Molecular Human Reproduction vol.2 no.10 pp. 793-798, 1996

Expression and activity of hexokinase in the early mouse embryo

F.D.Houghton1-3, B.Sheth2, B.Moran2, H.J.Leese1 and T.P.Fleming2

department of Biology, University of York, PO Box 373, York YO1 5YW, and department of Biology,University of Southampton, Bassett Crescent East, Southampton SO16 7PX, UK

^o whom correspondence should be addressed

The maximal activity and Michaelis constant. KM, of hexokinase have been measured in the peri-implantationmouse embryo using an ultramicrofluorescence technique. In addition, transcript detection of the predominantisoenzyme hexokinase I has been determined in single preimplantation mouse embryos at successive stagesof development using reverse transcriptase-mediated cDNA amplification. Maximal hexokinase activitydecreased dramatically peri-implantation, from 0.97 ± 0.19 nmol/ng protein/h at the blastocyst stage to0.31 ± 0.05 nmol/|i.g protein/h on day 6.5. The KM remained relatively low and constant over this period(0.23-0.39 mM), indicating the absence of the hexokinase type IV isoenzyme. The pattern of hexokinaseactivity resembled that of glucose consumption suggesting a possible regulatory role for the enzyme duringthis period of development. Hexokinase I mRNA was detected in the oocyte and all preimplantation stagesof development. The blastocyst polymerase chain reaction (PCR) product, when cloned and sequenced wasfound to be 98% homologous with mouse tumour hexokinase I. Taken together, these data suggest that thehexokinase gene is not under transcriptional control during early mouse embryo development but plays asignificant role in the regulation of glucose consumption. A role for hexokinase in the phosphate-inducedinhibition of early embryo development is also proposed.Key words: enzyme activity/hexokinase/mouse embryo/polymerase chain reaction

IntroductionPyruvate is required to support the first cleavage division ofmouse preimplantation embryos and is the predominant energysubstrate utilized until the morula stage (Brinster, 1965a;Biggers et al., 1967; Whitten and Biggers, 1968; Leese andBarton, 1984; Gardner and Leese, 1986). Glucose as the soleenergy source is unable to support development until the 4—8-cell stage (Brinster, 1965b; Brinster and Thomson, 1966)but becomes the main substrate at the blastocyst stage. Theswitch from pyruvate to glucose occurs at ~99 h after humanchorionic gonadotrophin (HCG) administration (Martin andLeese, 1995). Immediately after implantation, glucose remainsthe predominant energy substrate and the majority of glucoseconsumed can be accounted for by lactate appearance inembryos from the mouse (Clough and Whittingham, 1983;Houghton et al., 1996) and rat (Ellington, 1987). The glucosetransporter, GLUT 1, is present throughout mouse preimplanta-tion development and glucose entry into the cell is unlikely to beimpeded (Hogan, 1991). Thus, the block to glucose utilizationduring early preimplantation development is more likely toreside with the enzymatic control of glucose metabolism.

Three enzymes of glycolysis, which catalyse reactions farfrom equilibrium, are traditionally thought to be rate limiting;hexokinase, phosphofructokinase and pyruvate kinase(Newsholme and Start, 1973; Newsholme and Leech, 1989).In the mammalian embryo, measurements of maximal enzymeactivity have suggested a possible regulatory role for hexo-

kinase, the first enzyme of glycolysis, in glucose utilization,while regulation by phosphofructokinase cannot be disregardeddue to its allosteric properties (Barbehenn et al., 1974, 1978).In the mouse, hexokinase activity increases from the 8—16-cell to the blastocyst stage (Hooper and Leese, 1989; Ayabe,1994), a rise coincident with that of glucose uptake (Leeseand Barton, 1984). The low activity of hexokinase duringthe early preimplantation stages has been suggested as anexplanation of the inability of these embryos to consumeglucose (Brinster, 1968; Barbehenn, 1974, 1978; Hooper andLeese, 1989).

