.16 Tonsillar lym-phocytes were isolated from tonsils obtained from patients whounderwent tonsillectomy. Tonsillar lymphocytes were isolated bycentrifugation on Ficoll-Hypaque (Amersham Pharmacia BiotechAB, Uppsala, Sweden) after depleting monocytes with leucinemethylester (Sigma, St. Louis, MO) as described.17 The study wasconducted under the guidelines of the Ethical Review Board of theUniversity of Heidelberg abiding the tenets of the Helsinki proto-col. Biopsies were taken after patients’ informed consent.

Specific reagents, antibodies

Monoclonal antibodies (mAb) employed were: A78-G/A7 (anti-CD176),18 reactive with TF-a with minor cross-reactivity to TF-band A68-B/A11 reactive with TF-b, both from Glycotope, Berlin,Germany; HB-Tn1 (anti-CD 175, Dako, Copenhagen, Denmark);HB-STn1 (anti-175s, Dako); B72.3 (anti-175s, Dianova, Ham-burg, Germany); HH8 (anti-CD176), specific for TF-a, and TKH2(anti-CD175s), both obtained from Dr. H. Clausen, Copenhagen,Denmark.19 Since mAb TKH2 cross-reacts with blood group A,1 amAb to blood group A antigen (Dako) was used as control in orderto distinguish positive staining between A antigen and CD175s. Inaddition, anti-MUC1 mAb A76-A/C7 (Glycotope),20 E29 (anti-MUC1, Dako), CCP58 (anti-MUC2, a gift of Dr. P.X. Xiang, Hei-delberg, Australia),21 and a polyclonal rabbit antiserum againstasialo-GM1 (kindly provided by Dr. B. Kniep, Dresden, Germany)were used.

A soluble CD22-immunoglobulin fusion protein CD22Rg22 wasused to study the possible binding of CD22 to CD175s at the cellsurface. CD22Rg is a fusion protein construct containing the first3 immunoglobulin-like domains of CD22 linked to the Fc part ofhuman IgG1. For flow cytometry and Western blotting, CD22Rgwas preincubated with goat anti-human IgG 1 (Fc-specific)coupled to biotin in equimolar concentrations (5 lM/ml) for 1 hrat room temperature. The following antibodies to potential carrierglycoproteins were employed in Western blots and in immunoflu-orescence tests: CD34: 45.28 (Connex, Munich, Germany), T€UK3(Boehringer Mannheim, Germany), QBEnd10 (Dako), CD43: DF-T1 (Dako), WR14 (Serotec, Oxford, UK), CD45: HI30 (BD Bio-sciences Pharmingen, Heidelberg, Germany), 2B111PD7/26(Dako), BRA-55 (Sigma).

Immunocytochemistry

Target cells were grown on sterile Teflon1-coated multiwellmicroscope slides for 1 or 2 days. Then, the medium was carefullyaspirated, and the slides were air-dried. Wrapped slides werestored at 280�C until use.

Cells were fixed with cold (220�C) acetone for 20 min, thentreated with 3% H2O2 in phosphate-buffered saline (PBS) for30 min to block endogenous peroxidases, and incubated with nor-mal goat serum for 30 min to reduce nonspecific binding. Afterwashing with PBS, the fixed cells were incubated with mAbs atappropriate dilutions for 1 hr. The thoroughly washed cells on theslides were then treated with horseradish peroxidase-labeledanti-mouse immunoglobulin antiserum (Dako) for 30 min. Allincubation steps were performed at room temperature. Color de-velopment during incubation with the peroxidase substrate diami-nobenzidine was controlled under a microscope. Counterstainingwas performed with hematoxylin. Negative controls were

performed with an irrelevant IgM or IgG from a mouse plasmocy-toma (Sigma) at a comparable dilution instead of the specific mAb.

In some experiments, the possible lipid nature of TFRA carriermolecules was tested. To this end, slides were fixed with 4% form-aldehyde (special preparation for histology, Merck, Darmstadt,Germany) for 5 min and then immersed in methanol for 30 min atroom temperature before the immunostaining for CD175,CD175s, CD176 and sTF (sialylated CD176) as described above.The same procedure was used for flow cytometric staining experi-ments as depicted in Figure 2b.

For another set of experiments, lipid extraction of KG-1 cellsfixed with formaldehyde was done in 2 steps: methanol for10 min, followed by methanol/chloroform (1.1, v:v) for 10 min,both extractions at room temperature. Staining for these prepara-tions was performed in immunofluorescence mode using eitherCy-3- or FITC-labeled secondary antibodies (Dianova, Hamburg,Germany). The slides were mounted in PBS/glycerol (1:1, v:v)with a trace of p-phenylenediamine to prevent fading, and ana-lyzed with an Axioplan 2 microscope equipped with an AxioCamcamera system (Zeiss, Jena, Germany).

Staining of glycolipids is usually abolished after methanolextraction.

Since O-acetyl sTn is not recognized by anti-CD175s mAb, O-acetyl groups were removed from sialic acid by specific saponifi-cation on some slides as described by Jass et al.23 In brief, sectionswere treated with 0.5% KOH in 70% ethanol for 30 min at roomtemperature. Thereafter sections were rinsed in 70% ethanol andwashed in tap water for 10 min. The approximate amount of O-acetylated CD175s present in the cells was assessed by compari-son of the alkali-treated CD175s-stained with nontreated CD175s-stained cells.

No specific mAb is available for the detection of sialylated TF.Therefore, for the detection of sialosyl-TF, cells or tissue sectionswere incubated with VCN (sialidase from Vibrio cholerae, Roche,Mannheim, Germany) at a concentration of 5 mU/ml in mediumfor 60 min at 37�C to remove NeuAc in a2,3, a2,6 and a2,8 link-age, or with a2,3 sialidase NDVS (Calbiochem, San Diego, CA)at a concentration of 5 mU/ml in medium for 90 min at 37�C toremove NeuAc in a2-3 linkage. Thereafter, the cells were washedand stained with anti-TF (anti-CD176) mAb. Presence of sialy-lated TF was assessed by comparative CD176 stainings of desialy-lated and untreated cells.

Cryostat sections of tonsils were fixed with cold (220�C)acetone for 20 min before staining.

Flow cytometry

Cells of established cell lines were stained at densities of 1 3106 cells/100 ll. Cells were first incubated with the appropriateprimary mAb at 4�C for 15 min, followed by goat anti-mouse IgGor IgM (Fab)2 fragments conjugated to FITC (Dianova). Afterincubation, the cells were washed twice with PBS containing 1%BSA. As a positive control mAb W6/32 against HLA class I (IgG)was used. The irrelevant mAb HD20 (IgG) served as negative con-trol. Cells were analyzed on a FACScan flow cytometer (BectonDickinson, Mountain View, CA), collecting data for 10,000 cellsfor each histogram. Dead cells were excluded by staining with BDVia-probe (Pharmingen).

For analysis of the specificity of anti-CD175s, 1 3 106 cells ofTF1 and K562 were incubated with VCN or NDVS as describedabove and then stained with anti-CD175s mAb.

