EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL...
Transcript of EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL...
![Page 1: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/1.jpg)
WHO/BS/2019.2373
ENGLISH ONLY
EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION
Geneva, 21 to 25 October 2019
Report on a Collaborative Study
for the Proposed WHO 1st International Reference Panel (19/158) for the
Quantitation of Lentiviral Vector Integration Copy Numbers
Yuan Zhao1, Christopher Traylen, Peter Rigsby, Eleanor Atkinson, Stifani Satkunanathan, Participants2 and
Christian K Schneider
National Institute for Biological Standards and Control, Blanche Lane, South Mimms, Potters
Bar, HERTS EN6 3QG, UK 1Email address: [email protected]
2 Table 1
NOTE:
This document has been prepared for the purpose of inviting comments and suggestions on the
proposals contained therein, which will then be considered by the Expert Committee on
Biological Standardization (ECBS). Comments MUST be received by 27 September 2019 and
should be addressed to the World Health Organization, 1211 Geneva 27, Switzerland, attention:
Technologies, Standards and Norms (TSN). Comments may also be submitted electronically to
the Responsible Officer: Dr Ivana Knezevic at email: [email protected].
© World Health Organization 2019
All rights reserved.
This draft is intended for a restricted audience only, i.e. the individuals and organizations having received this draft. The draft
may not be reviewed, abstracted, quoted, reproduced, transmitted, distributed, translated or adapted, in part or in whole, in any
form or by any means outside these individuals and organizations (including the organizations' concerned staff and member
organizations) without the permission of the World Health Organization. The draft should not be displayed on any website.
Please send any request for permission to:
Dr Ivana Knezevic, Technologies Standards and Norms, Department of Essential Medicines and Health Products, World Health
Organization, CH-1211 Geneva 27, Switzerland. Email: [email protected].
The designations employed and the presentation of the material in this draft do not imply the expression of any opinion whatsoever on the part of the World Health Organization concerning the legal status of any country, territory, city or area or of its
authorities, or concerning the delimitation of its frontiers or boundaries. Dotted lines on maps represent approximate border lines
for which there may not yet be full agreement.
![Page 2: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/2.jpg)
WHO/BS/2019.2373
Page 2
The mention of specific companies or of certain manufacturers’ products does not imply that they are endorsed or recommended
by the World Health Organization in preference to others of a similar nature that are not mentioned. Errors and omissions
excepted, the names of proprietary products are distinguished by initial capital letters.
All reasonable precautions have been taken by the World Health Organization to verify the information contained in this draft.
However, the printed material is being distributed without warranty of any kind, either expressed or implied. The responsibility
for the interpretation and use of the material lies with the reader. In no event shall the World Health Organization be liable for
damages arising from its use.
This draft does not necessarily represent the decisions or the stated policy of the World Health Organization.
Summary
This report describes the development and characterisation of four candidate materials and
evaluation of their suitability to serve as WHO standards for lentiviral vector (LV) integration
analysis. The development of the 1st WHO standard for lentiviral vector integration is to meet a
high demand from the community to ensure delivery of a safe and efficacious dose of LV products
to patients and to facilitate patient follow-up worldwide. The materials comprise human genomic
DNA containing zero, low or high copies of a lentiviral vector integration. The lentiviral vector
integration copy number per cell was determined in an international collaborative study using three
principal methods: TaqMan qPCR, SYBRGreen qPCR and digital PCR, and supplementary
sequencing-based methods. A total of thirty-one laboratories from fifteen countries participated in
the collaborative study, including eight National Regulatory/Control laboratories; six academic
laboratories/hospitals and seventeen companies (Table 1). Based on the results obtained in this
study, three of the candidate materials are proposed as a reference panel for LV copy number with
assigned values of 0 LV copies/cell (coded 18/142), 1.42 LV copies/cell for the low value material
(coded 18/126) and 8.76 LV copies/cell for the high value material (coded 18/132) It is also
proposed that the other candidate material (coded 18/144) is established as a stand-alone
qualitative reference reagent for the integration site analysis, with 10 defined integration sites.
The intended use of the WHO 1st Reference panel (19/158) of three materials (18/126, 18/132 and
18/142) is for end-users to generate a genomic DNA standard curve from sample 18/132 using
18/142 as the diluent and to include 18/126 as a positive control (in order to confirm comparable
LV copies/cell to the consensus value for the sample 18/126 to validate the assay for unknown
sample quantitation). The WHO 1st Reference Reagent (18/144) is to be used as a standard-alone
qualitative reference reagent for the integration site analysis, with a confident detection of the ten
defined integration sites, in order to validate end-users’ integration-site study protocols. The
stability studies at eight months so far indicated that the candidate preparations are stable for long-
term storage at -20˚C.
Introduction
Lentiviral vectors (LV) have been successfully used in a cure for monogenic immunodeficiency
disorders and CAR T cell cancer immunotherapies. Two Chimeric Antigen Receptor CAR-T-cell
therapies Kymriah and Yescarta, and an ex vivo therapy for monogenic immunodeficiency,
Strimvelis, using integrating vectors have been approved to be used in EU and US markets. There
are currently a total of 138 LV clinical trials worldwide (6 in Phase III/IV), and 58 Chimeric
![Page 3: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/3.jpg)
WHO/BS/2019.2373
Page 3
Antigen Receptor CAR-T-cell trials (18 in Phase II/IV) (https://clinicaltrials.gov/). In addition, the
number of potential patients using LV based products will be significant, given that a number of
products in development using CRISPR, TALEN, nucleases, Zinc Finger or iPSC technologies
also use a lentiviral vector as tools or delivery system for genetical modification of the products.
Nevertheless, the number of patients is only one of the factors important for estimating the public
health impact; the severity of disease, impact of a given disease on both the patient and society,
and its unmet medical need are also important determinants for the impact of lentiviral vector-
based products. This is confirmed by experiences across jurisdictions from orphan medicinal
products where the number of patients is by definition very small, but the clinical impact of
medicines can be considerable.
Manufacture of LV based products used in ex vivo autologous therapies is often a de-centralized
or near-patient process. The complexity and intrinsic disparity of decentralized manufacture will
benefit significantly from an enhanced in-process control and standardization to ensure product
consistency. Significant efforts have been made in the field of CAR-T cell therapies using lentiviral
vectors to move from autologous to allogenic therapies and from near-patient to centralized
manufacturing processes. Well-controlled and standardized processes as well as well-understood
and consistent products are particularly important for LV based ex vivo therapies; therefore,
standardization of manufacturing processes for ex vivo lentiviral products is one that is best put in
place early in product development.
The need for standardization of LV integration is recognised due to uncontrolled LV integrations
potentially leading to insertional mutagenesis and overexpression or disruption of adjacent genes
at the site of integration. For example, the lentiviral vector used was found to disrupt the HMGA2
transcript in a Thalassemia trial2. Intragenic insertions of lentiviral vectors leading to aberrant gene
regulation have been identified in preclinical studies4-8. Therefore, using the lowest LV copy
numbers per cell that have been demonstrated to provide clinical benefit is, currently, an effective
measure to minimize the risk of insertional mutagenesis in target cells and reduce the genotoxic
and tumorigenic potential.
In addition, patients need to be monitored for long-term safety, often lifelong, for the level of
vector copies in blood cells. This level may be used to determine further treatment options.
Because cell modification occurs at multiple sites, assay standardisation is vital to ensure delivery
of a safe and efficacious dose, including allowing determining if a negative test result is “truly”
negative – a false negative test result may have far reaching consequences for the patient and the
benefit/risk assessment of a particular medicinal product. Global patient follow-up with rare
disease needs to be consistent for the individual and for the patient population.
Currently quantitative PCR, e.g. TaqMan qPCR, SYBRGreen qPCR, digital PCR and high-
throughput sequencing are the common methods used in integration analysis. All current methods
have significant limitations in terms of sensitivity, accurate quantification and data interpretation.
It has been previously shown that using the currently available methods, the integration vector
copy numbers (VCN) were often underestimated9. This is because the choice and design of
amplification target sequences and the conditions of reaction impact on the specificity and
sensitivity of PCR based methods, which makes it difficult to compare data across clinical trials,
assays and laboratories.
![Page 4: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/4.jpg)
WHO/BS/2019.2373
Page 4
The European Medicines Agency (EMA) and US Food and Drug Administration (FDA) require
integration studies and long-term follow-up on products like Lentiviral vectors that have a capacity
to permanently integrate into the host cells and to persist for a long time in treated individuals. The
EMA requirement for supporting marketing authorization applications includes integrated vector
copies per genome, integration profile and integration sites [EMA/CAT/190186/2012,
EMA/CAT/80183/2014]. An EMA reflection paper [EMA/CAT/190186/2012] on the
‘management of clinical risks deriving from insertional mutagenesis’ also highlighted the high
vector copy number as a risk factor for oncogenesis and recommended risk assessment and
management of the integration copy numbers, integration profile and sites in products. FDA
recommends limiting the integration copy number to under 5 copies per cell (presentation by Dr.
Vatsan/FDA at ISBioTech conference on March 7, 2017).
In 2016, an International Workshop was held at NIBSC with representation from Regulatory
agencies, pharmaceutical manufacturers, control laboratories and academia to discuss the logistics
of developing the 1st WHO lentiviral integration standard. The discussion included 1) the type of
standard materials, e.g. plasmid DNA, freeze-dried cells or genomic DNA, 2) the type of cell to
be used, e.g. MRC-5 cells, T cell line, 293T or hematopoietic cells, 3) production methods, e.g.
using bulk cell population or single cell clone for standard production, 4) composition of the
standard, a single standard material or a panel (>3) of standards, containing zero, 1 or up to 10
copies of LV integration. It was agreed at the Workshop to develop a panel of genomic DNA
standards from a single cloned cell line containing 0, 1 or up to 10 of LV integration with an
assigned unitage of LV copies/cell using as wide a range as possible of detection methods, e.g.
qPCR, digital PCR, LAM-PCR, whole genome sequence and Southern blot, to assign an unitage
of LV copies/cell to individual materials of the standard panel. Subsequently, a paper was
published in 2017 in Human Gene Therapy Methods (Appendix XI
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5628571/)10 to provide further information on the
history, rationale, proposed production and evaluation process and preliminary results for the
establishment of the candidate standard panel. The collaborative study (NIBSC study code CS633)
was conducted in 2018 with the participation of thirty-one laboratories from fifteen countries and
the aim of evaluating the candidate materials for their suitability to serve as the WHO 1st International
Reference panel (19/158) and Reference Reagent (18/144) for LV integration analysis.
The development of the 1st WHO standard for lentiviral vector integration will meet a high demand
from the community. The WHO standard is primarily for standardizing three milestone stages of
LV product development, that is, establishment of the manufacturing process, clinical dose
determination and patient safety follow-up. During manufacture, the standard could be used to
standardise the LV production process by measuring the number of vectors integrated in an in vitro
testing cell line with methods that are independent of the therapeutic transgene or the promoter.
Standardised LV potency assay is important for batch to batch comparability and consistency
assessment, also allowing for establishing changes and optimization of the manufacturing process
more reliably. Here, the standard could be used as a measurement of potency rather than safety
(insertional mutagenesis is an expression of potency, albeit medically unwanted). Secondly, the
genomic standard can be used to standardise the clinical dose of ex vivo LV products, where the
![Page 5: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/5.jpg)
WHO/BS/2019.2373
Page 5
medicinal product in these applications is the LV modified cells. The clinical protocols set an
average copy number of vector integrants for such products, usually an average of approximately
one copy to ensure efficacy and an upper limit of four copies to minimise the risk of toxicity. In
situations where the gene therapy medicinal product is intended to treat an orphan condition, this
will be particularly useful, since the access to patients for dose optimization is limited, and animal
models may not be sufficiently relevant, depending on the situation.
The development of this genomic DNA reference material for gene therapy supports the WHO’s
objectives to improve global access to Advanced Therapies (ATMPs) by 2030, WHO’s desire to
harmonise global regulation and the UK government’s long-standing task to enable innovation.
The development of a WHO International Reference for gene therapy has been in consideration
for several years, involving discussions with companies, clinicians and the academic community
in order to assess where such standard would be most useful in addressing unmet needs. As a
result, in 2016 the WHO’s Expert Committee on Biological Standardization (ECBS) endorsed the
proposal from NIBSC to develop the first WHO gene therapy genomic DNA standard panel for
the quantitation of lentiviral vector integration copy numbers – a significant milestone in the field
of standardization of biological medicines.
Materials
Bulk material and processing
Full details of the production and validation process for the candidate materials are detailed in
Appendix IV and schematically shown in Figure 3 (Appendix IV). Briefly, 293T cells were
transduced with a 3rd generation of lentiviral vector carrying a reporter gene GFP (kindly donated
by Professor Didier Trono, EPFL, detailed in Figure 2, Appendix IV) at MOI 0.5 to 10 and were
single cell cloned based on LV copies and GFP intensity to establish 18/126 and 18/132.
Candidate material 18/144 was established from double transduction of 18/132 with LV at MOI
~5 before multi-round of single cell cloning. Master cell banks and Working cell banks were
derived from the established single cell clones and were subjected to full characterization including
sterility test, karyotyping, qPCR and ddPCR quantitation of LV copies/cell and sequencing
analysis of LV integration sites (Figure 3, Appendix IV). Bulk genomic DNA were extracted and
purified from Working cell banks for individual candidate materials and were lyophilized at
5ggenomic DNA/ampoule in 10 mM Tris, 1 mM EDTA buffer with 5 mg/mL D-(+)-trehalose
dehydrate, as detailed in Appendix IV.
Cell line choice
HEK293T cells were used in this study on the basis of their performance in lentiviral transduction
experiments and also their rapid growth rates and ease of cloning. Concerns about aneuploidy and
genomic instability have been circumvented by proving this material in DNA-form with a unitage
of LV copies/diploid genome mass. The standard may be used to harmonies the measurement of
LV integrations in patient cells as LV copies/cell by comparison of LV measurement in the
standard and the patient DNA, and then extrapolating back to LV/cell in the patient on the basis
of patient cells being diploid (nLV copies/6.6pg DNA =nLV copies/ diploid cell).
![Page 6: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/6.jpg)
WHO/BS/2019.2373
Page 6
LV integration
The LV integration copies per cell (diploid genome mass) adopted in this study were derived from
using Albumin as the housekeeping gene with the sequence copy number N=2 per diploid cell
genome mass. The use of LV copies/cell as the unitage instead of International Units (IU) for the
candidate Reference panel is because 1) as shown in a summary table of 43 publications over last
10 years between 2000 and 2019 (Appendix XII), three types of Unitage have been used to express
LV integration copies in cells, i.e. LV copies/cell, LV copies/genome or LV copies/genome mass
e.g. ng or g with LV copies/cell being most common - the three Unitage expressions are in effect
inter-changeable and traceable to each other, this is because, one cell has one diploid cell genome
weight of 6.6pg; 2) current regulatory requirement is to limit LV integration to less than 5
copies/cell; 3) the gene therapy community is relatively new to WHO standardization and would
be unlikely to adopt IU given the common practice of expressing data as LV copies/cell at the
present time.
Stability assessment Multiple samples were reserved for in-house long-term accelerated degradation studies by storage
at temperatures (-150°C, -70°C, -20°C, +4°C, +20°C, +37°C, and +56°C), as well as for real-time
stability monitoring at -20°C. Accelerated degradation studies were performed to predict the long-
term stability of the candidate standard. Ampoules of the lyophilised preparation were stored at
different temperatures, namely +56 oC, +45 °C, +37 oC, 20 oC and 4 °C and tested at indicated
time points together with ampoules stored at the recommended temperature of -20 °C and -70 °C
as baseline reference temperature. Stability study results up to 8 months are detailed in Appendix
V (Figures 5-7 and Tables 11-13). Real time monitoring of stability is ongoing.
Collaborative Study
Aims of the Collaborative Study The purpose of the collaborative study (NIBSC study code CS633) was to evaluate the candidate
materials for their suitability to serve as the WHO 1st International Reference panel for PCR based
quantitation of Lentiviral vector integration copy numbers and to assign a consensus value (LV
integration copy number per cell) to each of the materials.
Participants A total of forty laboratories were willing to participate in the collaborative study, thirty-three
participating laboratories from fifteen countries were dispatched samples, due to the time
constraint, seven laboratories did not received the materials and thirty-one laboratories from
thirteen countries returned data contributing to this study report. The participating laboratories
include eight National Regulatory/Control laboratories; six academic laboratories/hospitals and
seventeen companies (Table 1).
![Page 7: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/7.jpg)
WHO/BS/2019.2373
Page 7
Table 1. List of participants in the collaborative study Country Contacts Address Affiliation
Canada Prof. Amine Kamen,
Michelle Yen Tran, Aline
Minh, David Sharon,
McGill University Academia/hospitals
France Dr. Xavier Leclerc Clean Cells Companies
France Dr. Bastian Herve Sangamo Therapeutics Companies
France Dr. Xavier Chenivesse ANSM Official Control
laboratories
Germany Drs. Manfred Schmidt,
Wei Wang, Irene Gil-
Farina, Marco Zahn
Genewerk GmbH Companies
Germany Drs Carsten Kintscher,
Susanne Knoll
Miltenyi Biotec GmbH Companies
Germany Drs. Csaba Miskey,
Zoltan Ivics
Paul Ehrlich Institute Official Control
laboratories
Italy Drs. Ilaria Visigalli,
Albertini Paola, Michela
Vezzoli, Naldini Luigi
Ospedale San Raffaele Academia/hospitals
Italy Drs. Francesca Rossetti,
Claudia Piovan
MolMed SPA Companies
Italy Drs. Filomena Nappi,
Pisani Giulio
Instituto Superiore di Sanita Official Control
laboratories
Japan Dr. Eriko Uchida National Institute of Health
Sciences
Official Control
laboratories
Korea Dr. Lee Jun-Ho Research Institute of
PharosVaccine
Academia/hospitals
Korea Professor Keerang Park,
Heesoon Change
CdmoGen Co Ltd Companies
P. R. China Drs. Yonghong Li,
Chunming Rao
National Institute for Food and
Drug Control (NIFDC)
Official Control
laboratories
P.R. China Dr. Guodong Javier Jia Obio Technology
(Shanghai)Corp.Ltd
Companies
P.R. China Drs. Haoquan Wu, Ying
Dang
Kanglin Biotech (hangzhou)Co.
Ltd
Companies
P.R. China Dr. Ling He Fundamenta Therapeutics Companies
P.R. China Drs. Wang Yu, Lei Sun Immunotech Applied Science
Ltd
Companies
Portugal Drs. Ana Sofia
Coroadinha, Pedro Cruz
iBET Companies
Singapore Drs. Lucas Chan, Paula
Lam, Wei Xiang Sin
CellVec Pte. Ltd Official Control
laboratories
Switzerland Dr. Caroline Bellac Swissmedic Official Control
laboratories
![Page 8: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/8.jpg)
WHO/BS/2019.2373
Page 8
Taiwan Drs. Yi-Chen Yang, Po-
Chih Wu
Taiwan Food and Drug
Administration
Official Control
laboratories
UK Drs. Daniel Chipchase,
Nicholas Clarkson,
Oxford BioMedica plc Companies
UK Drs. Jorge Soza Ried,
Martijn Brugman, John
Barlow, Steven Howe
GSK Companies
UK Drs. Christopher Perry,
Yasu Takeuchi
Wohl Virion Centre, UCL Academia/hospitals
UK Dr. Christopher Traylen,
Stifani Saktkunanathan
NIBSC/MHRA Official Control
laboratories
USA Dr. Christine Mitchell WuXi AppTec Companies
USA Dr. Clifford Froelich St. Jude Children's Research
Hospital
Academia/hospitals
USA Bradley Hasson, Audrey
Chang
Millipore-Sigma (BioReliance) Companies
USA Drs Deb Bhattacharya,
Alberta Colakovic
Bluebird Bio Companies
USA Dr. Brigitte Senechal MSKCC Academia/hospitals
Collaborative Study Materials Four materials (Table 2) were produced at NIBSC as detailed in Appendix IV_Bulk Material
and Processing and, were evaluated as candidates as the proposed WHO 1st International
Reference panel for the quantitation of Lentiviral vector integration copy numbers. All materials
were of freeze-dried, purified gDNA extracted from four cell lines containing either 0, low or high
copies of lentiviral vector integration.
Table 2. Code, stock number of candidate materials
Ampoule
code Fill date
Study
code
No of
ampoules
offered to
WHO
Excipients
18/126 01/06/2018 B ~2000
2.0 mM Tris,
0.2 mM EDTA,
5 mg/mL D-(+)-trehalose dehydrate
18/132 21/06/2018 C ~2000
18/142 28/06/2018 A, E ~4,000
18/144 28/06/2018 D ~1000
![Page 9: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/9.jpg)
WHO/BS/2019.2373
Page 9
Collaborative Study Design and protocol The collaborative study protocol is summarized as following:
• The panel of four genomic DNA materials coded A/E (18/142), B (18/126), C (18/132)
and D (18/144) were dispatched to participating laboratories. Of the five coded candidate
materials, samples A and E are identical (18/142) and were coded separately merely for the
technical convenience in sample preparation.
• Three principal methods, i.e. TaqMan qPCR, SYBRGreen qPCR, digital PCR and a
supplementary sequencing-based method, were conducted to evaluate the candidate
materials.
• Absolute quantitation, i.e. LV copies per cell, was sought for each candidate material.
• Candidate material C (18/132) was also evaluated in a format of five serial 3-fold dilutions,
i.e. C, C1, C2, C3 and C4, in the presence of the combined sample A/E (18/142) for its
suitability to serve as a quantitative genomic calculation standard.
• Qualitative data was also sought for individual candidate materials for LV integration sites
in human genomic DNA.
• Optional DNA quantitation data was also sought for each of materials for genomic DNA
quantity per ampoule.