There are four isoenzymes of hexokinase in mammaliantissues; types I-IV, but biochemical measurements of enzymeactivity are unable to differentiate between the various types.Hexokinase I—III are 100 kDa proteins with a low Michaelisconstant, KM, for glucose, whereas hexokinase IV is a 50 kDaprotein with a high KM for glucose (Preller and Wilson, 1992).The relative proportions of the isoenzymes vary in differenttissues: hexokinase I is the predominant isoenzyme in glucose-dependent tissues such as the brain (Schwab and Wilson,1989); hexokinase II predominates in skeletal muscle (Thelenand Wilson, 1991) and other insulin-sensitive tissues; hexo-kinase III, with the exception of pig erythrocytes (Magnaniet al., 1983; Stocchi et al, 1983), has not been found topredominate in any cell type; hexokinase IV (glucokinase) isfound only in liver (Katzen and Schimke, 1965) and pancreaticfj-cells (Magnuson and Shelton, 1989). It is thought that the100 kDa proteins have evolved from gene duplication and

© European Society for Human Reproduction and Embryology 793

Dow

nloaded from https://academ

ic.oup.com/m

olehr/article/2/10/793/1004809 by guest on 10 Decem

ber 2021

F.D.Houghton et al.

fusion of an ancestral form of the yeast hexokinase (Ureta,1982). Hexokinase I has been the most extensively studied(largely in the rat) and is the only isoenzyme whose DNAsequence is available for mouse, derived from tumour tissue(Arora et al., 1990). The gene consists of two structural halves,both coding for proteins containing an ATP and a glucosebinding site (Arora et al, 1990). The C-terminal half providesthe catalytic function (Schirch and Wilson, 1987; White andWilson, 1989) with the A'-terminal half providing enzymeregulation by binding glucose-6-phosphate (White and Wilson,1990). There is also a hydrophobic region, necessary forbinding hexokinase to the outer mitochondrial membrane. Todate, there have been no reports on the gene expression ofhexokinase in preimplantation embryos.

We have investigated maximal hexokinase activity in singlemouse blastocysts and in single postimplantation embryos on6.5 and 7.5 days of gestation using an ultramicrofluorescenceassay based on that of Martin et al. (1993). The enzymekinetics of hexokinase have also been examined to determinethe A"M and V,™,, during the peri-implantation period to discoverwhether the type IV (high KM) isoenzyme is present. Inaddition, hexokinase I mRNA analysis in single mouse embryosat successive stages of preimplantation development has beendetermined by reverse transcriptase-mediated cDNA ampli-fication using a technique based on that of Collins and Fleming(1995). The polymerase chain reaction product from blastocystswas cloned, sequenced and sequence homology with mousetumour hexokinase I cDNA determined.

Materials and methodsOvulation was stimulated in virgin mice, 6-8 weeks old of the strainCBA/Ca using 5 IU (0.1 ml) pregnant mare's serum gonadotrophin(PMSG, Folligon; Intervet, Cambridge, UK) administered by i.p.injection between 1200-1400 h. This was followed 48 h later by ani.p. injection of 5 IU (0.1 ml) of HCG (Chorulon; Intervet). Femaleswere immediately placed with MF1 males and the presence of avaginal plug the following morning was taken as an indication thatmating had occurred.

Embryo recoveryEmbryos were recovered from the dam at 1400 h on day 2 post-fertilization when they were at the 2-cell stage. Embryos wereretrieved by flushing the oviducts with H6, a HEPES-bufferedmedium before being transferred into T6 medium (Whittingham,1971) containing 5.5 mM glucose, 0.25 mM pyruvate and 2.5 mMlactate, and cultured under pre-equilibrated paraffin oil at 37°C in ahumidified atmosphere of 5% CO2 in air.

Extraction of poly (A)* mRNAmRNA was extracted from single preimplantation mouse embryosaccording to the method of Sheardown (1992). To avoid the amplifica-tion of any contaminating DNA all solutions were subjected to5000X100 UJ/cm of UV-irradiation (Spectrolinker XL-1000; Scotlab,Strathclyde, UK). Embryos were removed from culture and placedonto 2 mm squares of messenger affinity paper (MAP; AmershamInternational, Amersham, UK) in a minimal volume of T6 medium.The RNA was extracted from the embryos by the addition of 10 (J.1Tris-buffered 4 M guanidinium isothiocyanate (pH 7.5) containing1% (J-mercaptoethanol, dispensed in 1 u.1 droplets. The samples were

794

51- 1 poly Atail

l 4

- N-tennlnal half - X - C-tamliul half •

PositionSequences

1 - CACACAACATCGTGCACG 344-361

2 - CATTACGAATTCGATCACGTCCCTG 382-394

706-716

721-738

3 - CATTACCAATTCCATGTAGCAAGC

4 - GTCGATGTGTCGCACTTC

Figure 1. Primers used for DNA amplification designed to mousehepatoma hexokinase I cDNA (Arora et al., 1990). Arrowheadsmark the position of primers (sequences below) and direction ofcDNA synthesis. Nested primers were designed with EcoRlrestriction sites underlined, for cloning of products. A hydrophobicdomain ( • ) , ATP binding domains (•) and glucose bindingdomains (0) are also indicated.

washed by vortexing three times in 400 ul NaCl followed by twowashes in 80% ethanol before being stored under ethanol at -70°Cfor a maximum of 2 weeks.

