Expression and responsiveness of cytokines and their ...
Transcript of Expression and responsiveness of cytokines and their ...
1
University of Manchester
School of Pharmacy and Pharmaceutical Sciences
Expression and responsiveness of cytokines and their receptors
in breast cancer
Thesis submitted for the degree of MPhil
in the Faculty of Medical and Human Sciences 2011
by Kleopatra E Andreou
Supervised by: Dr Costas Demonacos (School of Pharmacy)
Dr Marija Krstic-Demonacos (Faculty of Life Sciences)
2
CONTENTS
Abstract..........................................................................................................5
Declaration ....................................................................................................6
Copyright statement......................................................................................7
List of abbreviations ..................................................................................8-9
Chapter 1: Introduction..............................................................................10
1.1 The link between inflammation and cancer ........................10-11
1.2 Characteristics of the inflammatory response...........................11
1.2.1 General background.........................................................11-12
1.2.2 Cytokines .........................................................................13-15
1.3 Role of inflammatory mediators in cancer...............................16
1.3.1 Immune cells and cytokines.............................................16-19
1.3.2 Chemokines .....................................................................19-21
1.4 Molecular insights and mechanisms of cancer related
Inflammation......................................................................21-22
1.4.1 Role of tumour necrosis factor.........................................22-25
1.4.2 Inflammation and hypoxia................................................25-27
1.4.3 The p53 tumour suppressor in inflammation...................28-30
1.4.4 Histone acetyltransferase activity, cancer and
Inflammation....................................................................30-33
1.4.5 Histone deacetylase activity, caner and inflammation...33-35
1.5 Breast cancer.......................................................................35-37
3
1.6 Therapeutic approaches.......................................................38-39
1.7 Hypothesis and aims of the project.....................................39-40
Chapter 2: Materials and Methods............................................................41
2.1Cell culture, chemical treatments and constructs................ 41-42
2.2 Western blotting........................................................................43
2.2.1 SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel
electrophoresis…………………………………………..43-46
2.2.2 Electroblotting and detection.............................................46-48
2.3 Co-immunoprecipitation.......................................................48-50
2.4 Polymerase chain reaction ...................................................50-52
2.5 DNA electrophoresis.............................................................52-53
2.6 Quantitative reverse transcription PCR (Real time PCR)..........53
2.6.1 RNA extraction and reverse transcription..........................53-55
2.6.2 Quantitative PCR ...............................................................55-57
2.7 Chromatin immunoprecipitation...........................................58-60
2.8 Handling and isolation of plasmid DNA....................................61
2.8.1 Transformation of competent bacteria ...............................61-62
2.8.2 Mini scale preparation of plasmid DNA .................................63
2.8.3 Maxi scale preparation of plasmid DNA............................63-64
2.9 Molecular cloning and restriction analysis.................................65
2.9.1 Genomic DNA extraction........................................................66
2.9.2 TOPO cloning.....................................................................66-67
2.9.3 Analysis with restriction digestion.....................................67-68
2.9.4 pGL3 cloning......................................................................69-70
2.10 Luciferase reporter assays...................................................70-72
4
Chapter 3: Results.......................................................................................73
3.1 Identification of putative hypoxia responsive elements
within the regulatory regions of the promoters of inflamma
tory genes…..……………………………………………..73-81
3.2 CXCR-4, TNF-α and IL-10 mRNA expression pattern in
hypoxic and/or treated with agents causing DNA damage
breast cancer cells………………………………………..81-85
3.3 HIF-1α recruitment to the HRE sites located within the
regulatory region of the CXCR4 and TNF-α
promoters…………………………..……………………..85-88
3.4 Protein levels of CXCR4 in breast cancer cells………..….88-92
3.5 SRC-1 interacts with HIF-1α and p53 in MCF-7 cells…...93-94
3.6 SRC-1 and SIRT-1 affect CXCR4 gene expression in hypoxia
mimicking conditions……………………………………...95-98
3.7 Effect of SRC-1 and SIRT-1 on CXCR4 protein levels...98-101
Chapter 4: Discussion…………………………………………..…102-108
References:…………………………………………………………109-127
5
ABSTRACT
Chronic inflammation is a critical component in breast cancer progression. Pro-
inflammatory mediators along with growth/survival factors within the tumor
microenvironment potentiate enhanced expression of pro-inflammatory cytokines (IL-1,
IL-6, TNF-α), chemotactic cytokines and their receptors (CXCR4, CXCL12, CXCL8)
and angiogenic factors (VEGF) that often overcome the function of anti-inflammatory
molecules (IL-4, IL-10) eradicating the host’s anti-tumor immunity. Therefore detailed
knowledge of the regulatory mechanisms determining cytokine levels is essential to
understand the pathogenesis of several diseases including breast cancer. Activated
transcription factors such as NF-κB and HIF-1α are important players for the
establishment of a pro-inflammatory and potentially oncogenic environment. HIF-1α is
the key mediator of the cellular response to oxygen deprivation and induces the
expression of genes involved in survival and angiogenesis within solid hypoxic tumors.
The expression of these genes is often modulated by the p53 tumor suppressor protein
which induces apoptosis or cell cycle arrest in neoplastic cells. Functional crosstalk
between HIF-1α and p53 pathways mediated by co-regulators shared between the two
transcription factors such as SRC-1 and SIRT-1 differentially regulate diverse subsets of
target gene expression under variable stress conditions. In an attempt to shed light in
the complex regulatory mechanisms involved in cancer related inflammation, we
investigated the effect of the chemotherapeutic drug etoposide, which induces p53, on
the expression of inflammatory genes (CXCR4, TNF-α, IL-10) carrying hypoxia
responsive elements within the regulatory regions of their promoters in breast cancer
cells under hypoxia mimicking conditions. In addition, the role of two common p53 and
HIF-1α co-regulators, namely SRC-1 and SIRT-1, in the expression of the highly potent
metastatic chemokine receptor CXCR4 was evaluated. Both SRC-1 and SIRT-1
overexpression in DSFX treated MCF-7 cells reduced CXCR4 cellular levels implying
that both co-regulators are crucial factors in the determination of the metastatic potential
of breast cancer cells.
6
DECLARATION
No portion of the work referred to in the thesis has been submitted in support for an
application for another degree or qualification of this or any other university or other
institute of learning.
7
COPYRIGHT STATEMENT
i. The author of this thesis owns any copyright in it (the ―Copyright‖) and he has given
The University of Manchester the right to use such Copyright for any administrative,
promotional, educational and/or teaching purposes.
ii. Copies of this thesis, either in full or in extracts, may be made only in accordance
with the regulations of the John Rylands University Library of Manchester. Details of
these regulations may be obtained from the Librarian. This page must form part of any
such copies made.
iii. The ownership of any patents, designs, trade marks and any and all other intellectual
property rights except for the Copyright (the ―Intellectual Property Rights‖) and any
reproductions of copyright works, for example graphs and tables (―Reproductions‖),
which may be described in this thesis, may not be owned by the author and may be
owned by third parties. Such Intellectual Property Rights and Reproductions cannot and
must not be made available for use without the prior written permission of the owner(s)
of the relevant Intellectual Property Rights and/or Reproductions.
iv. Further information on the conditions under which disclosure, publication and
exploitation of this thesis, the Copyright and any Intellectual Property Rights and/or
Reproductions described in it may take place is available from the Head of School of
Pharmacy and Pharmaceutical Sciences and the Dean of the Faculty of Medical And
Human Sciences, for Faculty of Medical And Human Sciences’ candidates.
8
LIST OF ABBREVIATIONS
ARNT: aryl hydrocarbon receptor nuclear translocator
ATM: ataxia telangiectasia mutated
ATR: ATM and Rad3 related
bHLH: basic helix-loop-helix
CBP: CREB binding protein
ChIP: chromatin immunoprecipitation
COX2: cyclooxygenase 2
CXCR4: CXC chemokine receptor 4
DNA: deoxyribonulceic acid
dNTP’s: deoxynucleosides triphosphates
DSFX: desferrioxamine
ER: estrogen receptor
Etop: etoposide
FADD: Fas-associated death domain
FIH: factor inhibiting HIF
FOXO: forkhead factor
GM-CSF: granulocyte macrophage colony stimulating factor
HAT: histone acetyltransferase
HDAC: histone deacetyltransferase
HIC1: hypermethylated in cancer 1
HIF-1: hypoxia inducible factor 1
HRE: hypoxia responsive element
IFN: interferon
IL: interleukin
IκB: inhibitor of NF-κB
JAK: Janus kinase
MAPK: mitogen activated protein kinase
MDM2: murine double minute 2
MIF: macrophage migration inhibitory factor
9
ml: milliliter
MMP: matrix metalloprotease
mRNA: messenger ridonucleic acid
NAD: nicotinamide adenine dinucleotide
NF-κB: nuclear factor kappa B
NK: natural killer (cell)
NR: nuclear hormone receptor
PAS: Per-ARNT-Sim
PBS: phosphate buffered saline
PCAF: p300/CBP associated factor
PHD: prolyl hydroxylase
pVHL: von Hippel-Lindau protein
RIP: receptor interacting domain
ROS/RNS: reactive oxygen species/reactive nitric species
rpm: revolutions per minute
RT-PCR: real time polymerase chain reaction
SDF-1: stromal cell derived factor 1
SDS-PAGE: sodium dodecyl sulphate polyacrylamide gel electrophoresis
SIRT1: silent mating type information regulation 2 homolog
SRC-1: steroid receptor co-activator 1
STAT: signal transducers and activators of transcription
TAD: transactivation domain
TAM: tumor associated macrophage
TGF-β: transforming growth factor beta
TNF-α: tumor necrosis factor alpha
TRADD: TNF receptor-associated death domain
TRAF: TNF receptor associated factor
VEGF: vascular endothelial growth factor
10
CHAPTER 1: INTRODUCTION
1.1 The link between inflammation and cancer
Cancer is a disease which develops through mutations that occur in genes
changing their function and altering the pathways within which these genes exert
important functions (1). Uncontrolled cell proliferation is one of the characteristic
features of cancer with strong genetic background. During their life span cells constantly
encounter checkpoints where they decide to proliferate, differentiate or die. Mutations
that either accumulate during an individual’s lifetime or are inherited disrupt the balance
between proliferation and death, leading to clonal expansion of cells that have unlimited
replicative potential and evade apoptosis (2). However, sporadic alterations of the
human genome alone are not sufficient to induce carcinogenesis. Malignancies develop
through an intricate series of molecular events that concisely involve initiation, namely
genetic alterations in pre-malignant cells, and promotion, that is to say establishment of
a tumour supporting environment characterized by resistance to growth-inhibitory
signals and apoptotic death, maintenance of vascularization, tissue invasion and
metastasis (3).
Wound healing, in response to tissue assault, involves procedures related to cell
proliferation, inflammation, new blood vessel formation, rearrangement of the
extracellular matrix and invasion. In this way, cancer and wound healing show many
similarities (4). The fact that human organism initially perceives tumours as wounds
appears to be deleterious because it generates an environment favourable for
carcinogenesis.
Currently accumulating evidence support the notion that most human tumours
develop in an environment of chronic inflammatory conditions (5). Consistent with this
view several epidemiological studies have associated chronic infection, inflammation
and increased risk of cancer development (6). For example, exposure to Helicobacter
pyroli (H.pyroli) infection is a common reason for the development of gastric cancer
whereas Human Immunodeficiency Virus (HIV) infection accounts for AIDS-associated
11
malignancies, such as non-Hodgkin’s lymphoma and Kaposi’s sarcoma (5). Apart from
bacterial and viral infections, autoimmune diseases and chronic inflammatory conditions
of unknown origin can also increase cancer risk (7).
More recent studies have demonstrated that genetic alterations can trigger
inflammation in tissues where there are no underlying infectious conditions. This
intrinsic pathway that links inflammation with cancer is initiated by mutations in
oncogenes, inactivation of tumour-suppressor genes and chromosomal rearrangements.
DNA damaging agents, such as reactive oxygen and/or nitric species (ROS/RNS),
produced by chronically inflamed cells increase the transformation potential of pre-
malignant cells and tumour development may easily occur by the actions of
inflammatory cells and mediators (cytokines, growth factors) (8). Regardless of the way
inflammation is triggered both the extrinsic (inflammation due to infection) and intrinsic
(genetic event) pathways involve activation of transcription factors that ultimately
establish an inflammatory environment that promotes tumour growth and progression.
1.2. Characteristics of the inflammatory response
1.2.1 General background
Human organisms encounter different types of pathogenic stimuli, such as
environmental chemical agents, microbes and tumours (which are treated by the human
body as wounds) that have the capability to disrupt their homeostasis if not eliminated (9).
Therefore, a number of effector mechanisms have been developed to defend the human
body against all the potentially harmful antigens. These immunity mechanisms can be
either mediated by soluble molecules, cells, or both. Whenever infection or injury occurs,
the innate and subsequently the adaptive immune system become active in order to
eliminate the insulting agents and retain homeostasis.
A cellular process inextricably linked to innate immune response is inflammation.
This is the term used to describe a non-specific biological response of vascular tissues to
12
harmful stimuli, such as pathogens, irritants or damaged cells. The fundamental signs of
inflammation were first described by Aulus Cornelius Celsus the first century AD and
included calor (warmth), dolor (pain), tumour (swelling) and rubor (redness,
hyperaemia). It was, thus, well established from the early years that inflammation is a key
reaction of the primary defense system that involves extravasation of plasma and
recruitment of immune cells to the site of infection (10). Indeed, widening of the blood
vessels to increase blood flow (vasodilation), increased vascular permeability to allow
entrance of diffusible molecules, activation of cells of the immune system, directed
movement of inflammatory cells (chemotaxis) as well as metabolic changes at the site of
inflammation are the major features of the inflammatory response that ultimately results
in the destruction of the harmful stimuli.
As mentioned above, cellular and extra-cellular components participate in the
complex process of inflammation. The prominent type of cells mediating inflammation is
leukocytes. The early phase of the inflammatory response, characteristic of increased
blood flow and vascular permeability, is initiated by immune cells already present in the
tissues, mainly macrophages, neutrophils, dendritic cells and mast cells. These cells
undergo activation and release inflammatory mediators that are responsible for the
clinical signs of inflammation and also for the establishment of an inflammatory
environment where neutrophil leukocytes migrate towards and accumulate to the site of
insult. This acute response ceases once the infectious agent is successfully eliminated but
if that is not accomplishable, inflammation becomes persistent and may occur over long
period of time. The chronic phase of inflammation is characterized by specific humoral
and cellular immune responses. The adaptive immune system intervenes with
lymphocytes (B-cells, T-cells), natural killer cells (NK), macrophages and plasma cells
being the principal cellular effectors of chronic inflammation. Soluble factors that mediate
both phases include inflammatory lipid metabolites (prostaglandins), soluble proteases,
nitric oxide and cell-derived polypeptides (cytokines) (11)
13
1.2.2 Cytokines
The inflammatory response is a complex procedure involving a variety of cell-
derived mediators. The primary peptidic mediators of cellular immunity are cytokines
(12), small proteins or glycoproteins of low molecular mass (8-30 kDa) that are secreted
by cells of the immune system and carry signals between the cells. Cytokines act as
molecular messengers facilitating the intercellular communication within the immune
system either in an autocrine or paracrine mode. Once released, cytokines are able to
locate immune cells that express specific receptors onto their surface and interact with
them. The signal is transduced upon binding of the ligand with the receptor and most of
the times the janus kinase (JAK)/signal transducers and activators of transcription
(STAT) pathway of transcriptional factors is activated, although alternative pathways
also exist. The result is the induction of transcription of certain target genes, usually
related to the activation, proliferation and differentiation of immune cells (Figure 1.1).
Cytokines can be classified, according to their function and the type of cell that
produces them, to interleukins (secreted by leukocytes they facilitate the inter-
communication between these cells), chemokines (mediating chemotaxis of cells) and
lymphokines (secreted by lymphocytes).
14
Figure 1.1: Cytokine signaling. Cytokines bind to homodimeric or heterodimeric
receptors that are bound to Jaks. After a series of trans- and/or auto- phosphorylations of
Jaks and Stats, phosphorylated Stats dimerize and translocate in the nucleus where they
regulate gene expression. Cytokine signalling modulates various processes, i.e.: immune
cell proliferation, angiogenesis, embryogenesis, inflammation and oncogenesis (adapted
from 13).
Although cytokines are usually referred to as the principle regulators of the
immune response, these peptides also mediate other important cellular functions via
their cognate receptors such as embryogenesis, angiogenesis, hematopoiesis, chronic
inflammation and oncogenesis (Figure 1.1). For instance, the members of the vascular
endothelial growth factor (VEGF) family are potent stimulators of blood vessel
formation under both physiological and pathological conditions. Stem cell factor (SCF)
is a cytokine shown to be involved in survival (14) and mobility of hematopoietic stem
cells (HSCs) (15).
immune cell
proliferation,
differentiation,
activation
angiogenesis
embryogenesis
inflammation
oncogenesis
15
Cytokines regulate inflammatory responses either directly or by inducing the
production of other cytokines and/or cellular adhesion molecules in other cells (16, 17).
They are formally divided, according to their function during the inflammatory process,
into two groups: the pro-inflammatory and the anti-inflammatory cytokines. As their
name suggests, pro-inflammatory cytokines contribute to build up and accelerate an
inflammatory reaction. Main members of this group are interleukin 1 alpha (IL-1α),
interleukin 1 beta (IL-1β), interleukin 6 (IL-6) and tumour necrosis factor alpha (TNF-
α). Other pro-inflammatory mediators include interferon gamma (IFN- γ), transforming
growth factor beta (TGF-β), interleukin 8 (IL-8), interleukin 12 (IL-12), granulocyte-
macrophage colony stimulating factor (GM-CSF) and chemotactic chemokines. Anti-
inflammatory cytokines, such as interleukin 4 (IL-4), interleukin 10 (IL-10) and
interleukin 16 (IL-16), deliver information which helps to cease the inflammatory
response and initiate healing processes like vessel and tissue building (18). The influx of
cytokines is temporary during acute inflammation but in cases of chronic inflammatory
responses there exists a permanent network of overproduced cytokines. IL-1, IL-6, IL-8,
TNF-α and GM-CSF play key roles in mediating acute inflammation while IL-2, IL-3,
IL-4, IL-5, IL-6, IL-7, IL-10, TNF-α, TGF-β and IFN-γ mediate chronic inflammation.
Nevertheless, some cytokines, namely TNF-α and IL-6, are involved in both types of
inflammatory responses (17).
Over the past years and after extensive studies on cytokines and their role in
inflammation, it has been clear that these numerous multifunctional molecules compose
an extensive network of molecular messengers that interact either in a synergistic or
antagonistic way. Within the cytokine network the balance of pro- and anti-
inflammatory cytokines is of pivotal importance as it determines the progression and
effect of inflammatory reactions and its manipulation can be exploited in the therapy of
various inflammatory diseases.
16
1.3 Role of inflammatory mediators in cancer
1.3.1 Immune cells and cytokines
Experimental evidence suggesting possible link between inflammation and
cancer arose from studies showing the presence of inflammatory cells and mediators in
malignant tissues (5). Indeed, the leukocyte infiltrate around the sites of tumour consists
predominantly of tumour-associated macrophages (TAM) as well as T regulatory
lymphocytes, dendritic and mast cells in lower percentages (19). These immune cells are
potentially capable of exerting anti-tumour immunity and eliminating cancer cells but
strong experimental and clinical evidence has indicated that in most cases they instead
promote tumour development (20). TAMs generally acquire a different phenotype in the
tumour stroma rather than the M1 phenotype, which is activated upon microbial
infection. The alternative polarized M2 phenotype of TAMs is associated with their
protumoural functions. This phenotype shift is attributed to different
microenvironmental signals, such as immunosuppressants like glucocorticoids, IL-4, IL-
10, as well as hypoxia (19, 21). Macrophages programmed to the anti-inflammatory and
pro-angiogenic M2 phenotype interact with neoplastic cells and actively support tumour
survival and growth. They also contribute to tumour invasion, angiogenesis and
metastasis. Thus, TAMs are frequently used as a cancer biomarker and their increased
number is correlated with poor survival prognosis for patients with solid tumours like
breast, cervical and prostate tumours (22).
Cytokines may be secreted by inflammatory, stroma and tumour cells creating a
network of factors that diversely influences immunosuppression, angiogenesis, cancer
cell growth and invasion (Figure 1.2). Most data converge to the notion that cytokines
and inflammatory cells found in tumours more likely promote tumourigenesis rather
than host an anti-tumour response (23, 5). It appears that aberrant cytokine production,
commonly observed during chronic inflammation, permits cancer cells to exploit host
derived cytokines to promote growth, metastasis and resistance to apoptotic death. The
multifunctionality of cytokines and their interdependent interactions within the
neoplastic tissue accounts for different outcomes in different environments (23).
17
Figure 1.2: Outcomes of interactions between tumour cells and infiltrating cells.
Cytokines within the tumour microenvironment may either promote tumour
development or suppress it. Concentrations and interactions of cytokines as well as
biology of each cancer are crucial (adapted from 23).
IL-1 and TNF-α are key components of inflammation with respect to
carcinogenesis. Polymorphisms of their genes accounting for the pro-inflammatory
phenotype affect cancer risk and progression. For instance, IL-1 genotypes that produce
higher levels of the respective cytokine are associated with poor survival of patients
with pancreatic cancer and pro-inflammatory genotypes of TNF-α are predisposal
factors for developing gastric and colorectal cancer (24). IL-1 is upregulated in many
human solid tumours, including breast cancer (25), lung cancer (26) and melanomas
(27). IL-1β in particular is also known to augment metastasis (28) and promote tumour
angiogenesis and invasiveness in vivo by inducing the expression of angiogenic genes
18
(VEGF) and growth factors (29). TNF-α is a major pro-inflammatory cytokine and
potent inducer of both cancer cell apoptosis and survival. TNF-mediated chronic
inflammation contributes to cancer development by tissue remodelling and invasion
while, when locally produced TNF acts as anti-angiogenic destroying tumour blood
vessels. TNF is detected in malignant and stromal cells in human breast, ovarian,
prostate and bladder tumours as well as in leukaemias and lymphomas (5).
Among more than 300 characterized so far members of the cytokine family, IL-6 also
plays a growth-promoting role in terms of cancer associated inflammation. Elevated
levels of IL-6 are observed in multiple myelomas (MM), colon and breast cancer,
diseases for which IL-6 is a predisposition factor (30).
Generally the tumour microenvironment is characterized by increased levels of
immunomodulating IL-10 and TGF- (23). TGF-β has two opposing roles during
carcinogenesis and this is widely known as the ―TGF-β paradox‖. In many human
malignancies TGF-β contributes to immunodeficiency against cancer cells and
carcinoma progression via suppression of the functions of lymphocytes and monocytes,
caused by alterations in the TGF-β signalling pathway (20). However, it is clear that in
early stages of carcinogenesis TGF- acts as a tumour suppressor since it mediates
growth arrest of malignant cells (31).
Likewise, IL-10 [also known as human cytokine synthesis inhibitory factor
(CSIF)] exerts multiple biological roles and contradictive effects in carcinogenesis. IL-
10 is commonly regarded as immunosuppressant due to its ability to decrease the
functionality of antigen presenting cells and T helper cells during immune responses
(32). Its production by immune and malignant cells hampers key elements of innate
immune response thus facilitating cancer cells to escape immune surveillance (33). For
instance, a recent study suggests a role of IL-10 in immune suppression in human
papilloma virus (HPV) related cervical cancer which is possibly due to the high number
of regulatory T cells in cervical cancer patients accounting for the high IL-10 mRNA
levels and maintenance of immune suppression (34). However, evidence arising from
experimental animal models suggests that the role of IL-10 is not always
immunosuppressive. High levels of IL-10 enhance NK cell activity, and may induce
immune mediated tumour rejection. Moreover, IL-10 accounts for inhibition of tumour
19
angiogenesis via VEGF suppression and metastasis probably by inducing the production
of matrix metalloproteases (MMP) inhibitors (35). In addition, IL-10 exerts anti-
inflammatory effects by inhibiting the production of several pro-inflammatory
cytokines, including TNF, IL-2, IL-6, IL-8, thus acting as an inhibitor of tumour
progression within the tumour microenvironment (23).
1.3.2 Chemokines
A subset of cytokines linked to cancer and metastasis in particular are
chemokines (36). They are chemotactic cytokines that cause directed migration of
nearby responsive cells expressing appropriate chemokine receptors along a
concentration gradient. Chemokines mediate homeostasis, cell development and
angiogenesis by controlling migration of cells during physiological processes. Apart
from that, chemokines are critical mediators of leukocyte migration during immune
surveillance and inflammation (37). Successful response of the immune system depends
on chemokine networks that recruit and activate leukocytes at the right place.
Inflammatory chemokines are secreted by circulating leukocytes and other cells upon
induction by inflammatory cytokines, growth factors and pathogenic stimuli.
Chemokine signalling, upon binding of the ligand to the corresponding G- protein
coupled receptor, results in transcription of target genes involved in cell activation,
motility and interactions with the extracellular matrix. Chemokines have been classified
into four families (C, CC, CXC, and CX3C) based on the number and positions of the
N-terminally conserved cysteine residues they possess (37).
Deregulation of chemokine networks or inappropriate activation can contribute
to inflammatory diseases and malignant transformations (38, 39). Several studies on
chemokines and their receptors provide evidence of their role in development of primary
tumours and metastases (38). Furthermore, functional chemokine receptors are not only
found on leukocyte cells, but also on endothelial cells and malignant epithelial cells.
This complex network influences the recruitment and function of immune-cell infiltrate
20
as well as cancer cell growth and metastasis either in a promoting or inhibitory manner.
CXCR2, CXCR4, CCR2 and CCR7, among the approximately 20 chemokine receptors
identified to date, play vital roles in tumourigenesis and metastatic spread (37).