Depending on the number of methods to be performed by individual laboratories, at least four sets
of five ampoules of gDNA materials coded A, B, C, D and E were sent to each laboratory. Of the
five coded candidate materials, samples A and E are identical and were coded differently merely
for the technical convenience in sample preparation. One plasmid DNA sample coded as ‘NIBSC
DNA standard’ and two sets of synthesized DNA oligos, coded “NIBSC LV_primer set” or
“NIBSC HK_primer set” were also sent to each laboratory, in case some of the laboratories did
not have in house standard or primers available. Detailed information on NIBSC plasmid standards
and primers sent to the participating laboratories is given in Appendix VI.
Instructions for use (IFU) (Appendix V) detailing the reconstitution, testing sample preparation
and storage conditions together with data reporting sheets were sent to each laboratory. Detailed
example protocols (termed NIBSC protocols, Appendix VII and VIII) were also provided to the
participants although participants were encouraged to use their individual (in house) protocols
wherever possible.
After being reconstituted and prepared as detailed in IFU (Appendix VI), each set of 8 samples
i.e. A+E, B, C, C1, C2, C3, C4 and D, were tested using qPCR or each set of four samples A/E, B,
C and D were tested using digital PCR. Each method was performed 3 times on each of three
separate days using three separate sets of samples in triplicate wells, preferentially by different
operators.
Laboratories were asked to report raw data and quantitative results for each sample, e.g. qPCR Ct
values or ddPCR droplet counts, together with details of the methods used and comments or issues
observed.
Summary of Collaborative Study Methods Three principal methods. i.e. TaqMan qPCR, SYBRGreen qPCR and digital PCR, were used by
thirty-one laboratories for the quantitation of LV integration copy numbers per cell (Table 3). Two
![Page 10: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/10.jpg)
WHO/BS/2019.2373
Page 10
supplementary methods were also used, i.e. sequencing-based methods for LV integration site
analysis and NanoDrop or QuBit for DNA quantitation (g/ampoule). Twenty-nine laboratories
used TaqMan qPCR, thirteen laboratories used SYBRGreen qPCR and eleven laboratories used
digital PCR to evaluate LV copy numbers, four laboratories performed sequencing-based methods
to evaluate integration sites and fifteen laboratories evaluated DNA quantity (g/ampoule). All
studies were performed using participants’ individual laboratories’ reagents and equipment. In
terms of study protocols, twenty-three sets of all PCR data were obtained from independent
laboratories’ (in-house) protocols and thirty-seven data sets from the provided NIBSC protocols
for SYBRGreen qPCR, TaqMan qPCR or digital PCR. Some laboratories provided two sets of
data for one method using different protocols. For one sample, each set of data (n=9) comprise
results from triplicate experiments tested in triplicate wells and performed on three independent
days using three independent sets of materials.
A total of sixty PCR (qPCR or ddPCR) data sets contribute to the quantitation of LV copy numbers
per cell, including thirty-one data sets from TaqMan qPCR, fifteen sets from SYBRGreen qPCR
and fourteen sets from digital PCR. A total of sixty-six operators performed PCR copy number
quantitation (Table 3).
Table 3. Methods performed by individual participating laboratories
Lab Code
Number of
PCR
Protocols
Number of
Operators
Methods
Performed
AA 3 1 STC
AB 1 1 T
AC 1 3 TC
AD 1 2 TC
AE 2 1 DTQ
AF 2 1 T
AH 2 3 STC
AI 1 3 T
AK 4 2 DSTQC
B 2 3 ST
C 2 2 ST
D 1 2 T
E 1 1 TC
F 1 3 T
H 3 2 STC
I 2 1 DTC
J 3 2 DST
L 3 3 DST
M 3 3 DST
N 3 3 DT
![Page 11: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/11.jpg)
WHO/BS/2019.2373
Page 11
O 1 2 T
P 3 3 DT
Q 1 3 T
S 2 3 STC
T 2 3 ST
U 3 2 ST
V 1 1 D
W 2 3 TQQvcnC
X 1 1 S
Y 2 1 DTQC
Z 4 3 STC
PCR Data sets from in house protocols 23
PCR Data Sets from NIBSC Protocols 37
Total PCR
operators
Total PCR Data Set 60 66
Total Sequencing Data set 4
Total DNA quantitation Data set 15
Notes for Table 3: D=digital PCR, S=SYBRGreen qPCR, T=TaqMan qPCR, Q=Sequencing
based Methods, C= DNA quantitation.
Results
Stability results Stability studies over 8 months indicated that the candidate preparations are stable for long term
storage at -20˚C. Furthermore, the LV copy number is not diminished after samples were stored
at +56˚C for 8 months, nor after repeated freeze-thaw cycles (Appendix V, Figures 5-7 and
Tables 11-13). As no loss in LV quantity was detected at any of the elevated temperatures, no
predicted loss in gDNA quantities can be calculated, and the panel is likely to be highly stable
when stored at -20˚C.
Collaborative Study Results
Statistical Analysis For quantitative PCR estimates of LV copies/cell calculated using individual laboratories’ plasmid
DNA standards, raw Ct data from all laboratories were analysed centrally at NIBSC in order to
obtain estimates of copies per cell for the study samples tested. Some extreme dilutions not in the
linear range were excluded from the LV and housekeeping (HK) standard curves when fitting the
linear regression model for Ct response against log concentration (copies/5µl per well) and the r2
values for both curves were confirmed to exceed 0.98 before concluding the plate results as
acceptable. Where the slope of results obtained for dilutions of sample C (18/132) did not appear
directly proportional to their expected values (assessed by confirming a slope within the range
![Page 12: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/12.jpg)
WHO/BS/2019.2373
Page 12
0.80-1.25) dilutional linearity was considered unacceptable and all results from the assay were
excluded from further analysis.
Integration copy numbers per cell (diploid genome mass) were calculated based on the equation:
LV copies/cell = (the copy numbers of integrated LV/the copy numbers of a housekeeping (HK)
gene) x HK target sequence copy number12-14; given that an equal mass of the DNA same sample
was tested for LV or HK on the same plate. Using Albumin as the HK gene, the sequence copy
number N=2 per diploid genome mass was used in this collaborative study to estimate the LV
copies/diploid cell genome of candidate materials. This was determined using diploid MRC-5 cells
as a calculation reference for the Albumin gene copy number, as detailed in Appendix IV and
Table 8.
To obtain quantitative PCR estimates (LV copies/cell) calculated directly using sample C (18/132)
as standard, Ct data from dilutions C, C1, C2 and C3 of sample C were used to construct a standard
curve and express the results for samples B (18/126) and D (18/144) relative to sample C (18/132),
as illustrated by the example in Appendix III. The r2 value for the linear regression was confirmed
to exceed 0.98 before concluding the plate results as acceptable.
For digital PCR (ddPCR), calculated estimates of copies per cell were used directly in further
analysis. Estimates relative to sample C were obtained by dividing by the corresponding assay
estimate for sample C and multiplying by its proposed assigned consensus value.
All mean results shown in this report are unweighted geometric means (GM). Variability has been
expressed using geometric coefficients of variation (GCV = {10s-1}×100% where s is the standard
deviation of the log10 transformed estimates). In order to mitigate the effect of any outliers or
anomalous results, Huber’s robust geometric mean was also calculated using the R package
‘WRS2’ (mest() function)15-16.
Individual Laboratory Data and Assay Validity
A summary of estimated copies per cell is shown in Table 4, Figure 1a (boxplot) and Figure 1b
(individual laboratory mean plot) calculated using laboratory geometric mean estimates for each
sample. Individual plate estimates are shown in Appendices I and II. Estimates from TaqMan and
SYBR-Green qPCR are presented separately and combined to give overall qPCR results. For the
calculation of results relative to C, this sample was assumed to contain 8.76 copies/cell, based on
the robust GM estimate obtained from qPCR assays.
Valid estimates were obtained for the majority of laboratories, including 38 of the 46 data sets
from qPCR and all from ddPCR. As shown in Appendix I, exclusions from further analysis were:
laboratories H2P and X where only one test gave valid estimates due to low r2 values (<0.98) in
LV or HK standard curves; laboratories AD, AH, H2R and J where estimates obtained for dilutions
of sample C did not appear to be directly proportional to the dilutions used (fitted slope < 0.80 in
all cases). Results from laboratory AF (in-house) were excluded as the poor PCR amplification
efficiency.
![Page 13: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/13.jpg)
WHO/BS/2019.2373
Page 13
The qPCR amplification efficiency was also calculated based on individual laboratories’ plasmid
DNA standards using the equation (qPCR efficiency E=10-1/slope -1). The majority of qPCR assays
gave a qPCR efficiency (E) within the acceptable range of 0.9-1.117. Two data sets H2P and H2R
with qPCR efficiency (E) values were noted to be outside the acceptable range (0.9-1.1) and had
already been excluded from further analysis as noted above. Sample A/E (18/142) was reported
by all laboratories with zero copies of LV integration (Appendix I), thus excluded from further
analysis.
Overall Estimates of Integration Copy Numbers Per Cell Table 4, Figure 1a and Figure 1b summarise overall results from all valid assays. Estimates from
TaqMan and SYBRGreen qPCR are presented separately and combined to give overall qPCR
results. Table 4 shows that inter-laboratory GCV values ranged from 14.9% to 20.2% in combined
qPCR assays (n=38) with robust geometric mean values of 8.76 (8.26 - 9.29) LV copies/cell for
sample C (18/132), 1.42 (1.37 – 1.48) for sample B (18/126) and 10.67 (10.05 – 11.33) for sample
D (18/144). The TaqMan qPCR estimates were in relatively good agreement with SYBRGreen
qPCR estimates for individual samples (Table 4, Figure 1a and Figure 1b).
Two formats of digital PCR were performed, that is simplex (n=5) and multiplex ddPCR (n=9)
ddPCR. The inter-laboratory GCV values ranged from 2.5% to 7.6% in simplex ddPCR, lower
than in multiplex ddPCR (21.5% to 27.9%) and qPCR assays (10.3% to 21.4%), although the high
variability in values for multiplex ddPCR was noted to be due to the results from laboratory P
being discrepant (higher) than the other laboratories performing this method. There was no
observed variation between results obtained from probe-based or dye, e.g. eva green-based digital
PCR. However, digital PCR results were not in good agreement between the two formats (simplex
and multiplex) used (Figure 1a and Figure 1b), with simplex ddPCR overestimating LV copy
numbers/cell for samples C and D when compared to multiplex ddPCR in laboratories AE, V and
N. Digital PCR results from either simplex or multiplex ddPCR were also not generally in good
agreement with the combined qPCR data. Due to the laboratories that used multiplex ddPCR
reporting only the final calculated LV copies/cell without raw data on droplet counts for either LV
or HK targets, it is unclear whether the absolute droplet counts in both formats of ddPCR were
comparable; therefore, it remains to be explored why there is a disparity between simplex and
multiplex ddPCR. As a result, data from digital PCR were not included in determining the
consensus values for individual samples.
![Page 14: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/14.jpg)
Table 4. Summary of estimated LV copies per cell calculated using individual laboratories’ plasmid DNA
standards or sample C as genomic DNA standard Method Sample Standard* Min Max N GM 95% LCL 95% UCL GCV Robust GM 95% LCL 95% UCL
qPCR
(MS&MT)
C Plasmid 4.86 11.73 38 8.65 8.14 9.18 20.2% 8.76 8.26 9.29
B Plasmid 0.93 1.94 38 1.43 1.36 1.49 14.9% 1.42 1.37 1.48
D Plasmid 6.15 13.61 38 10.51 9.91 11.15 19.7% 10.67 10.05 11.33
B C 1.09 1.81 38 1.52 1.47 1.57 10.8% 1.53 1.48 1.57
D C 6.46 14.63 38 11.11 10.59 11.66 15.7% 11.24 10.83 11.68
qPCR
(MS)
C Plasmid 6.64 11.73 12 8.94 7.90 10.11 21.4% 8.94 7.90 10.11
B Plasmid 1.33 1.91 12 1.53 1.44 1.63 10.3% 1.52 1.42 1.62
D Plasmid 7.65 13.61 12 10.05 8.96 11.28 19.8% 9.99 8.66 11.52
B C 1.09 1.73 12 1.51 1.39 1.64 14.0% 1.54 1.42 1.66
D C 6.46 12.04 12 10.43 9.22 11.80 21.5% 10.90 9.88 12.01
qPCR
(MT)
C Plasmid 4.86 11.12 26 8.51 7.91 9.16 19.8% 8.76 8.22 9.33
B Plasmid 0.93 1.94 26 1.38 1.30 1.46 15.4% 1.37 1.32 1.43
D Plasmid 6.15 13.17 26 10.73 9.99 11.54 19.6% 10.96 10.27 11.70
B C 1.23 1.81 26 1.52 1.47 1.58 9.4% 1.52 1.47 1.58
D C 9.18 14.63 26 11.44 10.94 11.96 11.6% 11.39 10.88 11.93
ddPCR (Simplex)
C Plasmid 9.76 11.59 9 10.81 10.41 11.23 5.1% 10.87 10.47 11.27
B Plasmid 1.37 1.48 9 1.43 1.40 1.45 2.5% 1.43 1.41 1.46
D Plasmid 11.64 14.26 9 13.34 12.61 14.11 7.6% 13.47 12.60 14.41
B C 1.07 1.22 9 1.16 1.11 1.20 5.0% 1.16 1.11 1.20
D C 9.54 11.35 9 10.80 10.37 11.25 5.5% 10.87 10.49 11.25
ddPCR (Multiplex)
C Plasmid 6.54 11.15 5 8.43 6.21 11.44 27.9% 8.32 4.66 14.88
B Plasmid 1.24 1.92 5 1.52 1.19 1.93 21.5% 1.51 1.07 2.13
D Plasmid 8.17 12.93 5 10.18 7.74 13.37 24.6% 9.84 6.07 15.96
B C 1.45 1.64 5 1.63 1.52 1.74 5.4% 1.58 1.46 1.71
D C 10.01 10.79 5 10.92 10.54 11.31 2.9% 10.60 10.07 11.14
Notes for Table 4: N: Number of data sets; GM: Geometric Mean; LCL: Lower Confidence Limit; UCL: Upper Confidence Limit;
GCV: Geometric Coefficient of Variation (%); Robust GM: Huber’s Robust Geometric Mean; * Sample C assumed 8.76 copies per
cell; methods: MS=SYBRGreen qPCR, MT=TaqMan qPCR.
![Page 15: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/15.jpg)
WHO/BS/2019.2373
Page 15
Figure 1a. Boxplot of estimated LV copies per cell calculated using individual laboratories’ plasmid DNA
standards or sample C as genomic DNA standard
Notes for Figure 1a: B:C and D:C indicate results determined using sample C as reference standard (qPCR) or expressed relative to
sample C (ddPCR), both assuming sample C to contain 8.76 copies/cell; boxes are inter-quartile ranges with line showing median
value
![Page 16: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/16.jpg)
WHO/BS/2019.2373
Page 16
Figure 1b. Individual laboratory mean value plot of estimated LV copies per cell calculated using individual
laboratories’ plasmid DNA standards or sample C as genomic DNA standard
Notes for Figure 1b: B:C and D:C indicate results determined using sample C as reference standard (qPCR) or expressed relative to
sample C (ddPCR), both assuming sample C to contain 8.76 copies/cell
![Page 17: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/17.jpg)
WHO/BS/2019.2373
Page 17
Table 5. Inter-method variability in estimated copies/cell for qPCR(MS), qPCR(MT), ddPCR(M) and
ddPCR(S)
Methods Sample Standard* Variance Components (as GCV)
Inter-lab Inter-method Total
qPCR (MS) &
qPCR (MT)
B Plasmid 13.8% 7.0% 15.7%
C 11.5% 0.0% 11.5%
D Plasmid 19.5% 0.6% 19.5%
C 15.2% 5.1% 16.2%
ddPCR (Simplex) &
ddPCR (Multiplex)
B Plasmid 12.1% 0.0% 12.1%
C 5.1% 24.5% 25.2%
D Plasmid 15.1% 20.1% 25.9%
C 4.8% 0.0% 4.8%
qPCR (MS),
qPCR (MT) &
ddPCR (Multiplex)
B Plasmid 14.7% 5.7% 15.9%
C 11.0% 0.0% 11.0%
D Plasmid 20.0% 0.0% 20.0%
C 14.5% 3.9% 15.1%
Notes for Table 5: GCV: Geometric Coefficient of Variation (%); * Sample C assumed 8.76 copies per cell; MS=SYBRGreen qPCR,
MT=TaqMan qPCR.
![Page 18: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/18.jpg)
Estimates obtained relative to sample C For the estimated LV copy numbers per cell calculated using sample C (18/132) as standard,
sample C was assumed to contain 8.76 copies/cell based on the robust GM estimate obtained from
qPCR assays (Table 4), whereas sample B and D were used as theoretical ‘unknowns’ to evaluate
the utility of using sample C in harmonising data between laboratories in future applications. A
variance components analysis was performed separately for qPCR and ddPCR results in order to
determine inter-laboratory and inter-method components of variability, as shown in Table 5.
The variability in qPCR results for both samples B and D was reduced when LV copy number per
cell was determined using sample C as standard (Table 5 and Figure 1; total GCV reduces from
15.7% to 11.5% for sample B and from 19.5% to 16.2% for sample D) indicating improved
agreement across laboratories performing qPCR when using sample C as reference standard. For
ddPCR, improved agreement was noted for sample D (total GCV reducing from 25.9% to 4.8%)
but not for sample B (total GCV increasing from 12.1% to 25.2%). It was further noted (Figure 1
and Table 4) that multiplex ddPCR results for both samples B and D showed improved agreement
with qPCR results when expressed relative to sample C (Table 5 and Figure 1; total GCV reduces
from 15.9% to 11.0% for sample B and from 20.0% to 15.1% for sample D), but this was not the
case for simplex ddPCR due to the results obtained for sample B.
LV Integration Site Analysis Four laboratories evaluated LV integration sites for candidate materials B (18/126), C (18/132)
and D (18/144) using sequencing-based methods following individual laboratories’ in-house
protocols. Table 6 shows that two identical integration sites were detected by all four laboratories
for sample B (18/126); seven identical integration sites were reported for sample C (18/132) by all
laboratories and one further site was shared by 3/4 laboratories for sample C (18/132). LV
integration copy number per cell were reported ranging from 8 to 10 LV copies/cell for sample C.
Sample D (18/144) was produced from double LV transduction of sample C (18/132); therefore,
some of the integration sites are expected to be shared by samples C and D. Table 6 shows that
ten identical integration sites were reported by all laboratories and an additional common site
detected by 3 out of 4 laboratories for sample D (18/144), of which seven identical integration
sites were shared by samples C (18/132) and D (18/144). The LV copy numbers per cell for sample
D were reported ranging from 11-13 copies/cell by individual laboratories.
Ampoule gDNA Quantitation
A total of fifteen laboratories evaluated DNA concentrations after reconstituting the samples in
200 L/ampoule nuclease-free water, of which 12 laboratories used a Nanodrop spectrophotometer
and 3 laboratories used a QuBit fluorometer (Table 7). Using QuBit quantitation, the intra-
laboratory GCV values ranged from 2.69-15.14% for all samples tested, with Geometric Mean
values between 5.16 and 5.65 g gDNA/ampoule, which were less than 12% deviation from the
origin-vialling quantity at 5g gDNA /ampoule (Table 8). The gDNA quantity measured using
NanoDrop was 15%-18% greater than that measured using QuBit fluorometer, giving GM values
between 6.25-6.61g /ampoule and intra-laboratory GCV values ranging from 3.13% to 3.53% in
NanoDrop DNA quantitation.
![Page 19: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/19.jpg)
Table 6. Summary of LV integration site analysis
Notes for Table 6: Highlighted in green: shared by all laboratories; in orange: differ among laboratories; in yellow: number of LV
integration sites as reported by individual laboratories; in grey: detected at low level and low confidence; *1: detected at a low level as
reported by the lab; *2: detected at low level <1%.
![Page 20: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/20.jpg)
WHO/BS/2019.2373
Page 20
Table 7. Ampoule gDNA quantity g/ampoule)
Quantitation using QuBit (gDNA g/ampoule)
Lab
Code AK W AC GM GCV 95% LCL 95% UCL N
A+E 5.03 5.37 5.19 5.19 3.28 4.79 5.63 3
B 5.11 5.92 5.21 5.40 8.37 4.42 6.59 3
C 5.14 6.62 5.24 5.63 15.14 3.96 7.99 3
D 5.00 5.24 5.24 5.16 2.69 4.83 5.51 3
Quantitation using Nanodrop (gDNA g/ampoule)
Lab
Code I AA Y AH S H2R H2P Z Z(IN) AD AA(T) E GM GCV
95%
LCL
95%
UCL N
A+E 5.96 7.94 6.47 6.30 6.56 6.08 6.11 6.27 6.19 6.36 8.92 5.58 6.25 3.13 6.11 6.40 9
B 6.29 8.75 6.68 6.47 7.04 6.45 6.45 6.58 6.60 6.65 8.51 5.71 6.58 3.22 6.42 6.74 9
C 6.35 8.14 6.93 6.58 7.06 6.49 6.49 6.43 6.64 6.57 8.60 5.65 6.61 3.54 6.44 6.79 9
D 6.14 8.39 6.41 6.16 6.75 6.14 6.15 6.16 6.21 6.16 7.22 5.25 6.25 3.27 6.10 6.41 9
Notes for Table 7: Data from Labs AA, AA(T), E (shaded in grey) were excluded due to number of outliers in result. N: number of
laboratories; GM: Geometric Mean; GCV: Geometric Coefficient of Variation (%); LCL: Lower Confidence Limit; UCL: Upper
Confidence Limit.
![Page 21: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/21.jpg)
Discussion
The collaborative study (CS633) was designed to seek absolute quantitation of LV integration
copy number and integration sites from 31 laboratories across 13 countries using four proposed
methods, i.e. TaqMan qPCR, SYBRGreen qPCR, digital PCR or sequencing-based methods, in
order to derive a consensus value i.e. LV integration copy number per cell, for four candidate
genomic DNA materials coded A/E (18/142), B (18/126), C (18/132) and D (18/144).