Reverse transcriptionThe production of a first strand cDNA template and product amplifica-tion were conducted according to the method of Collins and Fleming(1995). First strand cDNA synthesis was performed in a total volumeof 20 ul. The reaction mixture contained 50 mM Tris-HCl pH 8.3,75 mM KC1, 3 mM MgCl2, 10 mM dithiothreitol (DTT), 1 mM ofeach dNTP, 1 uM outer antisense hexokinase primer 4 (Figure 1),35 IU RNAguard ribonuclease inhibitor (Pharmacia, St Albans, UK)and 200 IU Moloney-murine leukaemia virus (M-MLV) reversetranscriptase (Gibco-BRL, Paisley, UK). The samples were incubatedfor 10 min at 27°C followed by 45 min at 37°C and 5 min at 95°C.

First stage cDNA amplificationAmplification of the first strand cDNA product was performed usingouter hexokinase primers 1 and 4 (Figure 1) in a total volume of45 ul. The reagents were added above solidified Dynawax (FlourgenInstruments Ltd, Lichfield, UK) and contained 4.5 u.1 10X Vent buffer(100 mM KC1, 100 mM (NH^SC^, 200 mM Tris-HCl pH 8.8,20 mM MgSO4, 1% Triton X-100) as supplied with Vent DNApolymerase (New England Biolabs, Hitchin, UK), 0.6 uM of theouter antisense and 1 uM of the sense outer primer. The first strandtemplate (20 u.1) was added and the samples heated to 65°C for 5 min(hot start). After cooling the samples on ice, false priming waseliminated by adding 1 IU of Vent polymerase in 5 (il IX Vent bufferabove solidified wax. The reaction was cycled 30 times at 95°C for30 s, 72°C for 60 s and 56°C for 60 s.

Second stage cDNA amplificationFurther amplification of the first stage product was performed usingnested hexokinase primers 2 and 3 (Figure 1). For each sample, a43 uJ reaction mixture was prepared containing 4.5 ul 10X Ventbuffer, 10 mM dNTPs, 1 uM of each primer and 2 ul of the firststage template. 1 IU of Vent polymerase was again added abovesolidified wax using hot start as described above. The reaction wascycled 30 times at 95°C for 30 s, 72°C for 60 s and 56°C for 60 s.

Two control samples were performed concurrently with eachexperiment; a MAP control conducted in the absence of an embryoand a reagent control performed in the absence of MAP. Theseeliminate any potential involvement of environmentally introducedDNA contamination of samples. The technique has also been shown

Dow

nloaded from https://academ

ic.oup.com/m

olehr/article/2/10/793/1004809 by guest on 10 Decem

ber 2021

Hexokinase in the mouse embryo

to eliminate genomic DNA contamination from the embryos (Collinsand Fleming, 1995). Amplified cDNA products were analysed on 1%agarose gels in Tris borate EDTA (pH 8.0) buffer, stained with 1 (ig/mlethidium bromide and photographed using a Polaroid DS34 instantcamera on 667 Polaroid film.

Cloning and sequencing reactionThe cDNA amplification product from blastocysts was digested withEcoRl, purified on a Wizard polymerase chain reaction (PCR) column(Promega, Southampton, UK) and ligated into a pGEX:lXT vector(Pharmacia). The ligation reaction was dialysed over 10% glycerolbefore being electroporated into DH5ct competent cells (CambridgeBioscience, Cambridge, UK). The transformed cells were grown andplasmid DNA purified using an alkaline lysis method (Sambrooket al., 1989). The orientation of the insert was determined by digestionwith BamHl and Bsaml. A total of five clones with the insert inboth the correct and incorrect orientation were further purified usinga Wizard miniprep purification system (Promega) and sequencedusing the sequenase version 2.0 kit (Amersham, Little Chalfont,UK) with a 5' pGEX primer (CTGGCAAGCCACGTTTGGTG).Sequences were read in both directions and analysed using a DNAStarcomputer programme (DNAStar Ltd, London, UK).

