Evaluation of TRPM (transient receptor potential melastatin)genes expressions in myocardial ischemia and reperfusion

Tuncer Demir • Onder Yumrutas • Beyhan Cengiz • Seniz Demiryurek •

Hatice Unverdi • Davut Sinan Kaplan • Recep Bayraktar • Nadide Ozkul •

Cahit Bagcı

Received: 3 August 2013 / Accepted: 11 January 2014

� Springer Science+Business Media Dordrecht 2014

Abstract In the present study, the expression levels of

TRPM1, TRPM2, TRPM3, TRPM4, TRPM5, TRPM6,

TRPM7, and TRPM8 genes were evaluated in heart tissues

after ischemia/reperfusion (IR). For this study, 30 albino

male Wistar rats were equally divided into three groups as

follows: Group 1: control group (n:10), Group II: ischemia

group (ischemia for 60 min) (n:10) and Group III: IR

(reperfusion 48 h after ischemia for 60 min and reperfusion

for 48 h). The expression levels of the TRPM genes were

analyzed by semi-quantitative reverse transcriptase-PCR.

When compared to the ischemia control, the expression

levels of TRPM2, TRPM4, and TRPM6 did not change,

whereas that of TRPM7 increased. However, TRPM1,

TRPM3, TRPM5, and TRPM8 were not expressed in heart

tissue. Histopathological analysis of the myocardial tissues

showed that the structures that were most damaged were

those exposed to IR. The findings showed that there is a

positive relationship between TRPM7 expression and

myocardial IR injury.

Keywords TRPM channel � Ischemia � Reperfusion �Expression � Myocardial infarction

Introduction

Calcium is an important chemical element that plays an

important role in excitation and contraction and is essential

for the living organism. Calcium influx into a cell occurs

via various mechanisms. Calcium channels, especially

voltage-dependent calcium channels, regulate calcium

influx [1]. Ca requires for activation of signal pathways and

contraction of fibers [2]. Calcium uptake in cells must be

carefully regulated during the contraction process. If the

uptake is irregular, excess calcium can accumulate, leading

to apoptosis or necrosis and subsequent tissue damage. IR

can give rise to apoptosis and necrosis in tissue. According

to Schrier et al. [3], calcium accumulation causes IR and

plays a role in apoptosis and necrosis.

The majority of cellular processes involving Ca depend on

ion channels, including transient receptor potential (TRP).

TRP channels are permeable to calcium [4] The TRP super-

family is classified into seven subfamilies: TRPC, transient

receptor potential melastatin (TRPM), TRPV, TRPA, TRPN,

TRPML [5]. TRPM is a large and diverse group of cation

channels [5]. TRPM is functionally diverse, with eight groups

with diverse functions and expression patterns [5, 6]. Research

has suggested that the TRPM ion channel has important roles

in ischemia. For example, among the TRPM channels,

TRPM7 was found to be involved in delaying neuronal death

after ischemia [7]. All TRPM channels are calcium perme-

able, except TRPM4 and TRPM5, but the permeability differs

from one channel to another [4].

To our knowledge, no report has examined the relation

of TRPM1–8 channels and myocardial IR. To understand

T. Demir � B. Cengiz � S. Demiryurek � D. S. Kaplan �N. Ozkul � C. BagcıDepartment of Medical Physiology, Faculty of Medicine,

University of Gaziantep, 27310 Gaziantep, Turkey

O. Yumrutas (&)

Department of Medical Biology, Faculty of Medicine,

University of Adiyaman, 02040 Adiyaman, Turkey

e-mail: yumrutasonder@gmail.com;

oyumrutas@adiyaman.edu.tr

H. Unverdi

Department of Pathology, Dr. Ersin Arslan Public Hospital,

27001 Gaziantep, Turkey

R. Bayraktar

Department of Medical Biology, Faculty of Medicine, University

of Gaziantep, 27310 Gaziantep, Turkey

123

Mol Biol Rep

DOI 10.1007/s11033-014-3139-0

the roles of ion channels in tissue damage, it is important to

understand the pathogenesis of renal IR and myocardial IR.

Therefore, the aim of the present study was to determine

the expression of TRPM1, TRPM2, TRPM3, TRPM4,

TRPM5, TRPM6, TRPM, and TRPM8 genes in heart tissue

following IR and the histopathological effects of the

expression of these genes.

Subject and methods

All the experimental protocols were approved by the

Experimental Animal Committee of Gaziantep University,

Faculty of Medicine.

Experiment animals and design

In this study, 30 male Wistar rats weighing 200–250 g

were used. The rats were maintained under a circadian

rhythm, a temperature of 24–26 �C, and 50–60 % humidity

in the experiment.

Experimental groups

Group I (control group): IR was not applied in this group of

rats.