Immunoprecipitation

Biotinylation of surface proteins on TF1, K562 and KG1a aswell as on VCN-treated KG-1a, TF1, Raji, JOK-1 and CEM-C7cells was performed using sulfosuccinimidobiotin (Pierce, Rock-ford, IL). Immunoprecipitation with anti-CD175s mAb (TF1 andK562), anti-CD175 mAb (KG1a), and anti-CD176 (VCN-treatedKG-1a, TF1, Raji, JOK-1, CEM-C7) and native lymphocytes

90 CAO ET AL.

derived from bone marrow and peripheral blood of healthy donorsand leukemia patients was done as described.24 In brief, biotinyl-ated cells were lysed in PBS containing 1% Nonidet P-40 and pro-tease inhibitor cocktail (Roche) for 20 min at 0�C, and nuclei andcellular debris removed by centrifugation at 1500g. For immuno-precipitation, labeled proteins were mixed with the specific mAbstogether with protein A-Sepharose CL-4B and incubated overnightunder gentle rotation at 4�C. Precipitated biotinylated proteinswere separated by sodium dodecyl sulfate-polyacrylamide gelelectrophoresis using 8% acrylamide for separation gels (SDS-PAGE), transferred to nitrocellulose membranes and detected onWestern blots by peroxidase-conjugated streptavidin.

In another approach to characterize carrier proteins for the TFsequence CD176-positive KG-1 cells were enriched with Dyna-beads M-450 IgM (Dynal Biotech, Hamburg, Germany) coatedwith anti-CD176 mAb A78-G/A7 according to the recommenda-tions of the company. After brief incubation, beads with attachedcells were separated with a magnetic device (Dynal MPC),washed, and cultivated together with the beads. After 24 hr thebeads had been spontaneously shed, and the cells were subculturedas separate cell line KG1/TF1. This cell line revealed approxi-mately 70–90% of CD176-positive cells.

Magnetic immunoprecipitation was also performed with Dyna-beads M-450 IgM coated with mAb A78-G/A7. In brief, KG-1/TF1 cells were incubated with a 5-fold number of A78-G/A7-coated sterile Dynabeads. After 2 days, the beads were magneti-cally collected, washed and boiled (95�C, 7 min) with samplebuffer according to Laemmli. The preparation was stored at220�C. In addition, affinity-purified preparations from cell lysates(see below), and in some cases crude cell lysates were used. Pro-teins were electroblotted onto PVDF (Immobilon) membranes(Millipore, Eschborn, Germany). Staining was performed usingthe mouse APAAP technique, and secondary antibodies werefrom Jackson Laboratories (Dianova).

Affinity chromatography of TF carrier glycoproteins

Affinity chromatography for gp150 was done on a PNA-agarosecolumn (Sigma, Taufkirchen, Germany). Cell lysates from KG-1/TF1 cells were prepared with lysis buffer containing a mixture ofprotease inhibitors, and applied to the column. After washing, TF-positive glycoproteins were eluted with 0.1 M lactose. Fractionswere analyzed in an ELISA with PNA coated as antigen, and A78-G/A7 as secondary antibody.

Microsequencing

Affinity-purified material from KG-1/TF1 cells was separatedon a preparative SDS-PAGE gel. A section from the middle of thegel was silver-stained to indicate the location of the gp150 band.Gel strips corresponding to this glycoprotein were cut from thegel, treated with iodoacetamide and digested with trypsin. Theobtained peptides were separated and sequenced.

Analysis of apoptosis after antibody treatment

For measuring possible apoptotic effects of anti-TFRA mAb therespective leukemia cells were seeded into microtiter flat bottomwells at a concentration of 5 3 105 cells/well, and the cells wereeither treated with VCN at a concentration of 5 mU/ml or NDVSat a concentration of 2 mU/ml in culture medium for 60 or 90 minat 37�C, or they were left untreated. The treated and untreatedcells after 3-fold washing were incubated together with sterile,purified, no preservative-containing preparations of anti-CD176mAb (A78-G/A7), anti-CD175 mAb (HB-Tn1) or CD175s mAb(HB-STn1) at 3 concentrations (1, 5 and 10 lg/ml) for 5 hr at37�C. The cells were washed twice afterwards and reacted withFITC-labeled annexin V (Pharmingen) according to the manufac-turer’s instructions. Isotype controls were performed with an IgMpreparation derived from mouse plasmocytoma at identical con-centrations (10 lg/ml). Binding of annexin V was quantitatively

assessed in flow cytometry using a FACScan flow cytometer asdescribed above.

Apoptosis-induced DNA fragmentation was measured accord-ing to Nicoletti.25 In brief, cells were harvested, treated withenzymes as described above and washed in PBS followed by over-night incubation at 37�C with no preservative-containing prepara-tions of anti-CD176 mAb or IgM isotype control (Biomol, Ham-burg, Germany). The cells were washed again in PBS, and the cellpellet was carefully resuspended in 250 ll of Nicoletti buffer con-sisting of 0.1% (v/v) Triton X-100 and 50 lg/ml propidium iodidesuspended in 0.1% sodium citrate, and were incubated overnightat 4�C. The samples were then analyzed by flow cytometry.

Reverse transcriptase-PCR analysis

Total cytoplasmic RNA was isolated from cell lines as indicatedin Figure 4 using the High Pure RNA Isolation Kit (Roche, Mann-heim, Germany). Synthesis of single-strand cDNA was performedon total RNA (2 lg) using the SUPERSCRIPT system (Life Tech-nologies, Karlsruhe, Germany) according to the manufacturer’sinstructions. The resultant single strand cDNA (20 ll) was used asthe template for PCR. The primers used for the amplification ofthe N-acetylgalactosamine-a2,6-sialyltransferase (ST6GalNAc I)gene26 were: (forward) primer 1: AAGCCTAAGTCCCAGG-CACCC; (reverse) primer 2: GATGCACCGGAGGCTCCCAGC,resulting in a PCR product of 800–900 bp. The temperature profileof the RT-PCR was as follows: denaturing at 94�C for 2 min,annealing [94�C for 30 sec, 60�C for 1 min, 72�C for 2 min] 30cycles, and extension at 72�C for 10 min. The products were sepa-rated by 1% agarose gel electrophoresis and stained with ethidiumbromide. The positive control was performed using human b-actin-specific primers in parallel RT-PCR amplifications resultingin a fragment of about 200 bp.

Results

Expression of TFRA on leukemic cells

Leukemic cell lines expressed CD175, CD175s and CD176 dif-ferently (Table I, Fig. 1). KG-1 and its derivative KG-1a as wellas K562, REH, Raji, JOK-1, Molt-3, Jurkat and CEM-C7 werepositive for CD176 (mAb A78-G/A7); KG-1a, HL-60, TF1, K562,REH, Nalm-6 and Jurkat expressed CD175 at varying intensities;only cell lines TF1 and K562 were stained by anti-CD175s mAb(TKH2, B72.3 and HBT-s-Tn). Since these cell lines were nega-tive with the anti-blood group A mAb, we conclude that positivestaining with mAb TKH2 (which is reportedly cross-reacting withblood group A) in TF1 and K562 actually resulted from CD175s.TF1 and K562 expressed MUC1, a potential carrier of CD175s.Asialo-GM1, a carrier of CD176-b on glycosphingolipids, waspositive on KG-1, KG-1a, Nalm-6, K562, REH, Raji, JOK-1,Molt-3, Jurkat and CEM-C7. Most of the antigens examined werelocalized at the cellular surface (Figs. 1a and 1b), while CD175s(Fig. 1d) and MUC1 were found at the cellular surface and in thecytoplasm as assessed by immunocytochemistry. Isolated tonsillarlymphocytes and peripheral blood B-cells as well as cryostat sec-tions of tonsils were negative for CD175, CD175s and CD176,proving that these carbohydrate sequences are not presented atmature stages of lymphocyte differentiation. From these data nolineage-specific pattern of TFRA could be found apart from theexpression of CD175s and MUC-1 on erythroblastic cell lines.