As is normal practice for WHO collaborative studies, participating laboratories were asked to
provide raw data, i.e. Ct values from qPCR and droplet counts from ddPCR, so that a common
analysis approach could be applied to the data from different laboratories, allowing them to be
compared to each other. Applying the global analysis showed that most data sets (38/46) from 24
out of 30 laboratories using qPCR gave valid estimates, indicating the study data were of high
quality, even with stringent validity parameters applied.
Combining the data from all valid qPCR (n=38) gave consensus robust geometric mean LV copies
per cell of 0 for sample A/E (18/142), 1.42 for sample B (18/126), 8.76 for sample C (18/132) and
10.67 for sample D (18/144). The inter-laboratory GCVs ranged from 14.9% for sample B (18/126)
to 20.2% for sample C (18/132). The large disagreement between some laboratories performing
simplex and multiplex digital PCR data and their disagreement with qPCR data resulted in only
the qPCR data being used to assign a consensus value for individual samples.
The use of sample C (18/132) to generate a genomic DNA standard curve for LV copy quantitation
by qPCR reduced the inter-laboratory variability in estimates obtained for the other panel samples
B and D, demonstrating the power of a common reference standard in harmonizing study results
across methods and laboratories. The advantages of using sample C as genomic DNA reference
standard include minimizing the potential variations being introduced from using varied individual
laboratories’ plasmid DNA standards.
It is noteworthy that the difference in the reported data between one laboratory and another can be
as great as ~2-fold for the same sample. For example, the reported value for the same sample D
was 6.15 copies/cell from one laboratory and 13.61 from another laboratory, highlighting intrinsic
issues in PCR quantitation and the importance of using well characterized reference materials for
LV integration copy number quantitation.
Over 70% of all reported integration sites for individual samples were confidently detected and
shared by all laboratories using four different sequencing-based methods, that is 2/2 detected sites
for sample B (18/126), 7/10 for sample C (18/132) and 10/13 for sample D (18/144). As the
genomic DNA were produced from single cell clones, this provides supporting evidence that the
reported LV copies from integration site analysis represent LV copies per cell.
It is important to note that the reported numbers of LV integration sites obtained from different
sequencing-based analyses are in good agreement with the values obtained from PCR quantitation,
that is, a consensus value of 2 LV integration sites vs PCR robust GM of 1.42 LV copies/cell for
18/126, a consensus value of 8 integration sites vs PCR robust GM 8.76 for 18/131 and a consensus
![Page 22: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/22.jpg)
WHO/BS/2019.2373
Page 22
value of 10 integration sites vs PCR robust GM 10.67 LV copies/cells for 18/144, demonstrating
the robustness of the value assignment for individual materials.
The collaborative study results highlighted that there exists disagreement between simplex and
multiplex digital PCR data and their disagreement with qPCR data, resulting in only qPCR data
being used to assign a consensus value for individual samples. As shown in Appendix XII, only
2/43 publications used ddPCR in LV quantitation, indicating that qPCR is still the most common
method used in LV copy quantitation. Nevertheless, the use of the qPCR assigned consensus value
of 18/132 as a common standard reduced the inter-laboratory variability in LV quantitation for
18/126 and 18/144 across data from qPCR and ddPCR methods, demonstrating the power of an
International Standard in harmonizing study results across methods and laboratories. It is
noteworthy that the consensus values for individual laboratories were derived not only results from
using NIBSC plasmid standards and study protocols, but also from diverse formats of calculation
standards including individual laboratories’ plasmid DNA or genomic DNA based on copy
numbers or DNA mass, and individual PCR primer target sequences, providing the confidence in
robustness of consensus values obtained in the study. It is also important to note that the results
obtained from PCR and sequencing based methods are in good agreement, demonstrating the
robustness of the value assignment for individual candidate materials.
International reference reagents are intended to be long-lasting, stable preparations suitable for
global distribution, thus formulation and process development was optimized to fulfil this
requirement whilst preserving bioactivity required for the standard’s intended use. Stability studies
over 8 months indicated that the candidate preparations are stable for long term storage at -20˚C.
These standards are to be presented as a panel (coded 19/158) of three materials (individually
coded as 18/126, 18/132 and 18/142). The high copy number standard 18/132 is for end-users to
generate a genomic DNA standard curve using 18/142 as the diluent, with 18/126 used as a
positive control (in order to confirm comparable LV copies/cell to the consensus value for the
sample 18/126 to validate the assay for unknown sample quantitation). The advantages of using
sample 18/132 as a genomic DNA reference standard include minimizing the potential variations
introduced from using varied individual laboratories’ plasmid DNA standards. The WHO 1st
Reference panel will primarily be used for the validation of internal in-house standards used in
different laboratories and will be applicable to a wide range of DNA and sequencing based
detection methods– a major step forward in obtaining reliable and reproducible data on insertional
mutagenesis, the assessment of which is a major point of interest for regulatory authorities.
End-users will be referred to the WHO ECBS report (via the Instructions for Use, Appendix X)
for further details of this data analysis. All (raw) data are stored at NIBSC and are available on
request to WHO (Secretary, Expert Committee on Biological Standardization) for a period of at
least 20 years, or longer if the standard is still in use.
Data from this study indicates that the introduction of the first International Reference panel
(19/158) will be an important tool for the inter-laboratory harmonization of lentiviral vector
quantitation in LV based gene therapy products. The availability of the LV integration Reference
panel (19/158) should improve the quality, confidence and comparability in LV integration
analysis.
![Page 23: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/23.jpg)
WHO/BS/2019.2373
Page 23
Proposal to WHO
Based on the results of the multi-centre collaborative study and the combined qPCR quantitation,
it is proposed that the panel of three genomic DNA preparations, i.e. 18/142 (sample A/E), 18/126
(sample B) and 18/132 (sample C), is established as the WHO 1st International Reference panel
(19/158) for the quantitation of lentiviral vector copy number in cells, with assigned values of 0
LV copies/cell for 18/142, 1.42 LV copies/cell for 18/126 (95% CI: 1.37 – 1.48; k=2.03) and 8.76
LV copies/cell for 18/132 (95% CI: 8.26 – 9.29; k=2.03), to be used in PCR based quantitation
methods. It is recommended for future end-users to make serial dilutions of sample C (18/132) in
the presence of sample A/E (18/142) to produce a genomic DNA standard curve for the estimation
of LV copy numbers/cell in unknown samples. It is also recommended the end-users to use 18/142
as a negative control and 18/126 as a positive control (robust GM 1.42 LV copies/cell) in order to
validate the assay for unknown sample LV copy number quantitation.
It is also proposed to WHO ECBS for sample D (18/144) to be established as a stand-alone
qualitative reference reagent for the integration site analysis, with ten defined integration sites, that
is, AGPAT3 (at chromosome 21), NUDT3 (Chr. 6), SEMA3F-AS1 (Chr. 3), GRID2 (Chr. 4),
ADAM9 (Chr. 8), R3HDM2 (Chr. 12), CBWD1 (Chr. 9), FOXP2 (Chr. 7), ENTHD1 (Chr. 22)
and SMYD4 (Chr. 17), as highlighted in green in Table 6, to validate end-users’ integration-site
study protocols.
![Page 24: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/24.jpg)
WHO/BS/2019.2373
Page 24
Comments from the Participants on the Draft Report
Significant comments and NIBSC responses
Lab 1
This lab disagreed to all the proposals made to WHO, i.e. consensus values, a panel of 3 standards
and RM for integration site analysis.
Comments: It appears that sample B is the only sample, which has two copies per cell, that was
confirmed by integration site analysis from 4 different labs. And based on the standard developed
in our company, which have one copy number per cell determined by integration site analysis, we
have determined that sample B have two copies per cells. Thus, we would suggest that sample B
to be the standard for VCN, while sample C and D will need to be further evaluated since the
integration site analysis results contradicted from different labs. Before the precise number was
determined for sample C and D, they are not good for either copy number or integration site
analysis references.
Response: This study shows that both PCR and integration site analysis methodologies have an
inherent high-variation tendency, it is unrealistic, at the current time, to expect 100% data match
from qPCR and sequencing-based methods. The high variation tendency makes WHO standards
more valuable in harmonizing data and data presentation across laboratories.
Lab 2
This lab agreed to all proposals to WHO.
Comments: The WHO Collaborative Study to establish a Lentiviral integration standard is an
excellent idea to serve a rapidly expanding and exciting market. However, we believe that the
reliance on qPCR to determine copy number is flawed as this study demonstrates the tendency of
this technology to produce very high variance and has several drawbacks that render it less accurate
and precise when compared to newer ddPCR technology. As shown in this study, the ddPCR data
is very consistent across and within labs, and the geometric mean (GM) is close to the qPCR data
in most cases. The results are excluded without sufficient explanation, and the qPCR results are
used to generate the standard values regardless of the drawbacks. We acknowledge that few labs
were able to conduct this study with ddPCR, leading to a less robust dataset relative to qPCR.
However, the ddPCR data should not be compared to qPCR data and discarded simply because it
does not match. We request that a discussion on the ddPCR results be included in the report. We
additionally suggest that additional statistical modeling, beyond geometric means, be used to
analyze to compare the different means.
Response: We acknowledge the limitation in current qPCR and ddPCR methods. We received 46
sets of data for qPCR, but only 5 sets of data for multiplex ddPCR, indicating that qPCR is, at the
present time, still a common method and widely used in DNA quantitation. 5 sets of multiplex
ddPCR data is rather small in representing a true consensus.
We propose to re-evaluate these standards at a later stage when ddPCR becomes more widely used
and more participants are able to perform ddPCR.
![Page 25: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/25.jpg)
WHO/BS/2019.2373
Page 25
Other comments: Why do simplex ddPCR at all? The lab P ddPCR undigested data should be
excluded as CN by ddPCR requires restriction digestion.
Response: We do not have enough experience or data to support exclusion of this procedure and
exclusion. The simplex ddPCR results have not been used in determining consensus values and
have been presented for information and discussion in this report.
Lab 3
This lab agreed to establish A, B and C as a standard panel and D as integration site analysis
Reference Reagents, but disagreed with the consensus values, due to changes to some data
reported.
Response: All consensus values have been recalculated to reflect the changes in some of the
reported data in the final report.
Comments: For establishing an international standard, the use of aneuploid target cell line may not
be the preferred choice, as we may expect instability of the genotype upon serial passage eventually
affecting the VCN determination. Even we independently determine and monitor the actual ploidy
of the reference gene there is no warranty that the obtained value applies to the whole genome,
thus providing a potential confounding factor for the determination. Thus, the use of a human cell
line with euploid genome would be preferable (many such T cell lines are available).
Response: The genetic stability of target cells has been discussed in the Introduction of this report.
Furthermore, unless we used primary cells, there will be no true diploid cell line unless we
characterize individual cells before extracting the DNA. This is because the number of cells and
the ‘purity of LV/cell clones’ we need for the standard production require a significant
amplification of the cells. Even primary cells let alone a T cell line, after such cell expansion and
multiple round of single cell cloning if possible, the euploidy nature of the cells would not sustain
unless proved by individual cell characterization.
We appreciate the comments and recognize the limitation in current standard. We considered that
gene therapy is a fast-evolving field, it is envisaged a rapid evolving in standard development as
well; therefore. we are prepared to develop a T cell line-based standard if there is the need from
the community and a fully characterized diploid T cell lines become attainable by us in the future.
Lab 4
This lab agreed to all proposals.
Comments: Suggest to include confidence intervals and list the HUGO approved names of the 10
genes in the proposal section. Unclear to me in which tables dilutions of C were used as a standard
and in which tables the laboratories estimates of copy numbers per cell were used
Response: Both confidence intervals and gene names are added in the final report. A new table
showing VCN from using C as standard has now been included as Appendix II in the final report.
![Page 26: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/26.jpg)
WHO/BS/2019.2373
Page 26
Lab 5
This lab agreed to use samples A/E, B and C as reference standard and Sample D as RM for
integration site analysis, disagreed to the consensus values
Comment 1: Would like to see these consensus values rather as a range reflecting the results of
this study.
Response: We have added the confidence interval to individual consensus values.
Comment 2: It would also be interesting for us to see what was the difference observed across
laboratories that analysed these samples following NIBSC or in-house qPCR protocols.
Response: The plot below shows the results split according to the protocol followed. No
statistically significant differences between the results obtained using the different protocols
(NIBSC or in-house) was observed.
Comment 3: With regards to vector integration site data: table 6 shows vector integration results
from four laboratories. Both integrations for sample A are consistently reported. Clone C and D
show some differences, indicated in orange in the table. Laboratory Y reports an integration in the
NPW transcript, while the other laboratories report integrations near ZNF598. These genes are
located next to each other on chromosome 16. This highlights and issue with annotation of vector
integration sites. Depending on the reference genome and annotation files used, slight variations
between methods of annotations might give conflicting results. Clarity on the version of the
![Page 27: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/27.jpg)
WHO/BS/2019.2373
Page 27
genome and annotation files used is necessary and some uncertainty can be avoided by reporting
the chromosome and location of the integration site rather than the nearest gene.
Responses: both the chromosome and gene locations of sample D integration sites are provided to
end-users as a reference.
Lab 6
This lab was unable to support the proposed consensus values as the estimates obtained by their
laboratory were lower, but they agreed to the panel A, B, C being established as WHO Reference
panel for quantitation and D as RM for integration site analysis.
Comment: It’s difficult to agree with this proposed unitage because we obtained lower LV copies
per cell in this study.
Lab 7
This lab agreed to all proposals.
Comments: We agree with the proposal for sample D (18/144) to be used as international reference
material in LV integration site analysis, as a positive control. In line with authority agencies
requirement, the quantitative measurement of each clone, which is represented by the composition
of individual integration sites in a bulk population, should be also described in detail.
Response: Not all labs reported the abundance (%) for each IS. Also, the % abundance for a given
IS, if reported, varied between labs. At moment, only 4 labs were able to report data for integration
sites, we considered it is difficult to extrapolate too much information from the rather small data
set at moment. Therefore, we propose to use Sample D as a positive control for time being. This
can be changed if we have more data.
Acknowledgements
We would like to thank Professor Didier Trono (EPFL, Lausanne) for his donation of the Lentiviral
plasmids to make the project possible. We gratefully acknowledge the significant contributions of
all participants to the collaborative study. We would also like to thank Drs. Pia Sanzone, Robin
Thorpe, Jennifer Boyle, Chris Bird, Chris Burns, Jackie Ferguson, Clive Metcalfe, Paul Stickings,
Clare Morris, Mary Collins, Ross Hawkins, Jack Price and Malcolm Hawkins for invaluable
discussions. Thanks to Drs. Hannah Stepto, Anna Nowocin, Paul Matejtschuk and the Standards
Processing Division at NIBSC for their contributions to the development and processing of the
materials. This project is funded by UK Department of Health.
List of Appendices
Appendix I: Individual laboratory estimates of LV copies per cell using individual laboratories’
standard
![Page 28: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/28.jpg)
WHO/BS/2019.2373
Page 28
Appendix II: Individual laboratory estimates of LV copies per cell calculated using sample C as
reference standard
Appendix III: Example of using sample C as a genomic DNA calculation standard
Appendix IV: Bulk materials and production
Appendix V: Accelerated degradation and stability studies
Appendix VI: Instructions for Use (IFU) sent to participants for the collaborative study
