American Journal of Medical Genetics Part B (Neuropsychiatric Genetics) 129B:13–15 (2004)

Evidence for Association Between Novel Polymorphismsin the PRODH Gene and Schizophrenia ina Chinese PopulationTao Li,1,2* Xiaohong Ma,2 Pak C. Sham,1,3 Xueli Sun,2 Xun Hu,1 Qiang Wang,2 Huaqing Meng,4 Wei Deng,4

Xiehe Liu,2 Robin M. Murray,1 and David A. Collier1,3

1Division of Psychological Medicine, Institute of Psychiatry, London, United Kingdom2Department of Psychiatry, West China Hospital, Sichuan University, Chengdu, P.R. China3SGDP Research Centre, Institute of Psychiatry, London, United Kingdom4Department of Psychiatry, Chongqing Medical School, Chongqing, P.R. China

Haploinsufficiency for or mutation in at least onegene from the velocardiofacial syndrome (VCFS)region at chromosome 22q11 is implicated in psy-chosis. Linkage disequilibrium mapping of theregion in patients identified a segment containingtwo genes, proline dehydrogenase (PRODH) andDGCR6, as candidates [Liu et al., 2002a] and byanalysis of additional polymorphisms thePRODHgene was associated with schizophrenia in adultand early onset patients. In the present studywe provide additional evidence in support ofgenetic association between PRODH and schizo-phrenia in a Chinese population. We analyzedthe PRODH gene in a samples of schizophrenicpatients and their families from Sichuan, SWChina consisting of 528 family trios and siblingpairs. We genotyped six SNPs, PRODH*1195C!T,PRODH* 1482C!T, PRODH*1483A!G, PRODH*1766A!G, PRODH*1852G!A PRODH*1945T!C,two of which (PRODH*1483A!G and PRODH*1852G!A) have not been previously reported.We found association with schizophrenia fortwo haplotypes consisting of PRODH*1945T!Cand PRODH*1852G!A (Global P¼0.006), andPRODH*1852G!A and PRODH*1766A!G (GlobalP¼0.01) which include one of the newly identifiedmarkers. After six-fold Bonferroni correctionfor multiple testing the PRODH*1945T-C/PRODH*1852G-A haplotypes remained signifi-cant. This is a sub-haplotype of the PRODHhaplotype previously associated with schizophre-nia and it also maps to the 30 region of the gene,indicating that this is the region most likely tocontain the underlying risk alleles. Overall thisfinding supports a role for the PRODH locus inschizophrenia. � 2004 Wiley-Liss, Inc.

KEY WORDS: Han Chinese; psychosis; VCFS;22q11; hyperprolineamia

Schizophrenia is a complex genetic disorderwithheritabilityestimated at about 80% [Cardno and Gottesman, 2000], andthere are likely to be multiple genetic susceptibility loci [Rileyand McGuffin, 2000]. Several lines of evidence imply that thechromosome 22q11 locus contains one or more susceptibilitygenes for schizophrenia, including linkage analysis inmultiplyaffected families [Karayiorgou and Gogos, 1997; Riley andMcGuffin, 2000] and the association of microdeletions of the22q11 region with velocardiofacial syndrome (VCFS), a contig-uous gene syndrome that includes a variety of congenitalabnormalities, learning difficulties, and psychosis in up to one-third of patients [Golding-Kushner et al., 1985; Pulver et al.,1994;Murphy et al., 1999]. Deletions in this region are also 80-fold more common in patients with a primary diagnosis ofpsychosis compared to the normal population [Karayiorgouet al., 1996; Sugama et al., 1999], particularly in early onsetpatients [Usiskin et al., 1999]. Most patients have a 3 mbdeletion [Murphy, 2002] but a smaller 1.5mb ‘psychosis criticalregion’ at 22q11 has been defined by deletion analysis ofschizophrenic patients [Edelmann et al., 1999; Shaikh et al.,2000].Haploinsufficiency ormutation in at least one gene fromthe critical region is thus causally implicated in psychosis.Linkage disequilibrium mapping of the region in patientsidentified a segment containing two genes, proline dehydro-genase (PRODH) and DGCR6, as candidates for involvementin psychosis [Liu et al., 2002a] and by analysis of additionalpolymorphisms the PRODH gene was associated with schizo-phrenia in adult and early onset patients [Liu et al., 2002b].Further evidence comes fromthe observation thatmice lackingPRODH have a prepulse inhibition deficit, a sensorineuronalgating deficit functionally relevant to schizophrenia [Gogoset al., 1999]. Furthermore, rare mutations appear to arise inthe PRODH gene in schizophrenic patients by a novel geneconversion mechanism involving short (18–57 bp) sequencesfrom the linked non-functional pseudogene [Liu et al., 2002b]and a subset of schizophrenic patients have PRODH deletionsor mutations and hyperprolineamia [Jacquet et al., 2002]. Inthe present study we provide additional evidence in support ofgenetic association between PRODH and schizophrenia in aChinese population.