Procedure to extract enzymes from early mouse embryosIndividual day 4 freshly flushed blastocysts were transferred to amicrocapillary tube containing between 1-2 |il of enzyme extractionbuffer [25% glycerol, 1 mM EDTA, 100 mM K2HPO4) 5 mM2-mercaptoethanol, 2 mg/ml bovine serum albumin (BSA), 0.5%Triton X-100 pH 7.5]. These volumes were sufficient to perform bothsample and control experiments. The ends of the microcapillary tubeswere sealed with parafilm and immediately stored at -70°C. Singlepostimplantation embryos on day 6.5 and 7.5 post-fertilization weretransferred to microcentrifuge tubes containing 15-30 u.1 of enzymeextraction buffer and homogenized before being stored at -70°C. Theextraction buffer was based on that from Chi et al. (1988) and Martinet al. (1993) and acted to release and solubilize the enzymes as wellas protect against degradation.

Measurement of maximal hexokinase (EC 2.7.1.1) activityAfter thawing on ice, the embryo extract was expelled under oil ona siliconized microscope slide. A 0.2-1.0 |il sample of the embryoextract was placed on a clean siliconized microscope slide and 0.2-0.5 ul of reaction media (5 mM MgCl2, 5 mM ATP, 1.5 mM NADP+,I mM glucose, 100 mM triethanolamine, 5 IU/ml glucose-6-phosphatedehydrogenase, pH 7.6) added. This was immediately taken up in a5 |il microcapillary tube and the ends sealed with parafilm. The rateof reaction was assessed with time by measuring the appearance ofNADPH. The samples were excited at 340 nm and the emittedlight collected at 459 nm and above using a Fluovert fluorescencemicroscope with photomultiplier and photometer attachments (Leica,Milton Keynes, UK). Reactions were conducted at 20°C over a periodof ~60 min. There was a linear rate of reaction and an increase influorescence as the reaction proceeded due to the reduction of NADP+

to NADPH. For each measurement of maximal enzyme activity acontrol sample was also run, using a reaction mixture containing allthe reagents with the exception of the enzyme substrate. This allowedany endogenous oxidation or reduction of co-factors to be determined.The increase in fluorescence was measured against an NADH standardcurve over the range of 0-0.2 mM. Kinetic experiments wereperformed to calculate the KM and V ^ of hexokinase at theblastocyst, day 6.5 and 7.5 stage, using reaction mixtures containingglucose in the range O-l.O mM. Data were expressed as Lineweaver-Burk plots; l/s versus l/v.

oocytt 2-c*ll 8-ctU moral* bUatocyit day 6J dxy 7.5

Figure 2. Relationship between maximal hexokinase activity ( • )and glucose consumption (O) by the early mouse embryo. Valuesof hexokinase activity for the oocyte to morula stage embryos aretaken from Hooper and Leese (1989), the figures for glucoseconsumption from Houghton et al. (1996). Values are the mean ofbetween six and nine observations ± SEM.

Statistical analysisMaximal enzyme activities were expressed as pmol/embryo/h orpmol/ng protein/h. Values of protein content for blastocysts werethose of Sellens et al. (1981) and for postimplantation embryos, fromHoughton et al. (1996). Hexokinase activity between stages wascompared by one-way analysis of variance; differences betweenindividual means were compared by Fisher's test.

ResultsMaximal hexokinase activity has been determined in extractsof single blastocysts, day 6.5 and 7.5 embryos. Hexokinaseactivity increased from 0.025 ± 0.005 nmol/embryo/h on day4 to 1.33 ± 0.22 on day 6.5 before increasing significantly(P < 0.01) to 7.92 ± 0.87 nmol/embryo/h on day 7.5. Tocompare the activity between the peri-implantation stages, itwas necessary to take into account the protein content of theseembryos. Figures for protein content at the blastocyst stagewere obtained from Sellens et al. (1981); those at day 6.5 and7.5 from Houghton et al. (1996), who found an increase inprotein of 170-fold and 4.5-fold between the blastocyst andday 6.5 embryo, and the day 6.5 and day 7.5 embryosrespectively. When this was performed, hexokinase activitydecreased significantly {P <0.01) from 0.97 ±0 .19 nmol/|igprotein/h at the blastocyst stage to 0.31 ± 0.05 nmol/(igprotein/h on day 6.5 (Figure 2). On day 7.5, hexokinase activitywas 0.42 ± 0.05 nmol/flg protein/h, significantly lower (P<0.01) than that at the blastocyst stage but not from that onday 6.5. The KM for hexokinase was determined over the peri-implantation stages by measuring the maximal activity atvarying substrate concentrations (Figure 3). The KM was 0.39,0.23 and 0.23 mM glucose for the blastocyst, day 6.5 and day7.5 stages respectively.