Group II (ischemia group): After laparotomy, ischemia

was initiated with a vascular clamp applied to the atrau-

matic vascular vein for 25 min. The ventricular myocardial

tissues of all the rats were then isolated.

Group III (reperfusion group): Reperfusion was applied

to the heart and atraumatic vascular vein by a clamp for

40 min after the laparotomy. After reperfusion, all the

animals underwent re-laparotomy, and the myocardial tis-

sues were isolated.

Myocardial I/R model

All the rats were anesthetized with an intraperitoneal injec-

tion of xylazine (10 mg/kg) and ketamine (40 mg/kg). After

anesthesia, the animal was fixed on the operating table, and

the abdominal skin was shaved and sterilized with 70 % ethyl

alcohol. Then, a midline incision was made, and the heart was

located and dissected free from its surrounding structures.

The edges of the abdominal incision were approximated to

each other and covered by a piece of gauze soaked with warm

isotonic saline to prevent undue loss of body fluids. After

removal of the vascular clamp from the myocardium the heart

was removed, and the abdomen was properly irrigated with

isotonic saline. The abdominal incision was closed by con-

tinuous stitches using vicryl 3/0 sutures. After 25 min of

ischemia and 40 min of reperfusion, the animals were

anaesthetized with ketamine/xylazine intraperitoneally (40/

10 mg/kg), and their hearts were harvested.

RNA isolation and cDNA construction

Total RNA samples were prepared by using a modified

method by manufacturer (Qiagen,Mainz, German). Total

RNAs were reverse-transcribed by a AMV Reverse Tran-

scription Kit (Roche, Switzerland) according to the pro-

cedures provided by the supplier. Briefly, 10X Buffer RT

(2 ll), MgCl2 (4 ll), deoxyinucleotide (2 ll), fandom-dT

primer (2 ll), RNase inhibitor (2 ll), AMV reverse trans-

criptase (0.8 ll), mRNA, and RNase free water were mixed

to obtain cDNA. The reaction mixture was incubated at 45�C for 45 min for reverse transcription and heated at 94� C

for 2 min to inactivate the AMV reverse transcriptase. The

cDNAs obtained were stored at -20 �C until tested.

The primer sequences used were as follows: TRPM2

(438 bp): sense TGGGAGCTCTACCTGAAGGA and anti-

sense CAGAAACTCTGCCTCCCAAG; TRPM4 (258 bp):

sense CAGCGACCTCTACTGGAAGG and antisense TCA

CGAGCTTGTGCCAATAG; TRPM6 (598 bp): sense CAA

GAGTGGCTTGTCATCA and antisense TGAAACAGGCA

ATCAGCAAG; and TRPM7 (417 bp): sense CTAGCC

TTCAGCCACTGGAC and antisense CCCTGAAA

GGAAAAACGTCA.

Reverse transcriptase-polymerase chain reaction

(RT-PCR)

The mRNA expression of each of TRPM and the b-actin

housekeeping genes were analyzed by semi-quantitative

RT-PCR. The cDNAs obtained were denatured at 94 �C for

3 min for first denaturation (1, number of cycle), and then

at 94 �C for 30 s for second denaturation (30, number of

cycle). They were annealed at 60 �C for 45 s (TRPM2), at

60 �C for 30 s (TRPM4), at 55.6 �C for 30 s (TRPM6), at

60.4 �C for 30 s (TRPM7), and extended at 94 �C for

3 min. They were all then extended at 72 �C for 30 s.

TRPM1, TRPM3, TRPM5, and TRPM8 were not expressed,

and so their PCR data were not given. PCR mixtures

(10 ll) were electrophoresed on a 2 % agarose gel, which

was subsequently stained with 0.5 ll/ml ethidium bromide

and photographed after visualization with an ultraviolet

transilluminator. The gels were scanned on an imaging

analyzer, and the corresponding band densities were rela-

tively measured by an Image J system.

Mol Biol Rep

123

Histopathological examination

Tissue histopathological examinations were evaluated by a

single pathologist. Samples of heart muscle from rats were

studied by light microscopy. Specimens for light micros-

copy were fixed in 10 % buffered formalin and embedded

in paraffin. The paraffin embedded blocks were sliced in

4 lm and stained with hematoxyline and eosin. The his-

topathological evaluation was graded as follows:

Grade 0 (none): No evidence of ischemic necrosis

Grade 1 (mild): Several focal myocytes or, at most, two

areas with approximately five myocytes injured

Grade 2 (moderate): Multiple small foci of injury or a

single large area of injury

Grade 3 (severe): Marked injury or more than one large

area of injury

Statistical analysis

All values were reported as mean ± SD. The statistical

analysis was carried out by one-way analysis of variance

(ANOVA, LSD). p values \0.05 were considered as sig-

nificant differences.