Appendix VII: Example qPCR protocols for the collaborative study
Appendix VIII: Example digital PCR protocol for the collaborative study
Appendix IX: Response form on the draft report sent to participants
Appendix X: Instruction for Use (IFU) for the to be established Reference panel
Appendix XI: NIBSC Publication
Appendix XII: relevant publications (2019-2000) on LV copy quantitation
Appendix XIII: References
![Page 29: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/29.jpg)
WHO/BS/2019.2373
Page 29
Appendix I
Individual laboratory estimates of LV copies per cell
calculated using individual laboratories’ standards
Method Lab Test A+E B C C1 C2 C3 C4 D
MS L 1 0.03 1.56 10.36 2.73 0.91 0.32 0.13 13.06
MS L 2 0.04 1.27 7.34 2.16 0.70 0.26 0.11 9.73
MS L 3 0.05 1.32 7.84 2.24 0.78 0.27 0.13 n/a
MS T 1 0.00 1.37 7.41 2.44 0.86 0.29 0.11 9.52
MS T 2 0.00 1.37 8.52 2.21 0.74 0.29 0.10 9.13
MS T 3 0.00 1.45 9.11 2.80 0.84 0.28 0.10 8.36
MS X 1 LV standard r2<0.98
MS X 2 LV standard r2<0.98
MS X 3 0.00 1.58 10.00 3.21 1.03 0.39 0.23 11.05
MS J 1 0.14 1.75 7.70 2.71 1.07 0.48 0.33 8.91
MS J 2 0.18 1.47 7.49 2.28 0.84 0.40 0.25 7.24
MS J 3 0.17 1.24 5.08 1.68 0.68 0.35 0.26 6.94
MS B 1 0.00 1.81 10.51 5.35 1.17 0.32 0.12 11.82
MS B 2 0.00 1.49 10.51 2.44 0.79 0.27 0.10 9.14
MS B 3 0.00 1.77 12.24 3.57 1.18 0.33 0.14 5.27
MS AH 1 0.21 1.81 8.09 2.60 1.02 0.51 0.31 9.42
MS AH 2 0.11 1.51 6.46 2.80 0.64 0.24 0.16 9.78
MS AH 3 0.19 1.54 7.88 2.31 0.86 0.46 0.28 9.35
MS S 1 0.00 1.79 14.32 3.36 1.46 0.42 0.21 12.03
MS S 2 0.00 1.90 10.00 4.17 1.61 0.45 0.22 12.69
MS S 3 0.00 2.05 11.28 3.96 1.18 0.41 0.12 16.51
MS H2R 1 C slope < 0.80
MS H2R 2 C slope < 0.80
MS H2R 3 C slope < 0.80
MS H2P 1 C slope < 0.80
MS H2P 2 HK standard r2<0.98
MS H2P 3 HK standard r2<0.98
MS Z 1 0.01 1.39 11.92 3.26 1.12 0.40 0.14 14.10
MS Z 2 0.01 1.32 10.36 3.33 1.09 0.40 0.13 12.51
MS Z 3 0.01 1.28 10.70 3.20 1.18 0.44 0.17 4.62
MS M 1 0.46 0.97 27.58 3.19 1.00 0.55 0.43 64.50
MS M 2 0.26 1.56 7.90 2.45 1.00 0.45 0.22 9.82
MS M 3 0.17 1.53 7.93 2.63 0.97 0.43 0.26 9.63
MS AK 1 LV standard r2<0.98
MS AK 2 0.01 1.56 11.92 3.14 0.95 0.30 0.11 13.35
![Page 30: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/30.jpg)
WHO/BS/2019.2373
Page 30
MS AK 3 0.01 1.43 11.08 2.98 1.05 0.35 0.11 13.06
MS U 1 0.24 1.83 7.80 2.21 0.90 0.41 0.26 6.75
MS U 2 0.13 1.35 6.58 2.06 0.73 0.33 0.22 9.36
MS U 3 0.18 1.35 7.46 1.97 0.78 0.33 0.20 10.18
MS C 1 0.00 1.58 9.41 2.97 0.99 0.35 0.12 11.64
MS C 2 0.00 1.57 8.13 2.40 0.84 0.28 0.10 11.16
MS C 3 0.00 1.59 9.35 2.85 0.93 0.32 0.10 11.82
MS Z (IH) 1 0.00 1.53 9.05 3.52 1.25 0.44 0.15 11.22
MS Z (IH) 2 0.00 1.58 8.68 3.24 1.09 0.39 0.13 9.92
MS Z (IH) 3 0.00 1.59 9.04 3.19 1.10 0.41 0.15 11.13
MT AD 1 C slope C slope < 0.80
MT AD 2 C slope C slope < 0.80
MT AD 3 C slope C slope < 0.80
MT H 1 n/a 1.57 7.73 2.52 0.93 0.35 0.11 10.22
MT H 2 n/a 1.37 5.70 2.30 0.93 0.41 0.13 6.86
MT H 3 n/a 1.24 6.75 2.18 0.78 0.31 0.11 8.85
MT I 1 n/a 1.58 8.67 2.23 0.73 0.27 0.09 11.85
MT I 2 n/a 1.56 8.78 2.28 0.77 0.27 0.10 12.10
MT I 3 n/a 1.50 8.85 2.42 0.76 0.28 0.10 11.94
MT L 1 n/a 1.50 12.28 3.00 1.01 0.37 0.11 14.83
MT L 2 n/a 1.18 9.40 2.56 0.82 0.25 0.09 11.40
MT L 3 n/a 1.11 7.02 1.89 0.55 0.09 0.00 n/a
MT T 1 0.00 1.33 7.69 2.55 0.93 0.46 0.19 11.88
MT T 2 HK standard r2<0.98
MT T 3 0.00 1.68 8.75 2.56 1.00 0.45 0.16 11.73
MT AE 1 n/a 1.48 8.87 2.76 0.89 0.30 0.11 10.91
MT AE 2 n/a 1.41 8.84 2.56 0.91 0.31 0.12 12.62
MT AE 3 n/a 1.37 8.91 2.53 0.88 0.28 0.10 11.46
MT AA 1 0.00 1.57 9.11 2.74 0.90 0.30 0.10 9.87
MT AA 2 n/a 1.47 9.63 2.67 0.87 0.32 0.11 9.15
MT AA 3 n/a 1.49 9.70 2.99 0.98 0.34 0.11 10.06
MT Q 1 0.00 1.77 9.33 3.32 1.09 0.35 0.11 11.83
MT Q 2 0.00 1.91 11.33 3.73 1.20 0.34 0.11 12.50
MT Q 3 0.00 2.15 13.01 4.19 1.34 0.42 0.13 15.45
MT P 1 n/a 1.95 9.58 3.68 1.28 0.43 0.16 11.32
MT P 2 n/a 1.86 8.42 3.09 1.23 0.37 0.13 11.16
MT P 3 n/a 1.73 9.94 3.28 1.05 0.33 0.12 9.31
MT D 1 n/a 1.23 8.56 2.51 0.82 0.29 0.12 10.10
MT D 2 n/a 1.31 9.59 2.86 0.88 0.33 0.11 12.16
MT D 3 n/a 1.22 8.92 2.45 0.80 0.27 0.11 10.58
MT J 1 C slope < 0.80
MT J 2 C slope < 0.80
MT J 3 C slope < 0.80
MT B 1 n/a 1.37 8.83 2.46 1.00 0.32 0.14 7.97
![Page 31: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/31.jpg)
WHO/BS/2019.2373
Page 31
MT B 2 n/a 1.41 9.21 2.61 1.19 0.42 0.12 10.25
MT B 3 n/a 1.40 10.42 2.94 0.85 0.25 0.14 12.06
MT AH 1 C slope < 0.80
MT AH 2 C slope < 0.80
MT AH 3 C slope < 0.80
MT S 1 0.00 1.70 8.75 2.58 0.77 0.31 0.11 10.66
MT S 2 0.00 1.29 5.73 2.71 0.73 0.32 0.12 9.42
MT S 3 n/a 1.08 5.86 1.96 0.85 0.19 0.07 9.99
MT M 1 n/a 1.38 9.00 2.52 0.81 0.29 0.10 12.16
MT M 2 LV standard r2<0.98
MT M 3 n/a 1.27 8.17 2.20 0.73 0.25 0.09 11.25
MT Z 1 n/a 1.44 10.30 2.97 0.97 0.36 0.12 12.90
MT Z 2 n/a 1.43 9.14 2.93 1.00 0.33 0.12 12.69
MT Z 3 n/a 1.58 10.44 2.96 1.06 0.41 0.15 13.18
MT AI 1 n/a 1.29 9.00 2.56 0.84 0.28 0.10 11.58
MT AI 2 n/a 1.41 10.27 2.78 0.84 0.29 0.10 12.41
MT AI 3 n/a 1.30 8.86 2.51 0.79 0.27 0.09 11.15
MT W 1 n/a 1.31 9.18 2.56 0.84 0.26 0.10 10.12
MT W 2 n/a 1.26 9.32 2.89 0.84 0.31 0.10 11.44
MT W 3 n/a 1.23 10.94 2.91 0.94 0.30 0.09 13.26
MT AC 1 n/a 1.63 9.38 2.99 1.04 0.36 0.14 11.97
MT AC 2 n/a 1.38 7.55 2.46 0.85 0.31 0.12 9.44
MT AC 3 n/a 1.19 6.49 2.13 0.72 0.26 0.09 8.40
MT F 1 n/a 1.61 8.21 2.40 0.77 0.29 0.10 13.33
MT F 2 n/a 1.07 6.32 2.46 0.71 0.20 0.06 11.96
MT F 3 n/a 1.24 8.97 2.91 0.92 0.25 0.09 13.63
MT AK 1 LV & HK standards r2<0.98
MT AK 2 n/a 1.43 8.62 2.64 0.84 0.29 0.04 8.58
MT AK 3 0.01 1.25 7.63 2.10 0.73 0.29 0.04 10.19
MT U 1 n/a 0.91 4.64 1.42 0.43 0.14 0.03 6.07
MT U 2 n/a 0.81 4.30 1.34 0.42 0.14 0.03 5.90
MT U 3 n/a 1.11 5.77 1.78 0.59 0.19 0.03 6.48
MT C 1 n/a 1.46 9.95 2.86 0.93 0.30 0.09 11.66
MT C 2 n/a 1.26 8.99 2.89 0.85 0.28 0.11 12.70
MT C 3 n/a 1.32 9.99 2.70 0.80 0.29 0.07 10.71
MT N 1 n/a 1.21 8.42 2.34 0.78 0.26 0.09 10.47
MT N 2 n/a 1.29 8.25 2.34 0.70 0.23 0.08 10.97
MT N 3 n/a 1.54 8.82 2.80 0.85 0.29 0.10 11.10
MT Y 1 0.00 1.37 11.37 3.19 1.00 0.30 0.11 13.93
MT Y 2 0.00 1.12 9.49 2.75 0.83 0.31 0.10 12.19
MT Y 3 0.00 1.19 9.62 2.67 0.84 0.28 0.09 11.82
MT E 1 n/a 1.18 8.46 2.43 0.75 0.23 0.07 11.02
MT E 2 n/a 1.09 7.27 1.94 0.59 0.19 0.07 8.82
MT E 3 n/a 1.13 7.37 2.04 0.69 0.22 0.08 9.07
![Page 32: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/32.jpg)
WHO/BS/2019.2373
Page 32
MT Z (IH) 1 n/a 1.75 6.22 2.68 1.08 0.39 0.14 7.10
MT Z (IH) 2 n/a 1.50 5.94 2.59 1.00 0.34 0.11 7.39
MT Z (IH) 3 n/a 1.69 6.47 2.70 1.03 0.35 0.11 8.21
MT AF(IH) 1
Low PCR efficiency MT AF(IH) 2
MT AF(IH) 3
MT AF 1 n/a 1.46 9.83 2.77 1.11 0.26 0.07 12.85
MT AF 2 n/a 1.51 9.82 2.82 1.12 0.26 0.07 12.20
MT AB 1 n/a 0.21 1.94 0.64 0.25 0.10 0.02 5.67
MT AB 2 HK standard r2<0.98
MT O 1 n/a 1.33 10.49 2.72 0.82 0.22 0.04 11.40
MT O 2 n/a 1.34 9.28 2.68 0.85 0.23 0.04 10.50
MT O 3 n/a 1.30 9.35 2.75 0.89 0.25 0.04 10.81
MD (Simplex) I 1 0.00 1.41 11.30 13.79
MD (Simplex) I 2 0.00 1.43 11.27 13.48
MD (Simplex) I 3 0.00 1.34 10.94 13.57
MD (Simplex) L (IH) 1 0.05 1.42 11.19 14.69
MD (Simplex) L (IH) 2 0.12 1.49 10.87 15.25
MD (Simplex) L (IH) 3 0.06 1.43 10.77 12.78
MD (Simplex) L (NIBSC) 1 0.06 1.48 10.78 13.00
MD (Simplex) L (NIBSC) 2 0.09 1.53 10.89 13.69
MD (Simplex) L (NIBSC) 3 0.05 1.44 9.85 12.34
MD (Simplex) AA 1 0.04 1.44 10.32 12.77
MD (Simplex) AA 2 0.08 1.33 9.21 11.73
MD (Simplex) AA 3 0.01 1.34 9.80 11.81
MD (Simplex) J 1 0.00 1.47 11.18 13.55
MD (Simplex) J 2 0.01 1.27 12.82 14.51
MD (Simplex) J 3 0.03 1.60 10.87 13.79
MD (Simplex) M 1 0.00 1.44 10.44 14.56
MD (Simplex) M 2 0.00 1.39 11.08 13.77
MD (Simplex) M 3 0.00 1.49 11.05 13.87
MD (Simplex) N 1 0.00 1.45 11.25 13.73
MD (Simplex) N 2 0.00 1.42 11.00 13.25
MD (Simplex) N 3 0.00 1.45 11.52 13.50
MD (Simplex) AK 1 0.10 1.36 10.94 9.03
MD (Simplex) AK 2 0.12 1.53 10.37 13.39
MD (Simplex) AK 3 0.09 1.46 10.27 13.04
MD (Simplex) Y 1 0.01 1.36 10.60 14.54
MD (Simplex) Y 2 0.01 1.42 11.07 14.72
MD (Simplex) Y 3 0.01 1.39 10.85 13.53
MD (Multiplex) AE 1 0.00 1.32 7.37 8.97
MD (Multiplex) AE 2 0.00 1.36 7.23 8.68
MD (Multiplex) AE 3 0.00 1.33 7.19 8.98
MD (Multiplex) P 1 0.00 1.91 11.66 13.61
![Page 33: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/33.jpg)
WHO/BS/2019.2373
Page 33
MD (Multiplex) P 2 0.00 1.76 10.1 11.7
MD (Multiplex) P 3 0.00 2.08 11.7 13.49
MD (Multiplex) P (undigested) 1 0.00 1.61 11.1 12.59
MD (Multiplex) P (undigested) 2 0.00 1.82 10.25 12.69
MD (Multiplex) P (undigested) 3 0.00 2.04 11.04 13.37
MD (Multiplex) V 1 0.00 1.40 7.38 8.94
MD (Multiplex) V 2 0.00 1.38 7.36 9.22
MD (Multiplex) V 3 0.00 1.40 7.58 8.92
MD (Multiplex) N 1 0.00 1.22 6.49 8.07
MD (Multiplex) N 2 0.00 1.26 6.63 8.32
MD (Multiplex) N 3 0.00 1.23 6.49 8.14
Notes for Appendix I: methods MD=digital PCR, MS=SYBRGreen qPCR, MT=TaqMan qPCR.
![Page 34: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/34.jpg)
WHO/BS/2019.2373
Page 34
Appendix II
Individual laboratory estimates of LV copies per cell
calculated using sample C (robust GM 8.76)
as a genomic DNA calculation standard
Method Lab Test B D
MS L 1 1.57 11.83
MS L 2 1.64 12.27
MS L 3 1.62 n/a
MS T 1 1.60 11.40
MS T 2 1.64 10.39
MS T 3 1.57 8.18
MS J 1 1.64 11.14
MS J 2 1.61 9.49
MS J 3 1.78 14.62
MS B 1 1.46 8.16
MS B 2 1.66 8.54
MS B 3 1.49 4.04
MS AH 1 1.69 11.94
MS AH 2 1.97 11.99
MS AH 3 1.58 12.67
MS S 1 1.30 8.17
MS S 2 1.36 10.26
MS S 3 1.62 12.56
MS Z 1 1.16 11.14
MS Z 2 1.13 10.90
MS Z 3 1.03 3.92
MS M 1 n/a n/a
MS M 2 1.52 12.69
MS M 3 1.49 11.76
MS AK 1 n/a n/a
MS AK 2 1.49 10.13
MS AK 3 1.32 10.95
MS U 1 1.97 8.63
MS U 2 1.69 14.24
MS U 3 1.64 14.04
MS C 1 1.54 11.14
MS C 2 1.77 12.51
MS C 3 1.62 11.39
MS Z (IH) 1 1.23 10.77
MS Z (IH) 2 1.42 9.92
MS Z (IH) 3 1.40 11.03
![Page 35: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/35.jpg)
WHO/BS/2019.2373
Page 35
MT H 1 1.68 12.29
MT H 2 1.52 11.25
MT H 3 1.51 12.39
MT I 1 1.90 12.89
MT I 2 1.83 12.94
MT I 3 1.73 12.50
MT L 1 1.34 11.64
MT L 2 1.37 10.86
MT L 3 1.98 n/a
MT T 1 1.27 15.96
MT T 2 n/a n/a
MT T 3 1.58 13.81
MT AE 1 1.57 10.94
MT AE 2 1.50 13.19
MT AE 3 1.51 11.63
MT AA 1 1.65 9.72
MT AA 2 1.53 8.93
MT AA 3 1.43 9.32
MT Q 1 1.61 10.81
MT Q 2 1.59 9.35
MT Q 3 1.55 10.23
MT P 1 1.56 10.08
MT P 2 1.68 11.40
MT P 3 1.59 18.30
MT D 1 1.39 10.82
MT D 2 1.33 11.52
MT D 3 1.42 10.86
MT B 1 1.42 8.47
MT B 2 1.25 10.91
MT B 3 1.51 10.01
MT S 1 1.87 11.37
MT S 2 1.57 14.09
MT S 3 1.56 14.12
MT M 1 1.54 12.41
MT M 2 n/a n/a
MT M 3 1.59 12.76
MT Z 1 1.35 11.62
MT Z 2 1.40 12.30
MT Z 3 1.39 12.12
MT AI 1 1.43 11.68
MT AI 2 1.48 10.98
MT AI 3 1.50 11.32
MT W 1 1.48 9.93
MT W 2 1.33 10.91
![Page 36: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/36.jpg)
WHO/BS/2019.2373
Page 36
MT W 3 1.25 10.93
MT AC 1 1.53 11.53
MT AC 2 1.56 11.40
MT AC 3 1.58 11.62
MT F 1 1.86 14.93
MT F 2 1.48 14.83
MT F 3 1.36 12.50
MT AK 1 n/a n/a
MT AK 2 1.59 8.96
MT AK 3 1.56 12.95
MT U 1 1.91 11.39
MT U 2 1.79 12.06
MT U 3 1.82 9.91
MT C 1 1.48 10.56
MT C 2 1.36 12.03
MT C 3 1.43 9.91
MT N 1 1.46 11.40
MT N 2 1.64 11.82
MT N 3 1.66 11.06
MT Y 1 0.34 16.15
MT Y 2 1.19 11.75
MT Y 3 1.30 11.10
MT E 1 1.45 11.42
MT E 2 1.63 10.97
MT E 3 1.55 11.20
MT Z (IH) 1 1.83 9.80
MT Z (IH) 2 1.67 10.52
MT Z (IH) 3 1.81 10.90
MT AF 1 1.49 11.19
MT AF 2 1.55 11.68
MT O 1 1.50 9.55
MT O 2 1.53 9.70
MT O 3 1.43 10.04
Notes for Appendix II: methods MS=SYBRGreen qPCR, MT=TaqMan qPCR. Reference to
Appendix III for an example calculation.
![Page 37: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/37.jpg)
WHO/BS/2019.2373
Page 37
Appendix III
Example of using sample C (robust GM 8.76)
as a genomic DNA calculation standard
Sample C data:
Sample Dilution Log10 copies/cell Ct (LV) Ct (HK) Ct difference
C - 0.943 22.263 24.953 -2.690
C 1:3 0.465 24.008 24.774 -0.766
C 1:9 -0.012 25.726 24.668 1.058
C 1:27 -0.489 27.489 24.643 2.846
Slope -3.863
Intercept 0.989
r2
>0.999
Unknown sample data:
Sample Ct (LV) Ct (HK) Ct difference
Estimated log10
copies/cell*
Estimated
copies/cell
B 24.789 24.423 0.366 0.161 1.45
*Estimate = (0.366 - 0.989) / (-3.863)
![Page 38: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/38.jpg)
WHO/BS/2019.2373
Page 38
Appendix IV
Bulk Material and Processing
The bulk candidate materials, i.e. A/E (NIBSC_18/142), B (18/126), C (18/132) and D (18/144),
were purified human genomic DNA in buffer containing 2.0 mM Tris, 0.2 mM EDTA and 5
mg/mL D-(+)-trehalose dehydrate (Sigma-Aldrich, St. Louis, MO, USA). They were produced at
NIBSC using four lentiviral packaging plasmids pMD2.G, pRSVRev, pMDLg/pRRE and
pRRLSIN.cppt.PGK-GFP.WPRE that were kindly donated by Professor Didier Trono (EPFL,
Lausanne) to produce the 3rd generation of lentiviral vector particles. The reason to select the 3rd
generation of lentiviral vector to produce the WHO 1st International Reference panel (19/158) is
because a homologous sequence, as highlighted in yellow in Figure 2, is shared by all three
generations of LV vectors and has been confirmed in our previous study to be suitable for LV
integration analysis in 18 different LV vectors across three generations of LV vectors10. The
biologically indispensable nature of this homologous sequence for lentiviral packaging and
production also means that the proposed WHO LV standards will stand the test of time and will
be applicable to future generations of lentiviral vector development.
Figure 2. LV indispensable homologous sequence
The production HEK293T cells (NIBSC_000617) were transduced with the lentiviral vectors at
various multiplicities of infection (MOI). A panel of LV-transduced single cell clones were
established and characterized for integration copy number using qPCR. Final four candidate cell
![Page 39: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/39.jpg)
WHO/BS/2019.2373
Page 39
lines containing 0 or various copies of lentiviral vector integration were subjected to a further 2-3
rounds of single cell sorting to ensure the homogeneity of the cell populations before being used
to produce bulk candidate genomic DNA, as detailed in Figure 3.
Figure 3. Summary of production process for candidate materials
Master cell banks were established from the selected single cell clones to ensure a continual future
cell supply for replacement standards. Master and working cell banks were tested and found
negative for HIV1, HTLV1, Hepatitis B, CMV and Hepatitis C by PCR. Large-scale cell
![Page 40: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/40.jpg)
WHO/BS/2019.2373
Page 40
production was carried out and genomic DNA was extracted from the LV transduced cells using
Gentra Puregene chemistry with a Gentra Autopure LS robot (Qiagen, Manchester, UK). The DNA
extraction process involved RNAse treatment, protein denaturation, protein removal, and 70%
ethanol washing. The use of 70% ethanol is an established method for viral inactivation11. Each of
the bulk gDNA materials was prepared at approximately 10 μg/mL DNA concentration in 2.0 mM
Tris, 0.2 mM EDTA, with 5 mg/mL D-(+)-trehalose dehydrate (Sigma-Aldrich, St. Louis, MO,
USA) before ampouling.
The concentration of the Albumin gene (ALB) in individual candidate materials (A, B, C and D)
was determined and monitored through the one years of development process by qPCR comparison
with MRC-5 DNA as a reference, which is expected to be diploid. In particular, equal amount of
genomic DNA extracted from MRC-5 cells and individual candidate materials were quantified
simultaneously, in order to derive the ratio of Albumin copy numbers of individual candidate
materials to MRC-5 in equal amount of gDNA. Specifically, Table 8 in Appendix IV shows that
copy numbers of 2.02 (95% CI: 1.92-2.12) were obtained for samples 18/142 (n=13); 2.04 (1.96-
2.12) for sample 18/126 (n=15), 2.03 (1.97-2.10) for 18/132 (n=28) and 1.98 (1.91-2.05) for
18/144 (n=16), indicating that Albumin copy numbers were stable overtime and were comparable
to that of MRC-5, i.e. 2 copies of Albumin genes diploid genome mass in 293T cells. The derivation
in copy numbers for the Albumin gene might result in a non-linear ALB dilution response; however,
it is not expected that this would cause any major measurement deviation.
It should be noted that this characterization does not define the ALB gene copy number in
HEK293T cells; but does determine the number of ALB copies per diploid genome mass of DNA.
This gene copy number enables ALB to be used to normalize DNA input in assays and to generate
LV/ALB copy number ratios. Integration copy numbers per diploid genome mass were calculated
based on the equation: LV copies/6.6pg genomic DNA = (the copy numbers of integrated LV/the
copy numbers of a housekeeping (HK) gene) x HK target sequence copy number per diploid
genome mass; given that an equal mass of the DNA same sample was tested for LV or HK on the
same plate.
Table 8 Quantitation of Albumin gene in candidate materials Reference Candidate Candidate Candidate Candidate MRC-5 18/142 (A) 18/126 (B) 18/132 (C) 18/144 (D)
Test (n=3) ALB
copies/cell
ALB
copies/cell
ALB
copies/cell
ALB
copies/cell
ALB
copies/cell
1 2 2.12 2.15 1.90 1.94
2 2 1.90 1.64 1.65 2.14
3 2 2.13 2.18 1.83 1.92
4 2 2.26 2.11 1.76 1.80
5 2 2.01 2.07 1.72 2.37
6 2 1.90 2.11 1.91 1.94
7 2 1.72 2.13 2.03 1.92
8 2 1.97 2.13 2.08 1.92
9 2 1.81 1.86 2.25 1.96
![Page 41: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/41.jpg)
WHO/BS/2019.2373
Page 41
10 2 1.90 1.95 1.97 1.97
11 2 2.12 1.92 2.01 1.92
12 2 2.24 2.16 2.16 1.98
13 2 2.12 2.11 2.27 1.92
14 2
2.06 2.35 2.10
15 2
1.96 2.05 1.83
16 2
2.17 2.00
17 2
2.05
18 2
2.27
19 2
2.23
20 2
1.95
21 2
2.03
22 2
2.16
23 2
2.17
24 2
1.98
25 2
1.92
26 2
2.01
27 2
2.05
28 2
2.03
n=13 n=15 n=28 n=16
Mean 2 2.02 2.04 2.03 1.98
SD
0.16 0.16 0.17 0.14
CV%
8.13 7.75 8.54 7.01
The definitive fills were performed on various dates and the four candidate materials were coded
as detailed in Table 2. Aliquots of 0.5 mL were dispensed into 3 mL autoclaved DIN glass
ampoules (Schott, Pont-sur-Yonne, France) using an automated AFV5090 ampoule filling line
(Bausch & Strobel, Ilfshofen, Germany) with the bulk materials continually stirred at a slow rate
using a magnetic stirrer whilst at ambient temperature. The homogeneity of the fill was determined
by on-line check-weighing of the wet weight of triplicate ampoules for every 90 ampoules filled.
The ampoules were partially stoppered with 13 mm Igloo stoppers (West, St Austell, UK) before
the materials were freeze-dried in a CS15 (Serail, Argenteuil, France) to ensure long-term stability:
the ampoules were frozen to -50°C, with primary drying at -35°C, 50 μbar, for 30 hours, followed
by secondary drying at +30°C, 30 μbar, for 40 hours. The vacuum was then released and the
ampoules back-filled using boil-off gas from high purity liquid nitrogen (99.99%), before
stoppering in situ in the dryer and flame sealing of the ampoules.