The presence of mRNA for hexokinase I in the preimplanta-tion mouse embryo was characterized by reverse transcription(RT)-cDNA amplification using primers designed againstmouse tumour hexokinase I cDNA (Arora et al., 1990). Usingthese primers, the /V-terminal glucose binding domain ofhexokinase I was amplified from single-staged embryos. Tran-scripts were detected at all stages of development with theproduction of a single 334 bp cDNA fragment (Figure 4) from

795

Dow

nloaded from https://academ

ic.oup.com/m

olehr/article/2/10/793/1004809 by guest on 10 Decem

ber 2021

F.D.Houghton et al.

E o

§ • ! •

I 1

0.30-

0.20-

. 4 - 2 0 2 4 6 8 10 12 14

1/substrate concentration (mM'1)

- 6 - 4 - 2 0 2 4 6 8 10 12 14 16 18 20 22

1/substrate concentration (mM''l

S 10 12 14 16 IS 20 22

l-ll1/substrate concentration (mM'1)

Figure 3. Lineweaver-Burk plot of hexokinase by the blastocyst(•), day 6.5 (A) and day 7.5 (O) embryo. Values are the mean offour to six determinations ± SEM.

the oocyte and zygote to the blastocyst stage (n = 2-5 determinations for each developmental stage). When theblastocyst PCR product from five separate clones, with thecDNA insert cloned in both orientations, was sequenced andanalysed by the Wilbur and Lipman method (1983) using aDNAStar computer programme, it was found to be 98%homologous with mouse tumour hexokinase I (Arora et al.,1990).

DiscussionHexokinase activity has previously been measured in pre-implantation embryos from the mouse (Brinster, 1968; Chiet al., 1988; Hooper and Leese, 1989; Ayabe et al, 1994) andhuman (Chi et al., 1988; Martin et al., 1993). All these reportsfound that activity increases at the blastocyst stage when

796

1 m

Figure 4. Detection of hexokinase transcripts by reversetranscription-cDNA amplification of single mouse embryosthroughout preimplantation development. Lanes (a, m) 100 bpmarkers, arrowheads at 600 bp; (b) oocyte; (c) zygote; (d) 2-cell;(e) 4-cell; (f) pre-compact 8-cell; (g) compact 8-cell; (h) 16-cell;(i) morula; (j) blastocyst; (k) no template control; (1) reagentcontrol.

glucose consumption rises, suggesting a possible role for thisenzyme in regulating glucose metabolism.

Our values for the maximal hexokinase activity for mouseblastocysts were comparable to those obtained by Hooper andLeese (1989) who used a similar technique, but ~30% higherthan those of Ayabe et al. (1994) who used a freeze dryingmethod and performed enzyme recycling techniques to amplifythe fluorescence signal.

The hexokinase activity of early mouse postimplantationembryos has not previously been reported. Activity over theperi-implantation period was found broadly to parallel that ofglucose consumption suggesting a regulatory role for hexo-kinase during this time. At each stage, blastocyst, day 6.5and day 7.5, hexokinase activity exceeded that of glucoseconsumption by factors of 3.4, 1.4 and 2.5 respectively. Duringthe preimplantation period, prior to the blastocyst stage,hexokinase activity is initially very low but then increases(Hooper and Leese, 1989) coincident with a rise in glucoseconsumption (Leese and Barton, 1984). It is likely, however,that hexokinase activity in vivo is below the maximal in-vitrorates measured, due to feedback inhibition from glucoses-phosphate and other factors. The true ratio of hexokinase toglucose consumption in vivo, is therefore likely to be closerto unity.

Our limited kinetic characterization of mouse hexokinaseindicates that hexokinase IV, which has a high KM for glucose,~10 mM, is unlikely to be present. The KM obtained for allperi-implantation stages was low (0.23—0.39 mM) indicatinga high binding capacity and therefore the possible presence ofhexokinase I, II or III. Hexokinase II predominates in insulinsensitive tissues and although insulin increases protein syn-thesis and cell number in the early mouse embryo (Gardnerand Kaye, 1991), it has no effect on glucose consumption inthe peri-implantation mouse embryo (F.D.Houghton et al.,unpublished observation). This is not surprising, since theinsulin sensitive glucose transporter GLUT 4 is not expressedat this stage of development (Hogan, 1991). The presence ofhexokinase HI is also unlikely, since with the exception of pigerythrocytes, this isoenzyme has only been found in very small

Dow

nloaded from https://academ

ic.oup.com/m

olehr/article/2/10/793/1004809 by guest on 10 Decem

ber 2021

Hexokinase in the mouse embryo

Table I. Sequence homology between mouse blastocyst cDNA hexokinaseproduct and other isoenzymes

Species/hexokinaseisoenzyme

Mouse tumour IRat brain IRat skeletal muscle IIRat liver HIRat pancreatic f}-cell IV

Homology withPCR product (%)

9893726471

Reference

Arora et al. (1990)Schwab and Wilson (1989)Thelen and Wilson (1991)Schwab and Wilson (1991)Magnuson and Shelton (1989)

PCR = polymerase chain reaction.

amounts in mammalian cells. We therefore investigated thegene expression of hexokinase I in the preimplantationmouse embryo.