Results

Evaluation of gene expression

The screening of the TRPM genes showed that TRPM1,

TRPM3, TRPM5, and TRPM8 were not expressed. Table 1

shows the expression levels of the TRPM genes. As shown

in the table, although the expression of TRPM2 decreased

in the IR group (p \ 0.05), it did not change in the

ischemia group (p [ 0.05). The expression of TRPM4 and

TRPM6 did not change in either the ischemia or the IR

group (p [ 0.05). The expression of the TRPM7 gene

showed the greatest change, increasing in both the ischemia

and the IR groups. Moreover, the increase was statistically

significant (p \ 0.05) when compared to the control. The

expression levels of the genes were measured with the

normalization method.

Histopathological evaluation

According to standard procedures, the myocardial tissues

were observed on a light microscope (Fig. 1), and the

results are given in Table 2. In the histopathological

evaluation, damage to the tissues were graded as 0: none, 1:

mild, 2: moderate, and 3: severe. Figure 1 shows the degree

of ischemic tissue damage over time (D). Moreover, the

effects of the ischemia on the tissues were mild and

moderate (A, B). As can be seen in Table 2, the structures

that were most damaged (Grade 3) in the myocardial tissue

were those exposed to IR. In addition, rat tissues exposed

only to ischemia showed more damage than the control

tissues.

Discussion

Calcium channels have a significant role in life processes,

and calcium channels are expressed in many cells and

tissues. The TRPM gene family is one of the most

important members of the calcium channels. There are

many studies of the expression of TRPM channels in the

literature. Some studies have suggested that TRPM genes

are associated with cancer [8], hypertension [9], ischemia

[10], neurodegenerative diseases [11], and cardiovascular

diseases [12]. Although the expression of TRPM genes in

some tissues has been reported, to the best of our knowl-

edge, this study is the first report of the expression of

TRPM genes after myocardial IR and the histopathological

effects of their expression. The TRPM1, TRPM3, TRPM5,

and TRPM8 genes were not expressed in any of the groups.

In addition, we determined the expression of TRPM2,

TRPM4, TRPM6, and TRPM7 in all the groups. The results

showed that the expression levels of TRPM2, TRPM4, and

TRPM6 did not change after IR. In contrast, the expression

level of TRPM7 increased in the ischemia and IR groups.

Zhang et al. [13] reported the expression levels of TRPM

genes (TRPM1–7) in a focal cerebral ischemia model

stimulated by rat middle cerebral artery occlusion.

Although the expression of TRPM7 increased, the expres-

sion of TRPM2 did not change. In the same study, the

expression of TRPM4 and TRPM6 did not change. Meng

et al. [14] found that the expression of TRPM7 increased at

Table 1 Results obtained from digital measurement of the target

gene expressions

Genes Groups Expression SD p

TRPM2 Control 1.099 ±0.216

Ischemia 1.041 ±0.230 p [ 0.05

IR 0.885 ±0.238 p [ 0.05

TRPM4 Control 1.062 ±0.237

Ischemia 1.124 ±0.279 p [ 0.05

IR 1.772 ±0.956 p [ 0.05

TRPM6 Control 0.774 ±0.068

Ischemia 0.773 ±0.182 p [ 0.05

IR 0.826 ±0.154 p [ 0.05

TRPM7 Control 0.334 ±0.206

Ischemia 1.670 ±0.302 p \ 0.05

IR 1.098 ±0.254 p \ 0.05

IR ischemia reperfusion

Mol Biol Rep

123

24 h after renal IR. Many factors may affect the expression

of these genes, including different tissue types, the meth-

odology, and the severity of IR.

TRPM7 is expressed in various tissues [15, 16]. TRPM7

plays an important role as a calcium channel in cells [17,

18]. In our study, we determined a positive relationship

between the expressions of TRPM genes and damaged

myocardial tissues. This relationship may be due to

increase in the expression of TRPM7. As shown in Fig. 1

and Table 2, the most severe tissue damage was observed

in the IR group. In addition, the IR group showed the

greatest increase in the expression of TRPM7. The over-

expression of the TRPM7 genes may result in over-accu-

mulation of calcium, thereby triggering the generation of

reactive oxygen radicals and increased damage to tissue in

the IR group. According to Meng et al. [14], if TRPM7

expression can be suppressed, the degree of the tissue

damage caused by IR may be decreased.

Conclusion

In the present study, we evaluated the expression changes

of TRPM2, TRPM4, TRPM6, and TRPM7 genes after IR,

and observed histopathology of myocardial tissues. Other

than TRPM7, which increased in the ischemia and IR

groups, the expression levels of the other TRPM genes did

not change. Moreover, the ischemia and IR groups showed

more tissue damage when compared to the control. The

findings of the present study show that there is a positive

relationship between TRPM7 expression and myocardial IR

injury. To better understand this relationship, further

Fig. 1 Representative light micrographic figures of myocardial tissues for each ischemic grade. Ischemic grade 0 (None) at 920 (a) power.