Measurement of the mean oxygen head space after sealing served as a measure of ampoule
integrity (Table 9). This was measured non-invasively by frequency modulated spectroscopy
(FMS 760, Lighthouse Instruments, Charlottesville, VA, USA), based upon the Near Infra-Red
absorbance by oxygen at 760 nm when excited using a laser. Controls of 0% and 20% oxygen
were tested before samples were analysed to verify the method. Twelve ampoules were tested at
random from each material; oxygen should be less than 1.14%. Residual moisture content was
![Page 42: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/42.jpg)
WHO/BS/2019.2373
Page 42
measured for the same 12 ampoules per material using the coulorimetric Karl Fischer method in a
dry box environment (Mitsubishi CA100, A1 Envirosciences, Cramlington, UK) with total
moisture expressed as a percentage of the mean dry weight of the ampoule contents. Individual
ampoules were opened in the dry box and reconstituted with approximately 1-3 mL Karl Fischer
analyte reagent which was then injected back into the Karl Fischer reaction cell and the water
present in the sample determined color metrically. Dry weight was determined for six ampoules
per material weighed before and after drying, with the measured water expressed as a percentage
of the dry weight. Residual moisture levels of less than 1% are typically obtained, but where the
dry weight is low (as here) the moisture level can be higher, with the materials still expected to
demonstrate long-term stability (as seen for the similarly prepared WHO 1st International
Reference Panel for Prader Willi & Angelman Syndromes, NIBSC panel code 09/140, which
continues to demonstrate high stability ten years post-manufacture). Ongoing stability is confirmed
by accelerated degradation studies (as detailed in Appendix IV).
Table 9. Production and measurement for gDNA contents and integrity NIBSC Code 18/126 18/132 18/142 18/144
Date Filled 01/06/2018 21/06/2018 28/06/2018 28/06/2018
Mean DNA
concentration upon
filling (µg/mL)
9.97 10.09 10.19 10.24
Mean fill mass (g) 0.5156g 0.5154g 0.5161g 0.5150g
Coefficient of variation
of fill mass (%) 0.16% 0.27% 0.15% 0.19%
Mean dry weight (g) 0.00249g 0.00268g 0.00233g 0.00278g
Coefficient of variation
of dry mass (%) 3.90% 5.42% 2.89% 5.02%
Mean residual moisture
after lyophilisation 1.72% 1.36% 0.85% 2.07%
Coefficient of variation
of residual moisture 77.44% 14.13% 58.40% 29.85%
Mean residual oxygen 0.39% 0.39% 0.42% 0.58%
Coefficient of variation
of residual oxygen 45.25% 30.00% 20.23% 30.56%
Mean Qubit DNA
concentration upon
reconstitution in 100µl
H2O (ng/µl)
51.81 49.23 54.13 54.73
Mean OD ratio
(260/280nm) 1.84 1.92 1.89 1.90
Mean TapeStation DIN 9.13 9.87 9.80 9.77
Presentation Sealed, glass DIN ampoules, 3mL
![Page 43: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/43.jpg)
WHO/BS/2019.2373
Page 43
Excipient 5mg/mL Trehalose in 2.0 mM Tris, 0.2 mM EDTA buffer
Address of facility
where material was
processed
NIBSC, South Mimms, Hertfordshire, UK
Present custodian NIBSC, South Mimms, Hertfordshire, UK
Storage Temperature -20°C
Genomic DNA materials were freeze-dried in glass ampoules as an established format to ensure
long-term stability of gDNAs. Ideally, the formulation for reference reagents should be as close as
possible to the usual product or patient analyte, cover the entire analytical process, and be
applicable to methods in use throughout the world. However, it is essential that the formulation be
stable for many years, and that it is practically possible to produce batches of sufficient size to
satisfy demand over a similar period of time. Additionally, it should ideally be possible to generate
replacement standards from the same source material to ensure consistency in formulation and to
minimize value drift.
Homogeneity of each fill was determined by analysis of samples from the beginning, middle, and
end of the filling process with quality and quantity of the freeze-dried gDNAs confirmed by
260/280 nm absorbance (Nanodrop, Thermo Fisher Scientific, Wilmington, DE, USA), Qubit
fluorometric DNA quantification (Thermo Fisher Scientific), TapeStation electrophoresis
(Agilent, Santa Clara, CA, USA). Figure 4 shows that the genomic DNA retained from each step
of the process showed a consistent and high integrity as being represented by a DIN value between
9.13 -9.9 throughout the production, filling and freeze-drying process, demonstrating a high
fidelity of the adopted production and lyophilization process. Table 10 shows that the
concentration and purity of the bulk and the reconstituted lyophilized-gDNA were comparable
before and after lyophilization. Microbiological results were negative for all materials.
All ampoules are stored at -20°C at NIBSC under continuous temperature monitoring for the
lifetime of the products. Shipping will typically be at ambient temperature, as previous studies
have indicated the retained stability of the materials at elevated temperatures (8 months at +56°C,
as detailed in the section of Degradation Studies of this report). Upon reconstitution with 200 μL
nuclease-free water, the DNA concentration will be approximately 25 μg/mL in 10 mM Tris, 1
mM EDTA buffer with 5 mg/mL D-(+)-trehalose dehydrate, that is 5g gDNA/ampoule base on
QuBit quantitation (Table 10).
![Page 44: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/44.jpg)
WHO/BS/2019.2373
Page 44
Figure 4. Integrity of gDNA through the production process
18/142 (A/E) 18/144 (D) L
add
er
Po
siti
ve
Co
ntr
ol
Pre
-Pri
me
Po
st-P
rim
e
Beg
innin
g F
ill
Rec
onst
itu
ted
Beg
innin
g F
ill
Mid
dle
Fil
l R
eco
nst
itu
ted
Mid
dle
Fil
l
End
Fil
l R
eco
nst
itu
ted
End
Fil
l
Pre
-Pri
me
Po
st-P
rim
e
Beg
innin
g F
ill
Rec
onst
itu
ted
Beg
innin
g F
ill
Mid
dle
Fil
l R
eco
nst
itu
ted
Mid
dle
Fil
l
End
Fil
l R
eco
nst
itu
ted
End
Fil
l
18/126 (B)
Lad
der
Po
siti
ve
Co
ntr
ol
Pre
-Pri
me
Po
st-P
rim
e
Beg
innin
g F
ill
Rec
onst
itu
ted
Beg
innin
g F
ill
Mid
dle
Fil
l R
eco
nst
itu
ted
Mid
dle
Fil
l
End
Fil
l R
eco
nst
itu
ted
End
Fil
l
![Page 45: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/45.jpg)
WHO/BS/2019.2373
Page 45
Lad
der
Po
siti
ve
Co
ntr
ol
Pre
-Pri
me
Po
st-P
rim
e
Beg
innin
g F
ill
Rec
onst
itu
ted
Beg
innin
g F
ill
Mid
dle
Fil
l R
eco
nst
itu
ted
Mid
dle
Fil
l
End
Fil
l R
eco
nst
itu
ted
End
Fil
l
18/132 (C)
![Page 46: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/46.jpg)
WHO/BS/2019.2373
Page 46
Table 10. Quality and Quantity of gDNA before and after production process
NIBSC Code
Study Code DNA quantitation
Bulk material
before vialing
n=3
Reconstituted
after freeze-dried
n= 3
18 / 142
A/E
Nanodrop (260/280nm) 1.85 1.90
Nanodrop (g/ampoule) - 6.42
Qubit (g/ampoule) 5.09 4.91
18 / 126
B
Nanodrop (260/280nm) 1.85 1.86
Nanodrop (g/ampoule) - 6.73
Qubit (g/ampoule) 4.96 4.95
18 / 132
C
Nanodrop (260/280nm) 1.86 1.86
Nanodrop (g/ampoule) - 7.1
Qubit (g/ampoule) 4.96 5.03
18 / 144
D
Nanodrop (260/280nm) 1.84 1.91
Nanodrop (g/ampoule) - 6.97
Qubit (g/ampoule) 5.12 4.99
![Page 47: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/47.jpg)
WHO/BS/2019.2373
Page 47
Appendix V
Accelerated Degradation and Stability Studies
Multiple samples were reserved for in-house long-term accelerated degradation studies by storage
at temperatures (-150°C, -70°C, -20°C, +4°C, +20°C, +37°C, and +56°C), as well as for real-time
stability monitoring at -20°C. Accelerated degradation studies were performed to predict the long-
term stability of the candidate standard. Ampoules of the lyophilised preparation were stored at
different temperatures, namely +56 oC, +45 °C, +37 oC, 20 oC and 4 °C and tested at indicated
time points together with ampoules stored at the recommended temperature of -20 °C and -70 °C
as baseline reference temperature. There was no observed loss in quantity so no attempt to predict
degradation rates has been undertaken. Real time monitoring of stability is ongoing.
Upon reconstitution with 200 μl nuclease-free water, the DNA concentration was approximately
25 μg/mL in 10 mM Tris, 1 mM EDTA buffer with 5 mg/mL D-(+)-trehalose dehydrate,
Homogeneity of each fill was determined by analysis of ampoules from the beginning, middle,
and end of the filling process with quality and quantity of the freeze-dried gDNAs confirmed by
260/280 nm absorbance (Nanodrop, Thermo Fisher Scientific, Wilmington, DE, USA), Qubit
fluorometric DNA quantification (Thermo Fisher Scientific), TapeStation electrophoresis
(Agilent, Santa Clara, CA, USA), qPCR and ddPCR, which also acted as a pilot study to determine
the performance of the materials in this increasingly-used diagnostic technique. Microbiological
results were negative for all materials. The ampoules are stored at -20°C at NIBSC under
continuous temperature monitoring for the lifetime of the product. Shipping will typically be at
ambient temperature, as studies have indicated the retained stability of the materials at elevated
temperatures (8 months at +56°C, see Degradation Studies, below).
Preliminary samples were assessed after four months’ and eight months’ storage and demonstrated
no apparent degradation at all temperatures measured (-150°C, -70°C, -20°C, +4°C, +20°C,
+37°C, and +56°C), as measured by electrophoresis (TapeStation; Figure 5 and Table 11),
260/280 nm absorbance (Nanodrop), DNA quantification (Qubit), with data comparable to that
seen at the time of manufacture (Table 12 and 13), including a retained lower DIN for materials
18/126, 18/132, 18/142 and 18/144, as compared with the other materials.
The absence of degradation at elevated temperature resulted in the inability to predict loss of real-
time stability. However, assurance that the materials are suitable for shipping at ambient
temperatures was provided. Samples will continue to be assessed on a regular basis (typically
annually) to ensure ongoing long-term stability for the lifetime of the panel. Previous experience
with similar gDNA reference panels has demonstrated ongoing real-time stability at least twelve
years post-manufacture.
![Page 48: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/48.jpg)
WHO/BS/2019.2373
Page 48
Figure 5. Genomic DNA integrity by TapeStation analysis after four (a) and
eight (b) month accelerated degradation studies
(a)
(b)
TapeStation analysis of the four materials of the proposed WHO 1st International Reference Panel
for following 8 months’ storage at various temperatures. High quality gDNA as indicated by a
high molecular weight band and the absence of lower molecular weight fragmented gDNA, and as
quantified by a high DIN, was apparent for all materials, including at elevated temperature,
indicating the absence of degradation. Lane 1, DNA ladder (catalogue number 5190-6292,
Agilent); lane 2, positive control (catalogue number G3041, Promega); lanes 3-28, ampoules
stored for eight months at -150°C, -70°C, -20°C, +4°C, +20°C, +37°C, and +56°C for each
material as follows: 18/126, 18/132, 18/142, and 18/144.
![Page 49: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/49.jpg)
WHO/BS/2019.2373
Page 49
Table 11. Genomic DNA integrity after 4 and 8-month accelerate degradation
studies 18/126 18/132 18/142 18/144 Average DIN Average DIN Average DIN Average DIN
Temperature
(oC)
4
months
8
months
4
months
8
months
4
months
8
months
4
months
8
months
-150 9.23 9.47 9.77 9.70 9.03 9.17 9.03 9.77
-70 8.93 9.47 9.53 9.83 9.73 9.67 9.73 9.67
-20 8.70 9.40 9.60 9.77 9.70 9.77 9.70 9.67
+4 9.07 9.57 9.70 9.63 9.70 9.80 9.70 9.77
+20 9.20 9.50 9.53 9.73 9.70 9.73 9.70 9.80
+37 8.60 9.53 9.20 9.50 9.63 9.77 9.63 9.73
+56 8.87 9.37 9.37 9.53 8.73 9.63 8.73 9.67
Note: Average DIN tested using TapeStation analysis after samples were kept at -150 to +56 oC
for four and eight months
Table 12. Genomic DNA quantity and quality after four-month accelerated
degradation studies Temperature oC
NIBSC
Code DNA quantitation -150 -70 -20 +4 +20 +37 +56
18/126
Nanodrop (ng/µL; n=3) 41.97 41.50 33.63 33.17 31.83 37.33 37.20
Nanodrop (260/280nm;
n=3) 1.85 1.86 1.86 1.86 1.85 1.85 1.87
Qubit (ng/µL; n=3) 28.30 26.70 24.93 24.53 24.73 25.50 27.47
18/132
Nanodrop (ng/µL; n=3) 38.10 39.10 35.73 36.80 36.17 35.83 36.50
Nanodrop (260/280nm;
n=3) 1.86 1.82 1.86 1.89 1.83 1.86 1.81
Qubit (ng/µL; n=3) 30.23 29.43 23.47 23.67 30.07 27.30 26.23
18/142
Nanodrop (ng/µL; n=3) 35.37 32.90 32.10 43.00 39.97 34.67 33.50
Nanodrop (260/280nm;
n=3) 1.85 1.86 1.90 1.84 1.87 1.85 1.87
Qubit (ng/µL; n=3) 24.37 25.37 28.20 30.03 24.53 29.27 30.07
18/144
Nanodrop (ng/µL; n=3) 36.27 36.00 34.87 39.33 35.70 35.80 34.77
Nanodrop (260/280nm;
n=3) 1.84 1.84 1.91 1.89 1.84 1.84 1.82
Qubit (ng/µL; n=3) 30.83 30.27 28.17 27.80 25.03 24.30 25.50
![Page 50: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/50.jpg)
WHO/BS/2019.2373
Page 50
Table 13. Genomic DNA quantity, quality and LV copy quantitation
after eight-month accelerated degradation studies Temperature oC
NIBSC
Code DNA quantitation -150 -70 -20 +4 +20 +37 +56
18/126
Nanodrop (ng/µL; n=3) 32.53 31.47 32.00 34.27 33.03 32.37 33.17
Nanodrop (260/280nm; n=3) 1.89 1.86 1.86 1.89 1.91 1.92 1.94
Qubit (ng/µL; n=3) 27.93 28.93 27.80 28.53 28.73 28.67 27.13
18/132
Nanodrop (ng/µL; n=3) 32.93 32.53 33.43 33.00 33.37 33.60 35.37
Nanodrop (260/280nm; n=3) 1.87 1.84 1.84 1.87 1.87 1.85 1.87
Qubit (ng/µL; n=3) 29.00 27.83 28.50 28.67 29.00 29.63 27.93
qPCR copy numbers/cell
(SYBRGreen) 8.10 8.52 7.35 6.57 7.32 8.62 8.18
95% LCL 9.57 7.80 10.26 9.08 4.52 10.19 9.30
95% UCL 11.29 16.11 12.43 13.74 14.87 11.32 13.00
qPCR copy number/cell
(TaqMan) 10.43 11.96 11.34 11.42 9.35 10.75 11.12
95% LCL 3.96 3.33 5.86 4.13 6.08 5.37 4.32
95% UCL 12.51 13.76 8.86 9.21 8.57 11.92 12.23
18/142
Nanodrop (ng/µL; n=3) 31.23 31.67 31.53 31.03 31.83 32.20 32.20
Nanodrop (260/280nm; n=3) 1.87 1.86 1.88 1.93 1.91 1.89 1.92
Qubit (ng/µL; n=3) 28.33 28.40 27.37 27.80 29.13 28.37 28.07
18/144
Nanodrop (ng/µL; n=3) 31.37 31.57 34.73 31.73 31.67 32.03 31.83
Nanodrop (260/280nm; n=3) 1.93 1.90 1.86 1.91 1.83 1.83 1.85
Qubit (ng/µL; n=3) 28.30 27.17 27.67 27.30 28.03 28.10 27.67
Post-Reconstitution Stability Studies
End-users are recommended to use the materials on the day of reconstitution. However, in-house
analysis determined reconstituted freeze-dried gDNA to be stable for at least four days at +4°C,
or for one months at -20°C (Figures 6 and 7), with data comparable to that seen at the time of
manufacture (Table 8), including a retained high DIN for materials 18/126, 18/132, 18/142 and
18/144, as compared with the other materials.
![Page 51: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/51.jpg)
WHO/BS/2019.2373
Page 51
Figure 6. Genomic DNA integrity by TapeStation analysis after reconstitution
in water and storage at 4 oC for four days
Lad
der
Po
st-f
ill
(10
ng/µ
L)
4 d
ays
Rec
onst
ituti
on
4°C
(5
0 n
g/µ
L)
Po
siti
ve
contr
ol
18/126
Po
st-f
ill
(10
ng/µ
L)
4 d
ays
Rec
onst
ituti
on
4°C
(5
0 n
g/µ
L)
Po
st-f
ill
(10
ng/µ
L)
4 d
ays
Rec
onst
ituti
on
4°C
(5
0 n
g/µ
L)
Po
st-f
ill
(10
ng/µ
L)
4 d
ays
Rec
onst
ituti
on
4°C
(5
0 n
g/µ
L)
18/132 18/142 18/144
![Page 52: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/52.jpg)
WHO/BS/2019.2373
Page 52
Figure 7. Genomic DNA integrity by TapeStation analysis after reconstitution
in water and storage at -20oC for one months
18/1
26
18/1
32
18/1
42
18/1
44
![Page 53: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/53.jpg)
Appendix VI
Instructions for Use (IFU) Sent to Participants
Thank you for participating in the collaborative study to evaluate the proposed World Health
Organization (WHO) 1st International Reference panel for lentiviral vector integration copy number
quantitation.
Introduction
Lentiviral vectors (LV) have emerged as the benchmark for gene therapy applications and have been
successfully used in a cure for monogenic immunodeficiency disorders and chimeric antigen receptor
(CAR) T-cell cancer immunotherapies. In 2016, World Health Organization (WHO) approved the
development of the WHO 1st International Reference panel for lentiviral vector integration copy
number quantitation, which is suitable for the standardization of assays and enabling comparison of
cross-trial and cross-manufacturing results for this important vector platform. The Reference panel
will be expected to optimize the development of gene therapy medicinal products, which is especially
important, given the usually orphan nature of the diseases to be treated, naturally hampering
reproducibility and comparability of results.
Aim of the Study
The purpose of this collaborative study (CS633) is to evaluate the provided five freeze-dried
genomic DNA samples using proposed methods, i.e. TaqMan qPCR, SYBRGreen qPCR, digital
PCR, or sequencing-based methods, in order to assign a consensus, i.e. LV integration copy
number per cell, to each of the materials.
The panel of five genomic DNA samples (A, B, C, D and E) have been produced from lentiviral
vector transduced single cell clones and freeze-dried at 2000 to 5,000 ampoules per sample. The
provided samples have been selected as candidate standards containing either zero, low or high
copies of LV integration.
Your agreement will be sought on the consensus value assignment before a report is submitted to
the World Health Organization in June 2019 for the establishment of the candidate materials as
the WHO 1st International Reference panel for the quantitation of lentiviral vector integration. It
is anticipated that the study results will be published in a WHO annual report and an international
journal with your consent and with individual participants’ data blind coded.
It is anticipated that the panel of genomic DNA standards can be used individually as zero, low or
high copy standard alongside individual laboratories’ in-house standards or can be used in
combination to generate a genomic DNA standard curve for the calibration of individual
laboratories’ in-house standards.
Before starting the study, please read this Instruction for Use (IFU) document completely. If
you intend to use the provided NIBSC standard and primer sets, please also read Appendix for
the ‘Example NIBSC Protocols’. If anything is unclear, please contact Yuan Zhao
([email protected]; telephone +44 (0)1707 641000).
![Page 54: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/54.jpg)
WHO/BS/2019.2373
Page 54
Samples provided:
Lyophilised samples are genomic DNAs freeze-dried in TE buffer and presented in sealed glass
DIN ampoules. Participants will receive multiple sets of five ampoules of the samples. Each set of
samples consists of one ampoule of each of samples A, B, C, D and E. The amount of genomic
DNA in each ampoule is approximately 5µg and the concentration after reconstitution in 200µl
water (Table 1) will be approximately 25ng/µL in 1x TE (as determined by Qubit quantification).
Liquid forms of samples include
• 80µL ‘NIBSC DNA standard’ at a concentration of 109 copies/5µL, which can be used to
generate a quantitation standard curve from 108 to 102 copies/5µl per well.
• 120µL of ‘NIBSC LV_primer set’ that includes forward and reverse primers targeting
lentivirus (LV) sequences at a concentration of 100µM solution in H2O
• 120µL ‘NIBSC HK_primer set’ that includes forward and reverse primers targeting house-
keeping (HK) gene sequences at a concentration of 100µM solution in H2O
All samples (lyophilised and liquid) are to be stored at -20°C upon receipt and until use.
Important Note:
1) The provided lyophilised genomic DNA samples carry a 3rd generation of lentiviral vector
(kindly donated by Professor Didier Trono, EPFL/Geneva) with a reporter gene GFP. You may
reference the publication by Zufferey et al 1998 (J Virology 72:9873-9880)4 when designing
or confirming the suitability of your in-house primers/probes before the tests.
2) Participants are recommended to use transgene independent primers/probe to evaluate
lentivirus copy number.
3) Due to the stability issue, we cannot send out the DNA probes for TaqMan qPCR testing.
Participants performing TaqMan qPCR testing are required to order the probes before
testing. The probe sequences that should be used with the corresponding NIBSC primer sets
are:
LV-probe 5’- [6FAM] – CCTCCAGGTCTGAAGATCAGCGGCCGC - [TAMRA] - 3’
HK-probe 5’- [6FAM] – CCTGTCATGCCCACACAAATCTCTCC - [TAMRA] - 3’.
4) All participants will receive the liquid NIBSC ‘DNA standard’, ‘LV_primer set’ and
‘HK_primer set’; however, you do not need to use these standards and/or primers if you have
an in-house standard and/or primers available. You can use the provided two NIBSC primer
sets together in a test, or you can use one set of the provided NIBSC primers, e.g. NIBSC HK
primers, in combination with a set of your in-house primers, e.g. in-house LV primers, or vice
versa, in a test. The provided primer sequences are given in Table 6.