The RT-PCR data indicated the presence of hexokinase ImRNA throughout all stages of preimplantation development.When cloned and sequenced, the PCR product was 98%homologous with mouse tumour hexokinase I and displayed ahigh degree of homology with rat hexokinase I (Table I). Atthe present time, there are no sequence data available formouse hexokinase II-TV, although when compared with ratisoenzymes II, m and IV the results obtained were consistent,with -70% homology, suggesting that it is a member of thesame family (Deeb et al, 1993).

Since the hexokinase I gene is switched on and transcriptionoccurs throughout preimplantation development, the increasein hexokinase activity seen at the blastocyst stage cannot beattributed to de novo synthesis of hexokinase I mRNA. TheRT-PCR technique used in this report simply indicates thepresence or absence of transcripts and does not quantitate ormeasure stability of the mRNA. Hence, it is feasible that anincrease in the stability of hexokinase I mRNA at the morulastage, could result in increased translation of the hexokinase Iprotein. This in turn could account for the significant increasein enzyme activity observed at the blastocyst stage. Temporalregulation of hexokinase activity in the late morula is thereforedistinct from that of other genes upregulated at this stage, suchas desmocollin (DSC2) and ZO-1 oc+ isoform. These proteinsare involved in intercellular adhesion and mRNA transcriptsfrom their genes are first expressed at the morula stage (Collinset al, 1995; Sheth et al, 1995). These transcripts are thenrapidly translated and the proteins assembled at the junctions,indicating that they are controlled at the transcriptional level.Further studies to investigate the gene regulation of hexokinaseI would require a complete DNA sequence; experiments tomeasure the influence of regulatory proteins on the stabilityof the mRNA could then be conducted.

When represented on a pmol/|ig protein/h basis, hexokinaseactivity at the postimplantation stages is comparable to that ofthe morula—a stage of development where there is a transitionfrom a metabolism based on pyruvate to one dependent onglucose. These considerations and the decrease in hexokinaseon days 6.5 and 7.5 suggest that glucose is not a major energysubstrate in day 6.5 and 7.5 mouse embryos.

Hexokinase and the role of inorganic phosphate inearly mouse embryo developmentBarnett and Bavister (1996) reported that glucose and inorganicphosphate (Pj) were inhibitory to hamster 2-cell embryo

development. Since P, is known to stimulate glycolysis, apathway potentially deleterious to the embryo (Gardner andLeese, 1990; Leese, 1991), the most likely explanation for thisphenomenon is that conversion of glucose to lactate isenhanced. Hexokinase, the first enzyme of glycolysis, isinhibited by its product, glucose 6-phosphate, an inhibitionrelieved by P, (Uyeda and Racker, 1965). We postulate thatomitting P, from embryo culture media allows glucose 6-phosphate to inhibit hexokinase and in this way limit theextent of glycolysis. This proposition is obviously testable.

In conclusion, the maximal activity and KM of hexokinasehas been measured in single peri-implantation mouse embryos.The profile of activity had a similar pattern to glucoseconsumption over this period. In addition using RT-PCR,hexokinase I mRNA was detected at all stages of preimplanta-tion development.

AcknowledgementsThe authors wish to thank Mark Hay for his technical assistanceduring this study. F.D.H. is a recipient of a BBSRC Studentship.Further financial support was obtained from grants by the WellcomeTrust and MRC to T.P.F.

ReferencesArora, K.K., Fanciulli, M. and Pedersen, P.L. (1990) Glucose phosphorylation

in tumor cells. J. Biol. Chem., 265, 6481-6488.Ayabe, T, Tsutsumi, O and Taketani, Y. (1994) Hexokinase activity in mouse

embryos developed in vivo and in vitro. Hum. Reprod., 9, 347—351.Barbehenn, E.K., Wales, R.G. and Lowry, O.H. (1974) The explanation for

the blockage of glycolysis in early mouse embryos. Proc. Nail. Acad. Sci.USA, 71, 1056-1060.

