Evolution and its Significance in the Sciences Introduction and Revolutions Introduction and Revolutions Historical context of evolution Historical context of evolution Theory of Evolution: mechanism of action Theory of Evolution: mechanism of action Origin and evolution of life Origin and evolution of life Evolution in 2015 Evolution in 2015 Evolution in perspective of the sciences Evolution in perspective of the sciences Introduction Two sides of the same coin: diversity and similarity Two sides of the same coin: diversity and similarity Theory of evolution Theory of evolution Species evolve gradually over time Species evolve gradually over time Mechanism is natural selection Mechanism is natural selection Gift to biology Gift to biology Unifying theory to explain diversity and similarity Unifying theory to explain diversity and similarity Theory underpinning all of the life sciences (ecology, environmental sciences, genetic engineering, molecular genetics, astrobiology, epidemic diseases, etc.) Theory underpinning all of the life sciences (ecology, environmental sciences, genetic engineering, molecular genetics, astrobiology, epidemic diseases, etc.) Revolutions in the Sciences: A Stroll through Time Notable revolutions Notable revolutions Copernicus Copernicus Newton Newton Rutherford and Bohr Rutherford and Bohr Vegener Vegener Hubble Hubble Darwin Darwin Einstein Einstein Watson and Crick Watson and Crick Attributes of revolutions Challenged existing science/ideas with heated debates Challenged concept of spatial dimension of natural world (e.g., universe, sun, flatness of Earth) Challenged concept of the time dimension of natural world (e.g., Hubble) Challenged static/fixed view of natural world Many more revolutions to come but pattern consistent with the above Evolutions Place in the Life Science Theodosius Dobzhansky Theodosius Dobzhansky Nothing in biology makes sense except in the light of evolution (1973) Genetics of inheritance (e.g., dominance and recessive traits, 3:1 ratio) Genetics of inheritance (e.g., dominance and recessive traits, 3:1 ratio) Medicine (e.g., mismatched diseases, transplant surgeries) Medicine (e.g., mismatched diseases, transplant surgeries) Ecology/environmental science (e.g., biodiversity) Ecology/environmental science (e.g., biodiversity) Genetic engineering (e.g., mutations, excision/repair, aging) Genetic engineering (e.g., mutations, excision/repair, aging) Molecular genetics (e.g., genetic code, DNA, RNA) Molecular genetics (e.g., genetic code, DNA, RNA) Historical Context: Darwin Voyage of the Beagle on the HMS Beagle (1831) Voyage of the Beagle on the HMS Beagle (1831) Age 22 as naturalist (theologian) Age 22 as naturalist (theologian) Convention at the time: Convention at the time: Static view of nature Static view of nature The Earth is young (1,000s of years) The Earth is young (1,000s of years) Frame of reference for Darwin: UK landscape and biodiversity as bland as UK food Frame of reference for Darwin: UK landscape and biodiversity as bland as UK food Notable Observations by Darwin: HMS Beagle South American diversity of landscapes and biota South American diversity of landscapes and biota Brazilian rainforest Brazilian rainforest Savannas of Argentina Savannas of Argentina Dry deserts of Terra del Fuego Dry deserts of Terra del Fuego Towering Andes mountains Towering Andes mountains Many structures with intuitive value in the environment (adaptations) Many structures with intuitive value in the environment (adaptations) Seeding of idea: living systems are not static but vary in accordance with the environment Seeding of idea: living systems are not static but vary in accordance with the environment What are These Adaptations? Tropical Rainforests Deserts Grasslands - Lama Bipedalism Galapagos Islands and Darwin Observations on the Galapagos Galapagos Islands: the seminal event Galapagos Islands: the seminal event Volcanic islands off Ecuador (500 km) Volcanic islands off Ecuador (500 km) Fauna (birds, tortoises, etc.) Fauna (birds, tortoises, etc.) Recognized lineage to species on S. American mainland (e.g., finches, tortoise), but different Recognized lineage to species on S. American mainland (e.g., finches, tortoise), but different Seeding of idea for a mechanism Seeding of idea for a mechanism Fauna arrived from mainland Fauna arrived from mainland Fauna diversified over time in new environment of Galapagos showing unique adaptations Fauna diversified over time in new environment of Galapagos showing unique adaptations Darwins Finches Galapagos Tortoise Darwin and Natural Selection (1840s) Idea No. 1: Organisms differ in their adaptations and success in reproduction and therefore contribute differently to future generations Idea No. 1: Organisms differ in their adaptations and success in reproduction and therefore contribute differently to future generations Idea No. 2: Driving force for this differential success is natural selection acting on the variability among individuals Idea No. 2: Driving force for this differential success is natural selection acting on the variability among individuals Product: evolution of adaptations enhancing success (fitness) Product: evolution of adaptations enhancing success (fitness) Seminal text: On the Origin of Species (1859) Seminal text: On the Origin of Species (1859) Note: genetics of inheritance unknown Mendel in 1860s Note: genetics of inheritance unknown Mendel in 1860s Heads: The Impressive Diversity Hi! You look a bit better today than last week! Tails: The Impressive Similarity Your DNA = 90% Pig! Question While Darwin published many treatises in his lifetime, the most influential was entitled ____ and released in A. A. The Zoology of the Voyage of the H.M.S. Beagle B. B. The geology of the Voyage of the H.M.S. Beagle C. C. On the Origin of Species D. D. Descent of man E. E. Variations Under Domestication Question Any structure or physiological process that helps an animal, plant or microbe survive in its environment is called a/an ___. A. A. fitness component B. B. adaptation C. C. asset D. D. liability Question After observing the varied landscapes and plants and animals of the South American mainland, Darwin surmised that living systems are not ___ but change as the environment changes. A. A. static B. B. related to one another C. C. camouflaged D. D. variable over space Evolution: the Mechanism Populations and species evolve (hierarchy) Populations and species evolve (hierarchy) Kingdom Kingdom Family Family Species Species Populations Populations Individuals Individuals Evolution at the population level = microevolution Evolution at the population level = microevolution Evolution at the species level and above = macroevolution Evolution at the species level and above = macroevolution Both based on genetic changes over time Both based on genetic changes over time Do individuals evolve? Do individuals evolve? Macroevolution: The Evolution of the Horse (An Example) Mechanism: Concept of Fitness Fitness = relative contribution of an individual to the next generation Fitness = relative contribution of an individual to the next generation Given two individuals of dissimilar physical size (robust vs. small stature) and the smaller individual with more offspring, which individual is more fit in an evolutionary sense? Given two individuals of dissimilar physical size (robust vs. small stature) and the smaller individual with more offspring, which individual is more fit in an evolutionary sense? Summary of Mechanism (1940s) Two cardinal tenets Two cardinal tenets Natural selection (Darwin) Natural selection (Darwin) Individuals differ genetically in fitness (Mendel - decades later; Watson and Crick 100 years later!) Individuals differ genetically in fitness (Mendel - decades later; Watson and Crick 100 years later!) Result: Result: Gene pool of the next generation a consequence of the action of natural selection on inherited variation at the level of populations, with some alleles (i.e., traits) contributing more to the next generation . microevolution Over time (1,000 to 100,000s of years) evolution of new species (speciation) macroevolution First Generation Gene Pool Second Generation Gene Pool N>100 Generations Gene Pool N>1000 Generations Gene Pool Gradual Speciation over Time 10,000 to 100,000s Years Million Years Evidence for Evolution Fossil record in geological strata Anatomy Molecular genetics Genetic relatedness Ongoing examples of evolution Fossil Evidence: Reptiles to Birds Examples Evolution of the horse (2 slides ago) Evolution of humankind (bit later) Evolution of birds Macroevolution from the dinosaur lineage! Archaeopteryx I am back! Anatomical Similarities Among Animals Embryos Molecular Genetics is the Same in All Life Forms DNA: Universal information broker ATP: Universal Energy Currency Remember: The Genetic Code of Molecular Genetics and Why Viruses are so Successful? Evidence: Genetic Relatedness HUMAN CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA CHIMPANZEE CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCATGACTGTTGAACGA GORILLA CCAAGGTCACAACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA Question Evolution that plays out at the level of populations of plants, animals or microbes is referred to as ___. A.population evolution B. B. macroevolution C. C. phyletic evolution D. D. microevolution Question Microevolution and macroevolution are recognized by evolutionary biologists because the mechanism underlying each is distinct from that of the other. A. A. True B. B. False Question Any feature (structure, physiology) of a plant, animal or microbe that enhances the individuals genetic contribution to the next generation is best described as conferring ___. A. A. positive B. B. fitness C. C. gametic D. D. All of the above Question While many think that ___ went extinct 60 million years ago, scientists now know that birds are one of the surviving lineages of this group of organisms. A. A. monkeys B. B. mammals C. C. reptiles D. D. dinosaurs Evolution Introduction Introduction Historical context Historical context Processes and mechanisms Processes and mechanisms Origin and evolution of life (see text) Origin and evolution of life (see text) Evolution in 2015 Evolution in 2015 Virus - H1N1 (earlier lecture) Virus - H1N1 (earlier lecture) Evolution of humans Evolution of humans Evolution as you sleep Evolution as you sleep Signs of recent human evolution Signs of recent human evolution Other perspectives on the evolution of life Other perspectives on the evolution of life Proto-Humans and First Humans: Who, Where and When Evolution of Humankind Worlds oldest human-linked skeleton found: Ardi predates Lucy by a million years, changes scientific view of origins Science News October 2009 Ardi MY ago (MYBP) Evolutionary Tree of Hominids (Bipedal Primates) Ardi (4 MYBP) Lucy (3 MYBP) Ardipithecus ramidus Thee and me! (