Since no reagent specific for sialylated CD176 is available, theexpression of sialylated CD176 had to be examined indirectly bycomparing CD176 staining of sialidase-treated and -untreatedcells. In all cell lines analyzed, anti-CD176 mAb binding was sig-nificantly increased after pretreatment with VCN, a sialidasewhich cleaves neuraminic acid in a2,6, a2,3 and a2,8 linkages.Remarkably, also cell lines negative for CD176 became stronglypositive after VCN pretreatment. This shows that CD176 in itssialylated form is common to cell lines of various lineages. Pre-treatment of the cells with NDVS, which specifically cleaves

91CD175, CD175S, CD176 ON MALIGNANT HEMATOPOIETIC CELLS

neuraminic acid in a2,3 linkage, also resulted in an increase ofCD176 reactivity, though to a smaller extent as after VCN treat-ment. We conclude that CD176 is sialylated at varying ratios ei-ther in a2,6 or a2,3 linkage among the cell lines examined (Table

II). All lymphocytes from tonsils grown on slides and in cryostatsections of tonsils strongly reacted with anti-CD176 after VCNpretreatment, and about 30% of lymphocytes reacted with anti-CD176 after NDVS pretreatment. Staining was observed at thecellular surface and in the cytoplasm.

In immunocytochemistry with human tonsils and leukemia celllines, reactions for CD175s were not significantly changed afterspecific saponification, indicating that in these cell lines CD175sis not present in O-acetylated form as described earlier for othercell types.23

Comparison of TF-a and TF-b expression on hematopoietic cells

Monoclonal antibodies recognizing different anomers of TF canbe used to obtain an overview on the expression of these carbohy-drate sequences either on glycoproteins, glycosphingolipids orboth. The antibody A78-G/A7 recognizes both anomers of TFwith a preference for TF-a, whereas mAb HH8 specifically detectsTF-a. As described and shown in Table I, A78-G/A7 reacted withKG-1, K562, REH, Raji, JOK-1, Molt-3, Jurkat and CEM-C7.However, mAb HH8 reacted only with KG-1 and somewhatweaker with Molt-3 (Table II). Therefore it would appear that inmost hematopoietic cell lines TF is expressed as part of the glycanmoiety of glycosphingolipids (as TF-b). In KG-1 cells, the

TABLE I – FLOW-CYTOMETRIC AND IMMUNOCYTOCHEMICAL ANALYSIS OF CD176, CD175 AND CD175s EXPRESSION ON VARIOUSHEMATOPOIETIC CELLS

Cells Tissue derivation CD176 CD175 CD175s MUC1 MUC2 Asialo-GM1

KG-1 Acute myelogenous L 11 2 2 2 2 11KG-1a Acute myelogenous L (1) 1 2 2 2 1HL-60 Acute myelogenous L 2 (1) 2 2 2 2U937 Promonocyte L 2 2 2 2 2 2TF1 Erythroblastic cell L 2 2 1 1 2 2K562 Erythroblastic cell L 2/1 (1) 1 1 2 11REH Pre-B cell L 11 1 2 2 2 11Nalm6 Pre-B cell L 2 (1) 2 2 2 1JOK-1 B cell L 1 2 2 2 2 11Raji Burkitt lymphoma 1 2 2 2 2 11U266 Multiple myeloma 2 2 2 1 2 2Jurkat T cell L 11 (1) 2 2 2 11CEM-C7 T cell L (1) 2 2 2 2 1Molt-3 T cell L 11 2 2 2 2 111B-cells Tonsils 2 2 2 2 2 2Lymphocytes Tonsils 2 2 2 2 2 2

L, leukemia; 2, negative for immunocytochemical staining; 2/1, <1% positive cells in flow-cytometry; (1), 1–5% positive cells; 1, 5–30%positive cells; 11, 30–60% positive cells; 111, >60% positive cells.

FIGURE 1 – Immunocytochemical results demonstrating that a sub-population of Raji cells is strongly stained by anti-CD176 (anti-TF, a)whereas after VCN pretreatment (b) all cells are stained. Staining ispredominantly at the cell surface, but in some cells also in the cyto-plasma; KG-1a cells express CD175 (Tn, c) at the cell surface; TF1cells express CD175s (sTn, d) at the cell surface.

TABLE II – COMPARISON OF REACTIVITIES OF THE ANTI-CD176MONOCLONAL ANTIBODIES A78-G/A7 AND HH8 ON VARIOUSHEMATOPOIETIC CELL LINES AFTER PRETREATMENT WITH

SIALIDASES––FLOW-CYTOMETRIC ANALYSIS

Cells G/A71 VCN1G/A7 NDVS1G/A7 HH8 HH81VCN

KG1 112 111 11 111 111KG1a (1) 111 1 2 111HL-60 2 111 11 nd ndU937 2 111 1 2 111K562 12 111 1 nd ndTF1 2 111 1 2 111REH 11 111 1 2 111Nalm6 2 111 1 nd ndJOK-1 1 111 11 2 111Raji 1 111 1 2 111U266 2 111 1 nd ndJurkat 11 111 11 2 1CEM-C7 (1) 111 11 nd ndMolt-3 11 111 11 1 111B-cells 2 111 1 2 11Lymphocytes 2 111 1 2 111

1G/A7: monoclonal antibody A78-G/A7 against CD176.–2Scoringof percent of positive cells:2, <1% positive cells; (1), 1–5% positivecells; 1, 5–30% positive cells; 11, 30–60% positive cells; 111,>60% positive cells.

92 CAO ET AL.

presence of both TF-a and TF-b was explicitly shown in experi-ments with lipid extraction. As demonstrated in Figure 2a, stainingof KG-1 cells was strong and resistant to lipid extraction with anti-bodies preferentially (mAb A78-G/A7) or exclusively (mAb HH8)reacting with TF-a. Staining with the anti-TF-b mAb A68-B/A11was weaker and lost after lipid extraction. Granular surface stainingby mAb A68-B/A11 (Figs. 2a and 2e) was abolished after lipidextraction (Figs. 2a and 2f). The efficacy of the methanol extractionmethod was also demonstrated in a flow cytometric experiment byabolition of asialo GM1 surface expression (Fig. 2b).

After VCN treatment, all cell lines reacted with mAb HH8 aswith A78-G/A7, which points to the fact that a significant amountof sialylated TF is expressed on glycoproteins.

Obviously, the degree of sialylation of TF is different on glyco-proteins and glycosphingolipids.

