Evolution (A Consolidated PPT)

download Evolution (A Consolidated PPT)

of 85

  • date post

    03-Dec-2014
  • Category

    Education

  • view

    1.895
  • download

    4

Embed Size (px)

description

I tried to integrate basic and important concepts of evolution from different ppt that can be downloaded here in slideshare to have a consolidated theme about evolution.

Transcript of Evolution (A Consolidated PPT)

  • 1. Prepared by: Ms. IRISH M. SEQUIHOD

2. Essential Questions Be able to describe how the earth is justright for life What are the evidences of evolution? What is evolution? How has evolution lead tothe current diversity of organisms? What is an ecological niche? How does itrelate to adaptationto changingenvironmental conditions? How do extinction of species and formation ofnew species affect biodiversity? 3. A Theory or a Fact? 4. Evolution as Theory and Fact Confusion sometimes arises as to whether Evolution is a theory or a fact. Actually it is both! The theory of Evolution deals with how Evolution happens. Our understanding of this process is always changing. Evolution is also a fact as there is a huge amount of indisputable evidence for its occurrence. 5. The Earth: The PERFECT PLANET Temperature Distance from Sun Geothermal energy from core Temperature fluctuated only 10-20oC over 3.7 billion years despite 30-40% increase in solar output Water exists in 3 phases Right size (=gravitational mass to keep atmosphere) Resilient and adaptive Each species here today represents a long chain ofevolution and each plays a role in its respectiveecosystem 6. Summary of Evolution of LifeChemical Evolution(1 billion years) FormationSmallLarge First of theorganic organic protocells earthsmoleculesmoleculesform inearlyform in (biopolymers) the seas crust andthe seas form inatmospherethe seasBiological Evolution(3.7 billion years)Single-cellSingle-cell Variety of prokaryotes eukaryotes multicellularform inform in organisms the seas the seas form, firstin the seasand lateron land 7. Biological EvolutionModern humans (Homo sapiens)appear about 2 seconds beforemidnight Age of Recorded human history beginsAge of mammals1/4 second before midnightreptiles Insects andOrigin of life (3.63.8 billion years ago) amphibians invade the landPlantsinvadethe landFossilsbecomeabundant Fossils present Evolution and but rareexpansion of life 8. Evidence (1): Biochemistry The basic similarity of all living things suggests that they evolved from a single commonancestor. As we have already seen, all living things pass on information from generation to generation using the DNA molecule. All living things also use a molecule called ATP to carryDNA for energy around theATP forInformationTransfer organism. Energy Transfer 9. Evidence (2): Similar GenesHUMAN CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGACHIMPANZEECCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCATGACTGTTGAACGAGORILLA CCAAGGTCACAACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGAGenetic code of chimps and gorillas is almost identical to humans If evolution is true then we might also expect that closelyrelated organisms will be more similar to one another thanmoredistantly related organisms. Comparison of the human genetic code with that of otherorganisms show that chimpanzees are nearly geneticallyidentical(differ by less than 1.2%) whereas the mouse differs by 15%. 10. Evidence (3): Comparative Anatomy Similar comparisons can be madebased on anatomical evidence. The skeleton of humans andgorillas are very similar suggestingthey shared a recent commonancestor, but very different from themore distantly relatedwoodlouse yet all have a commonHuman and Gorillashared characteristic: bilateral symmetry Woodlouse 11. Evidence (4): HomologyThe pentadactyl limb is ancestral to all vertebrates but modified for different uses 12. Evidence (5): Vestigial Structures As evolution progresses, some structures get side-lined as they are not longer of use. These are known as vestigial structures. The coccyx is a much reduced version of an ancestral tail, which was formerly adapted to aid balance and climbing.The coccyx is a vestigial tail Another vestigial structure in humans is the appendix. 13. Evidence (6): Fossil RecordThe fossil record shows a sequence from simple bacteria tomore complicated organisms through time and provides the mostcompelling evidence for evolution. 14. Fossil formationThere are many ways in which an organism can be fossilisedOne of these ways is shown in the next sequence of slidesIn principle, a fossil is formed when an organism dies, its body isenclosed in mud, or sand. The soft parts decay but some ofthe hard parts (skeleton, shells, seeds) are preservedThe mud or sand eventually becomes rock and the hard parts of theorganism are mineralised.When the rock is exposed as a result of earth movements or erosion,the fossil remains can be dug out and studied. 15. 4The sediment eventually becomes rockFish B becomes a fossil much later than fish AThe deeper the rock layer, the older the fossilLiving fish BDiesEnclosed in sedimentHard parts fossilisedLiving fish ADiesEnclosed in sedimentHard parts fossilised 16. 