Liu et al. [2002b] found association between the SNPPRODH*1945 in the PRODH gene and schizophrenia by bothTDT and case-control analysis. Subsequent analysis of furtherSNPs and ‘moving window’ haplotype analysis revealed a two-marker haplotype, PRODH*1945/1766, which was moresignificantly associated than either SNP alone in three in-dependent samples, particularly in early onset schizophrenicpatients. However, two other studies have not supported theassociation between PRODH and schizophrenia [Fan et al.,2003;Williams et al., 2003]. In the present studywe attemptedto replicate association between PRODH and schizophrenia in

*Correspondence to: Tao Li, M.D., Section of MolecularGenetics, Division of Psychological Medicine, Institute ofPsychiatry, PO82, De Crespigny Park, Denmark Hill, London,UK. E-mail: sphatal@iop.kcl.ac.uk

Received 12 November 2003; Accepted 19 February 2004

DOI 10.1002/ajmg.b.30049

� 2004 Wiley-Liss, Inc.

a sample of nuclear families from the Han Chinese populationof SichuanProvince, SWChina. Three sets of samples collectedin three phases were included in this study. The first sample is198 family trios consisting of schizophrenic patients and boththeir parents. The second sample is 139 schizophrenic siblingpair families with one or both parents included. Detailedinformation about the two sets of sample are described else-where [Li et al., 2000; Cai et al., 2001]. The third sampleconsists of 191 nuclear families with one or more affectedoffspring, which including 206 schizophrenic patients, 262 oftheir parents, and 8 affected siblings. All samples and datawere collected using the same methods and from the samegeographic region by a single team of clinical psychiatrists(supervised by TL and XL). Since there is no reason to supposethere is ethnic stratification or diagnostic differences betweenthe three samples theywere combined for the purpose of trans-mission distortion analysis. All subjects were interviewed by apsychiatrist using the SCID. Diagnosis of schizophrenia wasassigned on the basis of the interview and medical recordsaccording to DSM-III-R or DSM-IV criteria. Age at onset ofpsychosis was determined by the patients self-report of theonset of illness corroborated by medical records and the use ofinformants wherever possible. Genomic DNA was extractedfrom peripheral blood according to a standard phenol-chloro-form procedure. Informed consent was obtained from allparticipants, and the study was approved by the ethicalcommittee of the South London and Maudsley Trust, and bySichuan University.

Six SNPs within PRODH gene were analyzed in this study.None of these altered the primary amino acid sequence ofthe protein. Four out of six SNPs (PRODH*1945T!C,PRODH*1766A!G, PRODH*1482C!T and PRODH*1195C!T) in the PRODH gene were described by Liu et al.[2002a,b] andwere analyzedas described,with the exception ofPRODH*1482C!T which was analyzed by an amplifluorassay by K-Biosciences (Cambridge, UK). Two SNPs(PRODH*1852G!A and PRODH*1483A!G) are novel andwere identified by sequencing.Wewere not able to amplify onepublished polymorphism, DGCR6*959 and this is not includ-ed in the analysis, and one SNP PRODH*757 (Arg185Trp)whichwasnot found to be associatedwith schizophrenia byLiuet al. [2002b] either individually or as part of a haplotype, wasnot genotyped. PRODH1483A!G was genotyped using anamplifluor assay by K-Biosciences using the forward allele-specific primers ctatgacaatgtgaccctggac or gcctatgacaatgt-gaccctggat and the reverse primer cgcaccagcttggccccaaaa.PRODH*1852G!Awas genotyped using the primers atggggg-

cagatacaccat and cttgcaggggatgaagtctg followed by cleavagewith the restriction enzyme Hap1. Frequencies of the mostcommon alleles for these polymorphisms in the Chinesepopulation we studied were PRODH*1195C (0.81), PRODH*1482C (0.88), PRODH*11483G (0.96), PRODH*1766A (0.97),PRODH1852G (0.93), and PRODH*1945T (0.74).

Linkage disequilibrium between the PRODH SNPs wasestimated using UNPHASED http://www.hgmp.mrc.ac.uk/Menu/Help/unphased. UNPHASED is a suite of programs forassociation analysis of multilocus haplotypes from unphasedgenotypedata.Thenormalized linkagedisequilibriumstatisticD0 derived from the linkage disequilibriumstatisticDwasusedto measure LD between markers. Strong LD was observedamongmost paired SNPs ranged from 0.45 to 1 except betweenmarkers PRODH*1945 and PRODH*1195 (D0 ¼ 0.01), andPRODH*1766 and PRODH*1195 (D0 ¼ 0.11) where significantlinkage disequilibrium was not found.