Analysis of carrier molecules of TFRA in hematopoietic cells

The staining intensity of all examined cells with anti-CD175and anti-CD176 was reduced, but not completely abolished inimmunocytochemistry after methanol extraction (data not shown).This also indicates that glycolipids are not the sole carrier mole-cules of CD175 and CD176. An interesting observation was thatmost cell lines treated with NDVS showed a drastic reduction ofthe staining for anti-CD176 after methanol extraction (data notshown). Most likely these observations corroborate the conclusionthat a2,3-bound sialic acid was preferentially carried by glyco-lipids.

Glycoprotein carrier molecules of CD176 were analyzed byimmunoprecipitation and Western blotting of proteins extractedfrom sialidase-treated cell lines. KG-1a, TF1, JOK-1 and Rajirevealed a series of anti-CD176 mAb-reactive glycoproteins with

FIGURE 2 – Demonstration of TF-a and TF-b on KG-1 cells. (a) Immunofluorescence performed on formaldehyde fixed cells without (a, c, e)and with (b, d, f) lipid extraction. (a, b) mAb A78-G/A7 (TFa > TF-b), (c, d) mAb HH8 (TF-a), (e, f) mAb A68-B/A11 (TF-b � TF-a). TF-a(O-glycosidically bound to protein) is resistant to lipid extraction whereas TF-b (carried by glycosphingolipids) is not. Secondary antibodieswere either Cy-3-labeled (a–d) or FITC-labeled (e, f). Note that in (e, f) nuclei are counterstained by p-phenylenediamine present as anti-fadingagent in the embedding medium. (a, b) 340 lens, (c, d) 320 lens, (e, f) 363 lens. (b) Flow cytometric analysis of effects after lipid extraction.Formaldehyde fixed KG-1 cells without and with (shadowed curves) lipid extraction as described in Materials and Methods were stained with apolyclonal rabbit antiserum against asialo GM1. As control, cells were only stained with anti-rabbit secondary antibody conjugated to FITC.Numbers given in graphs represent the respective mean fluorescence intensity.

93CD175, CD175S, CD176 ON MALIGNANT HEMATOPOIETIC CELLS

2 main bands at about 180 and 120 kDa (Fig. 3a), a major band atabout 120 kDa for the T-cell leukemia cell line CEM-C7 (Fig. 2a),and 3 predominant bands at about 200, 180 and 120 kDa for themyeloid leukemia cell line KG-1a (Fig. 3b). When using nativebone marrow-derived and peripheral blood lymphocytes as well asleukemia cells from patients suffering from chronic lymphocyticleukemia (CLL), we always obtained a band of 150 kDa by immu-noprecipitation and subsequent Western blotting (Fig. 3d).Because of the sialidase pretreatment of the cells most of thebands recognized by anti-CD176 mAb may represent glycopro-teins carrying sialylated CD176.

To identify carrier proteins for the unmasked CD176 carbohy-drate sequence, we selected KG-1 cells with high surface expres-sion of CD176 by magnetobead separation technique as describedin Materials and Methods. The selected subline KG-1/TF1remained stable for its high CD176 expression during many cell

passages. For immunoprecipitation studies on this cell line weused magnetic beads coated with mab A78-G/A7 to collect thecorresponding carrier protein(s). The beads strongly attached toKG-1/TF1 cells, leading to aggregates of beads and cells as couldbe observed by immunofluorescence microscopy (images notshown). After 24 hr, the beads had been shed spontaneously andcould easily be magnetically collected and directly used for SDS-PAGE. These preparations contained—similar to whole celllysates—many proteins as seen in Comassie, Ponceau or silverstainings (Fig. 4a, lanes 1 and 2). More selective was an affinity-purified preparation from cell lysates using a PNA-agarose col-umn. Whereas in this case no distinct bands were visible by com-monly used protein staining methods (Ponceau, Coomassie, silverstaining), a fact commonly observed with highly glycosylated,mucin-like glycoproteins (Figs. 4a and 4b), Western blotting withanti-CD176 mAb revealed a broad band at approximately 150 kD

FIGURE 3 – Immunoprecipitation and Western blotting of proteins extracted from sialidase-treated cell lines JOK-1, Raji and CEM-C7revealed a series of CD176 (TF)-reactive glycoproteins with 2 main bands at about 180 and 120 kDa for B-cell leukemia (Raji and JOK-1, a), amajor band at about 120 kDa for T-cell leukemia (CEM-C7, a), and 3 predominant bands at about 200, 180 and 120 kDa for the myelogenousleukemia line KG-1a (b). The approximate molecular weight of CD175 (Tn) carrier glycoproteins in KG-1a was 180 and 150 kDa (b). The majorand common carrier molecule of CD175s (sTn) in TF1 and K562 is a 120 kDa glycoprotein which may be leukosialin (CD43); 2 weaker bandscould be seen in TF1 (c). A major band of 150 kDa for CD176 was observed in CD341 bone marrow hematopoietic precursor cells, normal pe-ripheral blood lymphocytes and leukemia cells derived from peripheral blood of CLL patients (d). For all immunoprecipitation experimentsirrelevant isotype-matched mouse immunoglobulin preparations were applied as controls, which resulted in negative banding (data notpresented).

FIGURE 4 – Characterization of GP150 from KG-1/TF1 cells. SDS-PAGE (a, b) and Western Blot (c) of affinity-purified gp150 from KG-1/TF1 cells (a) silver staining. Lanes 1 and 2: Cell lysate of KG-1/TF1; 1 before, 2 after PNA-Sepharose column (nonabsorbed proteins). Lane3: Molecular markers. Lanes 4–6: Increasing amounts of eluate from the PNA-Sepharose column. (b) Silver staining of a similar gel after trans-fer to an Immobilon-P membrane. Lanes 1–5: Increasing amounts of eluate (higher amounts than on gel A); Lane 6: Molecular markers.(c) Lanes 1–5: Increasing amounts of eluate, after transfer stained with anti-CD176 mab A78-G/A7. Lane 6: Molecular markers stained withPonceau S. (d) Western blot of KG-1/TF1 immunoprecipitates of gp150 with A78-G/A7-coated Dynabeads. Lanes 1 and 7, molecular weightmarkers; lanes 2 and 5, anti-CD176; lane 3, anti-CD34; lane 4, anti-CD45; and lane 6, control omitting the primary antibody.

94 CAO ET AL.

(Fig. 3c). Other CD176 mAbs used gave identical results (data notshown). This result was remarkable since one would haveexpected (cf results shown in Fig. 3) an array of different glyco-proteins carrying CD176 (i.e., with similar glycosylation defects).MAbs to a number of representative membrane glycoproteins (CDmarkers) of lymphoid cells were employed in Western blots inorder to identify the gp150 band of KG-1 by its co-migratorybanding pattern. Since TF is exposed as a result of incomplete sia-lylation, it was anticipated that the gp150 glycoprotein corre-sponds in its fully sialylated form to a glycoprotein with a lowerapparent Mr. In fact, anti-CD34 antibodies (normally stainingbands at 105–120 kDa) were the only antibodies among thoseemployed which showed staining at the same apparent Mr asCD176 mAb A78-G/A7, whereas antibodies to another candidateglycoprotein (CD45) stained a band at a higher apparent Mr corre-sponding to that of its fully glycosylated form (Fig. 4d).