6 more recent sediment collectsolder sedimentbecomes rock fish skeleton fossilised 17. 7land raised abovewater levelrecent rockolder rock 18. 8fossilised skeleton exposedearth movementsfracture rock 19. Evidence (7): Transitional fossils Many fossils show a cleartransition from one species,or group, to another. Archaeopteryx was foundin Germany in 1861. Itshare many characteristicswith both dinosaurs andbirds.Archaeopteryx It provides good evidencethat birds arose fromdinosaur ancestors 20. Evidence (8): Geography Geographic spread oforganisms also tells oftheir past evolution. Marsupials occur intwo populations todayin the Americas andAustralia. This shows the groupevolved before thecontinents drifted apart 21. Evidence (9): Antibiotic resistance Staphylococcus We are all familiar with the way that certain bacteria can become resistant to antibiotics This is an example of natural selection in action. The antibiotic acts as an environmental pressure. It weeds out those bacteria with low resistance and only those with high resistance survive to reproduce. 22. Charles Darwin Evolution, or change over time, is the process by which modern organisms have descended from ancient organisms. A scientific theory is a well- supported testable explanation of phenomena that have occurred in the natural world. 23. Voyage of the Beagle 24. Voyage of the Beagle Dates: February 12th, 1831 Captain: Charles Darwin Ship: H.M.S. Beagle Destination: Voyage around the world. Findings: evidence to propose a revolutionaryhypothesis about how life changes over time 25. Voyage of the Beagle 26. Patterns of Diversity Darwin visited Argentina and Australia whichhad similar grassland ecosystems. those grasslands were inhabited by very differentanimals. neither Argentina nor Australia was home to thesorts of animals that lived in European grasslands. 27. Patterns of Diversity Darwin posed challenging questions. Why were there no rabbits in Australia, despitethe presence of habitats that seemed perfect forthem? Why were there no kangaroos in England? 28. Living Organisms and Fossils Darwin collected the preserved remains ofancient organisms, called fossils. Some of those fossils resembled organismsthat were still alive today. Others looked completely unlike any creature he hadever seen. As Darwin studied fossils, new questions arose. Why had so many of these species disappeared? How were they related to living species? 29. The Galapagos Island The smallest, lowest islands were hot, dry, and nearlybarren-Hood Island-sparse vegetation The higher islands had greater rainfall and a differentassortment of plants and animals-Isabela- Island hadrich vegetation. Darwin was fascinated in particular by the landtortoises and marine iguanas in the Galpagos. Giant tortoises varied in predictable ways from oneisland to another. The shape of a tortoises shell could be used to identifywhich island a particular tortoise inhabited. 30. The Galapagos Island 31. Animals found in the Galapagos Land Tortoises Darwin Finches Blue-Footed Booby Marine Iguanas 32. The Journey Home Darwin Observed that characteristics of manyplants and animals vary greatly among theislands Hypothesis: Separate species may have arosefrom an original ancestor 33. Ideas that shaped Darwins Thinking James Hutton: 1795 Theory ofGeological change Forces changeearths surfaceshape Changes are slow Earth much olderthan thousands ofyears 34. Ideas that shaped Darwins Thinking Charles Lyell Book: Principles ofGeography Geographicalfeatures can be builtup or torn down Darwin thought ifearth changed overtime, what aboutlife? 35. Ideas that shaped Darwins ThinkingPopulation Growth Thomas Malthus-19th century English economist If population grew (more Babies born than die) Insufficient living space Food runs out Darwin applied this theory to animals 36. Discovery (1) Fixed speciesFrom Classical times until long after the Renaissance, species were considered to be special creations, fixed for all time. 37. Discovery (2): Transmutation Around 1800, scientists began to wonder whether species could change or transmute. Lamarck thought that if an animal acquired a characteristic during its lifetime, it could pass it onto its offspring. Hence giraffes got their long necks through generations of straining toJean Baptiste de Lamarck reach high branches.commons.wikimedia.org/wiki/Image:Jean-baptiste_lamarck2.jpg en.wikipedia.org/wiki/Image:Giraffe_standing.jpg 38. Discovery (3): Fossils and Stratahttp://en.wikipedia.org/wiki/ http://en.wikipedia.org/wiki/Image: http://en.wikipedia.org/wiki/Image:Smith_fossils2.jpgImageWilliam_Smith.g.jpgGeological_map_of_Great_Britain.jpgWilliam Smith, his geology map & some of his fossil specimensAt about the same time, geologists like William Smith weremapping the rocks and fossils of Britain. He and others showedthat different species existed in the past compared with today. 39. Discovery (4): Darwins Voyage From 1831-1836, a young naturalist called Charles Darwin toured the world in HMS Beagle. He was dazzled by the amazing diversity of life and started to wonder how it mightVoyage of the Beagle have origin