The pedigree disequilibrium test (PDT) was used to test theLD between the marker locus and the hypothetical diseaselocus. The PDT for individual markers and paired markershaplotype transmission were performed using the programPDTPHASE. 12PDTPHASE is an implementation of the PDTwith extensions to deal with haplotypes andmissing data. It issuitable for use with both family trio and sibling pair samplestructures.

PRODH*1852G!A showed significant allelic transmis-sion distortion (P¼ 0.02) with allele 1852G transmitted inexcess, and two flanking SNPs (PRODH*1945T!C andPRODH*1766A!G) also showed a trend of allelic trans-mission distortion (Table I). Haplotypic analysis of pairedmarkers supported the association between a haplotype ofPRODH*1945T!C and PRODH*1852G!A and schizophre-nia (Global P¼ 0.006), and PRODH*1852G!A and PRODH*1766A!G and schizophrenia (Global P¼ 0.01) before correc-tion for multiple testing (Table I). The global P-value for thehaplotype of the two SNPs found to be significant in Liu et al.[2002a], PRODH*1945T!C and PRODH*1766A!G, was alsosignificant (Global w2¼ 7.94, P¼ 0.05), with the same indivi-dual haplotype PRODH* 1945T-PRODH*1766G transmittedmore often than expected from parents to offspring (Z¼ 2.30,P¼ 0.02). However, no significant associations were observedbetweenPRODH gene and early onset (age of onset¼ 18 years)schizophrenia either considering individual SNPs alone orpaired SNP haplotype analysis (data not shown). Our findingsare partly consistent with the findings of Liu et al. [2002a,b]which suggest that PRODH gene may plays a role in sus-ceptibility to schizophrenia. However our most significant

TABLE I. Moving Window Pairwise Transmission Disequilibrium Analysis of Individual SNPs andHaplotypes Using Program UNPHASED

SNPs

IndividualSNPs

Paired haplotypesglobal test Individual haplotypes

w2 P w2 P Haplotype Frequencies Z P

PRODH*1945T!C 3.10 0.0812.58 0.006 1945T-1852A 00.010 �2.763 0.006

PRODH*1852G!A 5.78 0.0210.63 0.01 1852G-766G 00.922 2.342 0.02

PRODH*1766A!G 3.40 0.076.28 0.10

PRODH*1483A!G 1.18 0.281.03 0.79

PRODH*1482C!T 0.012 0.912.71 0.44

PRODH*1195C!T 1.13 0.29

The haplotype of ProDH *1945G/A and ProDH *1766T/C was also tested and was found to be nominally significant (Global w2¼ 7.94, P¼ 0.05) beforecorrection for multiple testing.

14 Li et al.

result was with a haplotype including a novel SNP not studiedby Liu et al. [2002a,b]. Interestingly, the associated haplotypein our sample is also at the 30 end of the gene, as previouslydescribed [Liu et al., 2002a,b]. Thus althoughwe see adifferentPRODH haplotype associated with schizophrenia in the HanChinese, which is in fact a sub-haplotype of the risk haplotypeidentified by Liu et al. [2002a,b], our data support the notionthat the causative risk alleles are towards the 30 end of thegene. In the January 2004 edition of the SNPper public SNPdatabase (http://snpper.chip.org/bio/) there are about 250 con-firmedor potential SNPs in thePRODH gene,more thanhalf ofwhich are in the 30 untranslated region of the gene. Thispositional and haplotype information may therefore facilitatethe search for the causative risk alleles from the large numberof SNPs in the gene as well as aiding further functional orbiological studies of the effect of the haplotypes on PRODHgene function.

ACKNOWLEDGMENTS

We are thankful to National Nature Science Foundation ofChina (NSFC), NARSAD, the Psychiatry Research Trust, andthe Wellcome Trust for an International Collaborative award.

REFERENCES

Cai G, Li T, DengH, Zhao J, HuX,Murray RM, Liu X, ShamPC, Collier DA.2001. Affected sibling pair linkage analysis of qualitative and quanti-tative traits for schizophrenia on chromosome 22 in a Chinesepopulation. Am J Med Genet 105:321–327.

Cardno AG, Gottesman II. 2000. Twin studies of schizophrenia: Frombow-and-arrow concordances to star wars Mx and functional genomics.Am J Med Genet 97:12–17.

Edelmann L, Pandita RK, Spiteri E, Funke B, Goldberg R, Palanisamy N,Chaganti RS, Magenis E, Shprintzen RJ, Morrow BE. 1999. A commonmolecular basis for rearrangement disorders on chromosome 22q11.Hum Mol Genet 8:1157–1167.

FanJB,MaJ, ZhangCS,TangJX,GuNF,FengGY,StClairD,HeL. 2003.Afamily-based association study of T1945C polymorphism in the prolinedehydrogenase gene and schizophrenia in the Chinese population.Neurosci Lett 338:252–254.