As already highlighted, angiogenesis is a required step for malignant
transformation of cells and subsequent formation of large tumours. Moreover, it is
established that new blood vessel networks within the tumour microenvironment
facilitate migration of cancer cells out of the tumour site and into the blood stream,
contributing this way to the formation of secondary tumours at distant sites. Signalling
via certain chemokines and their cognate receptors can regulate angiogenesis in vitro
and in vivo, by promoting both cellular proliferation and migration. CXCR2 is an
important receptor in terms of tumour angiogenesis. It is redundant and binds CXCL1,
CXCL2, CXCL3, CXCL5, CXCL6, CXCL7, and CXCL8 ligands, all characterized by
the presence of a peptidic ELR (glu-leu-arg) motif. It became obvious that this motif
preceding the CXC sequence is involved in the induction of angiogenesis. However, this
is not always the case as indicated by CXCR4 receptor and its ELR lacking ligand
CXCL12. It seems that a different mechanism is involved in the induction of
angiogenesis by this receptor-ligand complex (37).
Signalling via CXCR4 regulates important processes, such as cell proliferation,
homeostasis and trafficking of immune cells, migration, adhesion and angiogenesis, as
part of normal physiology (40). However, most of these events are also required for
carcinogenesis and this chemokine receptor is proven to regulate such events in a variety
of cancers. CXCR4 is the most commonly found receptor on cancer cells (41) and of
great importance in terms of cancer progression as it is involved in the metastatic spread
of many human tumours, notably breast, ovarian, prostate, colorectal, non-small cell
lung cancer and leukaemia. Its unique so far known ligand, CXCL12/SDF-1 (Stromal
cell derived factor 1), is also expressed within the tumour microenvironment as well as
at distant sites of metastasis, underlying a pivotal role of the axis CXCR4-CXCL12 in
invasion and metastasis. CXCL12 has a constitutive expression pattern in a wide range
of tissues including bone marrow, lymph nodes and liver (40). Furthermore, binding of
CXCL12 to CXCR4 induces effector molecules that favour cancer progression within
the tumour microenvironment (40). Notably, CXCR4 increases the production of MMPs
21
that facilitate invasion by degradation of extracellular matrix molecules and also induces
MAPK (mitogen activated protein kinase) pathway that promotes tumour growth in
breast cancer. Finally, CXCR4 may directly or indirectly promote angiogenesis via
upregulation of VEGF (40).
Chemokine receptor CCR2 and its ligand CCL2 have also been shown to exert
pro-angiogenic and tumour promoting effects in the cases of prostate cancer and
multiple myeloma (37). Furthermore, CCL2 is involved in the recruitment of leukocyte
cells around solid tumours and the levels of its expression are positively correlated to
the extend of macrophage and lymphocyte infilitrate (42). Indeed, chemotaxis by CC
chemokines determines the leukocyte infiltrate of many human cancers, like breast,
pancreas, cervix and oesophagus. Macrophage influx, as well as inflammatory cell
invasion in general, can subsequently trigger angiogenesis by the production of
angiogenic factors (for instance TNF-α, IL-6, IL-8).
1.4 Molecular insights and mechanisms of cancer related inflammation
It is now well established that inflammatory cytokines and chemokines secreted
by tumour cells themselves and tumour-associated immune cells contribute to malignant
progression (42, 43). The cytokine network within the tumour microenvironment
triggers signalling pathways that induce the expression of genes involved in tumour cell
growth and invasiveness, angiogenesis, metastasis and production of more cytokines
that interplay with the existent network and modulate malignant progression. Cytokines
usually transduce signals through the JAK-STAT pathway (44). Signal transducer and
activator of transcription 3 (STAT3), along with nuclear factor-kappa B (NF-κB) and
hypoxia inducible factor 1 alpha (HIF-1α) are the main regulatory transcription factors
coordinating tumour initiation and progression in tissues where cancer related
inflammation occurs (43).
Members of the NF-κB family of transcription factors [Rel (c-Rel), Rel A
22
(p65), Rel B, NF-κB1 (p105/p50) and NF-κB2 (p100/p52)] are important regulators of
immune and inflammatory responses in terms of modulating the expression of cytokines
and growth factors (45). NF-κB also plays role in carcinogenesis (46) by promoting cell
proliferation and up-regulating anti-apoptotic gene expression (47). NF-κB is expressed
in most tumour cells and disrupts the balance between proliferation and apoptotic death
in favour of malignant growth (48). Several studies confirm the presence of
constitutively active NF-κB in a range of cancers, including ovarian, breast, liver,
pancreatic, prostate, oral cancer and leukaemia. NF-κB is linked to poor survival in
patients with pancreatic, prostate and ovarian cancer, oesophageal adenocarcinomas,
hepatocellular and squamous cell carcinomas and with elevated aggressiveness of
inflammatory breast cancer. Therefore, NF-κB is considered as a tumour-promoting
molecule and is a major target for anti-cancer therapies.
Pro-inflammatory cytokines, mainly TNF-α, account for activation of the NF-κB
dependent transcriptional activity (45). In neoplastic and inflammatory cells NF-κB
induces the expression of genes encoding for inflammatory cytokines such as TNF-α
and IL-6, chemokines, MMPs, angiogenic factors such as VEGF, and cyclooxygenase 2
(COX2); all of these factors synergistically promote cancer cell proliferation and
invasion. Moreover, members of the anti-apoptotic Bcl-2 family of regulators and TNF
receptor associated factor proteins (TRAF) have been indentified as targets of NF-κΒ
that inhibit cell apoptosis upon transactivation (49). Notably, infiltrating leukocytes
(mainly TAMs) display impaired expression of NF-κB in advanced stages of cancer.
However, this probably reflects a possible change in the tumour microenvironment
during cancer progression, as evidence suggests that NF-κB is expressed at early stages
of carcinogenesis (50).
1.4.1 Role of tumour necrosis factor alpha
Tumour necrosis factor alpha is a multifunctional signalling cytokine with
important roles in acute inflammation and apoptosis. It belongs to the TNF family of
cytokines, composed of two isoforms (alpha and beta) encoded by adjacent genes
23
located within the major histocompatibility complex. TNF-α, both as a membrane-
intergrated or soluble protein, exerts its signalling potential via two cell surface
receptors, namely TNFR1 and TNFR2. In contrast to TNFR2, TNFR1 is expressed on
most types of cells and initiates the majority of soluble TNF’s signalling activities (51).
Binding of homotrimeric TNF-α to the extracellular domain of its cognate receptor
triggers the formation of a complex of adaptor proteins in the cytoplasm (Figure 1.3).
Initially TNF receptor-associated death domain (TRADD) recognizes the intercellular
domain of the transmembrane TNFR1 and then recruits the receptor-interacting protein
(RIP) and the TNFR-associated factor 2 (TRAF2). This protein complex subsequently
recruits additional key molecules, such as enzymes and kinases and initiates distinct
signalling pathways (52).
The default pathway induces genes involved in cell survival and inflammation
via NF-κB and c-Jun activation. Upon TNF-α stimulation, TRADD/RIP/TRAF2
complex recruits the TGFβ-activated kinase (TAK1) complex and the inhibitor of NF-
κB (IκB) kinase (IKK) complex that perform a series of phosphorylations leading to
selective ubiquitination and proteasomal degradation of IκB. In the absence of IκB, NF-
κB is free to translocate in the nucleus and exert its transactivation activity (53).
Alternatively, a cascade of kinases including MAPK, MEK (mitogen-activated protein
kinase/extracellular signal-regulated kinase) and JNK (c-Jun N-terminal kinase), may be
triggered by TRADD/RIP/TRAF2 complex and ultimately activate the transcriptional
factor c-Jun. Together, NF-κB and c-Jun induce expression of genes encoding for
inflammatory cytokines and chemokines, adhesion molecules and growth factors.
Initiation of the apoptotic pathway requires recruitment of Fas-associated death domain
(FADD) by the TRADD/RIP/TRAF2 complex, followed by activation of caspase-8 and
subsequent induction of other caspases and pro-apoptotic molecules (54).
TNFα is mitogenic to normal cells and regulates important functions such as
immune system responses and inflammation. However, when imbalance between the
survival and apoptotic signals occurs the apparent role of TNF-α in mediating
homeostasis can be reversed, as proven by several studies implicating TNF-α is the
pathogenesis of numerous diseases including sepsis, autoimmune diseases,
inflammatory bowel diseases and cancer (52). In fact, TNF-α was initially thought to
24
cause hemorrhagic necrosis of tumours thus preventing tumour growth and leading to
subsequent regression. This is the case when TNF-α is locally present at high levels and
induces T cell antitumour immunity. However, it was later realised that TNF is an
endogenous tumour-promoting factor within the tumour microenvironment (Figure 1.3).
Figure 1.3: Signalling upon TNF-α stimulation. Effector proteins form a complex
bound to the intercellular domain of TNFR. Signalling can either lead to NF-κB
activation or trigger the caspase cascade, dependent on the recruitment of TRAF2 or
FADD to the complex respectively. It appears that TNF favours carcinogenesis within
the tumour microenvironment by promoting the ―mitogenic‖ pathway.
Importantly, TNF-α plays paramount role in both initiating and promoting
tumourigenesis. It can be produced by macrophages, tumour and stromal cells and most
likely by all three. Sustained production of TNF-α at tumour sites causes chronic
inflammation and leads to malignant transformation via NF-κB mediated proliferation
25
of neoplastic cells and induction of pro-inflammatory mediators. Moreover, TNF-α may
directly promote malignant transformation inducing oxidative DNA damage, as
observed in a murine cancer model. In any case, TNF-α enhances tumour progression
and invasion by up-regulating cytokines, chemokines, MMPs and anti-apoptotic
molecules (51).
The mechanism by which TNF-α is constitutively produced in cancer cells
remained obscure for several years after its characterisation as a cancer promoting
cytokine. pVHL (von Hippel-Lindau) tumour suppressor has been reported to function
as TNF-α translational repressor in renal cell cancer cells (55). pVHL is often mutated in
renal cancer cells implying that cytokines acquire functional advantage in cells bearing
mutated tumour suppressor genes (55).
1.4.2 Inflammation and hypoxia
Hypoxia, a common feature of inflammatory solid tumours, is a condition of low
oxygen tension that alters the gene expression profile of genes involved in the regulation
of metabolism, angiogenesis, tissue remodelling, proliferation and apoptosis (56). The
primary mediator of transcriptional activation by hypoxia in mammals is the
transcription factor complex HIF-1 (hypoxia inducible factor 1), a heterodimeric
complex of HIF-1α and HIF-1β. HIF-1α belongs to the basic helix-loop-helix Per-
ARNT-Sim (bHLH-PAS) superfamily and is an 826 amino acid protein (57). HIF-1β
subunit, also known as aryl hydrocarbon receptor nuclear translocator (ARNT), is
constitutively expressed in the nucleus whereas the HIF-1α subunit and its isoforms
HIF-2α and HIF-3α are oxygen sensitive (58). The bHLH domain accounts for the
dimerization of α and β subunits while the PAS domain mediates specific DNA binding
of the transcription factor to its targets. Additional regulatory domains of HIF-1α are the
amino-(N) and carboxy-(C) terminal transactivation domains (N-TAD and C-TAD
respectively) that are bridged by a central inhibitory domain (ID) (59). HIF-1α is post-
translationally modified in the presence of oxygen by the Prolyl hydroxylase (PHD)
26
which hydroxylates proline 402 and 564 of HIF-1α. These modifications are required
for the interaction between HIF-1α and the pVHL tumour suppressor which mediates
HIF-1α protein degradation through its E3 ubiquitin-protein ligase activity.
Hydroxylation of HIF-1α asparagine 803 by the arginine hydroxylase FIH (Factor
inhibiting HIF-1α) regulates its transcriptional activity since this modification prevents
the interaction between HIF-1α and the transcriptional cofactor complex CBP (CREB
binding protein)/p300 (reviewed by 60). Low O2 concentration is a restrictive factor for
the activity of the afore mentioned hydroxylases, leading to protein stabilisation of the
HIF-α subunits (58) (Figure 1.4).
Figure 1.4: Structural organisation of HIF-1α (61) and mechanism of its protein
stabilisation and transcriptional activity under low oxygen concentration via the PHD
and FIH hydroxylase activity respectively.
27
The stabilized HIF-α translocates into the nucleus, dimerizes with HIF-1β
subunit, binds to hypoxia responsive elements [HRE, 5’(A/G)CGTG 3’] present within
the regulatory domains of the promoters of its target genes (62), thereby inducing their
expression (Figure 1.4). Among the genes included in the long list of HIF transcription
targets are genes encoding for metabolic enzymes, glucose transporters, growth factors,
inflammatory cytokines and chemokines (58). Hence, it is obvious that cellular
responses to hypoxia involve induction of genes regulating critical aspects of cancer
biology such as proliferation, angiogenesis, invasion, glucose metabolism and apoptosis.
HIF-1α is overexpressed in common cancers such as breast, colon, ovarian,
pancreatic and lung (63). HIF-1 promotes tumour cell growth and metastasis by
upregulating multiple growth factors such as TGF-β and VEGF (64). Tumour-derived
VEGF promotes angiogenesis and solid tumour expansion (65). Increased angiogenesis
due to VEGF production mediated by hypoxia is also reported in TAMs (66). Moreover,
HIF-1α induces the expression of CXCR4 in tumours cells and human microvascular
endothelial cells. CXCR4 is upregulated by hypoxia in renal carcinoma (67), myeloma
(68), ovarian and breast cancer cells (69).
Cytokines, primary TNF-α and IL-1β, have recently been shown to mediate
MAPK activation and ultimately result in biosynthesis and stabilization of HIF-1α in
normoxic conditions (70). IL-1β mediated upregulation of HIF-1α via the NF-κB
pathway also provides evidence for a link between inflammation and oncogenesis (71).
NF-κB, as a general stress-responsive transcriptional factor, is known to respond to
hypoxia although to a lesser extend compared to HIF-1 (56). Many genes encoding for
cytokines involved in angiogenesis (VEGF, TNF, bFGF) have NF-κB binding sites in
their promoters, underlying a link between immunity and the cellular response to
hypoxia. In vitro studies have shown that HIF-1α transcriptional activity is under NF-κB
control (72). Taken together these observations imply that chronic inflammatory
conditions activate transcription factors that induce the production of mediators
responsible for the establishment of a tumour-promoting environment and further
production of pro-inflammatory molecules.
28
1.4.3 The p53 tumour suppressor in inflammation
Two of the hallmarks of cancer cells are their capability to evade apoptosis and
replicate limitlessly (2). Deregulation of cell cycle control, DNA repair and apoptosis
are often attributed to genetic mutations in the p53 tumour suppressor gene. Such
mutations are observed in more than half of human cancers (73). p53 encodes for a
transcription factor that plays key role in inducing cell cycle arrest and apoptosis under
diverse types of genotoxic stress. The 393 amino-acid p53 protein in humans comprises
of three primary domains with well-defined functional significance. Its N-terminal
region contains the transactivation domain which exerts multiple regulatory roles by
interacting with regulatory proteins and co-activators. The central DNA binding domain
of the protein interacts with the p53 consensus DNA binding sequence [5'-Pu Pu Pu C
(A/T) (T/A) G Py Py Py-3' (Pu=A/G, Py=T/C)] present within the regulatory region
of the promoters of its target genes (74) The C-terminal region comprises the
oligomerization domain, responsible for the tetramerization of p53 molecules, and the
negative auto-regulatory domain. Numerous post translational modifications at this
domain regulate p53’s ability to bind to DNA core domain (75).
The availability of p53 is a pivotal parameter for the cellular response to a
variety of stresses. In unstressed cells, p53 levels remain low via an autoregulatory
feedback loop regulated by the oncoprotein murine double minute (MDM2). MDM2 is
induced by p53 and in turn, it suppresses p53’s transactivational activity on target genes
by binding to its transactivation domain. Moreover, MDM2 enhances p53’s degradation
rate via ubiquitination and proteasomal degradation (76). However, under DNA damage
conditions certain post translational modifications affect the formation of p53-MDM2
complex. Kinases phosphorylating both p53 and MDM2 on serine residues block the
interaction between these proteins and prevent MDM2 mediated p53 downregulation.
ATM (ataxia telangiectasia mutated) and/or ATR (ATM and Rad3 related) kinases
phosphorylate p53 at serine 15 and induce other kinases such as Chk1 (checkpoint
kinase1) and Chk2 (checkpoint kinase2) to phosphorylate p53 at serine 20 (reviewed by
77) (Figure 1.5). ATM also reinforces p53 accumulation by phosphorylating MDM2 at
29
serine 395 (78). Stabilized p53 protein is free to bind to specific DNA sequences and
modulates the expression of genes involved in cell cycle arrest (p21, GADD45) and
DNA repair (p53R2) or apoptosis (BAX, PUMA, NOXA) (79).
Figure 1.5: Depiction of p53 protein domain organisation. Residues that participate in
the regulation of p53’s activation or degradation are indicated (adapted from 80).
Mutated p53 pathway is ineffective in regulating the fidelity of cell division and
predisposes cells to tumourigenesis. Most mutations are observed in the central-DNA
binding-domain of the protein and strongly alter its function as transcription factor (75).
p53 mutants bind DNA targets in a structure-selective mode, rather than sequence
specific (81). In hypoxic tumours, wild type p53 mediates both apoptotic cell death and
anti-angiogenic effects by repressing HIF-1α, VEGF (82) and CXCR4 (83). Thus, p53
loss of function mutations can be oncogenic not only by reducing the apoptotic rate but
in a tumour-environment related mode as well. Furthermore, free radicals (ROS, NOS)
that are generated within the tumour microenvironment by pro-inflammatory mediators
(IL-1β, TNF-α) can directly modify p53 (both at gene and protein level) leading to
insufficient DNA repair and clonal expansion of pro-cancerous cells (84). The
inflammatory environment activates components of the p53 pathway (COX-2, NOS)
and at the same time produces mutations on the gene, abolishing its protective function
(85). Mutations that diminish or remove p53 pro-apoptotic ability allow inflammation
and NF-κB to exert their tumour-promoting effects (86).
30
In the absence of p53 mutations other molecular regulators suppress wild type
p53 transcriptional activity, thus leading again to cancer development. Macrophage
migration inhibitory factor (MIF), a cytokine produced by macrophages at sites of
inflammation, functionally inactivates p53 by inhibiting its transcriptional activity (87)
providing another link between inflammation and oncogenesis. Since p53 is not down-
regulated at the protein level, Petrenko and colleagues speculated that MIF might
inactivate the function of p53 by modulating the ability of the transcription factor to
form complexes with co-factors, such as p300/CBP (88). p300/CBP is a p53 co-
activator with intrinsic HAT (histone acetyltransferase) activity that acetylates lysine
residues (K372, K373, K382) of the p53 C-terminal region (Figure 1.5) thereby
enhancing its binding affinity for a particular subset of its transcription targets (89).
p300/CBP also transactivates HIF-1α, implying that conditional recruitment of
p300/CBP to either p53 or HIF-1α may differentially regulate cellular response since it
is known that hypoxia-induced MIF amplifies HIF-1 dependent transcriptional activity
in human cancer (90). Functional crosstalk between p53 and HIF-1α could similarly be
regulated by other pro-inflammatory cytokines promoting tumourigenesis.
1.4.4 Histone acetyltransferase activity, cancer and inflammation
Diverse transcription factor co-regulator (repressor/activator) complexes
participate in the modulation of gene expression in response to environmental as well as
intracellular signals (91). Gene expression is fine tuned via post translational
modifications such as acetylation, methylation, phosphorylation, ubiquitination,
occurring either on histones or on transcription factors which are mediated by these
multi-protein co-regulatory complexes (91). The p300/CBP complex is one of the
histone acetyltransferase family members (HATs) (92) and has been shown to
transactivate transcription factors involved in inflammation such as NF-κB (93), and
p53 (89). The p300/CBP associated factor (PCAF) and the steroid receptor co-activator
31
(SRC-1) both possess intrinsic histone acetylatranferase activity and have been shown to
regulate p53’s and HIF-1α mediated transcription (94, 95, 96).
Acetylation refers to the covalent post-translational modification of proteins and
is a major modulator of protein function and transcriptional regulation. Addition of
acetyl-groups (CH3-CO) on lysine residues of histones neutralizes their positive charge
resulting in a more ―relaxed‖ chromatin structure which allows access of the basal
transcription machinery to DNA and hence facilitates transcription initiation (97). Thus,
acetylation has been linked to increased transcriptional activity and deacetylation
mediated by histone deacetylases (HDACs) with transcription repression (98).
Initially it was thought that acetylation occurs only on histone substrates but it
was later realised that other proteins, including transcription factors, can also be
modified by HATs providing evidence that lysine acetylation holds a key role in gene
regulation. Epigenetic mechanisms that directly affect gene transcription at the
chromatin level or transcription complexes determine the equilibrium between
acetylation and deacetylation which controls both physiological and pathological
processes (92). Indeed, eukaryotic HATs and HDACs are involved in diverse processes
ranging from replication, DNA repair and apoptosis to metabolism and intercellular
signaling (99).
In accordance with the notion that proteins possessing HAT activity often exist
in multiprotein complexes along with other HATs and transcription factors and regulate
gene expression by acting on histone and non-histone targets, it is well established that
SRC-1, PCAF and p300/CBP interact with each other and form complexes with
additional trans-regulating factors (100). SRC-1 belongs to the p160 SRC family of
nuclear hormone receptor (NR) co-activators that induce transcription via their intrinsic
acetylatransferase activity (101). In addition to NR co-activators, all three homologous
members of this family (NCoA-1/SRC1, NCoA-2/TIF2/GRIP1 and NCoA-
3/p/CIP/ACTR/AIB) serve as co-activators of multiple transcription factors including
p53, NF-κB, HIFs, STATs and E2F1 (102). Structurally, SRCs comprise of three
domains (Figure 1.6): the bHLH-PAS domain at their N-terminal end, two
transactivation domains (AD) at their C-terminal and a central LXXLL motif (where L
is leucine and X any amino-acid). The bHLH-PAS domain is similar to the one present
32
in the HIF-1α, conserved among the p160 family members and required for the
interaction of these co-factors with other DNA-bound proteins (rather than DNA itself)
as well as for the hetero- and homo-dimerization with members of the SRC family in
response to hormonal stimuli (103). Moreover, upon hormonal stimuli the centrally
located LXXLL motifs mediate the efficient binding of SRC co-activators to nuclear
receptors on the promoters of target genes via amphiphatic α-helical structures (104).
However, the transactivation function and HAT activity of p160 co-activators are
ascribed to the C-terminal domain of the protein that contains the AD1 and AD2
domains. This region interacts with factors that possess strong HAT activity and are
essential for SRC-mediated transcription, predominantly p300/CBP (105) and PCAF,
and histone modifying enzymes such as co-activator-associated arginine
methyltransferase 1 (CARM1) and protein arginine N-methyltransferase 1 (PRMT1).
Figure 1.6: Representation of SRC-1’s structural organisation (106). The SRC-1
functional and interaction domains with the transcription factors NR, HIF, p53 and co-
factors PCAF, CBP/p300 are highlighted.
33
Aberrant expression of SRCs accompanied with any functional consequences,
has been extensively reported in human solid cancers (102). Potential interconnection
between SCR-3 and p53 pathways is highlighted by the existence of positive correlation
of high co-activator expression with p53 staining in breast and colorectal cancer
specimens (107, 108) although in such cases overexpressed SRC-3 possibly correlates
with transcriptionally compromised p53 (94).This notion combined with the observation
that its homologue SRC-1 potentiates p53-mediated transcription in the same ovarian
cancer experimental model (94) indicates the importance of the formation of temporal
differential co-factor complexes in regulation of gene transcription. In the context of
important solid cancer biological characteristics, Carrero and colleagues demonstrated
that SRC-1 and CBP synergistically stimulate HIF-1α activity in a hypoxia-dependent
manner (95). The same authors also investigated the contribution of the activity of each
one of these cofactors to HIF transactivation and concluded that both SRC-1 and CBP
are required for it. In line with these observations, interaction between CBP and HIF-1α
is essential for the recruitment of SRC-1 to the HIF complex in hypoxic cells (109).
SRC-1, as part of the macromolecular complex with CBP, has also been shown to
mediate the transcriptional regulation of some STAT factors (110). Overall, SRC-1 is
implicated in a variety of human solid cancers via its co-activator function which
regulates the expression of genes involved in proliferation and metastasis (102).
1.4.5 Histone deacetylase activity, cancer and inflammation
Lysine acetylation is a reversible procedure and perturbations of the equilibrium
between addition and removal of acetyl-groups on histone and non-histone substrates is
crucial for cell homeostasis and pathogenesis. Deacetylation mediated by HDACs has
been correlated with gene silencing and decreased protein stability/activity (97, 111).
HDACs can be categorized into two families and further classified into four classes (I-
IV) (112, 113). HDAC class I comprises of the HDACs 1, 2, 3 and 8 and its members
are closely related to the deacetylase Rpd3 found in yeast (Saccharomyces Cerevisiae).
34
HDACs 4, 5, 6, 7, 9 and 10 are similar to the yeast deacetylase Hda1 and form class II
while a more recently identified member, HDAC 11, alone forms class IV of
deacetylases. Classes I, II and IV collectively constitute the classical Zn2+
-dependent
HDAC family. The last class (class III HDACs) comprises of seven members namely
Sirtuins (SIRT1-7) and is the NAD+-dependent HDAC family. The fact that sirtuins
require NAD+ in order to exert their deacetylase activity suggests that these enzymes are
sensors of the cellular redox status and coordinators of cellular energy metabolism
(114). Indeed, yeast Sir2 which is the founding member of this highly conserved family
of proteins has been shown to promote longevity (115). SIRT-1 (silent mating type
information regulation 2 homolog) is the most extensively studied member of the
sirtuins family (115). All human SIRTs are characterised by the presence of a conserved
calatylic core domain that possesses the NAD+-dependent deacetylase activity (Figure
1.7).