A section of a preparative SDS gel corresponding to the CD176positive band (Figs. 4c and 4d) was eluted and examined bymicrosequencing. The major peptide revealed the sequence ‘‘L G IL D F T E Q D V A S H Q’’, which is fully concordant with thesequence of amino acids 258–272 of CD34. Minor peptides wereclearly contaminants (trypsin, traces of cytokeratin).

From these data, we conclude that the 150 kD band carrying TF(CD176) in KG-1 cells is the CD34 molecule.

The carrier glycoproteins of CD175 were also analyzed byimmunoprecipitation and Western blotting of proteins extractedfrom cell lines. The approximate molecular weight of CD175 car-rier glycoproteins in KG-1a was 180 and 150 kDa (Fig. 3b).

The major common carrier molecule of CD175s in TF1 andK562 is a 120 kDa glycoprotein. Additional bands were observedin TF1 cells (Fig. 3c).

Immunoprecipitation of proteins of the MUC1-positive cell lineTF1 followed by Western blotting with an anti-MUC1 mAbresulted in several bands at 150, 100 and 70 kDa (data not shown).

The staining intensity for CD175s on cell lines TF1 and K562was not significantly changed after methanol extraction in immu-nocytochemistry, These results indicate that glycoproteins are themajor carrier molecules for CD175s, and that glycolipids play aminor role in this respect.

In semiquantitative flow cytometric experiments, pretreatmentwith VCN drastically reduced binding of anti-CD175s mAbs,whereas NDVS had no effect on the binding in accord with thefact that CD175s is a2,6-sialylated.

Expression of ST6GalNAc I mRNA in CD175s 1 cell lines

Since the N-acetylgalactosamine-a2,6-sialyltransferase (ST6GalNAc I) has been implicated with the synthesis of CD175s (sTn) incarcinomas,26 we examined its transcription in CD175s1 andCD175s- hematopoetic cells by RT-PCR. The analysis revealed thatthe long-form (909 bp) ST6GalNAc I mRNA was present inCD175s1 TF1 and K562 cells but not in CD175s2 cells such asJOK-1, KG-1 or KG-1a (Fig. 5). Short-form transcripts (675 bp)were not detected in these cell lines.

Apoptotic effect of anti-CD176 antibody treatment

Induction of apoptosis mediated by galectin-1 after binding tocarbohydrate ligands with terminal galactose has been reported.15

We now wanted to see whether apoptosis could also be induced onCD176 expressing cells by contact with an appropriate mAb, possi-bly mimicking a naturally occurring lectin like the galectins. Cellswith varying expression of non-sialylated CD176 were exposed toincreasing amounts of anti-CD176 mAb (A78-G/A7), and earlysteps of apoptosis were first assessed by binding of annexin V to thecell surface. As can be seen in Figure 6a, only the cell line KG-1strongly expressing CD176 bound annexin V to a larger extent afterexposure to the antibody indicating a role of surface expressedCD176 in apoptosis induction. After pretreatment with VCN, othercell lines also showed higher annexin V binding induced by anti-CD176 antibody treatment. Pretreatment with NDVS, i.e., cleavingof a2,3-bound sialic acid, resulted in a much smaller effect withregard to apoptosis induction. Therefore, masking of CD176 surfaceglycans by sialylation (especially a2,6-bound sialic acid) obviouslyprotects the cells from apoptosis induction mediated by contact withantibodies (and possibly also lectins) reacting with CD176.

In a second approach, as an indication for terminal stages of ap-optosis, we measured DNA fragmentation by the Nicoletti methodafter incubation of the cells with anti-CD176 antibodies. As canbe seen in Figure 6b, the CD176 mAb induced DNA fragmenta-tion in several leukemia cell lines to a varying extent. The apopto-sis-enhancing effect of VCN pretreatment was only observed incell line CEM-C7 and more drastically in K652, whereas in theremaining cell lines—even without surface degradation of sialicacid—a destructive effect of the CD176 mAb was seen.

Discussion

In this study, the expression of a group of oncodevelop-mental, structurally related carbohydrate antigens, the

FIGURE 5 – Real-time-PCR analysis of ST6GalNAcI mRNA expression in the CD175s(sTn)1 cell lines TF1 and K562, and in theCD175s2

cell lines KG-1, KG-1a and JOK-1. Total RNA was subjected to reverse transcriptase and polymerase chain reaction using ST6GalNAcI specificprimers. TF1 and K562 expressed transcripts, the CD175s2 cell lines were deficient of any ST6GalNAcI specific transcript. Human b-actin wasused as internal control.

95CD175, CD175S, CD176 ON MALIGNANT HEMATOPOIETIC CELLS

FIGURE 6 – Apoptotic effect of anti-CD176 antibodies on hematopoietic cell lines. (a) Anti-CD176 mAb (A78-G/A7) induced apoptosis inVCN-(�) or a2,3 sialidase-treated (*) or in untreated cells (s). Cells were incubated with anti-CD176 for 5 hr and were subsequently analyzedfor binding of annexin V in flow cytometry as described in Material and Methods. As negative control, cells were treated with an irrelevantmouse IgM (at 10 lg/ml), which did not show significant annexin V binding (apoptotic cells in untreated/VCN-treated cells given in percentageannexin V binding: CEM-C7 2/4%; KG1 2/2%; KG1a 1/1.5%; K562 13/16%; U937 1/1.5%). (b) Nicoletti assay for apoptosis-induced DNAfragmentation. Cell lines were treated with anti-CD176 mAb with and without prior VCN treatment and were subjected to the Nicoletti assay an-alyzed by flow cytometry as described in Material and Methods. CD176 mAb and irrelevant IgM control antibody were applied in this experi-ment at a concentration of 10 lg/ml each. Numbers given in cytograms represent mean fluorescence of DNA fragments (region marked with abar), regions outside the bar on the right side represent intact cells in different stages of the cell cycle.