Barbehenn, E.K., Wales, R.G. and Lowry, O.H. (1978) Measurement ofmetabolites in single preimplantation embryos: a means to study metaboliccontrol in early embryos. J. Emb. Expt. Morph., 43, 29—46.

Barnett, D.K. and Bavister, B.D. (1996) Inhibitory effect of glucose andphosphate on the second cleavage division of hamster embryos: is it linkedto metabolism? Hum. Reprod., 11, 177-183.

Biggers, J.D., Whittingham, D.G. and Donahue, R.P. (1967) The pattern ofenergy metabolism in the mouse oocyte and zygote. Proc. Nail. Acad. Sci.USA, 58, 560-567

Bnnster, R.L. (1965a) Studies on the development of mouse embryos in vitro.II The effect of energy source. J. Exp. Zool., 158, 59-68.

Brinster, R.L. (1965b) Studies on the development of mouse embryos in vitro.IV Interaction of energy source. /. Reprod. Fertil., 10, 227-240.

Brinster, R.L. (1968) Hexokinase activity in the preimplantation mouseembryo. Enzymologia, 34, 304-308.

Brinster, R.L. and Thomson, J.L. (1966) Development of eight-cell mouseembryos in vitro. Exp. Cell. Res., 42, 308-315.

Chi, M.M.-Y., Manchester, J.K., Yang, V.C. et al. (1988) Contrast in levelsof metabolic enzymes in human and mouse ova. Biol. Reprod., 39,295—307.

Clough, J.R. and Whittingham, D.G. (1983) Metabolism of [MC] glucose bypostimplantation mouse embryos in vitro. J. Embryol. Exp. Morphol., 74,133-142.

Collins, J.E. and Fleming, T.P. (1995) Specific mRNA detection in singlelineage-marked blastomercs from preimplantation embryos. Trends Genet.,

• 11, 5-7.Collins, J.E., Lorimer, J.E., Garrod, D.R. et al. (1995) Regulation of

desmocollin transcription in mouse preimplantation embryos. Development,121, 743-753.

Deeb, S.S., Malkki, M. and Laakso, M. (1993) Human hexokinase II: sequenceand homology to other hexokinases. Biochem. Biophys. Res. Commun.,197, 68-74.

Ellington, S.K.L. (1987) In vitro analysis of glucose metabolism and embryonicgrowth in postimplantation rat embryos. Development, 100, 431-439.

797

Dow

nloaded from https://academ

ic.oup.com/m

olehr/article/2/10/793/1004809 by guest on 10 Decem

ber 2021

F.D.Houghton et al.

Gardner, D.K. and Leese, HJ. (1986) Non-invasive measurement of nutrientuptake by single cultured preimplantation mouse embryos. Hum. Reprod.,1, 25-27.

Gardner, D.K. and Leese, HJ. (1990) Concentrations of nutrients in mouseoviductal fluid and their effects on embryo development and metabolism.J. Reprod. Fertil., 88, 361-368.

Gardner, H.G. and Kaye, P.L. (1991) Insulin increases cell numbers andmorphological development in mouse preimplantation embryos m vitro.Reprod. Fertil. Dev., 3, 79-91.

Hogan, A. et al (1991) Glucose transporter gene expression in early mouseembryos. Development, 113, 363-372.

Hooper, M.A.K. and Leese, HJ. (1989) Activity of hexokinase in mouseoocytes and preimplantation mouse embryos. Biochem. Soc. Trans., 629,546-547.

Houghton, F.D., Thompson, J.E., Kennedy, CJ. and Leese, HJ. (19%) Oxygenconsumption and energy metabolism of the early mouse embryo. Mol.Reprod. Dev., 44, 476-485.

Katzen, H.M. and Schimke, R.T. (1965) Multiple forms of hexokinase in therat: tissue distribution, age dependency and properties. Proc. Natl. Acad.Sci. USA, 54, 1218-1225.

Leese, HJ. (1991) Metabolism of the preimplantation mammalian embryo. InMilligan, S.R. (ed.), Oxford Reviews of Reproduction, Oxford UniversityPress, New York, pp. 35-72.

Leese, HJ. and Barton, A.M. (1984) Pynivate and glucose uptake by mouseova and preimplantation embryos. J. Reprod. Fertil., 72, 9—13.

Magnani, M. et al. (1983) Pig red blood cells hexokinase: regulatorycharacteristics and possible physiological role. Arch. Biochem. Biophys.,266, 377-387.

Magnuson, M.A. and Shelton, fCD. (1989) An alternate promoter in theglucokinase gene is active in the pancreatic beta cell. /. Biol. Chem., 264,15936-15942.