Figure 1.7: Representation of SIRT-1’s structural organisation (116) and SIRT-1
mediated regulation of cell viability upon deacetylation of target transcription factors
(p53, HIF1-α, FOXO, NF-κB) by its catalytic domain.
35
In mammalian cells, SIRT-1 not only epigenetically regulates transcription via
deacetylation of histones H3 and H4, but also targets numerous key transcription factors
and regulators including p53, HIF-1α, forkhead transcription factors (FOXOs), nuclear
receptors, NF-κB and PCAF (117) (Figure 1.7). So far a wide range of SIRT-1
substrates has been identified, implicating this HDAC in the regulation of a variety of
cellular responses ranging from metabolism and inflammation to cell death. SIRT-1
dependent deacetylation of the tumor suppressor p53 hinders p53-induced apoptosis in
response to genotoxic/oxidative stress (118). SIRT-1 mediated deacetylation of FOXO3
and FOXO4 results in growth arrest and survival instead of death (119,120). In addition,
deacetylation of NF-κB by SIRT-1 represses NF-κB mediated responses and sensitizes
cells to apoptotic death upon TNF-α stimulation providing a link between SIRT-1 and
pro-inflammatory signalling (121). SIRT-1 has been shown to interact and deacetylate
HIF-1α (122) thereby suppressing HIF-1α transactivating ability. In conclusion, SIRT-1
by deacetylating a plethora of downstream effectors within cells exerts contradicting
effects in cancer (123, 124).
1.5 Breast cancer
Breast cancer accounts for the highest mortality rate in women among cancers
worldwide (125). The vast majority of breast cancer cases are caused by genetic
mutations that accumulate during an individual’s lifetime rather than are inherited.
Genes encoding for growth factors, cell cycle regulators, apoptosis mediators and
signalling molecules are commonly mutated or deregulated during carcinogenesis of
breast. Human breast carcinogenesis is characterized by abundant leukocyte infiltration.
Chronically activated B and T infiltrating lymphocytes, present at appreciable rates in
both ductal carcinoma in situ (DCIS) and invasive breast cancer, secrete factors (TNF-α,
IL-6, IL-10, IL-4, IL-13, TGF-β) that manoeuvre innate cellular responses towards
tumour proliferation (126). Furthermore, neoplastic cells themselves express cytokines
36
and their receptors, for instance IL1, IL6, TGF-β and their receptors, thus contributing
to tumour progression.
IL-2 and IFN consist the most used cytokines as therapeutic anti-tumour agents
because they stimulate cellular immunity against cancer. Clinical trials using IL-2 and
IFN alone, together or in combination with other anti-cancer molecules are in progress
and their results are being evaluated (127). IFN is widely used as treatment in breast
cancer patients because its action inhibits cancer cell proliferation and invasion and also
enhances estrogen-dependent therapy.
Estrogens, the steroid hormones that regulate reproduction and female
physiology, are widely implicated in breast carcinogenesis. Two complementary
mechanisms have been proposed for the carcinogenicity of estrogens in the mammary
gland: genotoxic intermediates of estrogen metabolism and ER signalling pathways can
potentially affect cell proliferation and apoptosis, contributing to cancer development
and progression (128). The ER-independent mechanism involves generation of
oxidative stress (ROS) and induces DNA damage and altered gene expression that may
trigger cancer initiation (129). Clinically, ER positive breast tumours correlate with
favourable prognosis and responsiveness to hormone therapy, despite the fact that
estrogens exert mitogenic activity on breast cells (130). ER signalling could possibly be
involved in pathways that inhibit cancer development. The role of cytokines is still
elusive in ER mediated tumour promotion. Chavey and colleagues postulated a down-
regulation of cytokines by ER, since high levels of multiple cytokines including IL-6,
IL-8, IL-10, TNFα, CCL2 were detected in ER negative breast carcinomas (25).
However, positive regulatory crosstalk between CXCR4-CXCL12 and ER (both α and β
isoforms) signalling pathways has been reported (131) and is of great biological
significance if taken into consideration with the well established role of the CXCR4-
CXCL12 axis in metastasis. Notably, SRC-1 participates in the afore-mentioned ER-
dependent CXCL12 transactivation, fact that implicates ER signalling in invasion of
breast cancer as well as early steps of breast tumourigenesis.
The SRC-1 co-activator along with other transcriptional co-factors, including
p300/CBP, activates ER transcriptional activity. In fact, recruitment of p300/CBP by
37
SRCs to the chromatin is essential for SRC induced transcriptional activity (102). In
vitro studies indicate that overexpression of SRC-1 in breast cancer cells stimulates
estrogen-mediated cell proliferation (132). Upregulated SRC-1 in breast cancer and its
subsequent transactivating activity is also linked to mammary tumour metastasis and
increased macrophage recruitment at the tumour site (133). SRCs are also co-activators
for other transcritpion factors, apart from nuclear receptors (102). Functional interplay
between SRC-1, NF-κB, HIF-1α and p53 regulate many different aspects of
tumourigenesis. For instance, CXCR4 is found to be up-regulated by HIF-1α (69) and
indirectly repressed by p53 (83). Thus, crosstalk between co-factors has paramount
importance for the gene expression profile in tumour associated inflammatory
environments and the promotion or repression of tumour progression. Pro-inflammatory
cytokines and mediators may alter the levels and recruitment of transcription factors in
favour or against breast carcinogenesis.
SIRT-1, the firstly discovered member of the NAD+ dependent deacetylase
family, was recently proposed to play a role in estrogen-mediated mammary
carcinogenesis via the attenuation of estrogen-IGF-1-signalling observed in SIRT-1
deficient mice (134). Although the contribution of SIRT-1 to breast tumorigenesis is
still ambiguous, there are indications that SIRT-1 exerts an oncogenic effect in breast
cells via silencing of tumour suppressive genes (135). Moreover, in human breast cancer
MCF-7 cells SIRT-1 expression affects the apoptosis-related factors NOXA and Bcl-2
in an apoptosis favouring mode (136). Being a transcription factor regulator, SIRT-1 has
been also implicated in inflammatory signalling. However, to our knowledge there are
only reports connecting cytokine expression with SIRT-1 in non-cancerous cells. MMP9
is negatively regulated by SIRT-1 in macrophage-like cells (137) while microarray data
show compromised CXCR4 and MMP14 expression in SIRT1 silenced human
endothelial cells (138).
38
1.6 Therapeutic approaches
Over the past years, the hypoxic nature of solid tumours has been implicated in
the reduced efficiency of the conventional chemotherapies (64). Oxygen deprivation
dramatically reduces the cytotoxic effects of the therapeutic agents, contributing to
chemotherapy resistance of cancer cells. The perspective of alternative therapeutic anti-
cancer strategies has orientated towards HIF-1 and components of the hypoxic pathway
in general. HIF-1α is a primary target for cancer therapy because activation of HIF-1α is
a key event in the process of carcinogenesis that influences a great variety of cellular
functions. Targeting HIF-1α directly, using molecular inhibitors, or targeting upstream
cellular events and/or molecules that activate HIF-1α have been extensively used for
clinical trials. However, use of HIF-1 inhibitors has been linked to elevated toxicity, due
to inhibition of HIF’s activity in physiological processes, so research has focused on
chemoprevention strategies that target pathways aberrantly activated by hypoxia, such
as glycolysis and angiogenesis (139).
Lately, emphasis has been given on therapeutic approaches that target the
tumour microenvironment and some of its components that support tumour growth; not
the cancer cells. Anti-angiogenic, anti-vascular and immune therapies are novel
strategies to battle cancer and involve inhibition of expression of cytokines, chemokines
and growth factors secreted by infiltrating and stromal cells. The anti-tumour function of
certain cytokines, such as IL-2 and IFN, has been successfully applied in patients with
various types of cancer. TNF has also shown anti-cancer/anti-vascular activity at certain
level when locally expressed, but yet systemic toxicity remains a major side effect.
Instead, due to increasing data pleading for TNF’s role in tumourigenesis, anti-TNF
therapies are being used against cancer. Furthermore, novel strategies using cytokine
derivatives that specifically target cancer cells are under investigation (140).
Long term use of non-steroidal anti-inflammatory drugs (NSAIDs) such as
aspirin have a chemopreventive effect and reduce the risk of certain cancers (colorectal,
lymphomas, lung, gastrointestinal) (141). However, reduction of breast cancer risk
associated with use of non-steroidal anti-inflammatory drugs is still ambiguous (142).
39
These drugs exert their biological activity by both COX-2 dependent and independent
mechanisms: inhibition of COX-2 as well as donwregulation of NF-κB activity may
induce apoptosis and inhibit angiogenesis (141, 143). It has become obvious that
targeting the inflammatory microenvironment of tumours can improve the clinical
outcome for cancer patients and furthermore, appropriate combination of these therapies
may provide highly efficacious therapeutic effects.
1.7 Hypothesis and aims of the project
The cellular levels of cytokines and cytokine receptors are rate limiting factors in
the outcome of several chronic inflammatory diseases including cancer and therefore the
study of the mechanisms regulating their levels is the centre of several investigations, since
the need to balance cytokine cellular levels is very important for the prognosis and cure of
chronic inflammatory diseases (23). Knowing that many cytokines involved in chronic
inflammatory conditions both promote oncogenesis and prevent cellular growth (43) we
were interested to monitor the expression pattern of pro- and anti-inflammatory cytokines
and their receptors in breast cancer cells, study how their levels correlate with diverse types
of stress conditions (DNA damage/ hypoxia mimicking) and dissect the molecular
mechanisms involved in the determination of their cellular levels.
The presence of multiple putative HREs in the regulatory region of the promoters of
IL-10, TNF-α and CXCR4 was identified using bioinformatic analysis and implies that
hypoxia responsive transcription factors may be implicated in their transcriptional control.
It has been shown that all three inflammatory factors are overexpressed in various types of
cancer including breast cancer (25, 36, 127, 42). Hypoxia has been reported to favour
cancer progression by up regulating CXCR4 and TNF-α expression in cancer and tumor
infiltrating cells (69,144). Moreover, within stressed cells p53 induces anti-metastatic
pathways by modulating CXCR4 (83) and its apoptotic potential is modified by TNF-α (84).
The regulation of IL-10 by hypoxia and DNA-damage in cancer cells is less clear. In
40
particular although hypoxia upregulates IL-10 levels in macrophages (145) an inverse
correlation between IL-10 and p53 expression has been documented in breast cancer
patients (146).
To shed light on the molecular mechanisms governing cytokines expression, the
contribution to the regulation of CXCR4 cellular levels of two modulators targeting both
HIF-1α and p53 with opposing functions, namely SRC-1 and SIRT-1, was investigated.
SRC-1 has intrinsic HAT activity whereas SIRT-1 is a NAD+ dependent deacetylase and
both modulators are involved in breast carcinogenesis. The role of SCR-1 and SIRT-1 in the
determination of the CXCR4 cellular levels was assessed in breast cancer cells treated with
etoposide and/or DSFX with the aim to evaluate the effects of these modulators in cancer
progression and identify possible signalling pathways that could be exploited in anti-cancer
therapy.
41
CHAPTER 2: MATERIALS AND METHODS
All chemicals were purchased from SIGMA (Sigma-Aldrich, Dorset UK) except for
TEMED (Biorad, Hertfordshire UK), acrylamide (National Diagnostics, Hull UK), APS
(Flowgen, Leicestershire UK), low EEO agarose (MELFORD, Ipswich UK), Nonident P40
(BDH Merck, Dorset UK), glycerol (BDH Merck, Dorset UK), LB broth Lennox L
(Invitrogen, Paisley UK), SDS (Fisher, Leicestershire UK), glycine (Fisher, Leicestershire
UK), Tris base (Fisher, Leicestershire UK), NaH2PO4 2H2O (Fisher, Leicestershire UK).
For tissue culture, DMEM medium and trypsin-EDTA solution were obtained from Sigma-
Aldrich (Dorset UK), FBS and penicillin/streptomycin from Gibco (Paisley UK). Western
blotting was performed using Mini-Protean system (Biorad, Hertfordshire UK). DNA
electrophoresis was performed using Mupid ex-u appliance (Takara). Reagents for PCR
were supplied from NEB (Ipswich UK) and primers from Eurofins MWG (London UK).
Reagents for restriction digestion and ligation reactions were supplied from Roche
Diagnostics (GmbH Germany).
2.1 Cell culture, chemical treatments and constructs
The human breast carcinoma cell lines MCF-7 (p53+/+) and MDA-MB-231 (p53-/-)
(obtained from ECACC) were routinely maintained in Dulbecco’s modified Eagle’s
medium (DMEM), supplemented with 10% foetal bovine serum (FBS) and 1%
penicillin/streptomycin (10 U/ml) at 37˚C and 5% CO2. Both cell lines are adherent, so
subculturing them involved trypsinization (enzymatic method) using trypsin-EDTA
solution (2mls per T75 flask), incubation for 2-3 minutes at 37 C and resuspension of the
cells in fresh medium.
42
In order to investigate the effect of HIF-1α and p53 transcription factors on the
expression of inflammatory genes, we treated the cells with chemical compounds known to
induce the transcriptional activity of these factors within the cells (147, 148). Etoposide
(Etop) is widely used in research as a DNA damage mimicking agent. Etoposide is
classified as a topoisomerase II inhibitor that binds to the respective enzyme and inhibits its
function in ligating DNA molecules. Its action results in accumulation of single- and
double-strand DNA breaks, inhibition of DNA replication and cell death. Etoposide
stabilizes p53 protein via a mechanism that involves inhibition of the p53-MDM2
autoregularory feedback loop (149). Etoposide was used at final concentration 10μM. For
hypoxia mimicking conditions, cells were treated with the chelator desferrioxamine
(DSFX). DSFX is involved in iron metabolism and acts as a chelating agent that binds to
free iron (trivalent iron) and forms a stable complex. DSFX is widely used as a hypoxia
mimicking agent due to its ability to prevent the cells to use the oxygen present in the
environment and hence inhibit the degradation of HIF-1α and induce its accumulation in the
cell. In terms of the mechanism that allows HIF-1α stabilisation, DSFX attenuates the
enzymatic activity of hydroxylases (PHD, FIH) due to the fact that iron is an essential
component of hydroxylation reactions (150). DSFX was used at final concentration of
250μM. In all experiments where the use of these compounds is mentioned cells were
treated with 10μM etoposide and 250μM DSFX for 16 hours, unless otherwise stated.
In experiments requiring expression of exogenous DNA, cells were transiently
transfected using the Polyfect transfecting reagent (QIAGEN, Sussex UK), according to the
manufacturer’s instructions. Constructs used for exogenous expression included the control
pcDNA3 vector (96), β-galactosidase expressing vector (96), HA-SRC-1 (151) and Flag-
SIRT-1 (Addgene, Cambridge MA) tagged expressing vector.
43
2.2 Western blotting
Western blot, also termed protein immunoblot, is an analytical method used for the
identification and/or quantification of specific proteins from the crude cellular extract (152).
Several alternative protocols exist for a range of applications, all of them including 3 steps:
separation of proteins according to their molecular size by electrophoresis on a
polyacrylamide gel (SDS-PAGE), transfer of proteins on to a polyvinylidene difluoride
(PVDF) or nitrocellulose membrane and detection of the protein of interest using
appropriate antibodies.
2.2.1 SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel
electrophoresis)
This technique is used for the electrophoretic separation of proteins from the whole
cellular extracts according to their molecular size. A polyacrylamide gel acts as molecular
sieve allowing proteins from the same sample to migrate under the application of electric
current. Proteins that are purified from the cellular extracts are mixed with sample buffer
that contains the anionic detergent sodium dodecyl sulfate (SDS). SDS acts by disrupting
the non-covalent bonds of the proteins, thus denaturing them and leaving them void their
native conformation. Proteins in their primary structure are coated uniformly by the
negative charges of SDS with an approximate ratio of 1.4g SDS per 1g protein which gives
all SDS-bound proteins roughly the same charge to mass ratio and hence equal mobility in
an electric field. Under these conditions, small proteins migrate faster through the pores of
the gel and larger proteins slower, since their migration during electrophoresis is solely
determined by their molecular weight. A sample containing a mixture of proteins of known
44
molecular weights (protein marker/ladder) allows comparison of the molecular weight of
these proteins with those present in the cellular extract resolved by electrophoresis.
Polyacrylamide gel is a good matrix for electrophoresis of proteins due to its tight-
pore properties, comparatively to agarose gels. Acrylamide is a chemical compound with
formula CH2=CHCONH2 whose chemical polymerisation forms linear polyacrylamide
molecules. The formation of the gel requires a mixture of acrylamide with the cross-linking
agent bisacrylamide that introduces links between poluacrylamide chains. The total amount
of acrylamide as well as the ratio bisacrylamide/acrylamide determine the size of the pores
of the gel. Thus, those two factors should be taken into consideration in respect of the size
of the protein to be analyzed. Generally, the amount of acrylamide correlates inversely with
the size of the pores of the gel. This means that gels with high percentage of acrylamide are
suitable for resolution of small proteins while low pecentage gels give better resolution of
large proteins. Polymerisation is initiated by the addition of ammonium pesulphate (APS)
and N-N-N’-N’ tetramethylenediamene (TEMED), with the latter acting as a catalyst by
promoting the production of free radicals by APS. Acrylamide mixtures are poored between
two glass plates placed on the casting stand of the electrophoretic apparatus so as to form a
thin gel at the top of which a comb, that helps form the wells for sample and marker loading
after polymerisation, is placed. Discontinuous SDS-PAGE is the commonest protocol
(classical Laemmli protocol) where the gel is cast between the glass as two gels of different
acrylamide and buffer concentrations: the resolving gel (high concentration), serving the
proper resolution of the proteins, topped by the stacking gel (low concentration) that is
important for the concentration of the proteins in a thin stack so they can smoothly enter the
resolving gel. Tracking of the electrophoresis is achevied by adding a dye (usually
bromophenol blue) to the samlpe buffer.
Total protein was extracted from cells treated/transfected appropriately. Initially
cells were washed twice in ice-cold phosphate buffered saline (PBS). Cells were then
scraped on ice in high salt lysis buffer (500 mM NaCl, 50 mM Tris-HCl pH 7.5, 5 mM
EDTA pH 8, 0.5% NP-40, 1% Triton X-100, 1 mM) containing 1μg/ml protease inhibitor
cocktail (pepstatin, aprotinin, and leupeptin) and 1 mM phenylmethylsulphonyl fluoride
(PMSF). Cell lysates were transferred to sterile tubes, rotated at 4˚C for 30 minutes and
insoluble material was pelleted by centrifugation at 4˚C for 20 minutes. The supernatant of
45
each sample containing the proteins was transferred to fresh tube. The relative
concentration of each protein sample was estimated based on the colorimetric Bradford
assay: 200μls Bradford reagent (Bio-Rad protein assay) were diluted 1:5 in ddH2O in a
cuvette and 2μls of protein sample were added. Reactions were mixed and left 2-5 minutes
at room temperature before the absorbance at 595 nm wavelength was measured using a
spectrophotometer (Beckman DU640). Equal amounts of protein for each sample were
transferred to fresh tubes and 3xSDS sample buffer (62.5 mM Tris-HCl pH 6.95, 2% SDS,
10% glycerol, 5% β-ME, bromophenol blue) was added to a final concentration of 1x.
Samples were boiled at 95˚C for 5 minutes and were either used for SDS-PAGE
immediately or stored at -20˚C for several days.
For electrophoresis, 7.5% polyacrylamide gels were prepared as described in Table
2.1:
RESOLVING GEL STACKING GEL
Acrylamide 4.43 ml 2.24 ml
ddH2O 2.33 ml 0.556 ml
1.5 M Tris-HCl (pH 8.95) 2.33 ml —
1 M Tris-HCl (pH 6.95) — 0.416 ml
0.2M EDTA 93 μl 33.3 μl
10% SDS 93 μl 33.3 μl
10% APS 52.3 μl 33.3 μl
TEMED 5.66 μl 3.33 μl
Table 2.1:Reagents and volumes used for preparing one 7.5% polyacrylamide gel
(resolving and stacking).
Mixtures were poured between the glass plates casted on the stand and left to
polymerasize. After 20-30 minutes, the stacking gel was prepared and poured on top of the
resolving, with the comp being fitted immediately on top of it. After gels had set, the stands
were placed in the tank filled with SDS running buffer (25 mM Tris base, 191 mM glycine,
0.1% SDS) and the boiled protein samples were loaded on the wells along with the
prestained protein marker (NEB, Ipswich UK). The gels run at 80 volts for approximately
46
20 minutes (until proteins passed the stacking gel) and then at 110 volts for another 50-80
minutes (depending on the desired resolution).
2.2.2 Electroblotting and detection
After being separated by electrophoresis, proteins were transferred on to membranes
(electroblotting) by the following assembly: the polyacrylamide gel was placed up against
the membrane in between the cassette assembly (Figure 2.1), which when placed in the tank
should have the following order from the cathode(-) to the anode(+): blotting sponge, filter
paper, gel, membrane, filter paper, blotting sponge. The tank was filled with the appropriate
buffer (transfer buffer) and application of electric current of specific volts and for specific
period of time to allow complete transfer of the negative charge coated proteins on to the
membrane.
Figure 2.1: Schematic assembly of the western blot apparatus depicting the proper
orientation of the blotting sandwich cassette in the tank for protein transfer (153).
47
After electroblotting, proteins are transferred on to a membrane with the exact order
they were resolved on the gel. Membranes were blocked in a bovine serum albumin
(BSA)/non-fat dry milk 5% solution for reducing the non-specific binding of the antibodies
that were used to identify the proteins of interest. After blocking, the incubation with the
primary and secondary antibodies took place using the appropriate dilution of the primary
and secondary antibodies (Table 2.2) in 2.5% non fat milk solution in 20% Tween-20.
Proteins were transferred to Millipore PVDF membrane (Fisher Scientific, Leicestershire
UK) by assembling the cassette as described in Figure 2.1. The cassette was placed in the
tank filled with transfer buffer (20% v/v methanol, 27 mM Tris base, 150 mM glycine) and
transfer was conducted at 0.4 amps for two hours. PVDF membranes were blocked in 5%
w/v non-fat dry milk in PBS solution for 1 hour at room temperature, rocking on a platform.
Membranes were incubated in primary antibody solution (2.5% w/v milk in 0.1% Tween-20
PBS) overnight at 4˚C rocking and next day they were washed three times in 0.1% PBS
Tween-20 for 10 minutes. Appropriate horseradish peroxidase-conjugated secondary
antibody solution (raised in the same species as primary) (2.5% w/v milk in 0.1% Tween-20
PBS) was applied on the membranes for 1 hour at room temperature and membranes were
washed three times in 0.1% Tween-20 PBS for 10 minutes. For the detection of horseradish
peroxidise (HRP) on the immunoblots, and thus the proteins of interest, SuperSignal West
Pico enhanced chemiluminescent substrate was used (Thermo-Scientific). This is a highly
sensitive non-radioactive chemiluminescent substrate that allows detection of HRP when
blots are exposed to X-rays. Exposure time of SuperRX X-rays films (FUJIFILM) varied
from a few seconds to several minutes, according to the desired optical result.
48
Antibody Clonality Supplier Dilution
HIF-1α Monoclonal Calbiochem (H1α67) 1:5000
p53 (DO-1) Monoclonal Santa Cruz (sc-126) 1:10000
CXCR4 Monoclonal R&D (MAB 721) 1:10000
SRC-1 Monoclonal Abcam (84) 1:5000
β-actin Polyclonal Abcam (8227) 1:10000
HA-11 Monoclonal Babco (Covance) 1:5000
Flag Monoclonal Sigma (M-20) 1:5000
Table 2.2: List of antibodies used in this study
2.3 Co-immunoprecipitation
Protein-protein interactions are of paramount importance in cell biology because
they are implicated in various intracellular signaling processes. Co-immunoprecipitation is
a widely used in vitro method for analysis of protein interactions. Immunoprecipitation
involves the precipitation of a specific antigen from a solution (usually the crude cellular
extract) using the respective antibody and a means of isolation of the complex from the
lysate, commonly a solid-phase support such as agarose beads. The proteins that stably
interact with the antigen of interest can be co-precipitated if the complex antibody-antigen-
interacting protein is captured on the solid support (Figure 2.2). Proteins that are not bound
to the solid support are washed away and those that interact with the antigen of interest are
eluted from the support and can by analyzed by SDS-PAGE and WB, as previously
described in chapter 2.2. Porous agarose beads are commonly used in immunoprecipitation
experiments due to their high capacity to bind antibodies. Moreover, beads are often coated
with bacterial protein A or protein G, which also have a high binding capacity for
immunoglobulins.
49
Figure 2.2: Schematic representation of co-immunoprecipitation assay. A sample
containing proteins (usually cell lysate) is incubated with an antigen-specific antibody, that
is also coupled with A or G proteins. The formed immunocomplexes consist of the protein
of interest as well as any interacting macromolecules and can be precipitated on a beaded
support to which protein A/G are immobilized. All proteins not precipitated are washed
away and the complexes of interest are eluted form the beaded support for further analysis
(154)
For immunoprecipitation experiments, MCF-7 cells were grown in 3-4 100mm
culture plates per treatment, treated appropriately and harvested in TNN buffer (50 mM Tris
pH 7.5, 120 mM/240 mM NaCl, 5 mM EDTA, 0.5% Ipegal, 1 µg/ml protease inhibitors
cocktail and 1 mM PMSF). TNN buffer is more appropriate for protein-protein interaction
studies due to its mild denaturating properties. 1/10 of the protein extract was kept for use
as input sample while the rest was subjected to immunoprecipitation with 1-2 μg of the
desired antibody and 20 μl pre-blocked (in BSA ) agarose A beads (Sigma-Aldrich, Dorset
UK) overnight. Next morning, beads were washed three times in 300 μl TNN buffer and
once in 500 μl PBS. Each wash consisted of rotation for 2-3 minutes at 4˚C and
centrifugation at 13000 rpm for 4 minutes at 4˚C. Finally, 30μl SDS loading buffer (3x)
50
were added to the beads and the proteins were eluted by boiling the samples for 5 minutes
at 95˚C. Input and IP samples were analysed by western blot, as previously described in
chapter 2.2.