Thomsen-Friedenreich-related antigens (TFRA), comprising Tn(CD175), sTn (CD175s), TF (CD176) and sialylated TF, wassystematically investigated on several human leukemia cell linesby means of specific mAbs without and with pretreatment of thecells with sialidases. CD175s was selectively expressed on theerythroblastoid leukemia cell lines TF1 and K562, whereasCD175 (the precursor of TFRA) was present on a broader spec-trum of leukemic cell lines. CD176 was expressed on severalleukemia cells in higher frequency. Thus its expression is not re-stricted to epithelial tumors3 and fetal epithelial cells.4 On epi-thelial cells CD176 and CD175 carbohydrate sequences are pre-dominantly carried by mucins.3 There are only few reports aboutcarrier molecules of CD176 and CD175 on hematopoieticcells.9,27 In the present study, the following information aboutcarrier molecules of TFRA in human hematopoietic cells wasobtained: (i) Both glycoproteins and glycolipids are carrier mol-ecules of CD176 and CD175 in hematopoietic cells. The glyco-sphingolipid asialo-GM1 (which is a carrier of TF-b) wasexpressed at the surface of many cell lines as described in thepresent study and in a previous report.28 When we treated cellswith O-sialoglycoprotein endopeptidase (sialopeptidase) prior tostaining with either mAb A78-G/A7 or HH8, this treatmentresulted in a substantial loss of A78-G/A7 staining intensity andan almost complete loss of HH8 staining in all cell lines as evi-denced by cytometrric analysis (data not shown). This provesthat a varying but significant portion of CD176 (TF-a) and sialy-lated CD176 is carried on mucin-type sialoglycoproteins in leu-kemic cell lines. (ii) A variety of glycoproteins carry TFRA. Aseries of glycoproteins that carry masked or unmasked CD176were found, which partially differed among cell lines tested: 3main broad bands (200, 180 and 120 kDa) for myeloid leukemia(KG-1a), 2 main bands (180 and 120 kDa) for erythroblastic cellleukemia (TF1), B-cell leukemia (JOK-1) and Burkitt-lym-phoma (Raji), and 1 predominant band (120 kDa) for T-cell leu-kemia (CEM-C7). However, when using normal lymphocytesderived from peripheral blood or CD341 hematopietic precur-sors from bone marrow or leukemia cells from CLL patients astarget cells for immunoprecipitation, we always obtained a dom-inant band at approximately 150 kDa. It may well be that thisband represents the same carrier glycoprotein as that of 120 kDafound in leukemia cell lines. The differences in molecularmasses may be explained by different glycosylation of the re-spective protein.

To closer determine carrier glycoproteins for unmasked CD176we selected KG-1 cells for high expression of CD176 and per-formed immunoprecipitation, Western blotting and subsequentmicrosequencing with this KG-1 subline (KG-1/TF1). Westernblots of CD176 immunoprecipitates with antibodies towards severalknown CD antigens revealed co-migration with a CD34 specificband in SDS-PAGE. Microsequencing of the glycoprotein of theCD176-positive band yielded a sequence specific for CD34. Weconclude that in CD341 KG-1 cells, the CD34 glycoprotein carriesthe unmasked CD176 (TF-a) carbohydrate sequence. CD34 has notyet been described or considered as a carrier molecule for CD176.

The identification of the immunoprecipitated 150 kDa band innormal lymphocytes of various differentiation stages and inchronic lymphocytic leukemia cells seen after sialidase treatmentremains to be clarified. For several reasons CD34 as carrier ofCD176 is rather unlikely in these cells. CD34 is a marker for he-matopoietic progenitors preferentially present in the bone marrowand is lost during maturation into the lymphocytic lineages.Whether CD34 of bone marrow hematopoietic progenitors con-tains CD176 as terminal glycan sequence cannot be settledunequivocally in this study. Although not verified by sequencinganalysis, the 120 kDa glycoprotein immunoprecipitated with anti-CD176 mAb in myeloid leukemia and in T-cell leukemia may beCD43. CD43 (Leukosialin) isolated from HL-60 cells appears as a120 kDa band in SDS-PAGE.29 This glycoprotein has beenreported to carry Galb1-3GalNAca1- and sialylated Galb1-3GalNAca1- as major O-linked oligosaccharides.27 It has also

been reported that a 120 kDa glycoprotein carrying the CD175structure in the T-cell leukemia cell line Jurkat is CD43.9 How-ever, as mentioned above, the carrier proteins of CD176 andCD175 show different mobilities in SDS-PAGE. There are 2 pos-sible explanations: either CD176 and CD175 are attached to dif-ferent glycoproteins, or CD176 and CD175 share the same poly-peptide as carrier but differ in SDS-PAGE due to their differentglycosylation as already described for CD43.29

MUC1 and MUC2 are not carrier molecules of CD175 andCD176 in hematopoietic cells. All cell lines except TF1 and K562were negative for MUC1, and all cell lines were negative forMUC2. In this study, the major and common carrier molecule ofCD175s in TF1 and K562 was a glycoprotein with an apparentmolecular weight of 120 kDa. Since CD43 was expressed as a 116kDa sialoglycoprotein in K56229 and contains NeuNAca2-6GalNAc-27 we presume that the glycoprotein prevailing in thesecell lines may also be a glycosylation variant of CD43.

Although, generally spoken, the expression of fetal antigensmay reflect incomplete or aberrant differentiation of leukemiccells, the actual mechanism underlying the presence of CD175and CD176 in leukemias and their absence in normal mature he-matopoietic cells is not clear. Exposure of these oligosaccharidesin colon cancer results from several defects in glycosyltransferaseactivities.30 In particular, the a2,6-sialyltransferase (ST6Gal-NAcII) is overexpressed in colon cancer and correlated at thesame time with an increased expression of CD176, probably dueto an imbalance of several glycosyltransferases.31 In Tn syndrome,a rare disease characterized by the exposure of the CD175 antigenon the cell surface of a variable portion of blood cells, unmaskingof GalNAca1-R ensues from a defect associated with the func-tional activity of b1,3-(O)galactosyltransferase. It has been shownfor blood cells of Tn syndrome patients that somatic mutations inthe chaperone gene Cosmc are responsible for the decreased gly-cosyltransferase activity which entails disruption of O-glycancore-1 synthesis and possibly leads to overexpression of TFRAs,in particular the Tn antigen.32,33 The mechanisms underlying theconcomitant expression of CD175 and CD176/sialylated CD176in leukemia cells is obviously not yet settled. Jurkat cells contain adeletion of 1 nucleotide (T) in the Cosmc gene which causes a fra-meshift and a stop codon and as a consequence thereof results in atruncated, non-functional protein in Jurkat cells as observed ear-lier34 and verified by us for the Jurkat cell line used in this study.Despite this CD176 is still expressed in Jurkat cells. A permissiveexpression of TF (CD176) in Jurkat cells has also been describedby others.35 It may be that the defects in Cosmc expressionobserved in normal lymphocytes of Tn syndrome patients andthose found in leukemia cells such as Jurkat cells have differentinfluence on the expression of TFRA structures, possibly due todifferent mechanisms in leukemia cells leading to by-passing ofthe chaperone defect.

The N-acetylgalactosamine-a2,6-sialyltransferase (ST6GalNAcI) has been identified as key enzyme for the synthesis of CD175sin epithelial cells,26 and the expression of CD175s in colon carci-nomas results from a reduction in sialic acid O-acetylation.23 Wedid not find a significant change in CD175s staining after specificsaponification in human tonsils and leukemia cell lines, indicatingthat human hematopoietic cells, unlike intestinal cells, do notexpress O-acetylated CD175s. Interestingly, CD175s1 TF1 andK562 cells expressed the long-form (909 bp) ST6GalNAc ImRNA similar to CD175s1 carcinoma cell lines, but in CD175s-cell lines such as JOK-1 any type of ST6GalNAc I transcript seemto be absent unlike CD175s- carcinoma cell lines, which expressshort-form ST6GalNAc I transcripts.26

Our results prove that the anti-CD175s mAbs are specific fora2,6 sialylated glycans. It has been reported that CD22 (siglec-2)binds to CD175s of porcine submaxillary mucin and ovine sub-maxillary mucin, but not to sTn at the cell surface.14 In our study,we could not find binding of CD22 to CD175s expressing celllines TF1 and K562 (data not shown). In our and other studies,

97CD175, CD175S, CD176 ON MALIGNANT HEMATOPOIETIC CELLS

CD22 was described as a lectin with predominant binding affinityto N-linked a2,6-sialylated lactosamine oligosaccharides,36 thusmaking binding to CD175s rather unlikely.