Martin, K.L. and Leese, HJ. (1995) Role of glucose in mouse preimplantationembryo development. Mol. Reprod. Dev., 40, 436-443.

Martin, K.L., Hardy, K., Winston, R.H.L. and Leese, HJ. (1993) Activity ofenzymes of energy metabolism in single human preimplantation embryos./. Reprod. Fertil, 99, 259-266.

Newsholme, E.A. and Leech, A.R. (1989) Biochemistry for the MedicalSciences. John Wiley and Sons Ltd, London.

Newsholme, E.A. and Start, C. (eds) (1973) Regulation in Metabolism. JohnWiley and Sons Ltd, London.

Preller, A. and Wilson, J.E. (1992) Localisation of the type III isozyme ofhexokinase at the nuclear periphery. Arch. Biochem. Biophys., 294,482—492.

Sambrook, J., Fritsch, E.F. and Maniatis, T. (eds) (1989) Molecular Cloning:A Laboratory Manual. Cold Spring Harbor Laboratory Press, New York.

Schirch, D.M. and Wilson, J.E. (1987) Rat brain hexokinase: localisation ofthe substrate hexose binding site in a structural domain at the C-terminusof the enzyme. Arch. Biochem. Biophys., 254, 385-396.

Schwab, D.A. and Wilson, J.E. (1989) Complete amino acid sequence of ratbrain hexokinase, deduced from the cloned cDNA, and proposed structureof a mammalian hexokinase. Proc. Natl. Acad. Sci. USA, 86, 2563-2567.

Schwab, D.A. and Wilson, J.E. (1991) Complete amino acid sequence of thetype III isozyme of rat hexokinase deduced from the cloned cDNA. Arch.Biochem. Biophys., 285, 365-370.

Sellens, M.H., Stein, S. and Sherman, M.I. (1981) Protein and free aminoacid content in preimplantation mouse embryos and in blastocysls undervarious culture conditions. J. Reprod. Fertil., 61, 307-315.

Sheardown, S.A. (1992) A simple method for affinity purification and PCRamplification of poly(A)+ mRNA. Trends Genet., 8, 121.

Sheth, B., Collins, J.E. and Fleming, T.P. (1995) Expression of tight junctionprotein, ZO-1, in mouse embryos. Mol Biol Cell, 6, 193.

Stocchi, V, Magnani, M., Novelli, G. et al. (1983) Pig red blood cellhexokinase: evidence for the presence of hexokinases type II and III, andtheir purification and characterisation. Arch. Biochem. Biophys., 266,365-376.

Thelen, A.P. and Wilson, J.E. (1991) Complete amino acid sequence of thetype II isozyme of rat hexokinase, deduced from the cloned cDNA:Comparison with a hexokinase from Novikoff ascites tumor. Arch. Biochem.Biophys., 286,645-651.

Ureta, T. (1982) The comparative isozymology of vertebrate hexokinases.Comp. Biochem. Physiol, 71B, 549-555.

Uyeda, K. and Racker, E. (1965) Coordinated stimulation of hexokinase andphosphofructokinase by phosphate in a reconstituted system of glycolysis.In Chance, B., Estabrook, R.W. and Williamson, J.R. (eds), Control ofEnergy Metabolism. Academic Press, New York, pp. 127-137.

White, T.K. and Wilson, J.E. (1989) Isolation and characterisation of thediscrete N- and C-terminal halves of rat brain hexokinase: retention of fullcatalytic activity in the isolated C-terminal half. Arch. Biochem. Biophys.,274, 375-393.

White, T.K. and Wilson, J.E. (1990) Binding of nucleoside triphosphates,inorganic phosphates and other polyanionic ligands to the W-terminal regionof rat brain hexokinase: relationship to regulation of hexokinase activityby antagonistic interactions between glucose-6-phosphate and inorganicphosphate. Arch. Biochem. Biophys., 277, 26-34.

Whitten, W.K. and Biggers, J.D. (1968) Complete development in vitro of thepreimplantation stages of the mouse in a simple chemically defined medium.J. Reprod. Fertil, 17, 399-401.

Whittingham, D.G. (1971) Culture of mouse ova. J. Reprod. Fert., 14, Suppl.,7-21.

Wilbur, WJ. and Lipman, DJ. (1983) Rapid similarity searches of nucleicacid and protein data banks. Proc. Natl. Acad. Sci. USA, 80, 726-730.

Received on May 20, 1996; accepted on August 20, 1996

798

Dow

nloaded from https://academ

ic.oup.com/m

olehr/article/2/10/793/1004809 by guest on 10 Decem

ber 2021