2.4 Polymerase chain reaction
Polymerase chain reaction (PCR) is a simple, yet powerful and flexible, method that
allows exponential amplification of a specific DNA fragment within long, double stranded
DNA molecules. The enzymatic in vitro amplification of a specific sequence requires a pair
of synthetic oligonoucleotides (referred to as primers) designed to flank the sequence to be
replicated, a thermostable DNA polymerase that catalyzes DNA synthesis in a template-
dependent fashion (due to complementary base pairing), mixture of deoxynucleotide
triphosphates (dNTP’s) and a reaction buffer that contains Mg2+
, among others, which
favour the enzymatic reaction. The most common polymerase used for PCR is the heat-
resistant Taq polymerase, a 94 kDa protein isolated from the thermophilic bacterium
Thermus aquaticus that possesses 5’→3’ polymerase activity.
PCR is an experimental procedure based on three elements: denaturation of the
template, annealing of the primers to the complementary target sequence and primer
extension by the polymerase. Initial heating of the reaction mixture at 95˚C leads to
denaturation of the DNA molecules, permitting primers to anneal to the complementary
sequences on the single strands (usually on the 3’ ends of the target) when the temperature
decreases to 40-60˚C. Subsequent adjustment of the temperature (commonly to 72˚C for
Taq polymerase) is required for attachment of the polymerase to each priming site and
synthesis of complementary DNA using the 3’ -OH of the primers as starting point and
dNTP's. Elongation of the primers with 5’→3’ direction on both strands ensures that the
sequence they bracket will be copied. In each extension step, both the original as well as the
newly synthesized strands serve as template for the polymerase. Hence, repeated cycles of
denaturation, annealing and elongation lead to exponential amplification of the target
sequence.
51
PCR reactions were performed according to the following general protocol: 50-500
ng of template DNA were added to a mix that consisted of 0.25 mM dNTP's, 1x PCR
reaction buffer (ThermoPol buffer), 1.25 mM MgCl2, 0.3 μΜ forward primer (Table 2.3),
0.3 μM reverse primer (Table 2.3), 1 unit of Taq polymerase and ddH20 up to a total
reaction volume of 40μl.
Primer name Sequence (5’→3’) Tm (˚C) Assay used for
CXCR4 (F) ChIP CATGTGTCTCCCCCTTGAGT 59.4 ChIP
CXCR4 (R) ChIP TCCGCCTCTAAATTCAGACAA 55.9 ChIP
TNFα (F) ChIP CTGCCCAAGAAAGAAACCAA 55.3 ChIP
TNFα (R) ChIP AAAAAGGGAAGGCAAGAAGG 55.3 ChIP
IL10 (F) ChIP GGGTGGTCTCAATCTCCTGA 59.4 ChIP
IL10 (R) ChIP CCCTTΤGTATGGGAGCTCTG 59.4 ChIP
CXCR4 (F) CAGCAGGTAGCAAAGTGACG 59.4 qPCR
CXCR4 (R) ATAGTCCCCTGAGCCCATTT 57.3 qPCR
TNFα (F) AGCCCATGTTGTAGCAAACC 57.3 qPCR
TNFα (R) ATGAGGTACAGGCCCTCTGA 59.4 qPCR
IL10 (F) TTACCTGGAGGAGGTGATGC 59.4 qPCR
IL10 (R) GGCCTTGCTCTTGTTTTCAC 57.3 qPCR
Rpl19 (F) ATGTATCACAGCCTGTACCTG 57.9 qPCR
Rpl19 (R) TTCTTGGTCTCTTCCTCCTTG 57.9 qPCR
CXCR4 (F) LUC GGTACCGTGCACAAGTGCAGAGAAG
G
68 Construction of the
luciferase reporter
CXCR4 (R) LUC GAGCTCAAGAGGGGAGAAGGGAGGA
T
68 Construction of the
luciferase reporter
TNF (F) LUC GGTACCAGGGAAAGTCCCAAACCAAC 66.4 Construction of the
luciferase reporter
TNF (R) LUC GAGCTCGACATGGGAGCCTTCAGAAA 66.4 Construction of the
luciferase reporter
52
Table 2.3: Table summarizing the names and properties of all the primers used in PCR
reactions. Sequence, melting temperature and related experiment are indicated for each
primer.
Primers were designed using the Primer 3 input (version 0.4.0) program.
OligoAnanlyzer 3.1 IDT (Integrated DNA Technologies) was used to check for potential
hairpin, self-dimer and hetero-dimer formation. Primer pairs were also blasted against the
human genome using the NCBI blast tool to confirm their complementarity to the gene of
interest only.
In some cases, the denaturing agent dimethyl sulfoxide (DMSO) was added in PCR
reactions in order to increase the specificity of the products. DMSO has an inhibitory effect
on the self-complementarity of DNA, thus preventing formation of secondary structures in
the template or the primers. DMSO was added in the PCR mixture at a final concentration
of 3%, when indicated.
In general, the PCR program is designed based on the length and the percentage of
GC content of a given pair of primers and the length of the expected product. Thus, any
variations on the PCR program are mainly observed in the annealing temperature and the
extension time. A typical PCR program included the following incubation steps: 95˚C for 4-
5 minutes for initial denaturation of template, 95˚C for 30 seconds for denaturation, 50-
58˚C for 30seconds for primer annealing, 72˚C for 30-60 seconds for primer extension. The
process of denaturation-annealing-extension was repeated approximately 35 times before a
final extension step at 72˚C.
2.5 DNA electrophoresis
Analysis of PCR products was performed by electrophoresis on agarose gels.
Electrophoresis is based on the principle of separating the negatively charged (due to their
phosphate backbone) DNA molecules according to their molecular size after loading them
on an agarose gel and under the application of electric current. Agarose is a linear
polysaccharide that, after being boiled in a buffered solution, can form an inert porous
matrix (gel) which acts as a molecular sieve. Under the application of an electric current,
53
linear DNA molecules migrate throughout the gel towards the anode with speed that is
inversely correlated to their molecular size. Small molecules fit easier into the pores of the
gel and thus migrate faster throughout it than longer molecules. Visualization of DNA is
performed using an ultraviolet (UV) trans-illuminator, provided that agarose is stained with
ethidium bromide (EtBr) before/after electrophoresis. EtBr is a fluorescent dye that
intercalates double stranded DNA and emits orange light when exposed to UV light,
allowing visualization of the DNA-dye complexes. This type of analysis is satisfactory for
qualitative data and for further manipulation of the products but does not provide accurate
quantification of the template DNA.
Agarose gels were prepared as following: depending on the desired concentration of
the gel (1-2% gel), 1-2gr of agarose were added to a conical flask containing 100 μl of
0.5xTAE buffer (20 mM Tris-acetate, 0.5 mM EDTA, pH 8) and boiled for 1-2 minutes in a
microwave until agarose was completely dissolved. The solution was left to cool down to
approximately 50˚C and 10μg of ethidium bromide were added. The solution was poured
slowly into the tank, the comb was fitted immediately and the solution was left to solidify.
The tank was filled with 0.5xTAE buffer, DNA samples mixed with loading buffer (30%
v/v glycerol, 0.25%w/v β-bromophenol blue, β-ME) were loaded on the gel and run at 100
Volts for approximately 40 minutes before visualization.
2.6 Quantitative reverse transcription PCR (Real time PCR)
2.6.1 RNA extraction and reverse transcription
One of the most useful applications of PCR involves the study of gene expression.
Within the cells, gene expression is determined by the presence and abundance of the
gene’s transcripts, the mRNA molecules. Thus, studies of gene expression patterns require
isolation of total RNA from the initial material (cultured cells) and reverse transcription of
mRNA to complementary DNA (cDNA) which can subsequently be used as template in
54
PCR reactions. Reverse transcription refers to the enzymatic conversion of RNA to DNA
by a RNA-dependent DNA polymerase (reverse transcriptase). This class of enzymes is
encoded by reverse-transcribing viruses and is vital for the replication of their genome.
Reverse transcriptases are also widely applicable in eukaryotic gene expression studies
since the genetic information needs to be in the form of DNA if to be subjected to PCR
analysis. Two of the most used reverse transcriptases are those encoded by the Moloney
murine leukemia virus (MMLV) and the avian myeloblastosis virus (AMV).
Total RNA was extracted using the RNeasy kit (QIAGEN, Sussex UK), according
to the manufacturer’s instructions. Briefly, cells were seeded in 6mm culture plates, treated
appropriately for 6h, washed twice in PBS and harvested in 350 μl RLT buffer (containing
β-ΜΕ). The lysate was placed into QIAshredder spin column and homogenized by
centrifugation at 13000 rpm for 2 minutes at room temperature. The homogenized lysate
was transferred to a gDNA eliminator column and the flow-through was collected after
centrifugation at 13000rpm for 1 minute. 350 μl of 70% ethanol were added to the lysate
and the sample was well mixed before being loaded to the RNeasy spin column.
Centrifugation at 13000 rpm for 30 seconds resulted in binding of total RNA to the column
and the flow through was discarded. The column was then washed once in 700 μl RW1
buffer and twice in 500 μl RPE buffer (The contents of RW and RPE buffers have not been
released from the supplier QIAGEN). Each wash consisted of centrifugation at 13000 rpm
for 1 minute and discard of the flow-though. RNA was finally eluted from the column by
addition of 50 μl of RNase-free water and centrifugation at 13000 rpm for 1 minute.
The concentration of the extracted RNA was measured with Nanodrop ND 1000 UV-Vis
spectrophotometer and subsequently reverse transcribed into cDNA. For this purpose,
500ng of anchored oligo-dT primer (Thermo-scientific, Leicestershire UK) were added to
1μg of total RNA template and the mixture was incubated at 70˚C for 5 minutes. Extension
of annealed primers was achieved by addition of the reaction mixture consisting of 0.5 mM
dNTP's, 1x reaction buffer, 1 unit BioScript reverse transcriptase (Bioline, London UK)
(final concentrations), and the reaction was incubated at 47˚ C for 1 hour. Finally, reverse
transcriptase was inactivated by heating at 75˚C for 10 minutes. Concentrations of cDNA
samples were measured with Nanodrop ND 1000 UV-Vis spectrophotometer and
standardized before being used as templates in real time PCR.
55
The Nanodrop technology allows determination of both concentration and purity of
the DNA sample of interest taking advantage of the ability of nucleic acids to absorb UV
light. Concentration of a DNA sample can be estimated by measuring the absorbance at
260nm, where DNA absorbs light maximally. The ratio of absorbance at 260nm and 280nm
(260/280 ratio) is representative of the purity of the DNA sample, which can be affected by
contaminating proteins and/or excess salt. Ratio of 1.8 is generally indicative of pure DNA.
2.6.2 Quantitative PCR
Reverse transcription PCR provides only qualitative rather than quantitative analysis
of gene expression, as mentioned before; in other words, it can be useful for verifying the
presence or absence of specific mRNA transcripts but it does not provide accurate
quantification of them.
Combining fluorescent probes/dyes with the conventional PCR reaction enables a
highly quantitative analysis of gene expression because the amplification of the product can
be monitored in real time. The most widely applicable version of real time PCR involves
the use of the fluorescent dye SYBR green. This stain intercalates only double stranded
DNA with high affinity and in a non sequence-specific mode, providing thus rigorous
monitoring of the accumulation of PCR products at the end of each cycle, as the reaction
proceeds. Real time PCR cyclers measure the kinetics of the reaction at its early stages,
when the amplification is at the exponential phase. This is a distinct advantage over
conventional PCR that only detects amplification rate at the end-point of the reaction, when
it has reached the plateau phase. As the reaction proceeds and more amplicons are
produced, data of fluorescent signal are plotted against the number of cycles and ultimately
give a graph similar to the one presented in Figure 2.3 A. The fluorescent signal is very low
at the early cycles, but as product accumulates over time fluorescence increases and rises
dramatically beyond a threshold (Ct). Thus, cycle threshold represents the cycle at which
fluorescence is detectable over background fluorescence and associated to exponential
amplification of reaction product. Beyond Ct, data obtained are very important for
quantification because fluorescence measured at the end of each cycle can provide
56
information for the initial template quantity by plotting a standard curve (using dilution
factor for known reactions).
Figure 2.3: qPCR amplification data (A) and melting curve (B). Amplification data
showing positive samples (blue curves) having an early cycle threshold (12-14 cycles), in
comparison with the negative control (red curve) that exhibits a very late and weak
threshold cycle number. The threshold value (Ct) is set at the exponential phase of the
reaction, when detectable increase of fluorescence (product) takes place, and before the
reaction reaches its plateau phase. The melting curve (B) shows a single peak (temperature
82˚C), indicative of amplification of a specific product as well as no primer dimers in PCR
57
reaction. The negative control (red curve) has low dissociation temperature (modified from
155)
However, SYBR green intercalates DNA non-specifically and therefore lacks the
specificity level introduced by fluorescent sequence specific probes. Caution should be
taken when analyzing the data in order to exclude fluorescence that potentially corresponds
to non specific products and/or primer dimmers. A Ct triggered by the correct amplification
product can be confirmed by the melting curve of the reactions (Figure 2.3 B), since all
reactions containing the same pair of primers will have the same melting temperature.
Regarding the protocol of qPCR, there were two main differences compared to the
conventional PCR protocol (chapter 2.4). The first was, presumably, the addition of SYBR
green dye in the reaction mix to a final concentration of 1x and the second concerned the
concentration of primers. After performing a series of optimization reactions, the final
concentration of each primer (Table 2.3) in the PCR mixtures was established to the range
of 30-45 nM. Apart from those two points, PCR was performed as previously described,
using 1μg of cDNA as template. Mastercycler® ep realplex (Eppendorf) was used for qPCR
reactions and data were analyzed using realplex software. The PCR program consisted of
the following steps:
1. 95˚C for 5 minutes
2. 95˚C for 15 seconds, 53-55˚C for 15 seconds, 72 ˚C for 20 seconds (repeated
40-44 times)
3. 72 ˚C for 5 minutes
4. (melting curve step) 95˚C for 15 seconds, 60 for 15 seconds, resolution set at
1˚C, 95˚C for 15 seconds
Primer pairs for RT-PCR were designed to bridge an exon-exon junction (splicing site) of
the specific gene to be studied, to eliminate the possibility of amplification from genomic
DNA in case of contamination. The expression of Rpl19, a gene that encodes for a
ribosomal protein and whose expression is unaffected by etoposide and/or DSFX treatment
(96), served as an internal control for normalization of mRNA levels of CXCR4, IL-10 and
TNF-α.
58
2.7 Chromatin immunoprecipitation
Chromatin immunoprecipitation (ChIP) is a powerful technique that allows
identification of interaction between proteins and DNA in the cell. Specific transcription
factors bind to genomic regions, usually consensus DNA binding sequences on the
promoters of genes, and regulate gene expression. Thus, ChIP can reveal potential
recruitment of transcription factors on to promoters of their target genes and provide insight
in the molecular pathways that regulate the expression pattern of genes. Briefly, the ChIP
method (Figure 2.4) involves temporary cross-linking of proteins with chromatin in live
cells using formaldehyde, extraction of cell lysates and subsequent shearing of chromatin,
immunoprecipitation of the protein of interest along with cross-linked DNA using the
respective antibody, reverse cross linking of the DNA and finally purification of DNA and
amplification of the genomic sequence of interest with PCR. PCR analysis can verify
whether the protein of interest is recruited to the genomic area amplified or not.
The experimental protocol used for ChIP was the following: MCF-7 cells were
grown in 3-4 10 cm tissue culture plates (per treatment) at 80-90% confluency and treated
appropriately. Cells were cross-linked by addition of formaldehyde in the culture medium at
a final concentration of 1.42% and incubation for 15 minutes at room temperature. Cross-
linking was quenched by addition of 125 mM glycine and incubation for 5 minutes at room
temperature. Cells were subsequently washed twice in ice cold PBS and scraped in PBS
containing protease inhibitors. Cells from each treatment were pulled together and collected
after centrifugation at 4700 rpm for 5minutes at 4˚C. Lysis of the cells was accomplished
with addition of 1ml IP buffer 150mM [150 mM NaCl, 50 mM Tris-HCl pH 7.5, 5 mM
EDTA pH 8, 0.5% NP-40, 1% Triton X-100, 1 mM PMSF, 1 μg/ml protease inhibitor
cocktail (pepstatin, aprotinin, and leupeptin), 20 mM β-glycerol phosphate, and 2 mM
sodium orthovanadate] and resuspension of the cell pellet. Nuclear extracts were collected
after centrifugation at 11400 rpm for 5minutes at 4˚C and were washed with 1ml IP buffer
59
150 mM (containing inhibitors) followed by centrifugation at 11400 rpm for 5minutes at
4˚C and removal of the supernatant.
Figure 2.4: Principle of ChIP assay. In living cells, formadelhyde crosslinking locks in the
DNA-protein complexes, trapping these unstable and sometimes transient interactions. Cell
harvesting followed by sonication of cell lysates results in shearing of chromatin into small
DNA fragments, each bound onto various proteins. Incubation with an antibody, conjugated
to protein A/G agarose beads, targeting the protein of interest, results in precipitation of the
DNA fragments bound onto the factor of interest while the rest are washed away. The
precipitated complexes are reverse crosslinked so that DNA can be purified and subjected
to PCR analysis.
60
To shear the chromatin, nuclear pellets were resuspended in IP buffer (containing
inhibitors) and sonicated using Bioruptor sonicator for 2.5-5 minutes on high power setting,
30 seconds on and 30 seconds off at 4˚C. Lysates were cleared by centrifugation at 11400
rpm for 10 minutes at 4˚C and supernatants containing the chromatin were transferred to
sterile tubes. At this point, 1/10 of each lysate was stored at -80˚C for later use as input
sample and the rest of the lysate was subjected to immunoprecipitation. Specifically, 1-2 μg
of the desired antibody were added to each sample and incubated overnight on a rotator at
4˚C. The next morning, protein A agarose beads were prepared for co-incubation with the
chromatin-antibody complex. First, 20μl beads per IP sample were washed three times in
1ml IP buffer (150 mM) by rotation and centrifugation at 4500rpm for a few seconds; then
beads were blocked with 2% BSA and 40 μg salmon sperm DNA for 1 hour at 4˚C to avoid
non-specific binding of proteins. Beads were washed again 3 times in 1ml IP buffer (150
mM) and transferred to the tube containing the chromatin. Samples were rotated for 2-3
hours at 4˚C, then beads were washed 3 times in 1ml IP buffer (150 mM), 3 times in 1ml
500 mM IP buffer (500 mM NaCl, 50 mM Tris-HCl pH 7.5, 5 mM EDTA pH 8, 0.5% NP-
40, 1% Triton X-100, 1 mM) followed by 2 more washes in 1ml IP buffer (150mM). 100μl
10% Chelex 100 (Biorad, Hertfordshire UK) resin slurry were added to the washed beads
and samples were boiled at 95˚C for 10 minutes. After samples cooled down, 30 μg of
proteinase K (Roche Diagnostics, GmbH Germany) were added and samples were
incubated at 55˚C for 30 minutes before being boiled again for 10 minutes. Proteinase K is
essential at this stage in order to digest chromatin aggregates that might interfere with the
DNA in subsequent steps. Samples were then centrifuged at 11400 rpm for 1 minute and
supernatants containing DNA were transferred to sterile tubes. Input samples were initially
subjected to ethanol precipitation (3 volumes of 100% ethanol, incubation at -80˚C for 30
minutes and wash in 70% ethanol), then 100 μl 10% Chelex 100 were added to the pellet
and samples were treated the same way as IP samples. Both inputs and IP samples were
used as templates in PCR analysis.
61
2.8 Handling and isolation of plasmid DNA
2.8.1 Transformation of competent bacteria
Transformation refers to the procedure of uptake and expression of foreign,
exogenous DNA by recipient bacteria. It can occur naturally, in certain species, or
artificially. Regarding the latter case, recipient cells are chemically or electrically ―forced‖
to uptake exogenous DNA through their cell membranes. This type of transformation is
widely used in experiments of genetic engineering. Bacteria that have the capability of
being transformed are called competent and are commercially available.
Escherichia coli bacterial DH5α cells, a derivative from Hanahan’s strain DH5, can
become chemically competent using CaCl2 treatment and subsequent heat shock. This
method involves chilling the cells in the presence of chloride ions that are permeable
through the bacterial membrane and cause swelling of the cells upon their entrance in the
cell. This step is necessary for the uptake of foreign DNA, which is considered to be
facilitated by interaction of the negatively charged phosphate backbone of the latter with the
divalent cations of calcium and heat shock.
DH5α cells (Invitrogen, Paisley UK) from the glycerol stock (-80˚C) were allowed
to grow with good agitation in Luria Bertani (LB) broth at 37˚C overnight (12-18 hours),
until they reach the stationary growth phase (Figure 2.5). Next day, the bacterial suspension
was diluted to 1 litre with supplementation of fresh broth and incubated at 37˚C until it
reached a desirable concentration corresponding to absorbance 0.5 measured at 500nm.
Following centrifugation at 5000 rpm 4˚C for 10 minutes, bacterial cells were resuspended
in 500 ml sterile, iced cold 100 mM CaCl2 and incubated on ice for 30 minutes with
occasional swirling. CaCl2 was discarded following centrifugation at 5000 rpm 4˚C for 10
minutes and cell pellet was resuspended in 50 ml of iced cold 100 mM CaCl2 in 15%
glycerol. After aliquoting the bacterial cell suspension appropriately, cells were kept on ice
for 12-24 hours before their storage at -80˚C. Plasmid DNA from ligation and/or cloning
reactions (will be discussed later) was transformed into chemically competent DH5α. DH5α
cells from the glycerol stock (1:1 in 50% LB/glycerol) in -80˚C were left to thaw on ice and
62
2μl of each reaction were added to 80-100 μl of competent cells. The mixtures were gently
agitated and incubated on ice for 30 minutes. Bacterial suspension was subsequently
subjected to heat-sock at 42˚C for 1minute and immediately placed on ice for 2minutes.
500-600 μl of LB broth were added to each mixture and incubated at 37˚C for 1 hour
shaking (~200 rpm). 180 μl of each transformation reaction were spread on selective LB
agar plates containing 50 μg/ml ampicillin or kanamycin, depending on the antibiotic
resistance properties of the vector introduced in the cells. Plates were incubated at 37˚C
overnight and bacterial colonies were analyzed next day for the expression of the inserted
DNA.
Figure 2.5: Representation of bacterial growth phases. For production of competent cells,
DH5α were collected during the stationary phase.
63
2.8.2 Mini scale preparation of plasmid DNA
Isolation of plasmid DNA from small volume bacterial cultures was performed
using QIAprep® miniprep kit (QIAGEN, Sussex UK). Briefly, each colony was inoculated
in 2mls of sterile LB broth and incubated overnight (16 hours approximately) on a shaker at
37˚C. Next day, 500 μl of the bacterial culture were removed and stored at -80˚C as
glycerol stock (1:1 in 50% LB/glycerol) for later use, while the rest were used for isolation
of pure plasmid DNA according to the manufacturer’s instructions. Cells were harvested by
centrifugation at 8000 rpm for 3 minutes at room temperature and aspiration of supernatant
medium. Cells were then resuspended in 250 μl buffer P1 (supplemented with RNase A)
and 250μl of buffer P2 were added. The suspension was mixed thoroughly by inversion of
the tube and lysis proceeded for 3-5 minutes at room temperature. 350μl of buffer N3 were
added to the lysate and after being well mixed, until formation of a homogenous cloudy
suspension, it was centrifuged at 13000 rpm for 10 minutes at room temperature. The
supernatant from this centrifugation step was applied onto the miniprep column and
plasmid DNA was bound while the flow through was discarded after centrifugation at
13000 rpm for 1 minute at room temperature. DNA was washed once with 750μl buffer PE
and finally eluted in 50μl of elution buffer EB (The composition of the N3, PE and EB have
not been released form the supplier QIAGEN). Plasmid DNA was stored at -20˚C for later
use.
2.8.3 Maxi scale preparation of plasmid DNA
Large scale isolation of plasmid DNA was performed using the PureLink™ HiPure
Maxi prep kit (Invitrogen, Paisley UK). Using a sterile pipette tip, a small portion of the
glycerol stock (-80˚C) was scraped and placed into a flask containing 200ml LB broth,
supplemented with the appropriate antibiotic (50μg/ml final concentration). Bacteria were
left to grow overnight for approximately 16 hours (stationary phase of growth) shaking at
37˚C. The overnight culture was centrifuged at 4000xg for 10 minutes and supernatant
64
medium was removed. Bacterial cells were resuspended in 10ml resuspension buffer (R3)
containing RNase A and transferred to a falcon tube. 10ml of lysis buffer (L7) were added
to the resuspended cells, gently mixed with the lysate by inversion of the tube and lysis was
allowed to proceed for 5 minutes at room temperature. 10ml of precipitation buffer (N3)
were subsequently added to the lysate which was mixed thoroughly before being loaded to
the HiPure Filter Maxi column; the column was previously equilibrated by addition of 30ml
EQ1 buffer to the inner filtration cartridge that was fitted into the Maxi column. The lysate
was left to run through the filter column by gravity flow until the flow became very slow.