Gogos JA, Santha M, Takacs Z, Beck KD, Luine V, Lucas LR, Nadler JV,Karayiorgou M. 1999. The gene encoding proline dehydrogenasemodulates sensorimotor gating in mice. Nat Genet 21:434–439.

Golding-Kushner KJ, Weller G, Shprintzen RJ. 1985. Velo-cardio-facialsyndrome: Language and psychological profiles. J Craniofac Genet DevBiol 5:259–266.

Jacquet H, Raux G, Thibaut F, Hecketsweiler B, Houy E, Demilly C,Haouzir S, Allio G, Fouldrin G, Drouin V, Bou J, Petit M, Campion D,

Frebourg T. 2002. PRODH mutations and hyperprolinemia in a subsetof schizophrenic patients. Hum Mol Genet 11:2243–2249.

Karayiorgou M, Gogos JA. 1997. Dissecting the genetic complexity ofschizophrenia. Mol Psychiatry 2:211–223.

Karayiorgou M, Gogos JA, Galke BL, Jeffery JA, Nestadt G, Wolyniec PS,Antonarakis SE, Kazazian HH, Housman DE, Driscoll DA, Pulver AE.1996. Genotype and phenotype analysis at the 22q11 schizophreniasusceptibility locus. Cold Spring Harb Symp Quant Biol 61:835–843.

Li T, Ball D, Zhao J,Murray RM, Liu X, ShamPC, Collier DA. 2000. Family-based linkage disequilibrium mapping using SNP marker haplotypes:Application to a potential locus for schizophrenia at chromosome 22q11Mol Psychiatry. 5:77–84. Erratum in: Mol Psychiatry 5:452.

Liu H, Abecasis GR, Heath SC, Knowles A, Demars S, Chen YJ, Roos JL,Rapoport JL, Gogos JA, KarayiorgouM. 2002a. Genetic variation in the22q11 locus and susceptibility to schizophrenia. Proc Natl Acad Sci USA99:16859–16864.

Liu H, Heath SC, Sobin C, Roos JL, Galke BL, Blundell ML, Lenane M,Robertson B, Wijsman EM, Rapoport JL, Gogos JA, Karayiorgou M.2002b.Genetic variation at the 22q11PRODH/DGCR6 locus presents anunusual pattern and increases susceptibility to schizophrenia. ProcNatlAcad Sci USA 99:3717–3722.

Murphy KC. 2002. Schizophrenia and velo-cardio-facial syndrome. Lancet359:426–430.

MurphyKC,JonesLA,OwenMJ.1999.High rates of schizophrenia inadultswith velo-cardio-facial syndrome. Arch Gen Psychiatry 56:940–945.

Pulver AE, Nestadt G, Goldberg R, Shprintzen RJ, LamaczM,Wolyniec PS,Morrow B, Karayiorgou M, Antonarakis SE, Housman D, et al. 1994.Psychotic illness in patients diagnosed with velo-cardio-facial syndromeand their relatives. J Nerv Ment Dis 182:476–478.

Riley BP, McGuffin P. 2000. Linkage and associated studies of schizo-phrenia. Am J Med Genet 97:23–44.

ShaikhTH,KurahashiH, Saitta SC,O’HareAM,HuP,RoeBA,Driscoll DA,McDonald-McGinn DM, Zackai EH, Budarf ML, Emanuel BS. 2000.Chromosome 22-specific low copy repeats and the 22q11.2 deletionsyndrome: Genomic organization and deletion endpoint analysis. HumMol Genet 9:489–501.

Shprintzen RJ, Goldberg R, Golding-Kushner KJ, Marion RW. 1992. Late-onset psychosis in the velo-cardio-facial syndrome. Am J Med Genet42:141–142.

Sugama S, Namihira T, Matsuoka R, Taira N, Eto Y, Maekawa K. 1999.Psychiatric inpatients and chromosome deletions within 22q11.2. 1999.J Neurol Neurosurg Psychiatry 67:803–806.

Usiskin SI, Nicolson R, Krasnewich DM, Yan W, Lenane M, Wudarsky M,Hamburger SD, Rapoport JL. 1999. Velocardiofacial syndrome inchildhood-onset schizophrenia. J Am Acad Child Adolesc Psychiatry38:1536–1543.

Williams HJ, Williams N, Spurlock G, Norton N, Ivanov D, McCreadie RG,Preece A, Sharkey V, Jones S, Zammit S,Nikolov I, Kehaiov I, Thapar A,Murphy KC, Kirov G, Owen MJ, O’Donovan MC. 2003. Associationbetween PRODH and schizophrenia is not confirmed. Mol Psychiatry8:644–645.

Association of PRODH With Schizophrenia in China 15