5) After being prepared as instructed in Table 1, each set of 8 testing samples i.e. A+E, B, C, C1,
C2, C3, C4 and D will be sufficient for loading onto 2 plates, i.e. to test each sample once using
![Page 55: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/55.jpg)
WHO/BS/2019.2373
Page 55
2 methods (e.g. SYBRGreen and TaqMan or TaqMan and digital PCR). Therefore, we are
sending 4 sets of samples - 3 sets for triplicate tests and one extra set as a backup - to the
participants who have proposed to perform two methods or one method, with both your in-
house standard/primers and NIBSC standard/primers.
Preparation of Sample Ampoule:
The samples should be handled as follows:
1. Due to the inherent stability of freeze-dried material, all materials will be shipped at
ambient temperature.
2. Store all unopened ampoules of the freeze-dried and liquid materials at -20°C until use.
3. A disposable plastic ampoule breaker is provided with each DIN ampoule.
4. DIN ampoules have an ‘easy-open’ coloured stress point, where the narrow ampoule stem
joins the wider ampoule body. Tap the ampoule gently to collect the material at the
bottom (labelled) end of the wider ampoule body.
5. Ensure that the disposable plastic ampoule safety breaker provided is pushed down on the
stem of the ampoule and against the shoulder of the ampoule body.
6. Hold the body of the ampoule in one hand and the disposable ampoule breaker
covering the ampoule stem between the thumb and first finger of the other hand.
7. Apply a bending force to open the ampoule at the coloured stress point, primarily
using the hand holding the plastic collar.
8. Care should be taken to avoid cuts and projectile glass fragments that might enter the
eyes, for example, using suitable gloves and an eye shield. Take care that no material
is lost from the ampoule and no glass falls into the ampoule. Within the ampoule is dry
nitrogen gas at slightly less than atmospheric pressure.
9. It is highly recommended that the materials are used on the day they are reconstituted and
are not stored. However, our analysis determined reconstituted freeze-dried genomic DNA
to be stable for up to 1 week at +4°C (or 1 month at -20°C). Care should be taken to avoid
cross-contamination with other samples.
![Page 56: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/56.jpg)
WHO/BS/2019.2373
Page 56
Overview of Sample Testing
Table 1. Sample Reconstitution and Preparation
To ensure the comparability of study results, participants are required to follow the
instruction given below:
10. To reconstitute the lyophilised samples in 200µL H2O as detailed in Table 1. It Is
recommended to reconstitute one set of samples at a time and on the day of testing. Each
set of samples consists of one ampoule of each of sample A, B, C, D and E.
11. Using Digital PCR, to test 0.4µL per well (i.e.~10ng per well) each of the 4 reconstituted
samples, i.e. A+E, B, C and D (Table 1), in triplicate wells for each sample and follow the
plate layout given in Table 3A-C for digital PCR. Please note that using digital PCR, you
do not need to prepare samples C1, C2, C3 and C4 and do not need to use DNA standards.
It is required to digest the genomic DNA samples with an appropriate restriction enzyme,
e.g. DraI, before digital PCR testing.
12. Using qPCR, to test 5 µL per well (i.e.~125ng per well) each of the 8 reconstituted
samples i.e. A+E, B, C, C1, C2, C3, C4 and D (Table 1), in triplicate wells for each sample
and follow the plate layout given in Table 2A-C for qPCR.
![Page 57: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/57.jpg)
WHO/BS/2019.2373
Page 57
13. To include a series of dilutions of your in-house or NIBSC DNA standards in qPCR, e.g.
a series of 1/10 dilutions and ranging from 108 to 102 copies. To test 5µL per well of the
DNA standards in triplicates following the plate layout given in Table 2A-C for qPCR.
DNA standards are not required for digital PCR.
14. Each method, e.g. SYBRGreen, TaqMan or digital PCR, should be tested 3 times on 3
separate days using 3 separate sets of samples, preferentially by 3 operators.
15. Participants are encouraged to use your own in-house methods to test the materials, given
that 5 µL sample per well (i.e.~125ng sample per well) or 5 µL standard per well (i.e.108
to 102 copies per well) were tested in qPCR and, 0.4 µL sample per well (i.e.~10ng per
well) were tested in digital PCR. In the case of no in-house methods available, example
NIBSC protocols are provided in Appendix III for qPCR and Appendix IV for digital PCR.
16. To complete the Data Reporting File as provided in a separate excel file and as outlined
in Table 4 for qPCR and Table 5 for digital PCR and, as further detailed below.
17. For Digital PCR, to complete “Digital PCR Data Reporting” file as shown Tale 5 and, to
provide the Mandatory Data in the area highlighted in orange. Within one reporting excel
file, there are 4 tabs, i.e. “Simplex digital PCR 1,2,3”, “Multiplex digital PCR 1,2,3”,
“digital PCR Result Summary” and “DNA concentration” (Table 5A-C). Please also
submit raw data in a format of csv file, as provided by the BioRad Quantasoft software.
18. For qPCR, to complete “qPCR Data Reporting” file as shown in Table 4 and, to provide
the Mandatory data (e.g. Ct in LightCycler qPCR) in the area highlighted in orange. There
are 5 tabs in Table 4, i.e. “qPCR Plate 1”, “qPCR Plate 2”, “qPCR Plate 3”, “qPCR Results
Summary” and “DNA concentration” (Table 4A-C).
19. If possible, please also provide the optional quantitative results in Table 4 Tab 4 in the area
shaded in grey, e.g. LV copies per cell, using your routine quantitation method, e.g. excel,
prism or Combi stats.
20. One Reporting excel file is for reporting one set of qPCR data, i.e. from 3 plates using one
method to test 3 times on 3 separate sets of samples. If more than one method is used for
qPCR, e.g. TaqMan and SYBRGreen qPCR, please complete one file (copy) for one
method.
21. Please submit raw data files exported from qPCR software, e.g. Roche Lightcycler 480,
Qiagen Q-Rex, Agilent MxPro or ThermoFisher StepOneTM software.
22. Using Sequencing based methods, to test 4 samples A+E, B, C and D and to report LV
integration sites for each sample in a word document.
23. Using Southern blot, to test 4 samples A+E, B, C and D and to report copy numbers for
Lentivirus (LV) and House-keeping gene (LV) separately and in your chosen format.
24. Please give details if you are unable to report results for any samples or encounter any
difficulties during the study.
25. Please provide any comments related to the study that may help the statistical analysis.
26. Please retain all original data files. We will contact you if further clarification is required
on your data reports.
![Page 58: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/58.jpg)
WHO/BS/2019.2373
Page 58
27. The results should be sent electronically before 18th January 2019 to Yuan Zhao
([email protected]) to ensure the submission of our study results to WHO before June
2019.
Contacts:
Project Leader: Yuan Zhao ([email protected] )
Statistician: Peter Rigsby ([email protected])
Study Coordinators: Christopher Traylen ([email protected]),
James Condron ([email protected])
Table 2A – qPCR Day 1 Plate Layout
1 2 3 4 5 6 7 8 9 10 11 12
A 108 108 108 5µl A+E 5µl A+E 5µl A+E 108 108 108 5µl A+E 5µl A+E 5µl A+E
B 107 107 107 5µl B 5µl B 5µl B 107 107 107 5µl B 5µl B 5µl B
C 106 106 106 5µl C 5µl C 5µl C 106 106 106 5µl C 5µl C 5µl C
D 105 105 105 5µl C1 5µl C1 5µl C1 105 105 105 5µl C1 5µl C1 5µl C1
E 104 104 104 5µl C2 5µl C2 5µl C2 104 104 104 5µl C2 5µl C2 5µl C2
F 103 103 103 5µl C3 5µl C3 5µl C3 103 103 103 5µl C3 5µl C3 5µl C3
G 102 102 102 5µl C4 5µl C4 5µl C4 102 102 102 5µl C4 5µl C4 5µl C4
H H2O H2O H2O 5µl D 5µl D 5µl D H2O H2O H2O 5µl D 5µl D 5µl D
Table 2B – qPCR Day 2 Plate Layout
1 2 3 4 5 6 7 8 9 10 11 12
A 108 108 108 5µl A+E 5µl A+E 5µl A+E 108 108 108 5µl A+E 5µl A+E 5µl A+E
B 107 107 107 5µl B 5µl B 5µl B 107 107 107 5µl B 5µl B 5µl B
C 106 106 106 5µl C 5µl C 5µl C 106 106 106 5µl C 5µl C 5µl C
D 105 105 105 5µl C1 5µl C1 5µl C1 105 105 105 5µl C1 5µl C1 5µl C1
E 104 104 104 5µl C2 5µl C2 5µl C2 104 104 104 5µl C2 5µl C2 5µl C2
F 103 103 103 5µl C3 5µl C3 5µl C3 103 103 103 5µl C3 5µl C3 5µl C3
G 102 102 102 5µl C4 5µl C4 5µl C4 102 102 102 5µl C4 5µl C4 5µl C4
H H2O H2O H2O 5µl D 5µl D 5µl D H2O H2O H2O 5µl D 5µl D 5µl D
qPCR target LV sequence qPCR target house-keeping gene
qPCR target LV sequence qPCR target house-keeping gene
![Page 59: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/59.jpg)
WHO/BS/2019.2373
Page 59
Table 2C – qPCR Day 3 Plate Layout
1 2 3 4 5 6 7 8 9 10 11 12
A 5µl A+E 5µl A+E 5µl A+E 108 108 108 5µl A+E 5µl A+E 5µl A+E 108 108 108
B 5µl B 5µl B 5µl B 107 107 107 5µl B 5µl B 5µl B 107 107 107
C 5µl C 5µl C 5µl C 106 106 106 5µl C 5µl C 5µl C 106 106 106
D 5µl C1 5µl C1 5µl C1 105 105 105 5µl C1 5µl C1 5µl C1 105 105 105
E 5µl C2 5µl C2 5µl C2 104 104 104 5µl C2 5µl C2 5µl C2 104 104 104
F 5µl C3 5µl C3 5µl C3 103 103 103 5µl C3 5µl C3 5µl C3 103 103 103
G 5µl C4 5µl C4 5µl C4 102 102 102 5µl C4 5µl C4 5µl C4 102 102 102
H 5µl D 5µl D 5µl D H2O H2O H2O 5µl D 5µl D 5µl D H2O H2O H2O
Table 3A – Digital PCR Day 1 Plate Layout 1 2 3 4 5 6 7 8 9 10 11 12
A H2O A+E A+E A+E
B H2O B B B
C H2O C C C
D H2O D D D
E H2O A+E A+E A+E
F H2O B B B
G H2O C C C
H H2O D D D
Table 3B – Digital PCR Day 2 Plate Layout 1 2 3 4 5 6 7 8 9 10 11 12
A H2O A+E A+E A+E
B H2O B B B
C H2O C C C
D H2O D D D
E H2O A+E A+E A+E
F H2O B B B
G H2O C C C
H H2O D D D
qPCR target LV sequence qPCR target house-keeping gene
Digital PCR targeting LV
Digital PCR targeting HK
Digital PCR targeting LV
Digital PCR targeting HK
![Page 60: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/60.jpg)
WHO/BS/2019.2373
Page 60
Table 3C – Digital PCR Day 3 Plate Layout
1 2 3 4 5 6 7 8 9 10 11 12
A H2O A+E A+E A+E
B H2O B B B
C H2O C C C
D H2O D D D
E H2O A+E A+E A+E
F H2O B B B
G H2O C C C
H H2O D D D
Table 4A – qPCR Data Reporting Form for Plate 1, 2 and 3 (Tabs 1, 2 and 3)
Lentivirus Date: xx/xx/2018 Plate Row Dilutions LV Standard (copies/5L per well) LV Ct LV Ct LV Ct Mean LV Ct Stdev SEM CV (%) Sample (5L per well) LV Ct LV Ct LV Ct Mean LV Ct Stdev SEM CV (%)
Please Circle below A P1 1.00E+08 e.g. 1 2 3 2.50 0.71 0.50 28.28 A+E #DIV/0! #DIV/0! #DIV/0! #DIV/0!
Operator 1 or 2 or3 B P2 1.00E+07 #DIV/0! #DIV/0! #DIV/0! #DIV/0! B #DIV/0! #DIV/0! #DIV/0! #DIV/0!
TaqMan qPCR: Yes / No C P3 1.00E+06 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C #DIV/0! #DIV/0! #DIV/0! #DIV/0!
SybrGreen qPCR: Yes / No D P4 1.00E+05 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C1 #DIV/0! #DIV/0! #DIV/0! #DIV/0!
In house Standard: Yes / No E P5 1.00E+04 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C2 #DIV/0! #DIV/0! #DIV/0! #DIV/0!
NIBSC Standard: Yes / No F P6 1.00E+03 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C3 #DIV/0! #DIV/0! #DIV/0! #DIV/0!
in House Primers/probe: Yes / No G P7 1.00E+02 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C4 #DIV/0! #DIV/0! #DIV/0! #DIV/0!
NIBSC LV_Primers/Probe: Yes / No H H2O H2O #DIV/0! #DIV/0! #DIV/0! #DIV/0! D #DIV/0! #DIV/0! #DIV/0! #DIV/0!
Note: Pink area is Mandatory area to fill in Grey area is optional to fill in
House -Keeping (HK) gene Plate Row Dilutions HK Standard (copies/5L per well) HK Ct HK Ct HK Ct Mean HK Ct Stdev SEM CV (%) Sample (5L per well) HK Ct HK Ct HK Ct Mean HK Ct Stdev SEM CV (%)
Please Circle below A P1 1.00E+08 #DIV/0! #DIV/0! #DIV/0! #DIV/0! A+E #DIV/0! #DIV/0! #DIV/0! #DIV/0!
Operator 1 or 2 or3 B P2 1.00E+07 #DIV/0! #DIV/0! #DIV/0! #DIV/0! B #DIV/0! #DIV/0! #DIV/0! #DIV/0!
TaqMan qPCR: Yes / No C P3 1.00E+06 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C #DIV/0! #DIV/0! #DIV/0! #DIV/0!
SybrGreen qPCR: Yes / No D P4 1.00E+05 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C1 #DIV/0! #DIV/0! #DIV/0! #DIV/0!
In house Standard: Yes / No E P5 1.00E+04 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C2 #DIV/0! #DIV/0! #DIV/0! #DIV/0!
NIBSC Standard: Yes / No F P6 1.00E+03 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C3 #DIV/0! #DIV/0! #DIV/0! #DIV/0!
in House Primers/probe: Yes / No G P7 1.00E+02 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C4 #DIV/0! #DIV/0! #DIV/0! #DIV/0!
NIBSC HK_Primers/Probe: Yes / No H H2O H2O #DIV/0! #DIV/0! #DIV/0! #DIV/0! D #DIV/0! #DIV/0! #DIV/0! #DIV/0!
Note: Pink area is Mandatory area to fill in Grey area is optional to fill in
qPCR Data Report for Plate 1qPCR Data Report for Plate 1
Comments:
Lentivirus Date: xx/xx/2018 Plate Row Dilutions LV Standard (copies/5L per well) LV Ct LV Ct LV Ct Mean LV Ct Stdev SEM CV (%) Sample (5L per well) LV Ct LV Ct LV Ct Mean LV Ct Stdev SEM CV (%)
Please Circle below A P1 1.00E+08 e.g. 1 2 3 2.50 0.71 0.50 28.28 A+E #DIV/0! #DIV/0! #DIV/0! #DIV/0!
Operator 1 or 2 or3 B P2 1.00E+07 #DIV/0! #DIV/0! #DIV/0! #DIV/0! B #DIV/0! #DIV/0! #DIV/0! #DIV/0!
C P3 1.00E+06 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C #DIV/0! #DIV/0! #DIV/0! #DIV/0!
D P4 1.00E+05 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C1 #DIV/0! #DIV/0! #DIV/0! #DIV/0!
E P5 1.00E+04 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C2 #DIV/0! #DIV/0! #DIV/0! #DIV/0!
F P6 1.00E+03 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C3 #DIV/0! #DIV/0! #DIV/0! #DIV/0!
G P7 1.00E+02 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C4 #DIV/0! #DIV/0! #DIV/0! #DIV/0!
H H2O H2O #DIV/0! #DIV/0! #DIV/0! #DIV/0! D #DIV/0! #DIV/0! #DIV/0! #DIV/0!
Note: Pink area is Mandatory area to fill in Grey area is optional to fill in
House -Keeping (HK) gene Plate Row Dilutions HK Standard (copies/5L per well) HK Ct HK Ct HK Ct Mean HK Ct Stdev SEM CV (%) Sample (5L per well) HK Ct HK Ct HK Ct Mean HK Ct Stdev SEM CV (%)
Please Circle below A P1 1.00E+08 #DIV/0! #DIV/0! #DIV/0! #DIV/0! A+E #DIV/0! #DIV/0! #DIV/0! #DIV/0!
Operator 1 or 2 or3 B P2 1.00E+07 #DIV/0! #DIV/0! #DIV/0! #DIV/0! B #DIV/0! #DIV/0! #DIV/0! #DIV/0!
C P3 1.00E+06 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C #DIV/0! #DIV/0! #DIV/0! #DIV/0!
D P4 1.00E+05 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C1 #DIV/0! #DIV/0! #DIV/0! #DIV/0!
E P5 1.00E+04 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C2 #DIV/0! #DIV/0! #DIV/0! #DIV/0!
F P6 1.00E+03 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C3 #DIV/0! #DIV/0! #DIV/0! #DIV/0!
G P7 1.00E+02 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C4 #DIV/0! #DIV/0! #DIV/0! #DIV/0!
H H2O H2O #DIV/0! #DIV/0! #DIV/0! #DIV/0! D #DIV/0! #DIV/0! #DIV/0! #DIV/0!
Note: Pink area is Mandatory area to fill in Grey area is optional to fill in
qPCR Data Report for Plate 2qPCR Data Report for Plate 2
Comments:
Digital PCR targeting LV
Digital PCR targeting HK
![Page 61: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/61.jpg)
WHO/BS/2019.2373
Page 61
Table 4B –qPCR Reporting form for Summary Quantitation of LV
copies/cell (Tab 4)
Table 4C – Reporting Form for the Concentration of Reconstituted Samples
(Tab 5)
Lentivirus Date: xx/xx/2018 Plate Row Dilutions LV Standard (copies/5L per well) LV Ct LV Ct LV Ct Mean LV Ct Stdev SEM CV (%) Sample (5L per well) LV Ct LV Ct LV Ct Mean LV Ct Stdev SEM CV (%)
Please Circle below A P1 1.00E+08 e.g. 1 2 3 2.50 0.71 0.50 28.28 A+E #DIV/0! #DIV/0! #DIV/0! #DIV/0!
Operator 1 or 2 or3 B P2 1.00E+07 #DIV/0! #DIV/0! #DIV/0! #DIV/0! B #DIV/0! #DIV/0! #DIV/0! #DIV/0!
C P3 1.00E+06 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C #DIV/0! #DIV/0! #DIV/0! #DIV/0!
D P4 1.00E+05 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C1 #DIV/0! #DIV/0! #DIV/0! #DIV/0!
E P5 1.00E+04 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C2 #DIV/0! #DIV/0! #DIV/0! #DIV/0!
F P6 1.00E+03 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C3 #DIV/0! #DIV/0! #DIV/0! #DIV/0!
G P7 1.00E+02 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C4 #DIV/0! #DIV/0! #DIV/0! #DIV/0!
H H2O H2O #DIV/0! #DIV/0! #DIV/0! #DIV/0! D #DIV/0! #DIV/0! #DIV/0! #DIV/0!
Note: Pink area is Mandatory area to fill in Grey area is optional to fill in
House -Keeping (HK) gene Plate Row Dilutions HK Standard (copies/5L per well) HK Ct HK Ct HK Ct Mean HK Ct Stdev SEM CV (%) Sample (5L per well) HK Ct HK Ct HK Ct Mean HK Ct Stdev SEM CV (%)
Please Circle below A P1 1.00E+08 #DIV/0! #DIV/0! #DIV/0! #DIV/0! A+E #DIV/0! #DIV/0! #DIV/0! #DIV/0!
Operator 1 or 2 or3 B P2 1.00E+07 #DIV/0! #DIV/0! #DIV/0! #DIV/0! B #DIV/0! #DIV/0! #DIV/0! #DIV/0!
C P3 1.00E+06 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C #DIV/0! #DIV/0! #DIV/0! #DIV/0!
D P4 1.00E+05 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C1 #DIV/0! #DIV/0! #DIV/0! #DIV/0!
E P5 1.00E+04 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C2 #DIV/0! #DIV/0! #DIV/0! #DIV/0!
F P6 1.00E+03 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C3 #DIV/0! #DIV/0! #DIV/0! #DIV/0!
G P7 1.00E+02 #DIV/0! #DIV/0! #DIV/0! #DIV/0! C4 #DIV/0! #DIV/0! #DIV/0! #DIV/0!
H H2O H2O #DIV/0! #DIV/0! #DIV/0! #DIV/0! D #DIV/0! #DIV/0! #DIV/0! #DIV/0!