The filtration cartridge was discarded and the filter column was washed with 50ml of wash
buffer (W8). After the washing step, plasmid DNA was eluted from the column by adding
15ml elution buffer (E4) and collected in a fresh tube (the composition of the baffers L7,
N3, EQ1, and W8 have not been released by the supplier Invitrogen). DNA was precipitated
with 10.5ml isopropanol and centrifugation at 12000xg for 30 minutes at 4 C. The
precipitated DNA pellet was resuspended in 5ml of 70% ethanol and pelleted again by
centrifugation at 12000xg for 5 minutes at 4 C. The pellet was air-dried for 10 minutes at
room temperature and dissolved in 500μl of TE buffer. The concentration of the extracted
DNA was measured with Nanodrop ND 1000 UV-Vis spectrophotometer and DNA was
stored at -20˚C for further use.
65
2.9 Molecular cloning and restriction analysis
Genomic sequences within the promoter regions of inflammatory genes that carry
multiple putative transcription factor binding sites (Figure 2.6) were cloned initially into
TOPO (Invitrogen, Paisley UK) and subsequently into pGL3 (Promega, Madison USA)
vectors.
Figure 2.6: Schematic depiction of the promoter regions of CXCR4 and TNF-α to be cloned
into pGL3 luciferase vector. Putative binding sites identified on each promoter are
highlighted in boxes, their position with reference point the translation start site (ATG) are
indicated below them and the positions of the forward and reverse primers is also indicated
with arrows.
66
2.9.1 Genomic DNA extraction
Genomic DNA from breast cancer cells was extracted using the GFX gemonic
blood DNA purification kit (Amersham Biosciences, Sweden). Up to 4 x 106
cells were
washed twice with PBS, harvested in PBS and pelleted by centrifugation at 13000 rpm for
30 seconds. Supernatant PBS was aspirated and cells were immediately resuspended by
vortexing in 500 μl of extraction buffer. Following a 5-minute incubation at room
temperature, the extraction mixture was transferred to a GFX column which was
centrifuged at 8000 rpm for 1 minute. The flow-through was discarded and the column was
washed once in 500 μl of extraction buffer at 8000 rpm for 1 minute and once in 500 μl of
wash buffer at 13000rpm for 3 minutes. Genomic DNA was eluted from the column by
addition of 200 μl of elution buffer/distilled water and centrifugation at 8000 rpm for 1
minute. Purified genomic DNA was stored at -20˚C.
2.9.2 TOPO cloning
TOPO plasmid vector (pCR-Blunt II-TOPO) provides a robust and efficient way of
optimizing the overall cloning procedure by allowing reproduction of the desired DNA-
insert at high quantities. TOPO cloning is based on the action of Vaccinia virus
topoisomerase I which binds double stranded DNA and cleaves the phosphodiester
backbone of one strand after 5’ CCCTT. At the linearized vector, topoisomerase I is bound
on the 3’ends and permits cloning of a PCR product due to the dominance of the bond
between the 5’ hydroxyl ends of the DNA product and the vector over the phospho-tyrosyl
bond between the vector and the enzyme.
Gemonic sequences of interest were amplified by PCR using high fidelity Phusion
polymerase, a thermostable polymerase that generates products with high accuracy and
speed. PCR reaction was set up as following: ~500 ng genomic DNA, 1x HF reaction
67
buffer, 0.2 mM dNTP's, 0.4 μM forward primer, 0.4 μM forward primer, DMSO to a final
concentration of 3%, 1 unit of Phusion polymerase, supplemented with ddH2O up to 50 μl
final reaction volume. The conditions for the PCR program used were 98˚C for 30 seconds,
30 cycles of 98˚C for 15 seconds followed by 66 ˚C for 30 seconds and 72˚C for 1 minute
and finally 72˚C for 10 minutes. Primers were designed to flank the region to be cloned
(Figure 2.6, Table 2.3), while 6-nucleotide tails that comprise the recognition sites for
restriction enzymes were added to their 5’ ends. KpnΙ and SacΙ restriction sites were chosen
because they form non-compatible ends after digestion. The PCR product was analysed on
low melting agarose gel and the band of the right size was excised and purified from salts,
enzymes etc. using the QIAquick gel extraction kit (QIAGEN, Sussex UK). DNA was
finally eluted in 40μl ddH2O.
Subsequently, the purified blunt-end products were ligated to TOPO vector (Zero
Blunt TOPO PCR Cloning Kit). 4μl of PCR product were mixed with 1μl of linear TOPO
vector, the reaction was supplemented with 1μl salt solution (as recommended by the
manufacturer) and incubated at room temperature for 15 minutes. The construct was
transformed into chemically competent E.coli cells (strain DH5a). Few colonies were
selected for isolation of plasmid DNA by minipreparation using QIAprep miniprep kit
(QIAGEN, Sussex UK). 20μl were used in restriction digestions to verify successful
cloning of the insert into TOPO vector.
2.9.3 Analysis with restriction digestions
Restriction analysis involves the use of restriction endonoucleases, enzymes that
cleave double stranded DNA at specific residues within a recognition sequence (restriction
site). KpnI, isolated from Klebsiella pneumoniae, recognizes the site 5’ -- GGTACC -- 3’
and cuts DNA between C residues, generating fragments with 3’ cohesive ends. Similarly,
SacI whose genomic source is Streptomyces achromogenes, recognizes the site 5’ –
GAGCTC – 3’ and cuts DNA after T residue.
A typical restriction digestion consisted of DNA (plasmid or amplification product)
up to 1 μg, 1x SuRE/Cut buffer (recommended for optimal activity of the enzyme is buffer
68
L for KpnI and buffer A for SacI), 1 unit of enzyme and distilled water. KpnI also required
addition of BSA at a final concentration of 100 μg/ml for enzymatic activity. Reactions
were incubated at 37 ˚C for 3 hours. Double digestions were performed either
simultaneously (both enzymes at the same reaction with the buffer L) or sequentially.
Restriction products were agarose gel purified using the QIAquick gel extraction kit.
Successful cloning of the insert (promoter region) into TOPO vector was verified by
restriction analysis, as shown in Figure 2.7, after mini preparation of plasmid DNA and the
indicated digestions.
Figure 2.7: Agarose gel (1%) showing the restriction analysis reactions that confirmed that
the cloning of the desired insert into TOPO vector was successful. Lane 1 represents the
DNA marker (HyperLadder™ Ι). The 1.4 kb fragment of CXCR4 promoter cut off TOPO
vector following single digestion with KpnI (lane 2), also indicative of reverse orientation
of the insert. Similarly, 1.4 kb fragment of TNF-α promoter after double digestion with
KpnI and SacI (lane 3)
69
2.9.4 pGL3 cloning
pGL3 is a luciferase reporter vector that allows the quantitative analysis of factors
regulating gene expression, for instance promoters and transcription factors. The pGL3
promoter vector which contains an SV40 promoter upstream of the luciferase gene was
used. The multiple cloning site of the vector (Figure 2.6) allows easy insertion of the
desired DNA fragment after appropriate restriction digestions of both the vector and the
fragment. KpnΙ and SacΙ restriction sites were chosen because they form non-compatible
ends after digestion. Restriction digestions were performed as previously described (chapter
2.9.3) and products were agarose gel purified before being ligated. Digested pGL3 vector
and DNA insert were ligated using T4 DNA ligase, an enzyme that catalyzes the formation
of phosphodiester bonds between neighbouring 3´-hydroxyl- and 5´-phosphate ends in
double-stranded DNA. The ligation reaction contained up to 1 μg DNA (vector and insert at
molecular ratios 1:2, 1:5), 1:10 of ligation buffer (10x), 3 units of T4 DNA ligase and
distilled water if needed. Ligations were incubated overnight at 4˚C or room temperature
and transformed into DH5α bacteria as previously described (chapter 2.8.1).
Different combinations of restriction enzyme digestions (single with KpnI or double
with both KpnI and SacI), molecular ratios (1:2, 1:5) and incubation temperature (4˚C or
room temperature) were tested and successful cloning was verified by restriction analysis
after minipreparation of plasmid DNA (Figure 2.8).
70
Figure 2.8: Agarose gel (1%) showing results for colony screening for CXCR4-pGL3
cloning. Lanes represent: (1) DNA ladder (HyperLadder), (2) 1:5 ratio, KpnI-SacI
digestion at 4°C (colony 1), (3) 1:5 ratio, KpnI-SacI digestion at 4°C (colony 2), (4) 1:5
ratio, KpnI-SacI digestion at RT (colony 1), (5) 1:5 ratio, KpnI-SacI digestion at RT
(colony 2), (6) 1:5 ratio, KpnI-SacI digestion at RT (colony 3), (7) 1:5 ratio, KpnI digestion
at 4°C (colony 1), (8) 1:5 ratio, KpnI digestion at 4°C (colony 2), (9) 1:2 ratio, KpnI
digestion at RT (colony 1); ratio refers to the molecular ratio vector:insert, temperature to
the ligation conditions. Successful cloning of the insert DNA (approximately 1.4 kb) is
shown in lanes (3) and (6) after restriction digestion of mini prep plasmid DNA.
2.10 Luciferase reporter assays
Luciferase reporter assays are commonly used in gene expression and function
studies. Their principle is based on the ability to assess the transcriptional
activity/regulatory potential of a genomic sequence of interest by linking it to a reporter
gene whose functionality is easily detectable (e.g: luciferase, beta-galactosidase,
chloramphenicol acetyltransferase). Coding regions, promoters as well as enhancer
71
elements may be used for constructing plasmids that also contain a reporter gene whose
expression can be measured by luminescence, fluorescence or absorbance.
The luciferase/luciferin system is a highly sensitive reporter assay system which linearly
correlates luciferase expression, and thus regulatory potential of the DNA insert, with
bioluminescence (light output). Firefly luciferase (Photinus pyralis) is an enzyme that
catalyzes the oxidation of D-luciferin (substrate) to oxyluciferin in the presence of
magnesium and ATP. The reaction also results in light emission that can be measured using
a luminometer.
The pGL3 luciferase reporter vector is a useful tool for quantifying the
transcriptional activity of genomic sequences via luciferase reporter assay. In our study, the
CXCR4 promoter region that carries potential responsive elements was inserted into the
pGL3 promoter vector as previously described (chapter 2.9.4). pGL3 promoter vector
contains the viral SV40 promoter upstream of the coding region for firefly luciferase and
allows easy insertion of the desired double stranded DNA sequence within its multiple
cloning region after restrictive digestions. Transfection of the construct to mammalian cells,
that lack endogenous luciferase activity, allows monitoring the expression levels/ regulatory
potential of the DNA of interest.
An important issue regarding reporter assays is the variability between samples
caused by factors other than those to be tested, for instance transfection efficiency, cell
toxicity, experimental errors. Normalization using a control allows diminishing such
variabilities and increases the validity of the data. A vector that encodes for a reporter
protein different from the one used in the construct and unaffected by the experimental
conditions can be co-transfected to the cells and used as a control. Beta galactosidase (β-
gal) is frequently used as control in luciferase reporter assays. Like luciferase, β-
galactosidase is an enzyme that catalyzes the hydrolysis of various β-galactosides including
ortho-Nitrophenyl-β-galactoside (ΟNPG). One of the hydrolysis products of ONPG, ortho-
nitrophenol, produces yellow color and can thus be used as a means of measuring β-
galactosidase activity by measuring the absorbance at 420nm (colorimetric assay). Once
both luciferase and β-galactosidase data are obtained, relative promoter activity of each
sample can be calculated by normalizing the luciferase (test) reporter activity to β-
galactosidase activity.
72
MCF-7 cells were split in 6-well plates the day before transfection so they would be
40-70% confluent on the day of transfection. Transfection was performed using Polyfect
(QIAGEN, Sussex UK) transfection reagent. 1.5μg of total plasmid DNA per well
(combination of pGL3 construct, β-galactosidase vector and other expressing vectors as
indicated) were mixed with DMEM medium containing no antibiotics/serum in a sterile
eppendorf tube, up to a final volume of 100μl. 8μl of Polyfect reagent were added to the
DNA solution, mixed well by vortexing for a few seconds and incubated at RT for 5-10
minutes for formation of complexes. 600μl of medium containing penicillin/streptomycin
and FBS were added to the complexes, mixed well and transferred to the cells in the well
that contains 2mls of medium. Plates were gently swirled to ensure uniform distribution of
the DNA comlpexes before being placed in the incubator for overnight incubation at 37 C,
5% CO2. Next day cells were treated with 250μM DSFX and incubated for 16 hours to
ensure gene expression under hypoxia mimicking conditions before being harvested for the
luciferase/beta-galactosidase assays.
Transfected MCF-7 cells and treated as indicated were washed twice in PBS and
PBS was aspirated before the addition of 100μl of 1x reporter lysis buffer (Promega) to
each well. Plates were left rocking for 30 minutes at RT before being scraped and cell
lysates were transferred in sterile eppendorf tubes. Insoluble material was removed by
centrifugation at 13000 rpm for 15 minutes at 4˚C. For the luciferase assay, 10μl of each
cellular lysate were transferred to luminometer tubes (Promega). 50μl of room temperature
luciferin were added to each tube, lysate and luciferin were well mixed by vortexing for a
few seconds and tubes were placed on the luminometer and the readings were recorded. For
each lysate, readings were performed in duplicates and consecutively. For the β-
galactosidase reading, 15-20μl of lysate were mixed with 300μl of assay buffer (200mM
sodium phosphate pH 7.3, 2 mM MgCl2, 100 mM β-mercaptoethanol, 4.415 mM ΟNPG)
and incubated at 37˚C for 30 minutes (or until the colour of the samples turned yellow).
500μl of distilled water were added to each sample and their absorbance was measured at
420nm using a spectrophotometer (Beckman DU640).
73
CHAPTER 3: RESULTS
3.1 Identification of putative hypoxia responsive elements within the
regulatory regions of the promoters of inflammatory genes
Given the fact that chronic inflammation and transcription factors such as p53 and
HIF-1α, the key mediator of the hypoxic response, are greatly implicated in cancer biology,
bioinformatics analysis was performed towards identifying putative DNA binding motifs
for various transcription factors within the regulatory regions of the promoters of multiple
cytokines and cytokine receptors in human. The genomic regions to be probed were defined
by first determining the translation start site (TSS) of each gene, as provided by NCBI
(www.ncbi.nlm.nih.gov) (protein and mRNA entries). Up to 10.000bp upstream of the site
that corresponds to the TSS were probed for the presence of putative responsive elements,
which revealed the presence of hypoxia responsive elements (HREs) within the CXCR4,
TNF-α and IL-10 promoters and some of them were conserved among species. The
identified DNA binding sites using this approach are indicated for each one of the above
mentioned genes in Figure 3.1. All numbers referring to putative responsive elements
throughout the thesis have been counted from the start codon which is not the same with the
trasnscription start site.
74
(A)
75
76
77
(B)
78
79
(C)
80
81
Figure 3.1: Identification of putative HREs within the regulatory regions of the promoters
of CXCR4 (A), TNF-α (B) and IL-10 (C). HREs are highlighted in blue, translation start site
ATG in red. NF-κB binding sites are highlighted in green, one AP-1 binding site in orange,
one YY1 binding site in light blue and one FOXO3α binding site in bold black.
3.2 CXCR-4, TNF-α and IL-10 mRNA expression pattern in DSFX and
etoposide treated breast cancer cells
HIF-1α plays a pivotal role in the transcriptional modulation within neoplastic cells,
thus regulating many cellular processes related to tumorigenesis including inflammation.
The presence of putative HREs within the promoters of the above mentioned genes
prompted us to study their expression under hypoxia mimicking conditions and explore
82
whether any variations occurred under these conditions in the presence or absence of
activated p53. In order to study the expression levels of CXCR4, TNF-α and IL10
quantitative real time PCR experiments (qRT-PCR) were performed as previously
described (chapter 2.6) using MCF-7 breast cancer cells treated with etoposide, DSFX or
combination of both chemicals for 6 hours.
CXCR4 gene expression is upregulated by hypoxia in breast cancer cells (69) and
suppressed in a p53 dependent manner (83). Solid tumors, such as breast cancers, bear
hypoxic fractions and are often treated with chemotherapeutics that cause DNA damage,
such as etoposide and other topoisomerase II inhibitors. The therapeutic effect of these
compounds is based on their ability to stimulate the p53 mediated apoptotic pathway. A
previous report from our laboratory along with published observations from other groups,
indicate that p53’s function differs significantly in a hypoxic compared to normoxic
environment (96, 156). In these terms, the expression pattern of CXCR4, a gene that is
targeted by both HIF-1α (69) and p53 (83) was followed in order to delineate the molecular
mechanisms involved in the regulation of the expression of this gene in conditions where
both p53 and HIF-1α were transcriptionally active. Quantitative real time PCR data showed
that CXCR4 expression level, measured and normalized as previously described (chapter
2.6), was averagely reduced by 50% in MCF-7 cells treated with etoposide compared to
untreated cells (Figure 3.2, compare bar 2 with bar 1 respectively). In agreement with the
observations reported by Schioppa et al.(69) indicating that CXCR4 is induced by hypoxia,
cells treated with the hypoxia mimicking agent DSFX exhibited approximately 1.7fold
higher CXCR4 gene expression compared to that in normoxic untreated cells (Figure 3.2,
compare bar 3 with bar 1 respectively). In MCF-7 cells treated with both etoposide and
DSFX, CXCR4 mRNA level was reduced compared to untreated cells by 30% (Figure 3.2,
compare bar 4 with bar 1), but was approximately 1.7 fold higher than in cells treated with
etoposide only (Figure 3.2, compare bar 4 with bar 2 respectively). Given that MCF-7 cells
bear wild type p53, the reduced CXCR4 levels observed in cells subjected to the combined
treatment relatively to the CXCR4 levels of DSFX treated cells (Figure 3.2, compare bar 4
with bar 3 respectively) imply a dominant p53 suppressive action over HIF-1α.
83
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
1.8
2
1 2 3 4
Re
lati
ve m
RN
A le
vels
Control Etop DSFX Etop+DSFX
CXCR4 expression (MCF-7)
Figure 3.2: CXCR4 mRNA levels in DSFX, etoposide and combination of etoposide and
DSFX treated MCF-7 cells. Graph shows CXCR4 mRNA levels measured in untreated,
etoposide, DSFX and both etoposide and DSFX treated cells normalized to Rpl19. The
relative CXCR4/Rpl19 mRNA level in the untreated cells was arbitrarily set to 1. Values
represent the mean of three independent experiments (95% CI) in which each point was
performed in duplicate.
Quantitative PCR was also performed in order to study IL-10’s expression pattern
under hypoxia mimicking conditions and DNA-damage stress in breast cancer cells. Our
data showed increased IL-10 expression level by almost 30% in etoposide treated MCF-7
cells compared to the expression level of untreated cells (Figure 3.3, compare bar 2 with bar
1 respectively). In DSFX treated MCF-7 cells, IL-10 mRNA level was also induced
compared to the expression level of untreated cells (Figure 3.3, compare bar 3 with bar 1
respectively) with the average induction ranging from almost 30% up to more than 2-fold
between different sets of experiments. In contrast, combination of etoposide and DSFX
treatment repressed IL-10 expression by approximately 40% comparatively to the basal
expression levels (Figure 3.3, compare bar 4 with bar 1 respectively).
84
Control Etop DSFX Etop+DSFX
IL-10 expression (MCF-7)
0
0.5
1
1.5
2
2.5
3
1 2 3 4
Re
lati
ve m
RN
A le
vels
Figure 3.3: IL-10 mRNA levels in DSFX, etoposide and combination of etoposide and
DSFX treated MCF-7 cells. Graph shows IL-10 mRNA levels estimated in untreated,
etoposide, DSFX and both etoposide and DSFX treated MCF-7 cells normalized to Rpl19
mRNA level. The relative IL-10/Rpl19 mRNA level in the untreated cells was arbitrarily set
to 1. Values represent the mean of two independent experiments (95% CI) in which each
point was performed in duplicate and the expression pattern amongst the applied treatments
is representative of three independent experiments.
Regarding TNF-α levels under hypoxia mimicking and DNA-damage mimicking
conditions in breast cancer cells, we observed that TNF-α expression was induced under all
stresses applied to MCF-7 cells compared to unstressed cells. Etoposide, DSFX and
combination of etoposide and DSFX treatment resulted in a 5 fold, 8 fold and 5.5 fold
induction of TNF-α mRNA levels respectively, compared to the expression levels of
untreated cells (Figure 3.4, compare bar 2 with bar 1, bar 3 with bar 1 and bar 4 with bar 1
respectively). Data obtained from a series of qRT-PCR experiments lacked consistency due
to insufficient amplification of the 10-fold diluted cDNA template of the standard reactions
and thus, inaccurate standard melting curves (discussed in chapter 2.6), hence the results
obtained from a single valid experiment are presented (Figure 3.4).
85
0
0.5
1
1.5
2
2.5
1 2 3 4
Re
lati
ve m
RN
A le
vels
Control Etop DSFX Etop+DSFX
TNF-α expression (MCF-7)
Figure 3.4: TNF-α levels in DSFX, etoposide and combination of etoposide and DSFX
treated MCF-7 cells. Graph shows TNF-α mRNA levels measured in untreated, etoposide,
DSFX and both etoposide and DSFX treated MCF-7 cells normalized to Rpl19 mRNA
level. The relative TNF-α/Rpl19 mRNA level in the untreated cells was arbitrarily set to 1.
Values represent the mean of a single experiment (95% CI) in which each point was
performed in duplicate.
3.3 HIF-1α recruitment to the HRE sites located within the regulatory
region of the CXCR4 and TNF-α promoters
CXCR4 and TNF-α mRNA levels followed by quantitative PCR experiments
suggested that gene expression in hypoxia mimicking conditions was under the control of a
hypoxia inducible factor. To investigate the possibility that this factor was HIF-1α as well
as to explore whether the HREs identified within the promoters of these genes (Figure 3.1)
86
were functional we performed ChIP assays (as previously described in chapter 2.7) using
HIF-1α antibody to precipitate HIF-1α chromatin immunocomplexes and primers flanking
the conserved putative HREs identified by bioinformatics analysis.
CXCR4 has been reported to be HIF-1α transcription target. In particular, HIF-1α
induces CXCR4 gene expression in cancer cells via its recruitment to CXCR4 promoter in
hypoxic conditions (69). However, given that etoposide treated MCF-7 cells in hypoxia
mimicking conditions exhibited lower CXCR4 mRNA levels compared to those observed in
cells treated with DSFX only (Figure 3.2, compare bar 4 with bar 3 respectively) and that
HIF-1α and p53 interfere with each other’s transcriptional activity (157, 158), we reasoned
that there should be a distinct mechanism coordinating the recruitment of HIF-1α to the
CXCR4 promoter in differentially treated MCF-7 cells. To test this hypothesis, we
performed ChIP experiments in MCF-7 cells treated with etoposide, DSFX or combination
of both and explored HIF-1α recruitment to a different HRE (Figure 3.1 A, comment k5)
from that assessed by Schioppa et al. and has already been reported to be functional in
hypoxic cells (69). Interestingly, we observed that this responsive element was functional
only in MCF-7 cells treated with both DSFX and etoposide as the anticipated 185bp PCR
product flanking the HRE of interest was present only in the cells subjected to combined
treatment (Figure 3.5 A, lane 8) whereas HIF-1α did not bind to this HRE in MCF-7 cells
treated with DSFX only (Figure 3.5 A, lane 7). Evidence for the specificity of the HIF-1α
antibody was provided by the fact that there was no 185bp PCR product present in the
mock IP (non-specific IgG antibody) samples (Figure 3.5 A, lanes 9-12). These findings
support the notion that the HIF-1α transcriptional complex recruited to the CXCR4
promoter in DSFX and etoposide treated MCF-7 cells was different from that present in
these cells treated only with DSFX. Moreover, the recruitment of HIF-1α within the
promoter of particular genes might be determined by the composition of the HIF-1α
transcription complex and in the case of genes such as CXCR4, that are transcriptional
targets of both HIF-1α and p53, transcriptional co-factors shared between HIF-1α and p53
[for instance SRC-1 (94, 95), p300 (159, 160) or PCAF (96)] might regulate the activity of
these transcription factors by preferential binding to one or the other transcription factor
under certain environmental conditions.
87
Figure 3.5: Functional analysis of the HREs present within CXCR4 and TNF-α promoters.
Chromatin immuno-complexes from untreated, etoposide, DSFX, or etoposide and DSFX
treated MCF-7 cells were precipitated using a specific HIF-1α (lanes 5 to 8) or an irrelevant
non specific antibody (lanes 9 to 12) as negative control. The pulled down DNA was
amplified with specific primers flanking the regions containing the HREs present in CXCR4
(A) and TNF-α (B) promoter. The resultant PCR products were then submitted to 2%
agarose gel electrophoresis.
Since TNF-α gene expression was induced in MCF-7 cells under hypoxia
mimicking conditions (Figure 3.4) ChIP experiments were carried out in these cells treated
with etoposide, DSFX or both to assess the functionality of the putative HRE located
6923bp upstream the translation start site of the TNF-α promoter (Figure 3.1 B, comment
k2). HIF-1α was recruited to the putative HRE site within the TNF-a promoter in DSFX
88
treated MCF-7 cells (Figure 3.5 B, lane 7) providing evidence that TNF-a induction in
hypoxia mimicking conditions was a result of direct HIF-1α mediated trans-activation.
Moreover, HIF-1α was recruited to the TNF-α promoter in MCF-7 cells treated with
combination of DSFX and etoposide (Figure 3.5 B lane 8) with higher binding affinity than
that exhibited in DSFX only treated MCF-7 cells (Figure 3.5 B, compare lane 8 with lane 7
respectively). These data provide evidence that both p53 and HIF-1α participate in the
regulation of TNF-α gene expression.
Finally, ChIP experiments performed to evaluate the functionality of the putative
HRE located 4537bp upstream of the translation start site within the IL-10 promoter (Figure
3.1 C, comment k4) in MCF-7 cells treated the same way as described in Figure 3.5 using
specific antibody against HIF-1α did not provide clear evidence for the involvement of
HIF-1α in the regulation of IL-10 gene expression (data not shown). Further investigation is
required to validate the role of HIF-1α in the induction of IL-10 gene expression in hypoxia
mimicking conditions (Figure 3.3).