Ischemic grade 1 (Mild) at 920 (b) power. Ischemic grade 2 (Moderate) at 920 (c) power. Ischemic grade 3 (Severe) at 920 (d) power

Table 2 Histopathological evaluation

Groups 1 2 3 4 5 6 7 8 9 10

Control 0 0 0 0 0 0 1 1 0 1

Ischemia 2 2 3 2 2 2 3 1 1 3

IR 3 3 2 2 2 3 2 1 2 3

The bold number means the number of the groups

IR ischemia reperfusion

Mol Biol Rep

123

studies of protein levels of the TRPM7 gene by the Western

blot method are warranted.

Conflict of interest The authors declared no conflict interest.

References

1. Hool LC (2007) What cardiologists should know about calcium

ıon channels and their regulation by reactive oxygen species.

Heart Lung Circ 16(5):361–372

2. Ruwhof C, Van Der Laarse A (2000) Mechanical stress-induced

cardiac hypertrophy: mechanisms and signal transduction path-

ways. Cardiovasc Res 47(1):23–37

3. Schrier RW, Arnold PE, Van Putten VJ, Burke TJ (1987) Cellular

calcium in ischemic acute renal failure: role of calcium entry

blockers. Kidney Int 32(3):313–321

4. Dadon D, Minke B (2010) Cellular functions of transient receptor

potential channels. Int J Biochem Cell Biol 42(9):1430–1445

5. Fleig A, Penner R (2004) The TRPM ion channel subfamily:

molecular, biophysical and functional features. Trends Pharmacol

Sci 25(12):633–639

6. Fonfria E, Murdock Pr, Cusdin FS, Cd Benham, Kelsell Re,

Mcnulty S (2006) Tissue distribution drofiles of the human

TRPM cation channel family. J Recept Signal Transduct Res

26(3):159–178

7. Sun HS, Jackson MF, Martin LJ, Jansen K, Teves L, Cui H,

Kiyonaka S, Mori Y, Jones M, Forder JP, Golde TE, Orser BA

(2009) Suppression of hippocampal TRPM7 protein prevents

delayed neuronal death in brain ischemia. Nat Neurosci

12(10):1300–1307

8. Guilbert A, Gautier M, Dhennin-Duthille I et al (2009) Evidence

that TRPM7 is required for breast cancer cell proliferation. Am J

Physiol Cell Physiol 297(3):493–502

9. Sontia B, Montezano AC, Paravicini T et al (2008) Downregu-

lation of renal TRPM7 and increased inflammation and fibrosis in

aldosterone-infused mice: effects of magnesium. Hypertension

51(4):915–921

10. Aarts M, Iihara K, Wei Wl et al (2003) A key role for TRPM7

channels in anoxic neuronal death. Cell 115(7):863–877

11. Popper P, Farber DB, Micevych PE, Minoofar K, Bronstein JM

(1997) TRPM-2 expression and tunel staining in neurodegener-

ative diseases: studies in wobbler and rd mice. Exp Neurol

143(2):246–254

12. Watanabe H, Murakami M, Ohba T, Takahashi Y, Ito H (2008)

TRP channel and cardiovascular disease. Pharmacol Therapeutics

118:337–351

13. Zhang Y, Zhou L, Zhang X, Bai J, Shi M, Zhao G (2012) Gin-

senoside-Rd attenuates TRPM7 and ASIC1a but promotes

ASIC2a expression in rats after focal cerebral ischemia. Neurol

Sci 33(5):1125–1131

14. Meng Z, Wang X, Yang Z, Xiang F (2012) Expression of transient

receptor potential melastatin 7 up-regulated in the early stage of

renal ıschemia-reperfusion. Transplant Proc 44(5):1206–1210

15. Massullo P, Toledo AS, Bhagat H, Sanchez SP (2006) TRPM

channels, calcium and redox sensors during innate immune

responses. Semi Cell Dev Biol 17(6):654–666

16. Kunert-Keil C, Bisping F, Kruger J, Brinkmeier H (2006) Tissue-

specific expression of TRP channel genes in the mouse and its

variation in three different mouse strains. BMC Genomics 7:159

17. Monteilh-Zoller MK, Hermosura MC, Nadler MJ, Scharenber-

gam, Penner R, Fleig A (2003) TRPM7 provides an ion channel

mechanism for cellular entry of trace metal ions. J Gen Physiol

121(1):49–60

18. Runnels LW, Yue L, Clapham DE (2001) TRP-PLIK, a bifunc-

tional protein with kinase and ion channel activities. Science

291(5506):1043–1047

Mol Biol Rep

123