Note: Pink area is Mandatory area to fill in Grey area is optional to fill in
qPCR Data Report for Plate 3qPCR Data Report for Plate 3
Comments:
Plate 1 Plate 2 Plate 3
Sample (5L per well) Mean LV Copies of 3 Wells Mean HK Copies of 3 Wells Mean LV Copies per Cell Mean LV Copies of 3 Wells Mean HK Copies of 3 Wells Mean LV Copies per Cell Mean LV Copies of 3 Wells Mean HK Copies of 3 Wells Mean LV Copies per Celli.e. (mean LV copies of 3 Wells/mean HK copies of 3 wells) x2 i.e. (mean LV copies of 3 Wells/mean HK copies of 3 wells) x2 i.e. (mean LV copies of 3 Wells/mean HK copies of 3 wells) x2
A+E
B
C
C1
C2
C3
C4
D
Comments:
qPCR Result Summary
Set 1 Samples for Plate 1 Concentration (ng/ul) Mean
Method used: Please Circle below Read 1 Read 2 Read 3 concentration
Nanodrop Yes/No A+E 1 2 3 2 1 0.707106781 50
QuBit Yes/No B #DIV/0! #### #DIV/0! ####
others (please specify): C #DIV/0! #### #DIV/0! ####
D #DIV/0! #### #DIV/0! ####
Set 2 Samples for Plate 2 Concentration (ng/ul) Mean
Method used: Please Circle below Read 1 Read 2 Read 3 concentration
Nanodrop Yes/No A+E #DIV/0! #### #DIV/0! ####
QuBit Yes/No B #DIV/0! #### #DIV/0! ####
others (please specify): C #DIV/0! #### #DIV/0! ####
D #DIV/0! #### #DIV/0! ####
Set 3 samples for Plate 3 Concentration (ng/ul) Mean
Method used: Please Circle below Read 1 Read 2 Read 3 concentration
Nanodrop Yes/No A+E #DIV/0! #### #DIV/0! ####
QuBit Yes/No B #DIV/0! #### #DIV/0! ####
others (please specify): C #DIV/0! #### #DIV/0! ####
D #DIV/0! #### #DIV/0! ####
Grey area is optional to fill in
Plate 3 Stdev SEM CV%
Plate 1 Stdev SEM CV%
Plate 2 Stdev SEM CV%
![Page 62: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/62.jpg)
WHO/BS/2019.2373
Page 62
Table 5A –Digital PCR Raw Data Reporting Form for Plate 1, 2 and 3 (Tab 1 and 2)
Table 5B –Digital PCR Summary Quantitation of LV copies per cell (Tab 3)
Date: xx/xx/2018 Sample LV Copies per Well LV Copies per Well LV Copies per Well Mean LV Copies per Well Stdev SEM CV (%) Sample LV Copies per Well LV Copies per Well LV Copies per Well Mean LV Copies per Well Stdev SEM CV (%) Sample LV Copies per Well LV Copies per Well LV Copies per Well Mean LV Copies per Well Stdev SEM CV (%)
Please Circle below A+E e.g. 1 2 3 2.50 0.71 0.50 28.28 A+E #DIV/0! #DIV/0! #DIV/0! #DIV/0! A+E #DIV/0! #DIV/0! #DIV/0! #DIV/0!
Eva Green Yes / No B #DIV/0! #DIV/0! #DIV/0! #DIV/0! B #DIV/0! #DIV/0! #DIV/0! #DIV/0! B #DIV/0! #DIV/0! #DIV/0! #DIV/0!
Probe Yes / No C #DIV/0! #DIV/0! #DIV/0! #DIV/0! C #DIV/0! #DIV/0! #DIV/0! #DIV/0! C #DIV/0! #DIV/0! #DIV/0! #DIV/0!
in House Primers: Yes / No D #DIV/0! #DIV/0! #DIV/0! #DIV/0! D #DIV/0! #DIV/0! #DIV/0! #DIV/0! D #DIV/0! #DIV/0! #DIV/0! #DIV/0!
NIBSC LV_Primers: Yes / No
Note: Pink area is Mandatory area to fill in Grey area is optional to fill in
Date: xx/xx/2018 Sample HK Copies per Well HK Copies per Well HK Copies per Well Mean HK Copies per Well Stdev SEM CV (%) Sample HK Copies per Well HK Copies per Well HK Copies per Well Mean HK Copies per Well Stdev SEM CV (%) Sample HK Copies per Well HK Copies per Well HK Copies per Well Mean HK Copies per Well Stdev SEM CV (%)
Please Circle below A+E #DIV/0! #DIV/0! #DIV/0! #DIV/0! A+E #DIV/0! #DIV/0! #DIV/0! #DIV/0! A+E #DIV/0! #DIV/0! #DIV/0! #DIV/0!
Eva Green Yes / No B #DIV/0! #DIV/0! #DIV/0! #DIV/0! B #DIV/0! #DIV/0! #DIV/0! #DIV/0! B #DIV/0! #DIV/0! #DIV/0! #DIV/0!
Probe Yes / No C #DIV/0! #DIV/0! #DIV/0! #DIV/0! C #DIV/0! #DIV/0! #DIV/0! #DIV/0! C #DIV/0! #DIV/0! #DIV/0! #DIV/0!
in House Primers: Yes / No D #DIV/0! #DIV/0! #DIV/0! #DIV/0! D #DIV/0! #DIV/0! #DIV/0! #DIV/0! D #DIV/0! #DIV/0! #DIV/0! #DIV/0!
NIBSC LV_Primers: Yes / No
Operator Operator OperatorNote: Pink area is Mandatory area to fill in Grey area is optional to fill in
Comments:
1 or 2 or 3 1 or 2 or 3 1 or 2 or 3
Data Report for Digital PCR Plates 1, 2, 3. Plate 1 Plate 2 Plate 3
Lentivirus
House -Keeping (HK) gene
Date: xx/xx/2018 Sample LV Copies per Cell LV Copies per Cell LV Copies per Cell Mean LV Copies per Cell Stdev SEM CV (%) Sample LV Copies per Cell LV Copies per Cell LV Copies per Cell Mean LV Copies per Cell Stdev SEM CV (%) Sample LV Copies per Cell LV Copies per Cell LV Copies per Cell Mean LV Copies per Cell Stdev SEM CV (%)
Please Circle below A+E e.g. 1 2 3 2.50 0.71 0.50 28.28 A+E #DIV/0! #DIV/0! #DIV/0! #DIV/0! A+E #DIV/0! #DIV/0! #DIV/0! #DIV/0!
Eva Green Yes / No B #DIV/0! #DIV/0! #DIV/0! #DIV/0! B #DIV/0! #DIV/0! #DIV/0! #DIV/0! B #DIV/0! #DIV/0! #DIV/0! #DIV/0!
Probe Yes / No C #DIV/0! #DIV/0! #DIV/0! #DIV/0! C #DIV/0! #DIV/0! #DIV/0! #DIV/0! C #DIV/0! #DIV/0! #DIV/0! #DIV/0!
in House Primers: Yes / No D #DIV/0! #DIV/0! #DIV/0! #DIV/0! D #DIV/0! #DIV/0! #DIV/0! #DIV/0! D #DIV/0! #DIV/0! #DIV/0! #DIV/0!
NIBSC Primers: Yes / No
Operator Operator Operator
Note: Pink area is Mandatory area to fill in Grey area is optional to fill in
Comments:
Data Report for Multiplex Digital PCR Plates 1, 2, 3.
PCR Amplification of Lentivirus and HK in the same well
1 or 2 or 3 1 or 2 or 3
Note: LV Copies/Cell = (LV copies/HK copies) x2
Plate 1 Plate 2 Plate 3
1 or 2 or 3
Plate 1 Plate 2 Plate 3
Mean LV Copies per Cell Mean LV Copies per Cell Mean LV Copies per Cell
Digital PCR Result Summary
Comments:
Sample
A+E
B
CD
Note: Mean LV Copies per Cell = (mean LV copies of three wells /mean HK copies of three wells ) x2
![Page 63: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/63.jpg)
WHO/BS/2019.2373
Page 63
Table 5C – Digital PCR Reporting Form for the Concentration of
Reconstituted Samples (Tab 4)
Table 6 - Sequences for NIBSC LV and HK Primers and Probes
NIBSC
Primers/Probes Sequence
Storage
temperature
Lentivirus (LV)
Forward primer 5’-AGTAAGACCACCGCACAGCA-3’ -20°C
Reverse primer 5’-CCTTGGTGGGTGCTACTCCT-3’ -20°C
House-keeping (HK)
Forward primer 5’-GCTGTCATCTCTTGTGGGCTGT-3’ -20°C
Reverse primer 5’-ACTCATGGGAGCTGCTGGTTC-3’ -20°C
Lentivirus (LV) probe
5’-[6FAM]-
CCTCCAGGTCTGAAGATCAGCGGCCGC-
[TAMRA]-3’
Follow
manufacturer’s
instructions
House-keeping (HK)
probe
5’-[6FAM]-
CCTGTCATGCCCACACAAATCTCTCC-[TAMRA]-
3’
Follow
manufacturer’s
instructions
![Page 64: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/64.jpg)
WHO/BS/2019.2373
Page 64
Appendix VII
Example TaqMan and SYBRGreen qPCR Protocols
for Collaborative Study
Participants are encouraged to use their in-house study protocol to evaluate the samples. In
the case of no in-house protocol available, the following example protocols can be considered.
Materials
• Samples A, B, C, D and E are provided as lyophilised genomic DNA in glass ampoules
• NIBSC DNA standard is provided in solution at a concentration of 109 copies/5µL in H2O.
The provided DNA standard encodes both LV and house-keeping (HK) gene sequences;
therefore, one standard can be used for qPCR targeting both LV and HK sequences
• Primers for LV and HK are provided as primer sets and as a 10-fold strength of a stock
solution at 100µM solution in H2O. You can use the provided two NIBSC primer sets
together in a test, or you can use one set of the provided NIBSC primers, e.g. HK, in
combination with a set of your in-house primers, e.g. in-house LV primers, and vice versa,
in a test. The provided primer sequences are given in Table 5 below.
• You do not need to use the standard and primers provided if you have an in-house standard
and primers available.
Reagents are required but not provided and hence, are to be provided or procured by participants:
• Probes for TaqMan qPCR are NOT provided and thus must be procured by participants.
The sequences for the required probes are: LV_probe 5’- [6FAM] –
CCTCCAGGTCTGAAGATCAGCGGCCGC - [TAMRA] - 3’ and HK_probe 5’- [6FAM] –
CCTGTCATGCCCACACAAATCTCTCC - [TAMRA] - 3’.
• qPCR master mix, such as Taq DNA Polymerase: Light Cycler® 480 Probes Master
(Roche Life Science) (# 04707494001) for TaqMan qPCR, or SensiMix™ SYBR® No-
ROX Kit (Bioline) (#QT650-05) for SYBRGreen qPCR.
• RNAse/DNAse-free H2O.
• DNAse/RNAse-free microtubes.
• DNAse/RNAse-free filter tips.
• 96-well qPCR plates and seals.
• qPCR appliance, e.g. LightCycler1.5 and capillary centrifuge or LightCycler 480, Roche
or equivalent.
• A spectrophometer for measuring the DNA concentrations.
It is recommended to prepare all solutions and perform the assays in a PCR cabinet or suite
with usual precautions for PCR experiments.
Methods
Sample Preparation:
![Page 65: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/65.jpg)
WHO/BS/2019.2373
Page 65
• Prepare the glass ampoules as instructed in the IFU (Instruction for Use).
• Reconstitute and prepare the 5 provided samples A, B, C, D and E as detailed in Table 1 to
give rise to 8 testing samples A+E, B, C, C1, C2, C3, C4 and D.
Primer and Probe Preparation:
• Centrifuge the 3 provided plastic tubes containing the provided primers or DNA standard,
to collect the sample liquid at the bottom of the tube and to ensure sufficient materials for
subsequent testing
• Make 1 in 10 dilution of the provided 10x primer sets (100uM) for LV or HK with
RNAse/DNAse-free H2O, to give rise to 10uM working primer solutions (1x).
• Prepare a 1.5uM working probe solutions for LV or HK from the probes purchased by
participants.
A series of DNA Standard Solution Preparation for qPCR
• Make a series of 1 in 10 dilutions of DNA standards with RNAse/DNAse-free H2O, to give
rise to 7 working DNA standard solutions at a concentration of 1x108, 107, 106, 105, 104,
103 or 102 copies/5µL, as detailed below and in the dilution Table 7.
• The provided 80µL DNA standard is a stock solution at a concentration of 1x109
copies/5µL and named P0 in the following steps and in the dilution Table 7 given below.
• Take 22µL of P0 and add to 198µL of nuclease-free water to make 220µL of P1
(1x108copies/5µL) standard solution.
• Vortex and tap the tube to collect all solution at the bottom of the tube.
• Change to a new pipetting tip
• Take 22µL of P1 and add to 198µL of nuclease-free water to make 220µL of P2
(1x107copies/5µL)
• Vortex and tap the tube to collect all solutions at the bottom of the tube
• Change pipetting tips between each dilution.
• Repeat with each new diluted standard solution to create a panel of P1 to P7 standards at
concentrations from 1x108 to 1x102 copies/5µL, as detailed in the following Table 6.
Please note that the ~200µL prepared DNA standard solution series for individual dilutions will
be sufficient for assays using two methods and testing 3 times, that is, sufficient to be used in 6
plates with a loading of 5µL per well in triplicate for both LV and HK assays.
![Page 66: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/66.jpg)
WHO/BS/2019.2373
Page 66
Table 7 – Dilutions of a Series of 1:10 DNA Standards
Copy Number Dilutions Dilution
Factor
Volume
P1 = 108/5µL 22µL of P0 109 + 198µL
H2O
1:10 220µL
P2 = 107/5µL 22µL of P1 108 + 198µL
H2O
1:10 220µL
P3 = 106/5µL 22µL of P2 107 + 198µL
H2O
1:10 220µL
P4 = 105/5µL 22µL of P3 106 + 198µL
H2O
1:10 220µL
P5 = 104/5µL 22µL of P4 105 + 198µL
H2O
1:10 220µL
P6 = 103/5µL 22µL of P5 104 + 198µL
H2O
1:10 220µL
P7 = 102/5µL 22µL of P6 103 + 198µL
H2O
1:10 220µL
TaqMan qPCR Master Mix Preparation:
• Prepare a 750µL of TaqMan qPCR Master Mix for qPCR targeting lentivirus (LV) using
LV primer/probe as detailed in the following Table. The prepared 750µL Master mix
solution is intended for loading into 48 wells at 15µL per well.
• Prepare a 750µL of TaqMan qPCR Master Mix for qPCR targeting House-keeping gene
(HK) using HK primer/probe as detailed in the following Table. The prepared 750µL
Master mix solution is intended for loading into 48 wells at 15µL per well.
Reagent For 1 well
(µL)
For 50 wells
(µL)
Final
concentration
H2O 3 150 -
LV primer set (10µM) 1 50 0.5µM
LV Probe (1.5µM) 1 50 0.075µM
TaqMan Master Mix (2x) 10 500 1x
Total Master Mix 15 750
Then:
Add the above Master Mix per well to the plate
(µL) 15 15
Add a standard or a sample per well (µL) 5 5
Total volume per well (µL) 20 20
![Page 67: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/67.jpg)
WHO/BS/2019.2373
Page 67
TaqMan qPCR Plate Preparation:
• Vortex and briefly centrifuge the LV and HK Master Mix solutions before loading to
collect the solutions and to ensure they are sufficient for loading to 48 wells in a plate.
• Load 15µL per well of the LV Master Mix containing LV primers/probe to 48 wells that
are designated for qPCR targeting Lentivirus sequences and are highlighted in green, e.g.
columns 1-6 on plate 1 and 2 and columns 7-12 on Plate 3 (Table 2A-C in the main IFU).
• Load 15µL per well of the HK Master Mix containing HK primers/probe to 48 wells that
are for qPCR targeting HK sequences and are highlighted in blue, e.g. columns 7-12 on
plate 1 and 2 and columns 1-6 on Plate 3 (Table 2A-C in the main IFU).
• Load 5µL per well of the prepared 7 DNA standards from each dilution of P1 to P7
standards (Table 6) in triplicate following the qPCR plate layout provided (Table 2A-C in
the main IFU).
• Load 5µL per well of the prepared 8 testing samples, i.e. A+E, B, C, C1, C2, C3, C4 and
D (Table 1), in triplicate following the qPCR plate layout provided (Table 2A-C in the
main IFU).
• Load 5µL per well of RNAse/DNAse-free H2O in triplicate into the corresponding wells
designated for H2O as a negative control, following the qPCR plate layout provided (Table
2A-C in the main IFU).
• Mix gently by pipetting up and down after individual loadings of DNA standards or
samples or H2O. Avoid air bubbles.
• Each well in the plate contains a final volume of 20µL, consisting of 15µL appropriate
Master Mix and 5µL sample or DNA standards or H2O.
• Seal the plate with a film and centrifuge the plate at ~400g for 1 minute to collect all
samples at the bottom of the wells.
• Load the plate to a qPCR thermo-cycler, e.g. LightCycler 480 (Roche)
• Run qPCR reaction following the temperature and cycle conditions as giving in the Table
below for TaqMan thermo-cycle conditions.
• Repeat the test twice using two separate new sets of samples on two separate days as day
2 or day 3 assay, following the plate layout for the corresponding days (Table 2A-C).
Reagent For 1 well
(µL)
For 50 wells
(µL)
Final
concentration
H2O 3 150 -
HK primer set (10µM) 1 50 0.5µM
HK Probe (1.5µM) 1 50 0.075µM
TaqMan Master Mix (2x) 10 500 1x
Total Master Mix 15 750
Then:
Add the above Master Mix per well to the plate
(µL) 15 15
Add a standard or a sample per well (µL) 5 5
Total volume per well (µL) 20 20
![Page 68: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/68.jpg)
WHO/BS/2019.2373
Page 68
TaqMan qPCR Thermo-Cycle Conditions:
Denaturation (1 cycle)
Temperature Time Ramp Rate
95°C 15 minutes 4.4°C /s
Amplification (45
cycles)
Temperature Time Ramp Rate
95°C 15 seconds 4.4°C /s
58°C 1 minute 2.2°C /s
72°C 12 seconds 4.4°C /s
Cooling (1 cycle)
Temperature Time Ramp Rate
40°C 30s 1.5°C/s
Wavelength Channel: 450-533
SYBRGreen qPCR Master Mix Preparation:
• Prepare a 750µL of SYBRGreen qPCR Master Mix for qPCR targeting lentivirus using LV
primer as detailed in the following Table 9A. The prepared 750µL solution is intended for
loading into 48 wells at 15µL per well.
Reagent For 1 well
(µL)
For 50 wells
(µL)
Final
concentration
H2O 3.8 190 -
LV primer set 10µM 1.2 60 0.5µM
SYBRGreen Master Mix (2X) 10 500 1x
Total Master Mix 15 750
Then:
Add the above Master Mix per well to the plate
(µL) 15 15
Add a standard or a sample per well (µL) 5 5
Total volume per well (µL) 20 20
• Prepare a 750µL of SYBRGreen qPCR Master Mix for qPCR targeting House-keeping
gene (HK) using HK primer as detailed in the following Table. The prepared 750µL
solution is intended for loading into 48 wells at 15µL per well.
◄ Single Acquisition
![Page 69: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/69.jpg)
WHO/BS/2019.2373
Page 69
Reagent
For 1
well
(µL)
For 50
wells (µL)
Final
concentration
H2O 3.8 190 -
HK primerset 10µM 1.2 60 0.5µM
SYBRGreen Master Mix (2X) 10 500 1x
Total Master Mix 15 750
Then:
Add the above Master Mix per well to the plate
(µL) 15 15
Add a standard or a sample per well (µL) 5 5
Total volume per well (µL) 20 20
SYBRGreen qPCR Plate Preparation:
• Vortex and briefly centrifuge the LV and HK Master Mix solutions before loading to
collect the solutions and to ensure they are sufficient for loading to 48 wells.
• Load 15µL per well of the LV Master Mix containing LV primers to 48 wells that are
designated for assay of Lentivirus sequences and are highlighted in green, e.g. columns 1-
6 on plate 1 and 2 and columns 7-12 on Plate 3 (Table 2A-C in the IFU).
• Load 15µL per well of the HK Master Mix containing HK primers to 48 wells that are
designated for assay of HK sequences and are highlighted in blue, e.g. columns 7-12 on
plate 1 and 2 and columns 1-6 on Plate 3 (Table 2A-C in the IFU).
• Load 5µL per well of the prepared 7 DNA standards from each dilution of P1 to P7
standards (Table 6) in triplicate following the qPCR plate layout provided (Table 2A-C in
the IFU).
• Load 5µL per well of the prepared 8 testing samples, i.e. A+E, B, C, C1, C2, C3, C4 and
D (Table 1), in triplicate following the qPCR plate layout provided (Table 2A-C in the
main IFU).
• Load 5µL per well of RNAse/DNAse-free H2O in triplicate in the corresponding wells
designated for H2O as a negative control, following the qPCR plate layout provided (Table
2A-C in the main IFU).
• Mix gently by pipetting up and down after individual loadings of DNA standards or
samples or H2O. Avoid air bubbles.
• Each well in the plate contains a final volume of 20µL, consisting of 15µL appropriate
Master Mix and 5µL sample or DNA standards.
• Seal the plate with a film and centrifuge the plate at ~400g for 1 minutes to collect all
samples at the bottom of the wells.
• Load the plate to a qPCR thermo-cycler, e.g. LightCycler 480 (Roche)
• Run SYBRGreen qPCR reaction following the temperature and cycle conditions as giving
in the Table below for SYBRGreen qPCR thermo-cycle conditions.
![Page 70: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/70.jpg)
WHO/BS/2019.2373
Page 70
• Repeat the test twice using two separate new sets of samples on two separate days as day
2 or day 3 assay, following the plate layout for the corresponding days (Table 2A-C).
SYBRGreen qPCR Thermo-cycle Conditions:
Denaturation (1 cycle)
Temperature Time Ramp Rate
95°C 10 minutes 4.4°C /s
Amplification (40
cycles)
Temperature Time Ramp Rate
95°C 15 seconds 4.4°C /s
58°C 15 seconds 2.2°C /s
72°C 15 seconds 4.4°C /s
Cooling (1 cycle)
Temperature Time Ramp Rate
40°C 30 seconds 2.2°C /s
Wavelength Channel: 450-533
qPCR Data reporting and analysis
Please following the main IFU (instruction for use) to complete and submit the data reporting file
for qPCR.
◄ Single Acquisition
![Page 71: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/71.jpg)
WHO/BS/2019.2373
Page 71
Appendix VIII
Example Digital PCR Protocol for Collaborative Study
Participants are encouraged to use their in-house study protocol to evaluate the samples. In
the case of no in-house protocol available, the following example protocols can be considered.