3.4 Protein levels of CXCR4 in breast cancer cells
Based on the fact that the mRNA levels do not always match the protein levels in
eukaryotes (161) western blot analysis was performed to investigate whether CXCR4
protein levels followed the same pattern as that of mRNA levels under conditions of DNA-
damage, hypoxia mimicking and combination of the two stresses. Two breast cancer cell
lines (MCF-7 and MDA-MB-231) were used for this analysis as these two cell lines differ
in terms of p53 status (MCF-7 is p53+/+
while MDA-MB-231 is p53+/-
) and would provide
clearer picture of the effect of hypoxia mimicking and DNA-damage on CXCR4
expression.
Western blot analysis of the levels of chemokine receptor CXCR4 in wild type p53
MCF-7 cells revealed a different pattern of CXCR4 protein expression compared to that of
mRNA levels in DSFX and etoposide treated MCF-7 cells. Specifically, elevated CXCR4
protein levels were observed under all stresses (DNA-damage, hypoxia mimicking and
89
combination of the two) compared to non treated cells (Figure 3.6 A, compare CXCR4
lanes 2, 3, 4 to lane 1). Contrary to the trans-repressing mode of action of the DNA-
damaging agent etoposide observed for the CXCR4 mRNA levels (Figure 3.2), etoposide
upregulated CXCR4 at the protein level (Figure 3.6 A,compare lane 2 with lane 1).
Elevated CXCR4 protein levels were also evident in DSFX treated MCF-7 cells (Figure 3.6
A, compare lane 3 with lane 1). Notably, combination of DSFX and etoposide treatment
resulted in higher CXCR4 protein levels compared to those observed in cells treated
individually with either etoposide or DSFX (Figure 3.6 A compare lane 4 with lanes 2 or 3
respectively). HIF-1α was detectable only in the cellular extracts of the DSFX treated
samples (Figure 3.6 A lanes 3 and 4) while no HIF-1α protein was detected in the extracts
of normoxic MCF-7 cells (Figure 3.6 A lanes 1 and 2). p53 was detected in the extracts of
all four experimental conditions, and as expected it was induced in MCF-7 cells treated
with etoposide, DSFX and both (Figure 3.6 A lanes 2, 3, 4 respectively).
Densitometric analysis showed 1.75 fold, 2.7 fold and 3.6 fold increase of CXCR4
protein levels in etoposide, DSFX and both etoposide and DSFX treated MCF-7 cells
respectively compared to untreated cells (Figure 3.6 B compare bar 2 with bar 1, bar 3 with
bar 1 and bar 4 with bar 1 respectively).
90
Figure 3.6: Etoposide, DSFX and combination of etoposide and DSFX increased CXCR4
protein levels MCF-7 cells. Cellular extracts from cells treated with etoposide, DSFX or
both etoposide and DSFX were subjected to Western blot analysis (A). Data are
representative of three independent experiments. Relative protein levels of CXCR4 for each
treatment, normalized to endogenous β-actin levels, were analyzed by densitometry (B).
The intensity of the CXCR4 protein band normalized to that of β-actin in untreated cells
(control) was arbitrarily set to 1. Values represent the mean of three independent
experiments.
To further investigate the effect of DNA-damage and hypoxia-mimicking agents on
CXCR4 protein levels, we performed the same western blot analysis in breast cancer cells
that express high levels of mutated (280 G→A) p53 (MDA-MB-231) (162). MDA-MB-231
91
cells did not respond to etoposide the same way as the wild type p53 MCF-7 cells did
(compare Figure 3.7 A with Figure 3.6 A blots for 53), which is in accord with recently
published observations (163). Elevated CXCR4 protein levels were observed in etoposide
and DSFX treated MDA-MB-231 cells (Figure 3.7 A compare lanes 2 and 3 with 1
respectively) whereas combined etoposide and DSFX treatment of these cells resulted in
downregulation of the CXCR4 protein levels (Figure 3.7 A compare lane 4 with 1).
However, the fluctuations of the CXCR4 protein levels observed in MDA-MB-231 cells
were of smaller scale compared to those observed in MCF-7 cells. Densitometric analysis
revealed an average 1.25-fold and 1.5-fold increase of CXCR4 protein in etoposide and
DSFX treated MDA-MB-231 cells respectively compared to untreated cells (Figure 3.7 B,
compare bar 2 and 3 with bar 1 respectively) and an approximate 40% reduction of CXCR4
protein in cells subjected to the combined treatment compared to untreated cells (Figure 3.7
B, compare bar 4 with bar 1).
92
Figure 3.7: Etoposide and DSFX treatment increased CXCR4 protein levels whereas
combination of treatments reduced CXCR4 protein levels in MDA-MB-231 cells. Cellular
extracts from cells treated with etoposide, DSFX or both etoposide and DSFX were
subjected to Western blot analysis (A). Data are representative of three independent
experiments. Relative protein levels of CXCR4 for each treatment, normalized to
endogenous β-actin levels, were analyzed by densitometry (B). The intensity of the CXCR4
protein band normalized to that of β-actin in untreated cells (control) was arbitrarily set to
1. Values represent the mean of three independent experiments.
93
3.5 SRC-1 interacts with HIF-1α and p53 in MCF-7 cells
Eukaryotic gene transcription is a process orchestrated by an enormous number of
proteins that have the ability to form multi sub-unit complexes and tightly regulate
transcription in co-operation with the basal transcriptional machinery (164). Transcription
co-regulators, both activators and repressors, have emerged as important effectors in
transcriptional regulation by facilitating the connection between sequence-specific DNA
binding factors and the transcriptional machinery. Transcriptional regulation is largely
dependent on multiprotein complex formation between factors and co-regulators, such as in
the case of HIF-1α/p53 trans-activation by p300 (159, 160), recruitment of the p160/SRC-1
co-activator to the ARNT transcription complex (165) and coordination of HIF-1α-
mediated signaling by the complex HIF-1α/ARNT/CBP/SRC-1 (109). Steroid receptor co-
activators have gained significant attention in the context of breast cancer since their
interaction with estrogen receptors is implicated in tumor development and resistance to
therapy (102). Given that transcription factors usually require co-factors to act upon target
genes, we were interested to study the role of transcription co-factors in the regulation of
inflammatory genes and in particular the role of SRC-1 co-activator, which is
overexpressed in breast cancer and has been recently characterized as a strong, independent
predictor of cancer recurrence (166).
Initially, we aimed to confirm the physical interaction between SCR-1, HIF-1α and
p53 in the cell line we worked with. For this purpose immunoprecipitation experiments
were carried out in MCF-7 breast cancer cells treated with etoposide or DSFX. HIF-1α was
precipitated from cellular extracts using the specific antibody and the co-precipitated
proteins were analyzed by western blot. Probing for SRC-1 signified interaction between
HIF-1α and SRC-1 in DSFX treated MCF-7 cells (Figure 3.8 A, SRC-1, lane 4). The fainter
band appearing at the molecular size of SRC-1 for the IP sample in untreated cells (Figure
3.8 A lane 3) is non-specific as HIF-1α was not detected in the input of untreated normoxic
cells (Figure 3.8 A lane 1).
In a similar way as for HIF-1α, p53 was precipitated from cellular extracts of
untreated, etoposide or DSFX treated MCF-7 using a specific antibody against this
transcription factor. SRC-1 coprecipitated with p53 under all three experimental conditions
94
applied: no stress, DNA-damage and hypoxia mimicking (Figure 3.8 B, SRC-1, lanes 4, 5,
6 respectively). The affinity of the interaction between SRC-1 and p53 appeared to be
higher in unstressed cells compared to those treated with etoposide or DSFX as well higher
in those cells treated with etoposide compared to the DSFX treated (Figure 3.8 B, compare
p53 lanes 5, and 6 to the respective SRC-1 lanes 5 and 6).
Interaction between HIF-1α and p53 in MCF-7 cells has been previously reported
(158) and was verified for the experimental conditions used in this study. In particular,
endogenous p53 coprecipitated with HIF-1α in DSFX treated MCF-7 cells (Figure 3.8 A,
p53, lane 4) and HIF-1α was found in complex with p53 in immunoprecipitation
experiments performed in DSFX treated MCF-7 cells using specific antibody against p53
(Figure 3.8 B, HIF-1α, lane 6).
Figure 3.8: Western blot analysis of anti-HIF-1α (A) and anti-p53 immunoprecipitated
complexes (B) carried out in untreated (A, lane 3 and B, lane 4) etoposide (B, lane 5) and
DSFX treated (A, lane 4 and B, lane 6) MCF-7 breast cancer cells.
95
3.6 SRC-1 and SIRT-1 affect CXCR4 gene expression in hypoxia
mimicking conditions
SRC-1 is a HIF-1 transcriptional coactivator in normoxic and hypoxic cells
(95,109). SIRT-1 deacetylase, has been proposed to exert opposing to SRC-1 effects in
androgen receptor signaling in prostate cancer cells (167), and has also been linked to
hypoxia-mediated transcription; resveratrol, a well estbalished SIRT-1 activator (168) was
shown to inhibit hypoxia-mediated induction of HIF-1α and VEGF (169). Given the
functional and physical interplay of SRC-1 and SIRT -1 with HIF-1α (95, 109, 122), the
identification of multiple putative HREs in the regulatory region of the CXCR4 promoter
triggered our interest to investigate the effect of those two factors on the activity of CXCR4
promoter in hypoxic breast cancer cells. To assess the role of SRC-1 and SIRT-1 on CXCR4
promoter activity under hypoxia mimicking conditions, we performed luciferase reporter
assays in MCF-7 cells transfected with the CXCR4-luc reporter construct (chapter 2.9
region of CXCR4 promoter that carries five HREs) and exogenously expressing either SRC-
1 or SIRT-1 under normoxic or hypoxia mimicking conditions.
Normoxic untreated MCF-7 breast cancer cells transfected with SIRT-1 exhibited a
repressive effect of CXCR4 luciferase reporter activity compared to cells transfected with
the empty vector pcDNA3 (Figure 3.9 , compare bar 1 with bars 2, 3, 4). Increasing
amounts of exogenously expressed SIRT-1 gradualy increased the reduction of CXCR4
luciferase reporter activity, providing evidence that SIRT-1 deacetylase modulates the
activity of CXCR4 luciferase reporter. Specifically, exogenous expression of 0.25 μg, 0.5
μg and 0.75 μg led to an average reduction of 30%, 43% and 54% of the reporter activity in
normoxic MCF-7 cells respectively compared to the activity of the reporter in pcDNA3
transfected cells (Figure 3.9 compare bars 2, 3, 4 to 1 respectively).
In order to assess the role of hypoxia on the effect of SIRT-1 on CXCR4 luciferase
reporter activity, we conducted the same experiments in MCF-7 cells treated with the
hypoxia mimicking agent DSFX. DSFX treatment of MCF-7 breast cancer cells exerted the
same pattern of reduced CXCR4 luciferase reporter activity that was observed in their
untreated counterparts. Similarly, increasing amounts of exogenously expressed SIRT-1
gradually reduced the CXCR4 luciferase reporter activity. 0.25 μg, 0.5 μg and 0.75 μg of
96
exogenously expressed SIRT-1 resulted in 27%, 34% and 47% reduction of reporter
activity, respectively (Figure 3.9 compare bars 6, 7, 8 with bar 5 respectively). However,
CXCR4 luciferase reporter avtivity of cells transfected with either SIRT-1 or empty vector
(pcDNA3) was notably lower under hypoxia mimicking conditions compared to normoxia
(Figure 3.9 compare bars 5-8 with 1-4 for hypoxia mimicking and normoxia respectively).
This finding might reflect the existence of a hypoxia responsive factor that exarcebates the
repressive effect of SIRT-1 on CXCR4 luciferase reporter activity in hypoxia mimicking
conditions.
Figure 3.9: SIRT-1 has a repressive effect on CXCR4 luciferase reporter activity in
untreated or DSFX treated MCF-7 cells. Relative luciferase activity of CXCR4–luc reporter
(5 HREs) is reduced in MCF-7 cells transfected with increasing amounts of Flag-SIRT-1
expression vector compared to cells transfected with the empty (pcDNA3) vector. Values
represent the means of three independent experiments. The relative luciferase activity of the
CXCR4–luc reporter in untreated cells transfected with pcDNA3 was arbitrarily set to 100
units after normalization to β-galactosidase activity.
97
In an attempt to shed light on the effect of SRC-1 on CXCR4 gene expression,
luciferase reporter assays were performed in MCF-7 cells transfected with the CXCR4
luciferase reporter together with an SRC-1 expression vector. Exogenously expressed SRC-
1 reduced the CXCR4 luciferase reporter activity in untreated MCF-7 cells (Figure 3.10
compare bars 2, 3, 4 with bar 1). However, the suppression trend due to SRC-1 transfection
in normoxic untreated cells was reverse compared to SIRT-1’s suppression trend;
increasing amounts of exogenous SRC-1 relieved the suppression on CXCR4 luciferase
reporter activity. Overall, an average reduction of 20%, 16% and 4% reporter activity
compared to pcDNA3 transfected cells’ reporter activity was observed when 0.25 μg, 0.5
μg and 0.75 μg SRC-1 were exogenously expressed, respectively (Figure 3.10 compare bars
2, 3, 4with bar 1).
An overall decrease of CXCR4 luciferase reporter’s activity of pcDNA3 and SRC-1
transfected cells was also observed under hypoxia mimicking conditions (Figure 3.10
compare bars 1-4 with bars 5-8). Within the DSFX treated samples, we observed an average
9% and 5% reduction of reporter activity when 0.25 μg and 0.5 μg SRC-1 were
exogenously expressed respectively compared to the reporter avtivity of pcDNA3
transfected cells (Figure 3.10 compare bars 6, 7 with bar 5). On the contrary, 0.75 μg of
exogenously expressed SRC-1 enhanced CXCR4 luciferase reporter activity by 15%
compared to the reporter activity of cells transfected with the empty vector pcDNA3
(Figure 3.10 compare bar 5 with bar 8). Thus, it appears that increasing amounts of SRC-1
tend to reverse the suppressive effect of DSFX on the CXCR4 luciferase reporter activity.
It is worth mentioning that internal normalization is paramount when performing
transient expression experiments. Although in the present study the increasing amounts of
exogenously expressing constructs were verified by WB analysis in most cases (e.g: figure
3.9, blot for Flag SIRT-1), a more definite evaluation of the role of both SIRT-1 and SRC-1
in CXCR4 luciferase reporter expression would arise from luciferase experiments where the
expression of transfected expression vectors is quantified using real time PCR. Such
improvements would potentially allow us to define the dose-dependent effect of the afore-
mentioned transcriptional regulators in the activity of the CXCR4 promoter region under
study.
98
Figure 3.10: SRC-1 has a mild repressive effect on CXCR4 luciferase reporter activity in
untreated MCF-7 cells which tends to reverse in DSFX treated MCF-7 cells. Relative
luciferase activity of CXCR4–luc reporter (5 HREs) is reduced in MCF-7 cells transfected
with increasing amounts of HA-SRC-1 expression vector compared to cells transfected with
the empty (pcDNA3) vector.Values represent the means of three independent experiments.
Relative luciferase activity of the CXCR4–luc reporter in untreated cells transfected with
pcDNA3 was arbitrarily set to 100 units after normalization to β-galactosidase activity.
3.7 Effect of SRC-1 and SIRT-1 on CXCR4 protein levels
Having observed the effect of SRC-1 and SIRT-1 on a specific CXCR4 promoter
region activity and in order to have a better perception of the involvement of SIRT-1 and
SRC-1 in the modulation of CXCR4 expression, we assessed CXCR4 protein levels in
99
untreated, etoposide and DSFX treated cells exogenously expressing those regulators.
Western blot analysis was performed for MCF-7 breast cancer cells transfected with the
SIRT-1/SRC-1 expression vector under hypoxia mimicking conditions, DNA-damage
mimicking conditions and combination of two treatments. CXCR4 protein expression of
each sample was compared to that of reference samples (lysates from cells transfected with
the empty vector pcDNA3).
Our data indicate that exogenously expressed SRC-1 altered the CXCR4 protein
levels in MCF-7 cells (Figure 3.11 A and B). SRC-1 caused an average 50% increase of
CXCR4 protein in untreated normoxic cells (Figure 3.11 B, compare blue bar 1 to grey bar
1). In a similar way, etoposide treatment increased the CXCR4 protein levels by 40% in
SRC-1 exogenously expressing cells compared to pcDNA3-transfected cells (Figure 3.11 B,
compare blue bar 2 to grey bar 2). In contrast, decreased by 29% CXCR4 protein levels
were observed in DSFX treated MCF-7 cells over-expressing SRC-1 compared to non-
transfected cells (Figure 3.11 B, compare blue bar 3 with grey bar 3). Combination of
etoposide and DSFX treatment in SRC-1 exogenously expressing cells reduced CXCR4
protein levels by 16% compared to cells transfected with pcDNA3 under the same
conditions (Figure 3.11 B compare blue bar 4 with grey bar 4).
100
Figure 3.11: SRC-1 reduces CXCR4 protein levels in DSFX treated MCF-7 cells. Western
blot analysis (A) of SRC-1-HA tagged transfected MCF-7 cells showing the levels of
endogenous CXCR4 in unstressed and stressed cells, endogenous β-actin levels as a protein
loading reference and levels of HA-tag as a verification of transfection. The expression
pattern is more obvious after densitometric analysis (B) of independent experiments (bar 1
is the mean value of three experiments, while bars 2, 3, 4 are mean values of two
experiments).
.
Transfection of MCF-7 cells with SIRT-1 increased CXCR4 protein levels in
untreated cells but reduced CXCR4 protein levels in cells treated with etoposide, DSFX and
combination of them compared to untransfected cells. Exogenously expressed SIRT-1
conferred an almost 2-fold increase in unstressed breast cancer cells compared to pcDNA3
transfected cells (Figure 3.12 B compare blue bar 1 with grey bar 1). However in etoposide,
DSXF and etoposide and DSFX treated cells, SIRT-1 decreased CXCR4 protein levels by
19%, 34% and 43% respectively, compared to pcDNA3 transfected MCF-7 cells (Figure
3.12 B compare blue bar 2 with grey bar 2, blue bar 3 with grey bar 3 and blue bar 4 with
grey bar 4 respectively). Densitometric analysis of a single representative experiment
(corresponding to Figure 3.12 A) is presented in Figure 3.12 B. Transfection of SIRT-1 was
confirmed by detection of the exogenously expressed protein with the Flag antibody (Figure
3.12 A).
101
Figure 3.12: SIRT-1 reduces CXCR4 protein levels in etoposide and DSFX treated MCF-7
cells. Western blot analysis (A) of SIRT-1-Flag tagged transfected MCF-7 cells showing
the levels of endogenous CXCR4 in unstressed and stressed cells, endogenous β-actin
levels as a protein loading reference and levels of Flag-tag as a verification of tranfection.
The expression pattern is more obvious after densitometric analysis (B) of a single
experiment representative of two independent experiments exhibiting the same expression
pattern but significant deviations of the induction/repression percentages.
102
CHAPTER 4: DISCUSSION
Inflammation is the protective innate immune response to infection, injury, or tissue
damage. Although the purpose of the inflammatory reaction is to allow cells of the immune
system to accumulate in the area of infection, defend the body from the invasion of
pathogens and initiate the process of tissue repair, various inflammatory factors associated
with chronic inflammation could lead to a range of pathological conditions including cancer
(5). Several studies have indicated that perturbations of the inflammatory response increase
the likelihood of pathogenesis in diseases related to metabolism, auto-immunity, and
malignant transformation (43, 51, 170, 171,172). Accumulated evidence supports the
important role of the pro-inflammatory cytokines such as IL-1β in obesity, diabetes and
atherosclerosis (170, 173), as well as (TNF)-α and interleukin (IL)-6 in tumorigenesis (51,
30). Therefore the regulation of the cytokine levels is essential for these diseases as aberrant
activation of pro-inflammatory or compromised function of anti-inflammatory cytokines is
a crucial parameter for pathogenesis. In these terms signaling pathways mediated by
inflammation responsive transcription factors such as NF-κB, HIF-1α and p53 play
important role in linking inflammation and disease.
Numerous studies have established a fundamental connection between chronic
inflammation and predisposition to certain types of cancer. For example breast cancer is
characterized by increased recruitment of TAMs within the tumor and elevated secretion of
pro-inflammatory (IL-1, TNF-α, IL-6) or anti-inflammatory cytokines (IL-10) chemokines
and chemokine receptors (CXCL8, CXCR4) and angiogenic molecules (VEGF)
(36, 50). This network of pro-inflammatory components rivals the inhibitory effect of the
anti-inflammatory cytokines (IL-4) on the growth of breast cancer cells (174) and promotes
cell proliferation, tumorigenesis and metastasis (36). Thus, it is clear that studying the
regulation of the expression levels and activity of cytokines and cytokine receptors is
important for understanding the pathways that promote cancer progression.
103
Key mediators of cancer related inflammation are several transcription factors such
as HIF-1α, the principal mediator of the cellular adaptation to hypoxia which is a common
feature of solid tumors (69), and the potent tumor promoter NF-κB whose transcriptional
activity accounts for the expression of multiple cytokines thereby establishing a pro-
inflammatory environment (46). HIF-1 and NF-κB act synergistically promoting the
expression of pro-inflammatory, pro-angiogenic and pro-survival molecules thus converting
pro-inflammatory into oncogenic signals by transactivating gene expression of genes
involved in angiogenesis, metastasis and metabolic switch (VEGF, GLUT-1, Epo) (43,
175). On the other hand, the stress responsive tumor suppresor protein p53 restrains
neoplastic transformation via its pro-apoptotic and anti-proliferative function (66, 69, 86).
HIF-1α induces CXCR1 and CXCR2 gene expression in prostate cancer cells (176)
and CXCR4 in breast and ovarian cancer cells (69). Upregulation of CXCR4 enhances
metastasis and its overexpression is a poor prognostic indicator in breast cancer patients
(40). HIF-1α is recruited on the CXCR4 promoter region and upregulates the levels of this
highly potent metastatic chemokine receptor in cancer cells (69). In line with these studies,
a 1.7 fold induction of CXCR4 mRNA levels were observed in DSFX treated MCF-7 breast
cancer cells compared to those determined in normoxic conditions (Figure 3.2).
Furthermore, the inflammatory genes IL-10 and TNF-α were upregulated in hypoxia
mimicking conditions (Figure 3.3 and 3.4). In particular, a 2- and 8-fold induction of IL-10
and TNF-α mRNA levels respectively were detected in DSFX treated versus untreated
normoxic cells. HIF-1α and NK-κB mediated pathways upregulating the pro-inflammatory
TNF-α levels has been documented in hypoxic macrophages (144) but the finding that TNF-
α is upregulated in epithelial cancer cells via the same signaling pathways provides an
additional indication that inflammation and cancer are closely linked (71, 177).
The p53 tumor suppressor is defective in the majority of human malignancies (73)
and this in combination with the chronic infammatory environment present in tumor tissues
exacerbates the oncogenic outcome (178, 179, 180). Komarova and colleagues observed
upregulation of several pro-inflammatory cytokines and chemokines in p53 null mice (181).
In agreement with these observations reduced CXCR4 and IL-10 gene expression was
detected in MCF-7 breast cancer cells treated with combination of the chemotherapeutic
drug etoposide and the hypoxia mimicking agent DSFX compared to those measured in
104
untreated cells (Figures 3.2 and 3.3). These results are in accord with previously published
reports (157) indicating that etoposide treatment counteracts hypoxia’s transactivating
effect on the expression of inflammatory genes (Figures 3.2, 3.3 and 3.4 compare bars 3 to
bars 4).
HIF-1α and p53 transcription factors functionally crosstalk at various levels. In
particular HIF-1α has been shown to protect p53 protein from degradation (158, 182), while
p53 promotes HIF-1α degradation in hypoxic cells (157, 183) providing a possible
explanation for the clonal selection and expansion of neoplastic cells bearing mutated p53
(184). Results presented in Figures 3.2, 3.3 and 3.4 showing CXCR4, IL-10 and TNF-α
downregulation in etoposide and DSFX treated compared to DSFX only treated cells
(Figure 3.2, 3.3 and 3.4 compare bars 4 to bars 3) prompted us to investigate the HIF-1α
recruitment to the regulatory regions of the promoters of these genes. We observed that
HIF-1α exhibited higher binding affinity for the TNF-α and CXCR4 promoter HREs in cells
treated with combination of DSFX and etoposide compared to those treated with DSFX
alone (Figure 3.5 A and B compare lanes 8 to lanes 7). Notably, the hypoxia responsive
element within CXCR4 promoter occupied by HIF-1α in DSFX and etoposide and not
DSFX only treated breast cancer cells is different from the one reported in human ovarian
cancer cells CAOV3 by Schioppa et al. (69). One possible explanation for the selective
recruitment of HIF-1α to the CXCR4 promoter only in cells treated with both DSFX and
etoposide is the differential recruitment of co-factors to HIF-1α and/or HIF-1α post-
translational modifications. In addition, since CXCR4 repression is mediated via a p53-
repressible AP-1 element present within its promoter (83) next to the HRE (Figure 3.1 A),
p53 might release p300 from the AP-1 element as part of the transrepresion process and
increase the availability of this co-activator for HIF-1α. Nevertheless, further quantitation
of the observed selective recruitment of HIF-1α by qPCR is required in order to solidify our
data and gain a better understanding of HIF-1α's recruitment on the promoters of
inflammatory genes under the applied stresses.