The expression of CD176 may be of pathophysiological signifi-cance. For example, CD176 antigen on the surface of extrahepatic,especially gastrointestinal cancer cells may lead to binding to he-patocytes or Kupffer cells carrying asialoglycoprotein receptorsand mediate liver metastasis of malignant tumor cells.12 Althoughone group found CD176 adhesion to endothelium,37 in our studyno binding of TF-PAA to 2 human endothelial cell lines wasobserved (data not shown). The physiological and pathophysiolog-ical function of TFRA on leukemias and lymphomas is even lessclear. According to our data, anti-CD176 mAbs seem to be able toinduce apoptosis in cells carrying this glycotope at their surface.In our experiments, a protective effect of CD176 sialylationagainst apoptosis induction at early stages was observed (meas-ured by annexin V binding), whereas overnight exposure of cellsto anti-CD176 mAbs led to apoptosis induction even without priorsialidase treatment (measured by DNA fragmentation). Applica-tion of CD175/CD175s antibodies in the same experiment did notexert this effect (data not shown). The mechanism(s) underlyingthis effect are not known but deserve further study. The predomi-nant carrier molecules of CD176 recognized by mAb A78-G/A7are glycoproteins as described above. We presume that apoptosisinduced by this anti-CD176 mAb is mediated by CD176 carrierglycoproteins. Anti-CD176 mAb binds to the unmasked CD176glycan sequence on preapoptotic cells which as a consequencemay activate apoptotic signal pathways. The data available so fardemonstrate 3 features: (i) CD176 sialylation obviously protectsagainst apoptosis induced by natural anti-CD176 antibodies thatoccur in all adult sera.38 Cryptic CD176 (Galb1-3GalNAca1-R;core-1) is an ubiquitous structure found in many O-glycans on thesurface of human blood cells, but natural anti-CD176 antibodies

do not induce apoptosis in normal human blood cells. (ii) Severalpapers have shown that TF1 (CD1761) T-cell acute lymphoblas-tic leukemia (ALL) has a better prognosis than TF-negativeALL.10,11 Apoptotic destruction induced by anti-CD176 antibod-ies of the natural antibody repertoire may provide an explanationfor this phenomenon. The observation that natural human poly-reactive IgM fractions (containing anti-CD176 antibodies) induceapoptosis of lympoid cell lines supports this hypothesis and maybe exploited for therapeutic strategies.39 A further corroborationof a link between expression of non-sialylated CD176 and apopto-sis in lymphocytes was provided by the experiments of Priatelet al., which demonstrated that peripheral CD81 T lymphocytesof mice deficient in ST3Gal-I sialyltransferase, the key enzymefor CD176 sialylation, showed enhanced expression of unsialy-lated core 1 O-glycans and increased apoptosis.40 (iii) It is an openquestion whether this also applies to epithelial cancers. In headand neck cancer, the expression levels of both galectin-1, galectin-3 and CD176 and of their possible binding sites are decreasingalong the process of malignancy.41

In summary, the expression of the oncodevelopmental TFRA inhuman leukemia and lymphoma indicates abnormal or incompleteglycosylation patterns similar to those in epithelial cells, althoughtheir carrier molecules are different. Surface-expressed CD176 inhematological malignancies may be involved in apoptosis inductionwhen encountered by appropriate lectins or specific antibodies.

Acknowledgements

The authors thank Dr. M. Willhauck-Fleckenstein (GermanCancer Research Center) for molecular biological analysis ofCosmc expression in hematopoietic cells, Dr. Renate Stahn (Gly-cotope) for support with lipid extraction experiments, and Mrs.Margot Kiefer (MDC) for excellent technical assistance.

References

1. Schwartz-Albiez R. Carbohydrate and lectin: section report. In:Mason D, Andr�e P, Bensussan A, Buckley C, Civin C, Clark E, deHaas M, Goyert S, Hadam M, Hart D, Horejsi V, Jones Y, et al. Leu-cocyte typing VII, white cell differentiation antigens. Oxford: OxfordUniversity Press, 2002:149–64.

2. Cao Y, Stosiek P, Springer GF, Karsten U. Thomsen-Friedenreich-related carbohydrate antigens in normal adult human tissues: a system-atic and comparative study. Histochem Cell Biol 1996;106:197–207.

3. Kim YS, Gum JR Jr, Brockhausen I. Mucin glycoproteins in neopla-sia. Glycoconjugate J 1996;13:693–707.

4. Barr N, Taylor CR, Young T, Springer GF. Are pancarcinoma T andTn differentiation antigens? Cancer 1989;15:834–41.

5. Clausen H, Hakomori S-I. ABH and related histo-blood group anti-gens; immunochemical differences in carrier isotypes and their distri-bution. Vox Sang 1989;56:1–20.

6. Springer GF. Immunoreactive T and Tn epitopes in cancer diagnosis,prognosis and immunotherapy. J Mol Med 1997;75:594–602.

7. Muroi K, Suda T, Nakamura M, Okada S, Nojiri H, Amemiya Y,Miura Y, Hakomori S. Expression of sialosyl-Tn in colony-formingunit-erythroid, erythroblasts. B cells and a subset of CD41 cells.Blood 1994;83:84–91.

8. Aller CT, Kucuk O, Springer GF, Gilman-Sachs A. Flow cytometricanalysis of T and Tn epitopes on chronic lymphocytic leukemia cells.Am J Haematol 1996;52:29–38.

9. Inoue M, Nakada H, Tanaka N, Yamashina I. Tn antigen is expressedon leukosialin from T-lymphoid cell. Cancer Res 1994;54:85–8.

10. Kaspers GJL, Veerman AJP, Van Wering ER, Van Der Linden-Schrever BEM, Van Zantwijk CH, Van Der Does-Van Den Berg A, RPieters. Prognostic significance of peanut agglutinin binding in child-hood acute lymphoblastic leukemia. Leukemia 1996;10:675–81.

11. Veerman AJ, Hogeman PH, Huismans DR, Van Zantwijk CH, BezemerPD. Peanut agglutinin, a marker for T-cell acute lymphoblastic leuke-mia with a good prognosis. Cancer Res 1985;45: 1890–3.

12. Cao Y, Karsten UR, Liebrich W, Haensch W, Springer GF, SchlagPM. Expression of Thomsen-Friedenreich-related antigens in primaryand metastatic colorectal carcinomas: a reevaluation. Cancer 1995;76:1700–8.

13. Ogata S, Maimonis PJ, Itzkowitz SH. Mucins bearing the cancer-asso-ciated sialosyl-Tn antigen mediate inhibition of natural killer cell cy-totoxicity. Cancer Res 1992;52:4741–6.

14. Brinkman-Van der Linden EC, Varki A. New aspects of siglec bind-ing specificities, including the significance of fucosylation and of thesialyl-Tn epitope. Sialic acid-binding immunoglobulin superfamilylectins. J Biol Chem 2000;275:8625–32.