Materials
• Samples A, B, C, D and E are provided as lyophilised genomic DNA in glass ampoules
• Primers for LV and HK are provided as primer sets and as a 10-fold strength of a stock
solution at 100µM solution in H2O. You can use the provided two NIBSC primer sets
together in a test, or you can use one set of the provided NIBSC primers, e.g. HK, in
combination with a set of your in-house primers, e.g. in-house LV primers, and vice versa,
in a test. The provided primer sequences are given in Table 5.
• You do not need to use the primers provided if you have in-house primers available.
Reagents are required but not provided and hence, are to be provided or procured by participants:
• QX200™ ddPCR™ EvaGreen Supermix #1864034 (BioRad)
• RNAse/DNAse-free H2O.
• DNAse/RNAse-free microtubes.
• DNAse/RNAse-free filter tips.
• 96-well qPCR plates and seals.
• Droplet generator in the QX200™ Droplet Digital™ PCR System
• ddPCR™ 96-Well Plates #12001925 (BioRad)
• Pierceable Foil Heat Seal #1814040 (BioRad)
• Automated Droplet Generation Oil for EvaGreen #1864112 (BioRad)
• DG32™ Cartridge for Automated Droplet Generator #186-4108
• PX1 PCR Plate Sealer #1814000 (BioRad)
• QX100™ Droplet Reader and QuantaSoft™ Software #186-3001
• A spectrophometer for measuring the DNA concentrations.
It is recommended to prepare all solutions and perform the assays in a PCR cabinet or suite
with usual precautions for PCR experiments.
Digital PCR Sample Preparation:
• Prepare the glass ampoules as instructed in the IFU (Instruction for Use).
• Reconstitute the 5 provided samples A, B, C, D and E as detailed in Table 1, to give rise to
4 samples A+E, B, C and D. Please note that you do not need to prepare and test samples
C1, C2, C3 and C4 for digital PCR.
![Page 72: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/72.jpg)
WHO/BS/2019.2373
Page 72
• Using restriction enzyme DraI to digest the 4 reconstituted samples A+E, B, C and D as
detailed below
• Prepare 1:50 dilution of DraI (20U/µL) in 1x CutSmart buffer as below to give rise to
working DraI solution at 0.4U/µL, as detailed in the following table.
Reagent Volume
(µL)
H2O 44
CutSmart Buffer
(10X)
5
DraI enzyme
(20U/µL)
1
Total volume 50
• Digest 4.4µL of the reconstituted DNA samples A+E, B, C, and D in individual tubes as
detailed in the following Table.
• Mix well and briefly centrifuge the tubes to collect samples
• Incubate the samples at 37°C for 30 minutes
• Heat inactivate the enzyme at 65°C for 5 minutes
• Briefly centrifuge the tubes to collect all samples
• Proceed to the following steps immediately or store the samples at 4oC before use within
the same day.
Digital PCR Primer Preparation:
• Dilute both the provided 100µM LV primer set and 100µM HK primer set to make 2µM
working primer solutions in H2O.
Reagent Volume
(µL)
Sample A+E, B, C or D 4.4
H2O 41.6
Diluted DraI enzyme
(0.4U/µL)
4
Total volume 50
![Page 73: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/73.jpg)
WHO/BS/2019.2373
Page 73
Digital qPCR Master Mix Preparation:
• Prepare 340µL of digital qPCR Master mix for digital PCR targeting lentivirus (LV) using
LV primer set as detailed in the following Table. The prepared 340µL solution is intended
for loading into 16 wells at 17µL per well.
Reagent For 1 well
(µL)
For 20 wells
(µL)
Final
concentration
H2O 5.2 104 -
LV Primer set (2µM) 0.8 16 0.8µM
EvaGreen Supermix (2X) 11 220 2X
Total Master Mix 17 340
Then:
Add the above Master Mix per well to the plate
(µL) 17 17
Add a standard or a sample per well (µL) 5 5
Total volume per well (µL) 22 22
• Prepare 340µL of digital PCR Master Mix for digital PCR targeting House-keeping gene
(HK) using HK primer set as detailed in the following Table. The prepared 340µL solution
is intended for loading into 16 wells at 17 µL per well.
Reagent
For 1
well
(µL)
For 20 wells
(µL)
Final
concentration
H2O 5.2 104 -
HK Primer (2µM) 0.8 16 0.8µM
EvaGreen Supermix (2X) 11 220 1X
Total Master Mix 17 340
Then:
Add the above Master Mix per well to the plate
(µL) 17 17
Add a standard or a sample per well (µL) 5 5
Total volume per well (µL) 22µL 22
![Page 74: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/74.jpg)
WHO/BS/2019.2373
Page 74
Digital qPCR Plate Preparation:
• Vortex and briefly centrifuge the LV and HK Master Mix solutions before loading to the
plates, to collect the solutions and to ensure they are sufficient for loading to 16 wells.
• Load 17µL per well of the LV Master Mix containing LV primers to 16 wells that are
designated for assay of Lentivirus sequences and are highlighted in green (Table 3A-C in
the main IFU).
• Load 17µL per well of the HK Master Mix containing HK primers to 16 wells that are
designated for assay of HK sequences and are highlighted in blue (Table 3A-C in the main
IFU).
• Load 5µL per well of the prepared 4 testing samples, i.e. A+E, B, C and D (Table 1), in
triplicate following the digital PCR plate layout provided (Table 3A-C in the main IFU).
• Load 5µL per well of RNAse/DNAse-free H2O in the 4 corresponding wells designated
for H2O as a negative control, following the digital PCR plate layout provided (Table 3A-
C in the main IFU).
• Mix gently by pipetting up and down after individual loadings of samples or H2O. Avoid
air bubbles.
• Each well in the plate contains a final volume of 22µL, consisting of 17µL appropriate
Master Mix and 5µL samples. The preparation of a total 22µL per well is to ensure
sufficient samples for subsequent droplet generation of 20µL sample per well.
• Seal the plate with a pierceable heat seal foil film.
• Centrifuge the plate at ~400g for 1 minutes to collect all samples at the bottom of the wells.
• Follow the Bio-Rad protocol to generate droplets using the droplet generator in the
QX200™ AutoDG™ Droplet Digital™ PCR System. The QX200™ AutoDG™ Droplet
Digital™ PCR System is set to automatically take 20 µL samples with equal volume of
droplet generation oil to generate a final volume of 40µL droplets for PCR amplification.
• Perform PCR on the prepared DNA droplets using a PCR machine, e.g. C1000 touch
PCR machine (BioRad) and, following the thermocycle condition below
PCR Cycling Conditions:
Steps Temp. Time Cycles
Initial Denaturation 94°C 10 min 1
Denaturation 94°C 30 Sec
40 Annealing 58°C 1 min
Extension 72°C 1 min
Final Extension 98°C 10 min 1
Hold 4°C ∞
• Read droplets using QX200™ Droplet Digital™ PCR System.
• Acquire the copies per well data point for both the LV sample and HK sample using
Quantasoft (Version 1.7) (BioRad).
• Repeat the test twice using two new sets of samples on two separate days as day 2 or day
3 assay, following the plate layout for the corresponding days (Table 3A-C).
Digital Data reporting and analysis
![Page 75: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/75.jpg)
WHO/BS/2019.2373
Page 75
Please following the main IFU (instruction for use) to complete and submit the data reporting file
for digital PCR.
Appendix IX
Participant Response Form
Dear Participant,
Please answer the following questions regarding the report:
Laboratory:
Have your details/data been correctly reported?
YES / NO
Do you agree with the proposed unitage for the candidate materials?
0 LV copies/cell for Sample A+E (18/142)
1.41 LV copies/cell for Sample B (18/126)
8.63 LV copies/cell for Sample C (18/132)
10.57 LV copies/cell for Sample D (18/144)
YES / NO
Do you agree with the proposal to establish the three materials, i.e. A/E (18/142), B (18/126)
and C (18/132), as the WHO 1st International Standard panel for lentiviral vector Integration
copy number quantitation?
YES / NO
Do you agree with the proposal for sample D (18/144) to be used as an International
Reference Material in LV integration site analysis?
YES / NO
Will you see the need to develop a WHO DNA Standard for the detection and quantitation
of Replication Competent Lentivirus?
YES / NO
![Page 76: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/76.jpg)
WHO/BS/2019.2373
Page 76
Please report additional comments, if any:
Sign: Name: Date
Please return your comments by 15th June 2019 by email to [email protected]
Note: proposed values shown on this form have now been changed following the amended
results submitted participants.
Appendix X
Instructions for Use
for the to be Established WHO Standard Panel
![Page 77: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/77.jpg)
WHO/BS/2019.2373
Page 77
![Page 78: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/78.jpg)
WHO/BS/2019.2373
Page 78
![Page 79: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/79.jpg)
WHO/BS/2019.2373
Page 79
![Page 80: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/80.jpg)
WHO/BS/2019.2373
Page 80
![Page 81: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/81.jpg)
WHO/BS/2019.2373
Page 81
Appendix XI
NIBSC Publication on the development of Candidate Materials
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5628571/
Appendix XII
Relevant Publications (2019-2000) on LV Copy Quantitation
Publications (2019- 2000) on LV copy quantitation Method Standard Unitage
1 A safe and potent anti-CD19 CAR T cel therapy (2019) From <https://www.ncbi.nlm.nih.gov/pubmed/28976817>
qPCR gDNA LV/293T
mass
2 In vivo expansion and antitumor activity of coinfused CD28 and CD4-1BB-engineered CAR-T cells in patients with B cell leukemia (2018) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6079368/
qPCR ND /mass
3 Activity of mesothelin-specific chimeric antigen receptor T cells against pancreatic carcinoma metastases in a phase 1 trial (2018) https://www.ncbi.nlm.nih.gov/pubmed/29567081
qPCR ND detectable
4 Chimeric antigen receptor T cells in Refractory B cell lymphoma (2017)
https://www.ncbi.nlm.nih.gov/pubmed/29226764 qPCR ND /cell
5 Hematopoietic Stem-Cell Gene Therapy for Cerebral Adrenoleukodystrophy (2017) From <https://www.ncbi.nlm.nih.gov/pubmed/28976817> qPCR gDNA /haploid cell
genome
6 Lentiviral Vectors with Cellular Promoters Correct Anemia and Lethal Bone Marrow Failure in a Mouse Model for Diamond-Blackfan Anemia (2017)
From <https://www.sciencedirect.com/science/article/pii/S1525001617301612> qPCR NA sites
7 Efficacy of lentivirus-mediated gene therapy in an Omenn syndrome recombination-activating gene 2 mouse model is not hindered by inflammation and immune dysregulation (2017) From <http://www.jacionline.org/article/S0091-6749(17)31886-9/abstract>
qPCR
ND /cell genome
8 Clinical efficacy of gene-modified stem cells in adenosine deaminase–deficient immunodeficiency (2017) From <https://www.jci.org/articles/view/90367>
ddPCR NA /cell
9 Clinical and immunological responses after CD30-specific chimeric antigen receptor–redirected lymphocytes (2017) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5669573/
qPCR
plasmids /mass
10 Intent-to-treat leukemia remission by CD19 CAR T cells of defined formulation and dose in children and young adults (2017) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5482103/
qPCR
ND detectable
11 Autologous T Cells Expressing CD30 Chimeric Antigen Receptors for Relapsed or Refractory Hodgkin Lymphoma: An Open-Label Phase I Trial (2017) http://clincancerres.aacrjournals.org/content/23/5/1156.long#ref-9
qPCR
plasmid /mass
12 Phase I trials using Sleeping Beauty to generate CD19-specific CAR T cells. (2016). <https://www.ncbi.nlm.nih.gov/pubmed/27482888> ddPCR
qPCR NA /cell
13 CD19 CAR–T cells of defined CD4+:CD8+ composition in adult B cell ALL patients (2016) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4887159/
qPCR
ND detectable
14 GD2-specific CAR T Cells Undergo Potent Activation and Deletion Following Antigen Encounter but can be Protected From Activation-induced Cell Death by PD-1 Blockade (2016) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4923328/
qPCR
ND /mass
![Page 82: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/82.jpg)
WHO/BS/2019.2373
Page 82
15 Third-generation CD28/4-1BB chimeric antigen receptor T cells for chemotherapy relapsed or refractory acute lymphoblastic leukaemia: a non-randomised, open-label phase I trial protocol (2016) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5223707/
qPCR
ND /cell
16 Predominant cerebral cytokine release syndrome in CD19-directed chimeric antigen receptor-modified T cell therapy (2016) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4986179/
qPCR
ND /mass
17 Outcome following Gene Therapy in Patients with Severe Wiskott-Aldrich Syndrome (2015)
From <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4942841/> qPCR
ND /cell
18 Tolerance and efficacy of autologous or donor-derived T cells expressing CD19 chimeric antigen receptors in adult B-ALL with extramedullary leukemia (2015) https://www.tandfonline.com/doi/full/10.1080/2162402X.2015.1027469
qPCR
plasmid /mass
19 Phase I Hepatic Immunotherapy for Metastases study of intra-arterial chimeric antigen receptor modified T cell therapy for CEA+ liver metastases (2015) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4506253/
qPCR
plasmid /cell genome
20 Effective response and delayed toxicities of refractory advanced diffuse large B-cell lymphoma treated by CD20-directed chimeric antigen receptor-modified T cells (2014) https://www.sciencedirect.com/science/article/pii/S1521661614002381?via%3Dihub#bb0070
qPCR
plasmid /cell
21 Closely related T-memory stem cells correlate with in vivo expansion of CAR.CD19-T cells and are preserved by IL-7 and IL-15 (2014) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4055922/
qPCR
ND /cell
22 Dual-regulated Lentiviral Vector for Gene Therapy of X-linked Chronic Granulomatosis (2013) From <https://www.sciencedirect.com/science/article/pii/S1525001616307444?via%3Dihub#cesec100> qPCR
gDNA /cell genome
23 Lentiviral hematopoietic stem cell gene therapy benefits metachromatic leukodystrophy (2013) From <https://www.ncbi.nlm.nih.gov/pubmed/23845948>
qPCR
gDNA /cell genome
24 Lentiviral hematopoietic stem cell gene therapy in patients with Wiskott-Aldrich syndrome (2013) From <https://www.ncbi.nlm.nih.gov/pubmed/23845947>
qPCR
ND /cell genome
25 Lentivirus-based gene therapy of hematopoietic stem cells in wiskott-Aldrich syndrome (2013)
qPCR gDNA /cell genome
26 Mesothelin-specific Chimeric Antigen Receptor mRNA-Engineered T cells Induce Anti-Tumor Activity in Solid Malignancies (2013) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3932715/
qPCR
ND expression
27 Donor-derived CD19-targeted T cells cause regression of malignancy persisting after allogeneic hematopoietic stem cell transplantation (2013) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3862276/
qPCR
ND detectable
28 Infusion of donor-derived CD19-redirected virus-specific T cells for B-cell malignancies relapsed after allogeneic stem cell transplant: a phase 1 study (2013) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3811171/
qPCR
plasmid /mass
29 Preclinical safety and defficacy of human CD34+ cells transduced with lentiviral vector for the treatment of Wiskott-aldrich syndrome
qPCR gDNA /genome
30 Persistence and Efficacy of Second Generation CAR T Cell Against the LeY Antigen in Acute Myeloid Leukemia (2013) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3831035/
qPCR
plasmid /cell
31 Treatment of Metastatic Renal Cell Carcinoma With CAIX CAR-engineered T cells: Clinical Evaluation and Management of On-target Toxicity (2013) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5189272/
qPCR
plasmid /cell
32 CD20-specific adoptive immunotherapy for lymphoma using a chimeric antigen receptor with both CD28 and 4-1BB domains: pilot clinical trial results (2012) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3350361/
qPCR
plasmid /cell
33 A phase I clinical trial of adoptive transfer of folate receptor-alpha redirected autologous T cells for recurrent ovarian cancer (2012) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3439340/
qPCR
NA sites
34 Decade-Long Safety and Function of Retroviral-Modified Chimeric Antigen Receptor T-cells (2012) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4368443/
qPCR
ND /106cells
35 Retroviral gene therapy for X-linked chronic granulomatous disease: results from phase I/II trial. (2011)
From <https://www.ncbi.nlm.nih.gov/pubmed/21878903> qPCR
NA sites
![Page 83: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/83.jpg)
WHO/BS/2019.2373
Page 83
36 Integration profile of retroviral vector in gene therapy treated patients is cell-specific according to gene expression and chromatin conformation of target cell. (2011)
From <https://www.ncbi.nlm.nih.gov/pubmed/21243617>
qPCR ND sites
37 Antitumor activity and long-term fate of chimeric antigen receptor–positive T cells in patients with neuroblastoma (2011) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3234664/
qPCR
gDNA /cell
38 CD28 costimulateion improves expansion and persistence of chimeric antigen receptor-modified T cells in lymphoma pateients (2011 file:///C:/Users/yzhao/OneDrive%20-%20MHRA/RSS%202019/2019%20RM/RM%20Dossier/2019_WHO%20Collaborative%20study/Report%20Discussion/Ref%20LV%20intG%20analysis/z_JCI46110.pdf
qPCR plasmid /mass
38 Transfusion independence and HMGA2activation after gene therapy of human β-thalassaemia (2010) From <https://www.nature.com/articles/nature09328#methods-summary>
qPCR
qDNA /cell
40 Hematopoietic stem cell gene therapy with a lentiviral vector in X-linked adrenoleukodystrophy. (2009) From <https://www.ncbi.nlm.nih.gov/pubmed/19892975>
qPCR
gDNA /haploid
genome
41 Virus-specific T cells engineered to coexpress tumour-specific receptors: persistence and antitumor activity in individuals with neuroblastoma
qPCR gDNA /cell
42 Parallel detection of transduced T lymphocytes after immunogene therapy of renal cell cancer by flow cytometry and real time polymerase chain reaction: implications for loss of transgene expression https://www.liebertpub.com/doi/pdf/10.1089/hum.2005.16.1452
qPCR plasmid /cell
43 Human T lymphocyte genetic modification with naked DNA (2000)
https://www.sciencedirect.com/science/article/pii/S1525001699900126?via%3Dihub qPCR plasmid /cell
Note: ND: no details given; NA: not applicable
Appendix XIII
References
1. Stepanenko A and Dmitrenko V. HEK293 in cell biology and cancer research: phenotype,
karyotype, tumorigenicity, and stress-induced genome-phenotype evolution. Gene. 2015
Sep 15;569(2):182-90. doi: 10.1016/j.gene.2015.05.065.
2. Lin Y, Boone M, Meuris L et al. Genome dynamics of the human embryonic kidney 293
lineage in response to cell biology manipulations. Nature Communications. 2014 Sep
3;5:4767. doi: 10.1038/ncomms5767.
3. Jacobs J, Jones C, Baille J. Characteristics of a human diploid cell designated MRC-5.
Nature. 1970 Jul 11;227(5254):168-70.
4. Zufferey R, Dull T, Mandel R, et al. Self-inactivating lentivirus vector for safe and efficient
in vivo gene delivery. Journal of Virology 1998;72:9873–80
5. Cavazzana-Calvo M, Payen E, Negre O, et al. Transfusion independence and HMGA2
activation after gene therapy of human [bgr]-thalassaemia. Nature 2010;467:318-322.
6. Heckl D, Schwarzer A, Haemmerle R, et al. Lentiviral vector induced insertional
haploinsufficiency of Ebf1 causes murine leukemia. Molecular Therapy 2012;20:1187-
1195.
7. Arumugam P, Higashimoto T, Urbinati F, et al. Genotoxic potential of lineage-specific
lentivirus vectors carrying the β-globin locus control region. Molecular Therapy
2009;17:1929-1937.
![Page 84: EXPERT COMMITTEE ON BIOLOGICAL ......WHO/BS/2019.2373 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 21 to 25 October 2019 Report on a Collaborative Study for](https://reader033.fdocuments.net/reader033/viewer/2022052720/5f084e787e708231d4215bdb/html5/thumbnails/84.jpg)
WHO/BS/2019.2373
Page 84
8. Montini E, Cesana D, Schmidt M, et al. The genotoxic potential of retroviral vectors is
strongly modulated by vector design and integration site selection in a mouse model of
HSC gene therapy. The Journal of Clinical Investigation 2009;119:964-975.
9. Charrier S, Ferrand M, Zerbato M, et al. Quantification of lentiviral vector copy numbers
in individual hematopoietic colony-forming cells shows vector dose-dependent effects on
the frequency and level of transduction. Gene Therapy 2011;18:479-487.
10. Zhao Y, Stepto H, Schneider C. Development of the First World Health Organization
Lentiviral Vector Standard: Toward the Production Control and Standardization of
Lentivirus-Based Gene Therapy Products. Human Gene Therapy Methods. 2017
Aug;28(4):205-214. doi: 10.1089/hgtb.2017.078.
11. Roberts PL, Lloyd D. Virus inactivation by protein denaturants used in affinity
chromatography. Biologicals. 2007 Oct;35(4):343-7.
12. Jesen MC, Clarke P, Tan G et al. Human T lymphocyte genetic modification with naked
DNA. Molecular Therapy. 2000;1:49-55.
13. Till BG, Jensen MC, Wang J et al. CD20-specific adoptive immunotherapy for
lymphoma using a chimeric antigen receptor with both CD28 and 4-1BB domanis: pilot
clinical trial results. Blood. 2012;119:3940-3950.
14. Scholler J, Braydy TL, Binder-Scholl G et al. Decade-long safety and function of
retroviral-modificed chimeric antigen receptor T cells. Sci Transl Med. 2015; 4:1-16.
15. R Core Team (2018). R: A language and environment for statistical computing. R
Foundation for Statistical Computing, Vienna, Austria. https://www.R-project.org/.
16. Mair P, Schoenbrodt F, and Wilcox R. WRS2: Wilcox Robust Estimation and Testing,
2017. 0.9-2.
17. Bustin S, Benes V, Garson JA, et al. The MIQE guidelines: minimum information for
publication of quantitative real-time PCR experiments. Clinical Chemistry. 2009;55:611–
622. doi: 10.1373/clinchem.2008.112797.