The CXCR4 mRNA levels observed in etoposide and DSFX treated MCF-7 cells
are in line with previously published reports indicating CXCR4 induction in p53 defective
(83) and hypoxic breast cancer cells (69) (Figure 3.2). We further assessed the role of
etoposide treatment on the CXCR4 protein levels in DSFX treated cells and observed that
105
there was a weak correlation between CXCR4 mRNA and protein levels. In wild type p53
MCF-7 cells combination of DSFX with etoposide treatment enhanced the CXCR4 protein
levels (Figure 3.6 B compare bar 4 with bar 1) whereas in contrast in MDA-MB-231 cells
submitted to the same treatment CXCR4 protein levels were reduced to half (Figure 3.7 B
compare bar 4 to bar 1). This reduction in CXCR4 protein levels in MDA-MB-231 cells
might reflect the ability of mutated p53 to block HIF-mediated transactivation (157).
Although the homozygous p53 mutation present in MDA-MB-231 is not expected to affect
p53’s involvement in CXCR4 regulation as suggested by the luciferase reporter assays (83),
high levels of mutated p53 (Figure 3.7 blot for p53) interfered with HIF-1α's contribution to
CXCR4 protein upregulation in DSFX treated MDA-MB-231. HIF-1α and p53 are
components of the same transcription complexes (Figure 3.8 B, 158) and p53 mutations in
MDA-MB-231 cells or post-translational modifications of either p53 or HIF-1α
differentially regulate the transcriptional activity of each other under diverse types of stress
thereby determining the CXCR4 protein levels in DSFX treated breast cancer cells.
Several lines of evidence highlight the importance of co-factors’ function in
regulating HIF-1α's and p53’s responses in hypoxic cells. Previous work from our
laboratory has shed light into the molecular mechanisms underlying the regulation of action
of both p53 and HIF-1α by co-factors in cancer cells by identifying PCAF as a crucial
mediator of p53’s activity in hypoxic cancer cells (96). PCAF, p300 and SCR-1 are
transcription co-factors harboring HAT activity that modulate the transcriptional activity of
both HIF-1α and p53 individually or co-operatively (100, 96, 109). SRC-1 plays a crucial
role in breast oncogenesis as transcriptional co-activator of estrogen receptor (102). SRC-1
was also found to interact with both p53 and HIF-1α in MCF-7 breast cancer cells (Figure
3.8).
To investigate the potential role of common transcriptional cofactors for HIF-1α and
p53 in the TNF-α and CXCR4 gene expression in breast cancer, the SRC-1 binding affinity
for p53 was followed under DNA-damage and hypoxia mimicking conditions. As it is
evident in Figure 3.8 higher binding affinity of SRC-1 for p53 was observed in cells treated
with DSFX than in those treated with etoposide. Post-translational modifications may
account for this effect. SRC-1 and p300/CBP interact with the animo-terminal domain of
p53 (94,159) which is phosphorylated at Ser 15 in response to etoposide treatment (156).
106
This modification might preferentially enhance the binding of p300/CBP to p53 and at the
same time displace SRC-1 from the complex with p53. In DSFX treated cells, p53 localizes
both in the cytoplasm and the nucleus (185) suggesting that the weak interaction observed
between SRC-1 and p53 in DSFX-treated MCF-7 cells (Figure 3.8) might be due to the
nuclear localisation of SRC-1 in hypoxic conditions (109).
SRC-1 has been shown to induce breast cancer cell proliferation and metastasis by
regulating the CXCR4 ligand expression (186). To further investigate the role of the SRC-1
in the differential regulation of the CXCR4 gene expression mediated by HIF-1α and p53 in
diverse types of cellular stress, a luciferase reporter containing a region of the CXCR4
promoter bearing five HREs was constructed (Figure 2.9). Although exogenously expressed
SRC-1 exerted a modest trans-repressive effect on CXCR4 luciferase reporter activity in
both untreated and DSFX treated MCF-7 cells (Figure 3.10, compare bar 1 with bar 2 and
bar 5 with bar 6), increasing amounts of SRC-1 tended to reverse this repression (Figure
3.10, compare bars 1 and 4 with bars 5 and 8 respectively). The presence of binding sites
for the transcription factors AP-1 and YY1 within the CXCR4 reporter (Figure 3.1 A) might
affect the activity of CXCR4 luciferase reporter. Although the role of YY1 in the regulation
of CXCR4 expression is still ambigious (187, 188), this factor could play a role in the
marginal suppression of CXCR4 reporter activity (188). In cells expessing high levels of
SRC-1, this cofactor either directly or in co-operation with HIF-1α (Figure 3.10, bar 8)
transcactivates AP-1 (189, 190) reversing the repression observed in untreated cells.
More solid indications concerning the role of SRC-1 in CXCR4 regulation arose
from studies of its protein levels in MCF-7 cells. We observed that although exogenous
SRC-1 induced CXCR4 protein levels in normoxic and etoposide treated MCF-7 cells, it
exerted a repressive effect in the MCF-7 cells treated with DSFX (Figure 3.11). Although
SRC-1 is widely accepted as a transcriptional co-activator in some cases co-repressive
potential has been reported (191). Therefore the modulatory effect of SRC-1 might depend
on environmental conditions or cellular needs. Interestingly SRC-1 and hypoxia induce the
CXCR4 ligand, SDF-1α, gene expression in human solid cancer cells (186, 192), suggesting
that in hypoxia mimicking conditions the negative regulation of the CXCR4 protein levels
might indicate the existence of an autoregulatory loop (193), a hypothesis requiring further
investigation.
107
To gain further insight in the regulation of the CXCR4 expression in MCF-7 cells,
we were interested to assess the role of a transcriptional regulator that usually exerts the
opposite functions of those of SRC-1. To this direction we studied the role of the NAD+
dependent deacetylase SIRT-1 which through its intrinsic HDAC activity represses the
transcriptional activity of both HIF-1α and p53 (122, 194). In agreement with the known
pattern of SIRT-1 activity, exogenously expressed SIRT-1 reduced CXCR4 protein levels
and CXCR4 luciferase reporter activity in DSFX treated MCF-7 cells (Figure 3.12 and 3.9
respectively). The presence of a FOXO3α responsive element within the CXCR4 luciferase
reporter region (Figure 3.1 A comment k10) suggests that a potential interplay between
SIRT-1 and FOXO3a enhanced the repressive effect of the former on the CXCR4 reporter
activity in DFSX treated cells, since both SIRT-1 and FOXO3a modulate HIF-mediated
transcription (122, 195). Moreover, in MCF-7 cells treated with either etoposide alone or
with combination of etoposide and DSFX, SIRT-1 overexpression reduced CXCR4 protein
levels compared to non transfected cells in the same conditions (Figures 3.12, 3.9). In these
terms it appears that SIRT-1 acts as an anti-cancer agent since it decreases CXCR4 aberrant
expression in MCF-7 cells under hypoxia mimicking and DNA-damage conditions allowing
the hypothesis that SIRT-1 inhibitors used as anti-cancer therapeutics (116) in this context
would probably not prove beneficial in targeting CXCR4 in breast cancer cells.
To conclude, in an attempt to provide additional mechanistic insights of molecular
pathways that contribute to breast cancer progression via cancer-related inflammation we
evaluated the roles of HIF-1α and p53 transcription factors in the regulation of the
expression of inflammatory cytokines. We observed that the chemotherapeutic drug
etoposide, whose function is based on p53-dependent transactivation, compromises the
inductive effect of hypoxic stress on CXCR4, TNF-α and IL-10. As part of a larger
transcriptional protein comlpex, p53 functionally interplays with HIF-1α in hypoxic cells
and we speculate that this is also the case for CXCR4 and TNF-α since stabilized p53
(Figure 3.6, blot for p53) promotes recruitment of HIF-1α to the promoters of those genes
in DSFX treated MCF-7 cells (Figure 3.5). In addition we observed that wt p53 also
mediates CXCR4 protein induction in hypoxic breast cancer cells despite its opposite role at
the mRNA level. Further investigation of the role of the common HIF-1α and p53
transcriptional co-factor SRC-1 would elucidate the contribution of this cofactor in CXCR4
108
expression under diverse stress conditions. The expression pattern of the highly potent
metastatic chemokine receptor CXCR4 should be also investigated in other breast cancer
cells lines with higher metastatic potential than MCF-7 cells (196).
109
REFERENCES
1. Vogelstein B. and Kinzler K.W. (2004). Cancer genes and the pathways they
control. Nature Medicine 10, 789 – 799
2. Hanahan D. and Weinberg R.A. (2000). The hallmarks of cancer. Cell 100, 57–70
3. Rakoff-Nahoum S. (2006). Why cancer and inflammation? Yale Journal of
Biology and Medicine 79, 123-130
4. Dvorak H.F.(1986). Tumours: wounds that do not heal. Similarities between
tumour stroma generation and wound healing. N Engl J Med. 315, 1650-1659.
5. Balkwill F. & Mantovani, A. (2001). Inflammation and cancer: back to Virchow?
Lancet 357,539–545
6. Thun M.J., Henley S.J., Gansler T. (2004). Inflammation and cancer: an
epidemiological perspective. Novartis Found Symp. 256:6-21, discussion 22-
8,49-52, 266-9
7. Kuper H., Adami H.O. and Trichopoulos D. (2000). Infections as a major
preventable cause of human cancer. Journal of Internal Medicine 248, 171-183.
8. Allavena P., Garlanda C., Borrello M.G., Sica A. and Mantovani A. (2008).
Pathways connecting inflammation and cancer. Curr Opin Genet Dev. 18, 3-10.
9. Yoshimura A. (2006). Signal transduction of inflammatory cytokines and
tumour development. Cancer Science 97, 439-447.
10. Linnemeyer P.A. The immune system- An overview. 2008
11. Ferrero-Miliani L., Nielsen O.H., Andersen P.S. and Girardin S.E. (2007).
Chronic inflammation: importance of NOD2 and NALP3 in interleukin-1β
generation. Clin Exp Immunol 147, 227-235.
12. Lowry S.F. (1993). Cytokine Mediators of Immunity and Inflammation. Arch
Surg. 128, 1235-1241.
13. Yamaoka K., Saharinen P., Pesu M., Holt Vance E.T III, Silvennoinen O. and
O’Shea J.J. (2004). The Janus kinases (Jaks). Genome Biol. 5, 253
110
14. Hassan H.T., Zander A. (1996). Stem cell factor as a survival and growth factor
in human normal and malignant hematopoiesis. Acta Haematol. 95, 257–262
15. Kollet O., Dar A., Shivtiel S. et al (2006). Osteoclasts degrade endosteal
components and promote mobilization of hematopoietic progenitor cells. Nat
Med. 12,657–664.
16. http://www.copewithcytokines.de/: Cytokines & Cells Online Pathfinder
Encyclopedia, by Prof Dr H Ibelgaufts (2010)
17. Feghali C.A. and Wright T.M.(1997).Cytokines in acute and chronic
inflammation. Frontiers in Bioscience 2, 12-26.
18. Hanada T. and Yoshimura A. (2002). Regulation of cytokine signaling and
inflammation. Cytokine Growth Factor Rev. 13, 413-21.
19. Mantovani A., Sozzani S., Locati M., Allavena P., Sica A. (2002). Macrophage
polarization: tumour-associated macrophages as a paradigm for polarized M2
mononuclear phagocytes. Trends Immunol, 23, 549-555
20. Hadden J.W.(2003). Immunodeficiency and cancer: prospects for correction.
Int Immunopharmacol 3, 1061-1071.
21. Weigert A., Tzieply N., von Knethen A., Johann A.M., Schmidt H., Geisslinger
G. and Brüne B.(2007 ). Tumour Cell Apoptosis Polarizes Macrophages—Role
of Sphingosine-1-Phosphate. Mol Biol Cell 18, 3810-3819.
22. Bingle L., Brown N.J. and Lewis C.E. (2002).The role of tumour-associated
macrophages in tumour progression: implications for new anticancer therapies.
J. Pathol. 196, 254-265.
23. Lin W.W. and Karin M. (2007). A cytokine-mediated link between innate
immunity, inflammation, and cancer. J Clin Invest. 117,1175–1183.
24. Allavena P., Garlanda C., Borrello M.G., Sica A. and Mantovani A. (2008).
Pathways connecting inflammation and cancer. Current opinion in genetics and
development 18, 3-10.
25. Chavey C., Bibeau F. , Gourgou-Bourgade S., Burlinchon S., Boissière F.,
Laune D., Roques S. and Lazennec G.(2007). Estrogen-receptor negative breast
cancers exhibit a high cytokine content. Breast Cancer Res 9, R15.
111
26. Gemma A., Takenaka K., Hosoya Y., Matuda K., Seike M., Kurimoto F., Ono
Y., Uematsu K., Takeda Y., Hibino S., Yoshimura A., Shibuya M. and Kudoh S.
(2001). Altered expression of several genes in highly metastatic subpopulations
of a human pulmonary adenocarcinoma cell line. Eur. J. Cancer 37, 1554–1561.
27. Kock A., Schwarz T., Urbanski A., Peng Z., Vetterlein M., Micksche M., Ansel
J.C., Kung H.F. and Luger T.A. (1989). Expression and release of interleukin-1
by different human melanoma cell lines. J. Natl. Cancer Inst. 81, 36–42.
28. Giavazzi R., Garofalo A., Bani M.R., Abbate M., Ghezzi P., Boraschi
D.,Mantovani A., Dejana E. (1990). Interleukin 1-induced augmentation
ofexperimental metastases from a human melanoma in nudemice. Cancer Res,
50, 4771-4775.
29. Voronov E., Shouval D.S., Krelin Y., Cagnano E., Benharroch D., Iwakura Y.,
Dinarello C.A. and. Apte R.N
(2003). IL-1 is required for tumour invasiveness
and angiogenesis. Proc Natl Acad Sci USA 100, 2654-2650.
30. Germano G., Allavena P., Mantovani A.(2008). Cytokines as a key component
of cancer-related inflammation. Cytokine 43, 374–379.
31. Reiss M. (1999). TGF-β and cancer. Microbes and infection 1,1327-1347.
32. Moore K.W., O'Garra A., de Waal Malefyt R., Vieira P., Mosmann T.R.(1993)
Interleukin-10. Annu Rev Immunol.11:165-90.
33. Mocellin S., Marincola F.M. and Young H.A. (2005).Interleukin-10 and the
immune response against cancer: a counterpoint. Journal of Leukocyte Biology.
78, 1043-1051.
34. Bhairavabhotla R.K., Verm V., Tongaonkar H., Shastri S., Dinshaw K.,
Chiplunkar S. (2007). Role of IL-10 in immune suppression in cervical cancer.
Indian J Biochem Biophys., 44, 350-356.
35. Mocellin, S., Panelli, M. C., Wang, E., Nagorsen, D., Marincola, F. M. (2003)
The dual role of IL-10. Trends Immunol. 24,36-43.
36. Ali S. and Lazennec G. (2007). Chemokines: novel targets for breast cancer
metastasis. Cancer Metastasis Rev. 26,401-420.
112
37. Raman D., Baugher P.J., Thu Y.M., Richmond A. (2007). Role of chemokines in
tumour growth. Cancer Letters 256,137–165.
38. Balkwill F (2003). Chemokine biology in cancer. Semin Immunol. 15(1):49-55.
39. Allavena P, Germano G, Marchesi F, Mantovani A.(2011). Chemokines in
cancer related inflammation. Exp Cell Res. 317(5):664-73.
40. Luker K. E, Luker G.D. (2006). Functions of CXCL12 and CXCR4 in breast
cancer, Cancer Lett. 238, 30-41.
41. Balkwill F. (2004). The significance of cancer cell expression of the chemokine
receptor CXCR4. Seminars in Cancer Biology 14, 171-179.
42. Balkwill F. (2004). Cancer and the chemokine network. Nat Rev Cancer, 4, 540-
550.
43. Mantovani A., Allavena P., Sica A. and Balkwill F. (2008). Cancer related
inflammation. Nature 454, 436-444.
44. Heim M.H. (1999). The Jak-STAT pathway: cytokine signalling from the
receptor to the nucleus. J Recept Signal Transduct Res. 1999, 19(1-4):75-120.
45. Ghosh S., May, M.J., and Kopp, E.B. (1998). NF-κB and Rel proteins:
Evolutionarily conserved mediators of immune responses. Annu. Rev. Immunol.
16, 225-260.
46. Pikarsky E. et al.(2004). NF-kB functions as a tumour promoter in inflammation
associated cancer. Nature 431, 461–466
47. Karin M. and Lin A. (2002). NF-kappaB at the crossroads of life and death. Nat
Immunol 3(3):221-7
48. Lin, A. and Karin, M.(2003), NF-kB in cancer: a marked target. Semin. Cancer
Biol. 13, 107–114
49. Chen S., Guttridge D.C., Tang E., Shi S., Guan K. and Wang C.Y. (2001).
Suppression of Tumour Necrosis Factor-mediated apoptosis by Nuclear Factor
κB-independent Bone Morphogenetic Protein/Smad Signaling. The Journal of
Biological Chemistry 276, 39259-63
50. Mantovani A., Marchesi F., Porta F., Sica A. and Allavena P. (2007).
Inflammation and cancer: Breast cancer as a prototype. The Breast 16, 27–33.
113
51. Balkwill F. (2006). TNF-α in promotion and progression of cancer. Cancer
Metastasis Rev 25, 409-416.
52. Chen G. and Goeddel D.V.(2002). TNF-R1 signaling: a beautiful pathway.
Science 296, 1634-1635.
53. Karin M and Ben-Neriah Y (2000). Phosphorylation meets ubiquitination: the
control of NF-κB activity. Annu Rev Immunol 18:621-63
54. Kataoka T. (2009). Chemical biology of inflammatory cytokine signalling. The
Journal of Antibiotics 62, 655–667.
55. Galban S., Fan J., Martindale J.L., Cheadle C., Hoffman B., Woods M.P. et al.
(2003). Von Hippel-Lindau protein-mediated repression of tumour necrosis
factor alpha translation revealed through use of cDNA arrays. Molecular &
Cellular Biology 23, 2316-2328.
56. Denko N.C., Fontana L.A., Hudson
K.M., Sutphin
P.D., Raychaudhuri
S., Altman R. and Giaccia A.J. (2003). Investigating hypoxic tumour physiology
through gene expression patterns. Oncogene 22, 5907–5914.
57. Wang G.L., Jiang B.H., Rue E.A., and Semenza G.L. (1995). Hypoxia-inducible
factor 1 is a basic-helix-loop-helix-PAS heterodimer regulated by cellular 02
tension. Proc. Natl. Acad. Sci. USA 92(12): 5510-5514
58. Semenza G.L. (2004). Hydroxylation of HIF-1: Oxygen Sensing at the
Molecular Level. Physiology 19,176-182.
59. Jiang B.H., Zheng J.Z., Leung S.W., Roe R., Semenza G.L.(1997).
Transactivation and inhibitory domains of hypoxia-inducible factor 1alpha and
modulation of transcriptional activity by oxygen tension. J Biol Chem
272(31):19253-60
60. Semenza GL (2007). Hypoxia-inducible factor 1 (HIF-1) pathway. Sci STKE.
9(407):cm8
61. Poon E., Harris A.L., Ashcroft M.(2009). Targeting the hypoxia-inducible factor
(HIF) pathway in cancer. Expert Rev Mol Med. 11:e26.
62. Semenza G.L., Jiang B.H., Leung S.W., Passantino R., Concordet J.P., Maire P.,
Giallongo A. (1996). Hypoxia response elements in the aldolase A, enolase 1,
114
and lactate dehydrogenase A gene promoters contain essential binding sites for
hypoxia-inducible factor 1. J Biol Chem. 271(51):32529-37.
63. Zhong H, De Marzo AM, Laughner E, Lim M, Hilton DA, Zagzag D,
Buechler P, Isaacs WB, Semenza GL, Simons JW. (1999). Overexpression
of hypoxia-inducible factor 1alpha in common human cancers and their
metastasis. Cancer Res 59, 5830–5835.
64. Semenza, G. L. (2003). Targeting HIF-1 for cancer therapy. Nat. Rev. Cancer 3,
721–732
65. Grunstein J., Roberts W.G., Mathieu-Costello O., Hanahan D. and Johnson R.S.
(1999). Tumour-derived Expression of Vascular Endothelial Growth Factor Is a
Critical Factor in Tumour Expansion and Vascular Function. Cancer Research
59, 1592-1598.
66. Lewis, J. S., Landers, R. J., Underwood, J. C.,Harris, A. L., and Lewis, C. E.
(2000). Expression of vascular endothelial growth factor by macrophagesis up-
regulated in poorly vascularized areas of breast carcinomas. J Pathol, 192, 150-
158.
67. Staller P., Sulitkova J., Lisztwan J., Moch H., Oakeley E.J., Krek W. (2003).
Chemokine receptor CXCR4 downregulated by von Hippel-Lindau tumour
suppressor pVHL. Nature, 425, 307-311.
68. Kim S.W., Kim H.Y., Lee H.J., Yun H.J., Kim S., Jo D.Y.. (2009).
Dexamethasone and hypoxia upregulate CXCR4 expression in myeloma cells.
Leuk Lymphoma. 50, 1163-73.
69. Schioppa T., Uranchimeg B., Saccani A.,.Biswas S.K., Doni A., Rapisarda A.,
Bernasconi S., Saccani S., Nebuloni M. , Vago L., Mantovani A., Melillo G. and
Sica A. (2003). Regulation of the Chemokine Receptor CXCR4 by Hypoxia. The
Journal of Experimental Medicine 198, 1391-1402.
70. Haddad J.J. and Harb H.L. (2005). Cytokines and the regulation of hypoxia-
inducible factor (HIF)-1a. International Immunopharmacology 5, 461–483.
71. Jung Y.J., Isaacs J.S., Lee S., Trepel J., Neckers L. (2003). IL-1hmediated
up-regulation of Hif-1α via an NF-nB/COX-2 pathway identifies HIF-1 as a
critical link between inflammation and oncogenesis. FASEB J 17, 2115–2117.
115
72. Rius J., Guma M., Schachtrup C., Akassoglou K., Zinkernage A.S., Nizet V.,
Johnson R.S., Haddad G.G. and Karin M. (2008). NF-kB links innate immunity
to the hypoxic response through transcriptional regulation of Hif-1α. Nature
453, 807-811.
73. Nigro J.M., Baker S.J., Preisinger A.C., Jessup J.M., Hostetter R., Cleary K.,
Bigner S.H., Davidson N., Baylin S., Devilee P., Glover T., Collins F.S., Weston
A., Modali R., Harris C.C., Vogelstein B. (1989). Mutations in the p53 gene
occur in diverse human tumour types. Nature 342, 705-708.
74. El-Deiry, W. S., S. E. Kern, J. A. Pietenpol, K. W. Kinzler, and B. Vogelstein
(1992). Human genomic DNA sequences define a consensus DNA binding site
for p53. Nat Genet. 1:45–49
75. Joerger A.C. and Fersht
A.R. (2007). Structure–function–rescue: the diverse
nature of common p53 cancer mutants. Oncogene 26, 2226–2242.
76. Momand J., Wu H.H., Dasgupta G. (2000). MDM2 – master regulator of the p53
tumour suppressor protein. Gene 242, 15-29.
77. Abraham R.T. (2001). Cell cycle checkpoint signaling through the ATM and
ATR kinases. Genes Dev. 15, 2177-2196.
78. Maya R., Balass M., Kim S.-T., Shkedy D., Leal J.-F.M., ShifmanO., Moas M.,
Buschmann T., Ronai Z., Shiloh Y., etal. (2001). ATM-dependent
phosphorylation of MDM2 on serine 395: Role in p53 activation by DNA
damage. Genes & Dev. 15: 1067–1077
79. Giono L.E. and Manfredi J.J. (2006).The p53 tumor suppressor participates in
multiple cell cycle checkpoints. Journal of Cellular Physiology 209, 13-20.
80. O’Morgan D. (2007). The cell cycle: principles of control. New Science Press.
81. Göhler T., Jäger
S., Warnecke
G., Yasuda
H., Kim
E. and Deppert
W. (2005).
Mutant p53 proteins bind DNA in a DNA structure-selective mode. Nucleic
Acids Research 33:1087-1100.
116
82. Yang J., Ahmed A., Poon E., Perusinghe N., de Haven Brandon A., Box G.,
Valenti M., Eccles S., Rouschop K., Wouters B. and Ashcroft M. (2009). Small
Molecule Activation of p53 Blocks HIF-1α and VEGF Expression In Vivo and
Leads to Tumour Cell Apoptosis in Normoxia and Hypoxia. Mol. Cell. Biol. 29,
2243-2253.
83. Mehta S.A., Christopherson K.W., Bhat-Nakshatri P., Goulet Jr R.J..,
Broxmeyer H.E., Kopelovich L. and Nakshatri H. (2007). Negative regulation of
chemokine receptor CXCR4 by tumour suppressor p53 in breast cancer cells:
implications of p53 mutation or isoform expression on breast cancer cell
invasion. Oncogene, 26:3329-3337
84. Hussain S.P., Hofseth
L.J. and Harris C.C. (2003). Radical causes of cancer.
Nature Reviews Cancer 3, 276-285.
85. Staib F., Robles
A.I., Varticovski
L., Wang
X.W., Zeeberg
B.R., Sirotin
M.,
Zhurkin V.B., Hofseth
L.J., Hussain
S.P., Weinstein
J.N., Galle
P.R. and Harris
C.C. (2005). The p53 Tumour Suppressor Network Is a Key Responder to
Microenvironmental Components of Chronic Inflammatory Stress. Cancer
Research 65, 10255-10264
86. Webster G.A. and Perkins N.D. (1999). Transcriptional Cross Talk between NF-
κB and p53. Mol Cell Biol 19(5): 3485–3495
87. Hudson J.D., Shoaibi M.A., Maestro R., Carnero A., Hannon G.J. and Beach
D.H.(1999) A proinflammatory cytokine inhibits p53 tumour suppressor activity.
J. Exp. Med. 190, 1375–1382
88. Petrenko O., Fingerle-Rowson G., Peng T., Mitchell R.A. and Metz
C.N.(2003). Macrophage Migration Inhibitory Factor Deficiency Is Associated
with Altered Cell Growth and Reduced Susceptibility to Ras-mediated
Transformation. The Journal of Biological Chemistry 278, 11078-11085.