15. Perillo NL, Pace KE, Seilhamer JJ, Baum LG. Apoptosis of T cellsmediated by galectin-1. Nature 1995;378:736–9.

16. Schwartz-Albiez R, Merling A, Martin S, Haas R, Gross H-J. Cell sur-face sialylation and ecto-sialyltransferase activity of human CD34progenitors from peripheral blood and bone marrow. GlycoconjugateJ 2004;21:451–9.

17. Schwartz-Albiez R, D€orken B, M€oller P, Brodin NT, Monner DA,Kniep B. Neutral glycosphingolipids of the globo-series characterizeactivation stages corresponding to germinal center B cells. Int Immu-nol 1990;2:929–36.

18. Karsten U, Butschak G, Cao Y, Goletz S, Hanisch F-G. A new mono-clonal antibody (A78-G/A7) to the Thomsen-Friedenreich pan-tumorantigen. Hybridoma 1995;14:37–44.

19. Kjeldsen T, Clausen H, Hirohashi S, Ogawa T, Iijima H, HakomoriS-I. Preparation and characterization of monoclonal antibodiesdirected to the tumor-associated O-linked sialosyl-2-6 a-N-acetylga-lactosaminyl (sialosyl-Tn) epitope. Cancer Res 1988;48:2214–20.

20. Cao Y, Schlag PM, Karsten U. Immunodetection of epithelial mucin(MUC1. MUC3) and mucin-associated glycotopes (TF, Tn, and sialo-syl-Tn) in benign and malignant lesions of colon epithelium: a polarlocalization corresponds to malignant transformation. VirchowsArchiv 1997;431:159–66.

21. Xiang P-X, Prenzoska J, Layton GT, Devine PL, McKenzie IFC. Sec-ond-generation monoclonal antibodies to intestinal MUC2 peptide re-active with colon cancer. J Natl Cancer Inst 1992;84:699–703.

22. Bergmann M, Gross H-J, Abdelatty F, M€oller P, Jaeken J, ReinhardSchwartz-Albiez. Abnormal surface expression of sialoglycans on Blymphocyte cell lines from patients with carbohydrate deficient glyco-protein syndrome I A (CDGS IA). Glycobiology 1998;8:963–72.

23. Jass JR, Allison LJ, Edgar SG. Monoclonal antibody TKH2 to the can-cer-associated epitope sialosyl Tn shows cross-reactivity with variantsof normal colorectal goblet cell mucin. Pathology 1994;26:418–22.

24. Cao Y, Merling A, Karsten U, Schwartz-Albiez R. The fucosylated histo-blood group antigens H type 2 (blood group O. CD173) and Lewis. Y(CD174) are expressed on. CD341 hematopoietic progenitors but absentonmature lymphocytes. Glycobiology 2001; 11:677–83.

98 CAO ET AL.

25. Riccardi C, Nicoletti I. Analysis of apoptosis by propidium iodidestaining and flow cytometry. Nat Protoc 2006;1:1458–61.

26. Ikehara Y, Kojima N, Kurosawa N, Kudo T, Kono M, Nishihara S,Issiki S, Morozumi K, Itzkowitz S, Tsuda T, Nishimura S-I, Tsuji S,Narimatsu H. Cloning and expression of a human gene encoding anN-acetylgalactosamine-a2,6-sialyltransferase (ST6GalNAc I): a can-didate for synthesis of cancer-associated sialyl-Tn antigens. Glycobi-ology 1999;9:1213–24.

27. Carlsson SR, Sasaki H, Fukuda M. Structural variations of O-linkedoligosaccharides present in leukosialin isolated from erythroid, mye-loid, and T-lymphoid cell lines. J Biol Chem 1986;261:12787–95.

28. Nakahara K, Ohashi T, Oda T, Hirano T, Kasai M, Okumura K, TadaT. Asialo GM1 as a cell-surface marker detected in acute lymphoblas-tic leukemia. N Engl J Med 1980;302:674–7.

29. Carlsson SR, Fukuda M. Isolation and characterization of leukosialin,a major sialoglycoprotein on human leukocytes. J Biol Chem1986;261:12779–86.

30. Vavasseur F, Dole K, Yang J-M, Matta KL, Myerscough N, CorfieldA, Paraskeva C, Brockhausen I. O-Glycan biosynthesis in human col-orectal adenoma cells during progression to cancer. Eur J Biochem1994;22:415–24.

31. Schneider F, Kemmner W, Haensch W, Franke G, Gretschel S, KarstenU, Schlag PM. Overexpression of sialyltransferase CMP-sialic acid:Galb1,3GalNAc-R a6sialyltransferase is related to poor patient survivalin human colorectal caercinoma. Cancer Res 2001;61:4605–11.

32. Schietinger A, Philip M, Yoshida BA, Azadi P, Liu H, Meredith SC,Schreiber H. A mutant chaperone converts a wild-type protein into atumor-specific antigen. Science 2006;314:304–8.

33. Ju T, Cummings RD. Chaperone mutation in Tn syndrome. Nature2005;437:1252.

34. Ju T, Cummings RD. A unique molecular chaperone Cosmc requiredfor activity of the mammalian core 1 b3-galactosyltransferase. ProcNatl Acad Sci USA 2002;99:16613–18.

35. Piller V, Piller F, Fukuda M. Biosynthesis of truncated O-glycans inthe T cell line Jurkat. J Biol Chem 1990;265:9264–71.

36. Powell LD, Varki A. The oligosaccharide binding specificities ofCD22 b, a sialic acid-specific lectin of B cells. J Biol Chem 1994;269:10628–36.

37. Glinsky VV, Glinsky GV, Rittenhouse-Olson K, Huflejt ME, GlinskiiOV, Deutscher SL, Quinn TP. The role of Thomsen-Friedenreich anti-gen in adhesion of human breast and prostate cancer cells to the endo-thelium. Cancer Res 2001;61:4851–7.

38. Butschak G, Karsten U. Isolation and characterization of Thomsen-Friedenreich-specific antibodies from human serum. Tumor Biol2002;23:113–22.

39. Varambally S, Bar-Dayan Y, Bayry J, Lacroix-Desmazes S, Horn M,Sorel M, Bar-Dayan Y, Ruberti G, Kazatchkine MD, Kaveri SV. Nat-ural human polyreactive IgM induce apoptosis of lymphoid cell linesand human peripheral blood mononuclear cells. Int Immunol2004;16:517–24.

40. Priatel JJ, Chui D, Hiraoka N, Simmons CJT, Richardson KB, PageDM, Fukuda M, Varki NM, Marth JD. The ST3Gal-I sialyltransferasecontrols CD81 T lymphocyte homeostasis by modulating O-glycanbiosynthesis. Immunity 2000;12:273–83.

41. Choufani G, Nagy N, Saussez S, Marchant H, Bisschop P, Burchert M,Danguy A, Louryan S, Salmon I, Gabius HJ, Kiss R, Hassid S. The lev-els of expression of galectin-1, galectin-3, and the Thomsen-Frieden-reich antigen and their binding sites decreases as clinical aggressivenessincreases in head and neck cancers. Cancer 1999;86:2353–63.

99CD175, CD175S, CD176 ON MALIGNANT HEMATOPOIETIC CELLS