89. Liu L., Scolnick D.M., Trievel R.C., Zhang H.B., Marmorstein R., Halazonetis
T., et al.(1999). p53 sites acetylated in vitro by PCAF and p300 are acetylated in
vivo in response to DNA damage. Mol Cell Biol. 19, 1202–1209.
117
90. Winner M., Koong
A.C., Rendon
B.E., Zundel
W. and Mitchell
R.A. (2007).
Amplification of Tumour Hypoxic Responses by Macrophage Migration
Inhibitory Factor–Dependent Hypoxia-Inducible Factor Stabilization. Cancer
Research 67, 186-193.
91. Rosenfeld M.G., Lunyak V.V. and Glass C.K. (2006). Sensors and signals: a
coactivator/corepressor/epigenetic code for integrating signal-dependent
programs of transcriptional response. Genes Dev 20:1405-1428
92. Peserico A. and Simone C. (2011). Physical and functional HAT/HDAC
interplay regulates protein acetylation balance. J Biomed Biotechnol.
2011:371832
93. Sheppard K.A., Rose D.W., Haque Z.K., Kurokawa R., McInerney E., Westin
S, Thanos D., Rosenfeld M.G., Glass C.K., Collins T (1999) Transcriptional
activation by NF-kappaB requires multiple coactivators. Mol Cell Biol.
19(9):6367-78.
94. Lee S.K., Kim H.J., Kim J.W., Lee J.W. (1999). Steroid receptor coactivator-1
and its family members differentially regulate transactivation by the tumor
suppressor protein p53. Mol Endocrinol. 13(11):1924-33
95. Carrero P., Okamoto K., Coumailleau P.,
O'Brien S.,
Tanaka H. and Poellinger
L.
(2000). Redox-regulated recruitment of the transcriptional coactivators CREB-
binding protein and SRC-1 to hypoxia-inducible factor 1α Mol Cell Biol 20(1):
402–415
96. Xenaki G., Ontikatze T., Rajendran R., Stratford I.J., Dive C., Krstic-
Demonacos M. and Demonacos C. (2008). PCAF is an HIF-1α cofactor that
regulates p53 transcriptional activity in hypoxia. Oncogene 27:5785–5796
97. Glozak M.A., Sengupta N., Zhang X., Seto E. (2005). Acetylation and
deacetylation of non-histone proteins. Gene 363:15-23.
98. Shahbazian M.D. and Grunstein M. (2007). Functions of site-specific histone
acetylation and deacetylation. Annu Rev Biochem, 76:75-100.
118
99. Yang X.J. and Seto E.(2007). HATs and HDACs: from structure, function and
regulation to novelstrategies for therapy and prevention. Oncogene 26, 5310–
5318
100. Kuo M.H. and Allis C.D. (1998). Roles of histone acetyltransferases and
deacetylases in gene regulation. Bioessays. 20(8):615-26
101. Spencer T.E., Jenster G., Burcin M.M., Allis C.D., Zhou J., Mizzen
C.A., McKenna N.J., Onate S.A., Tsai S.Y., Tsai M.J., O'Malley B.W. (1997).
Steroid receptor coactivator-1 is a histone acetyltransferase.
Nature 389(6647):194-8
102. Xu J., Wu R.C., O’Malley (2009). Normal and cancer-related functions of the
p160 steroid receptor co-activator (SRC) family. Nature reviews 9, 615-630.
103. Partch C.L. and Gardner K.H. (2010). Coactivator recruitment: a new role for
PAS domains in transcriptional regulation by the bHLH-PAS family. J Cell
Physiol. 223(3):553-7.
104. Heery D.M., Kalkhoven E., Hoare S., Parker M.G. (1997). A signature motif in
transcriptional co-activators mediates binding to nuclear receptors. Nature
387(6634):733-6.
105. Torchia J., Rose D.W., Inostroza J., Kamei Y., Westin S., Glass
C.K., Rosenfeld M.G. (1997). The transcriptional co-activator p/CIP binds CBP
and mediates nuclear-receptor function. Nature.387(6634):677-84
106. Moore J.M. and Guy R.K. (2005) Coregulator interactions with the thyroid
hormone receptor. Mol Cell Proteomics. 4(4):475-82
107. Bouras T., Southey M.C., Venter D.J. (2001). Overexpression of the steroid
receptor coactivator AIB1 in breast cancer correlates with the absence of
estrogen and progesterone receptors and positivity for p53 and HER2/neu.
Cancer Res.61(3):903-7.
119
108. Xie D., Sham J.S., Zeng W.F., Lin H.L., Bi J., Che L.H., Hu L., Zeng
Y.X., Guan X.Y.(2005). Correlation of AIB1 overexpression with advanced
clinical stage of human colorectal carcinoma Hum Pathol. 36(7):777-83.
109. Ruas J.L., Poellinger L., Pereira T. (2005). Role of CBP in regulating HIF-1-
mediated activation of transcription. J Cell Sci.118(Pt 2):301-11
110. Cvijic H., Bauer K., Löffler D., Pfeifer G., Blumert C., Kretzschmar
A.K., Henze C., Brocke-Heidrich K., Horn F. (2009). Co-activator SRC-1 is
dispensable for transcriptional control by STAT3. Biochem J. 420(1):123-32.
111. Glozak M.A. and Seto E. (2007). Histone deacetylases and cancer. Oncogene.
26(37):5420-32.
112. de Ruijter A.J., van Gennip A.H., Caron H.N., Kemp S., van Kuilenburg A.B.
(2003). Histone deacetylases (HDACs): characterization of the
classical HDAC family. Biochem J. 370(Pt 3):737-49.
113. Voelter-Mahlknecht S., Ho A.D. and Mahlknecht U. (2005) Chromosomal
organization and localization of the novel class IV human histone deacetylase 11
gene. Int J Mol Med, 16, 589-98.
114. Michan, S. and Sinclair D. (2007) Sirtuins in mammals: insights into their
biological function. Biochem J, 404, 1-13
115. Haigis, M.C. and Guarente, L.P. (2006) Mammalian sirtuins--emerging roles in
physiology, aging, and calorie restriction. Genes Dev., 20, 2913-21.
116. Liu T., Liu P.Y., Marshall G.M. (2009). The critical role of the class III histone
deacetylase SIRT1 in cancer. Cancer Res. 69(5):1702-5
117. Rajendran R., Garva R., Krstic-Demonacos M., Demonacos C. (2011). Sirtuins:
molecular traffic lights in the crossroad of oxidative stress, chromatin
remodelling and transcription. Journal of Biomedicine and Biotechnology (in
press).
118. Langley E., Pearson M., Faretta M., Bauer U.-M., Frye R.A., Minucci S.,
Pelicci P.G. and Kouzarides T. (2002) Human SIR2 deacetylates p53 and
antagonizes PML/p53-induced cellular senescence. EMBO J. 21:2383-2396.
120
119. Giannakou M.E., Partridge L. (2004). The interaction between FOXO
and SIRT1: tipping the balance towards survival. Trends Cell Biol. 14(8):408-
412
120. Brunet A., Sweeney L.B., Sturgill J.F., Chua K.F., Greer P.L., Lin Y., Tran
H., Ross S.E., Mostoslavsky R., Cohen H.Y., Hu L.S., Cheng
H.L., Jedrychowski M.P., Gygi S.P., Sinclair D.A., Alt F.W.,Greenberg M.E.
(2004). Stress-dependent regulation of FOXO transcription factors by
the SIRT1 deacetylase. Science. 303(5666):2011-5.
121. Yeung F., Hoberg J.E., Ramsey C.S., Keller M.D., Jones D.R., Frye
R.A., Mayo M.W. (2004). Modulation of NF-kappaB-dependent transcription
and cell survival by the SIRT1 deacetylase. EMBO J. 23(12):2369-80
122. Lim J.H., Lee Y.M., Chun Y.S., Chen J, Kim J.E., Park J.W. (2010). Sirtuin 1
modulates cellular responses to hypoxia by deacetylating hypoxia-inducible
factor 1alpha. Mol Cell. 38(6):864-78
123. Sung J.Y., Kim R., Kim J.E., Lee J. (2010). Balance between SIRT1 and DBC1
expression is lost in breast cancer. Cancer Sci. 101(7):1738-44
124. Feige J.N., Auwerx J. (2008). Transcriptional targets of sirtuins in the
coordination of mammalian physiology. Curr Opin Cell Biol. 20(3):303-9
125. http://www.who.int/en/ (2010)
126. DeNardo D.G. and Coussens L.M. (2007). Inflammation and breast cancer.
Balancing immune response: crosstalk between adaptive and innate immune
cells during breast cancer progression. Breast Cancer Research 2007 9, 212.
127. Nicolini A., Carpi A., Rossi G. (2006). Cytokines in breast cancer. Cytokine &
Growth Factor Reviews 17, 325–337.
128. Yager J.D. and Davidson N.E. (2006). Estrogen Carcinogenesis in Breast
Cancer. N Engl J Med 354. 270-282.
129. Bhat H.K., Calaf G., Hei T.K., Loya T., Vadgama J.V. (2003). Critical role of
oxidative stress in estrogen-induced carcinogenesis. Proc Natl Acad Sci USA
100, 3913-3918.
121
130. Platet N., Cathiard A.M., Gleizes M., Garcia M. (2004). Estrogens and their
receptors in breast cancer progression: a dual role in cancer proliferation and
invasion. Crit Rev Oncol Hematol. 51(1):55-67.
131. Sauvé K., Lepage J., Sanchez M., Heveker N. and Tremblay A. (2009).
Positive feedback activation of estrogen receptors by the CXCL12-CXCR4
pathway. Cancer Research 69, 5793-5800.
132. Tai H., Kubota N., Kato S. (2000). Involvement of nuclear receptor coactivator
SRC-1 in estrogen-dependent cell growth of MCF-7 cells. Biochem. Biophys.
Res. Commun. 267, 311-316.
133. Wang S., Yuan Y., Liao L., Kuang S.Q., Tien J.C.Y., O’Malley B.W. and Xu J.
(2008). Disruption of the SRC-1 gene in mice suppresses breast cancer
metastasis without affecting primary tumour formation. The National Academy
of Sciences of the USA 106, 151-156.
134. Li H., Rajendran G.K., Liu N., Ware C., Rubin B.P., Gu Y. (2007). SirT1
modulates the estrogen-insulin-like growth factor-1 signaling for postnatal
development of mammary gland in mice. Breast Cancer Res. 9(1):R1.
135. Pruitt K., Zinn R.L., Ohm J.E., McGarvey K.M., Kang S.H., Watkins
D.N., Herman J.G., Baylin S.B. (2006). Inhibition of SIRT1 reactivates
silenced cancer genes without loss of promoter DNA hypermethylation. PLoS
Genet. 2(3):e40
136. Chen W.Y., Wang D.H., Yen R.C., Luo J., Gu W., Baylin S.B. (2005). Tumor
suppressor HIC1 directly regulates SIRT1 to modulate p53-dependent DNA-
damage responses. Cell. 123(3):437-48.
137. Nakamaru Y., Vuppusetty C., Wada H., Milne J.C., Ito M., Rossios C., Elliot
M., Hogg J., Kharitonov S., Goto H., Bemis J.E., Elliott P., Barnes P.J., Ito K.
(2009). A protein deacetylase SIRT1 is a negative regulator of
metalloproteinase-9. FASEB J. 23(9):2810-9
138. Potente M., Ghaeni L., Baldessari D., Mostoslavsky R., Rossig L., Dequiedt
F., Haendeler J., Mione M., Dejana E., Alt F.W., Zeiher A.M., Dimmeler S.
(2007). SIRT1 controls endothelial angiogenic functions during vascular growth.
Genes Dev. 21(20):2644-58.
122
139. López-Lázaro M. (2006). Hypoxia-inducible factor 1 as a possible target for
cancer chemoprevention. Cancer Epidemiol Biomarkers Prev 15, 2332-2335
140. Burton E.R. and Libutti S.K. (2009). Targeting TNF-α for cancer therapy.
Journal of Biology 8, 85
141. Jana N.R. (2008). NSAIDS and apoptosis. Cell. Mol. Life. Sci 65, 1295-1301.
142. Gierach G.L., Lacey J.V., Schatzkin A., Leitzmann M.F., Richesson D.,
Hollenbeck A.R. and Brinton L.A. (2008). Nonsteroidal anti-inflammatory drugs
and breast cancer risk in the National Institutes of Health–AARP Diet and
Health Study. Breast Cancer Research 10, R38.
143. D'Acquisto F.,May M.J., Ghosh S. (2002). Inhibition of nuclear factor kappa B
(NF-κB): an emerging theme in anti-inflammatory therapies. Molec Interv 2, 22-
35.
144. Murdoch C., Lewis C.E. (2005). Macrophage migration and gene expression in
response to tumor hypoxia. Int J Cancer. 117(5):701-8.
145. Murata Y., Ohteki T., Koyasu S., Hamuro J..(2002). IFN-gamma and pro-
inflammatory cytokine production by antigen-presenting cells is dictated by
intracellular thiol redox status regulated by oxygen tension. Eur J Immunol.
32(10):2866-73
146. Llanes-Fernández L., Alvarez-Goyanes R.I., Arango-Prado Mdel C., Alcocer-
González J.M., Mojarrieta J.C., Pérez X.E., López M.O., Odio S.F., Camacho-
Rodríguez R., Guerra-Yi M.E.,Madrid-Marina V., Tamez-Guerra R., Rodríguez-
Padilla C. (2006). Relationship between IL-10 and tumor markers in breast
cancer patients. Breast. 15(4):482-9
147. Chresta C.M., Masters J R.W. and Hickman J.A. (1996). Hypersensitivity of
human testicular tumors to etoposide-induced apoptosis is associated with
functional p53 and a high Bax:Bcl-2 ratio. Cancer Res 56:1834-1841.
148. Jiang B.H., Zheng J.Z., Leung S.W., Roe R., and Semenza G.L.
(1997).Transactivation and inhibitory domains of hypoxia-inducible factor 1α:
modulation of transcriptional activity by oxygen tension. J Biol Chem 272
(31):19253–19260
123
149. Arriola E.L., Lopez A.R. and Chresta C.M. (1999). Differential regulation of
p21waf-1/cip-1
and MDM2 by etoposide: etoposide inhibits the p53-MDM2
autoregulatory feedback loop. Oncogene 18, 1081-91
150. Lando D., Gorman J.J., Whitelaw M.L., Peet D.J. (2003). Oxygen-
dependent regulation of hypoxia-inducible factors by prolyl and asparagynil
hydroxylation. Eur J Biochem. 270(5):781-90
151. Onate S.A., Tsai S.Y., Tsai M.J., O'Malley B.W.(1995). Sequence and
characterization of a coactivator for the steroid hormone receptor superfamily.
Science. 270(5240):1354-7
152. Towbin H., Staehelin T., Gordon J. (1979): Electrophoretic transfer of proteins
from polyacrylamide gels to nitrocellulose sheets: procedure and some
applications. Proc Natl Acad Sci USA, 76(9):4350-4354.
153. www.mitosciences.com (2011)
154. http://www.piercenet.com/(2010)
155. www.norgenbiotek.com(2011)
156. Koumenis C., Alarcon R., Hammond E., Sutphin P., Hoffman W., Murphy
M., Derr J., Taya Y., Lowe S.W., Kastan M., Giaccia A. (2001). Regulation of
p53 by hypoxia: dissociation of transcriptional repression and apoptosis from
p53-dependent transactivation. Mol Cell Biol. 21(4):1297-310.
157. Blagosklonny M.V., An W.G., Romanova L.Y., Trepel J., Fojo T., Neckers L.
(1998). p53 inhibits hypoxia-inducible factor-stimulated transcription. J Biol
Chem 273(20):11995-8.
158. Chen D., Li M., Luo J., Gu W.(2003). Direct interactions between HIF-1 alpha
and MDM2 modulate p53 function. J Biol Chem. 278(16):13595-8
159. Scolnick D.M., Chehab N.H., Stavridi E.S., Lien M.C., Caruso L., Moran
E., Berger S.L., Halazonetis T.D. (1997). CREB-binding protein and p300/CBP-
associated factor are transcriptional coactivators of the p53 tumor suppressor
protein. Cancer Res. 57(17):3693-6
160. Kallio P.J., Okamoto K., O'Brien S., Carrero P., Makino Y., Tanaka
H., Poellinger L. (1998). Signal transduction in hypoxic cells: inducible nuclear
124
translocation and recruitment of the CBP/p300 coactivator by the hypoxia-
inducible factor-1alpha. EMBO J. 17(22):6573-86.
161. Pradet-Balade B., Boulmé F., Beug H., Müllner E.W., Garcia-Sanz J.A. (2001).
Translation control: bridging the gap between genomics and proteomics? Trends
Biochem Sci. 26(4):225-9.
162. Keimling M., Wiesmüller L. (2009). DNA double-strand break repair activities
in mammary epithelial cells--influence of endogenous p53 variants.
Carcinogenesis. 30(7):1260-8
163. Bug M., Dobbelstein M. (2011). Anthracyclines induce the accumulation of
mutant p53 through E2F1-dependent and -independent mechanisms. Oncogene,
1-13
164. Lemon B., Tjian R. (2000). Orchestrated response: a symphony of transcription
factors for gene control. Genes Dev. 14(20):2551-69.
165. Beischlag T.V., Wang S., Rose D.W., Torchia J., Reisz-Porszasz
S., Muhammad K., Nelson W.E., Probst M.R., Rosenfeld M.G., Hankinson
O.(2002). Recruitment of the NCoA/SRC-1/p160 family of transcriptional
coactivators by the aryl hydrocarbon receptor/aryl hydrocarbon receptor nuclear
translocator complex. Mol Cell Biol. 22(12):4319-33
166. Redmond A.M., Bane F.T., Stafford A.T., McIlroy M., Dillon M.F., Crotty
T.B., Hill A.D., Young L.S. (2009). Coassociation of estrogen receptor and p160
proteins predicts resistance to endocrine treatment; SRC-1 is an independent
predictor of breast cancer recurrence. Clin Cancer Res.15(6):2098-106
167. Lavery D.N., Bevan C.L. (2011). Androgen receptor signalling in prostate
cancer: the functional consequences of acetylation. J Biomed Biotechnol.
2011:862125
168. Borra M.T., Smith B.C., Denu J.M. (2005). Mechanism of human SIRT1
activation by resveratrol. J Biol Chem. 280(17):17187-95
169. Zhang Q., Tang X., Lu Q.Y., Zhang Z.F., Brown J., Le A.D. (2005).
Resveratrol inhibits hypoxia-induced accumulation of hypoxia-inducible factor-
1alpha and VEGF expression in human tongue squamous cell carcinoma and
hepatoma cells. Mol Cancer Ther. 4(10):1465-74.
125
170. De Nardo D. and Latz E. (2011). NLRP3 inflammasomes link inflammation
and metabolic disease. Trends Immunol
171. Strober W., Fuss I.J. (2011). Proinflammatory cytokines in the pathogenesis of
inflammatory bowel diseases. Gastroenterology. 140(6):1756-67.
172. Papadakis K.A., Targan S.R. (2000). Role of cytokines in the pathogenesis of
inflammatory bowel disease. Annu Rev Med. 51:289-98.
173. Mor A., Aizman E., George J., Kloog Y.(2011). Ras inhibition induces insulin
sensitivity and glucose uptake. PLoS One.6(6):e21712.
174. Toi M., Bicknell R., Harris A.L. (1992). Inhibition of colon and breast
carcinoma cell growth by interleukin-4. Cancer Res. 52(2):275-9.
175. Aggarwal B.B., Shishodia S., Sandur S.K., Pandey M.K., Sethi G. (2006).
Inflammation and cancer: how hot is the link? Biochem
Pharmacol. 72(11):1605-21
176. Maxwell P.J., Gallagher R., Seaton A., Wilson C., Scullin P., Pettigrew
J., Stratford I.J., Williams K.J., Johnston P.G., Waugh D.J. (2007). HIF-1 and
NF-kappaB-mediated upregulation of CXCR1 and CXCR2 expression promotes
cell survival in hypoxic prostate cancer cells. Oncogene. 26(52):7333-45
177. Hussain S.P., Harris C.C. (2007). Inflammation and cancer: an ancient link with
novel potentials. Int J Cancer.121(11):2373-80.
178. Riou G., Lê M.G., Travagli J.P., Levine A.J., Moll U.M.(1993).
Poor prognosis of p53 gene mutation and nuclear overexpression of p53 protein i
n inflammatory breast carcinoma. J Natl Cancer Inst. 85(21):1765-7.
179. Aziz S.A., Pervez S., Khan S., Kayani N., Azam S.I., Rahbar M.H.(2001). Case
control study of prognostic markers and disease outcome in inflammatory
carcinoma breast: a unique clinical experience. Breast J. 7(6):398-404.
180. Schetter A.J., Heegaard N.H., Harris C.C..(2010). Inflammation and cancer:
interweaving microRNA, free radical, cytokine and p53 pathways.
Carcinogenesis. 31(1):37-49
181. Komarova E.A., Krivokrysenko V., Wang K., Neznanov N., Chernov
MV., Komarov P.G., Brennan M.L., Golovkina T.V., Rokhlin O.W., Kuprash
126
D.V., Nedospasov S.A., Hazen S.L., Feinstein E.,Gudkov A.V.(2005). p53 is a
suppressor of inflammatory response in mice. FASEB J. 19(8):1030-2
182. An W.G., Kanekal M., Simon M.C., Maltepe E., Blagosklonny M.V.,
Neckers L.M. (1998). Stabilization of wild-type p53 by hypoxiainducible factor
1a. Nature 392: 405–408
183. Ravi R., Mookerjee B., Bhujwalla Z.M., Sutter C.H., Artemov D., Zeng Q. et
al. (2000). Regulation of tumor angiogenesis by p53-induced degradation of
hypoxia-inducible factor 1a. Genes Dev 14: 34–44.
184. Graeber T.G., Osmanian C., Jacks T., Housman D.E., Koch C.J., Lowe
S.W., Giaccia A.J. (1996). Hypoxia-mediated selection of cells with diminished
apoptotic potential in solid tumours. Nature. 379(6560):88-91.
185. Ashcroft M., Taya Y., Vousden K.H. (2000). Stress signals utilize multiple
pathways to stabilize p53. Mol Cell Biol. 20(9):3224-33
186. Kishimoto H., Wang Z., Bhat-Nakshatri P., Chang D., Clarke R., Nakshatri
H.(2005). The p160 family coactivators regulate breast cancer cell proliferation
and invasion through autocrine/paracrine activity of SDF-1alpha/CXCL12.
Carcinogenesis 26(10):1706-15
187. de Nigris F., Rossiello R., Schiano C., Arra C., Williams-Ignarro S., Barbieri
A., Lanza A., Balestrieri A., Giuliano M.T., Ignarro L.J., Napoli C.(2008).
Deletion of Yin Yang 1 protein in osteosarcoma cells on cell invasion and
CXCR4/angiogenesis and metastasis. Cancer Res. 68(6):1797-808.
188. Moriuchi M., Moriuchi H., Margolis D.M., Fauci A.S. (1999). USF/c-Myc
enhances, while Yin-Yang 1 suppresses, the promoter activity of CXCR4, a
coreceptor for HIV-1 entry. J Immunol. 162(10):5986-92
189. Lee S.K., Kim H.J., Na S.Y., Kim T.S., Choi H.S., Im S.Y., Lee J.W.(1998).
Steroid receptor coactivator-1 coactivates activating protein-1-mediated
transactivations through interaction with the c-Jun and c-Fos subunits. J Biol
Chem. 273(27):16651-4.
190. Laderoute K.R., Calaoagan J.M., Gustafson-Brown C., Knapp A.M., Li G.C,
Mendonca H.L., Ryan H.E., Wang Z., Johnson R.S. (2002). The response of c-
127
Jun/AP-1 to chronic hypoxia is hypoxia-inducible factor 1α dependent. Mol Cell
Biol. 22(8): 2515–2523
191. Weiss R.E., Xu J., Ning G., Pohlenz J., O'Malley B.W. and Refetoff S. (1999).
Mice deficient in the steroid receptor co-activator 1 (SRC-1) are resistant to
thyroid hormone. EMBO J. 18(7): 1900–1904
192. Zagzag D., Krishnamachary B., Yee H., Okuyama H., Chiriboga L., Ali M.A.,
Melamed J., Semenza G.L.(2005). Stromal cell-derived factor-1alpha and
CXCR4 expression in hemangioblastoma and clear cell-renal cell carcinoma:
von Hippel-Lindau loss-of-function induces expression of a ligand and its
receptor. Cancer Res.65(14):6178-88
193. Geminder H., Sagi-Assif O., Goldberg L., Meshel T., Rechavi G., Witz I.P.,
Ben-Baruch A. (2001). A possible role for CXCR4 and its ligand, the CXC
chemokine stromal cell-derived factor-1, in the development of bone marrow
metastases in neuroblastoma. J Immunol. 167(8):4747-57.
194. Vaziri H., Dessain S.K., Eaton E.N., Imai S.-I., Frye R.A., Pandita T.K.,
Guarente L. and Weinberg R.A. (2001) hSIR2SIRT1 functions as an NAD-
dependent p53 deacetylase. Cell,107, 149-159.
195. Bakker W.J., Harris I.S., Mak T.W..(2007). FOXO3a is activated in response to
hypoxic stress and inhibits HIF1-induced apoptosis via regulation of CITED2.
Mol Cell 28(6):941-53.
196. De Larco J.E., Wuertz B.R.K., Yee D., Rickert B.L., and Furcht L.T. (2003).
Atypical methylation of the interleukin-8 gene correlates strongly with the
metastatic potential of breast carcinoma cells. PNAS. 100 (24): 13988-13993
128