European Union Reference Laboratory for Monitoring ... · PDF fileEuropean Union Reference...

European Union Reference Laboratory for Monitoring Bacteriological and Viral Contamination of Bivalve Molluscs, Cefas, Weymouth Technical Report for Calendar Year 2011 Cefas Weymouth Laboratory, Barrack Road, The Nothe, Weymouth, Dorset, DT4 8UB, UK Telephone: +44 (0) 1305 206600 Fax: +44 (0) 1305 206601 E-mail: [email protected]

Website: www.eurlcefas.org

http://www.eurlcefas.org/

EU-RL for monitoring bacteriological and viral contamination of bivalve molluscs annual technical report calendar year 2011

Page 1 of 19

Contents

Legal functions and duties 2

Introduction 2

1. Scientific advice and support 2

2. Co-ordination of activities of NRL network and provision of technical assistance and training 8

3. Proficiency testing and quality assurance 12

4. Confirmatory testing 19

5. Development of analytical methods 20

List of Annexes

Annex I - Work programme for the EU-RL for bacteriological and viral contamination of bivalve

molluscs 2011.

Annex II - Resolutions of the 10th workshop of NRLs for bacteriological and viral contamination

of Bivalve Molluscs, 2011.

Annex III - Agenda of the 10th workshop of NRLs for bacteriological and viral contamination of

Bivalve Molluscs, 2011.

Annex IV – RT 38 Interlaboratory trial for generation of additional data for the revision of ISO

TS 21872 series 2011

Annex V - RT 39 Norovirus and hepatitis A virus ring trial 2011

Annex VI – RT 41 Enumeration of Escherichia coli and the detection of Salmonella spp. in Pacific

oysters (Crassostrea gigas)

Annex VII– RT 43 Norovirus and hepatitis A virus proficiency testing 2011

Annex VIII - RT 44 Escherichia coli and Salmonella spp. EQA

Annex IX - The public health implications of real time PCR detection of norovirus in bivalve

molluscan shellfish


Page 2 of 19

European Union Reference Laboratory for Monitoring Bacteriological and Viral Contamination of Bivalve

Molluscs, CEFAS, Weymouth

Technical Report for Calendar Year 2011

Legal functions and duties

The functions and duties of the EURL are specified in Article 32 of Council Regulation (EC) 882/2004 (Official

Journal of the European Communities No L165).

Introduction

The annual work programme for the EU-RL for 2011 was approved by the European Union in December

2010. This report details activities of the EU-RL according to the work programme 2011 (Annex I),

additional tasks described under the resolutions of the 10th workshop of microbiological NRLs held in

Weymouth (Annex II) and other responsibilities outlined in Commission Regulation (EC) 882/2004 for the

calendar year 2011.

1. Scientific advice and support

To the European Union.

The EU-RL provided DG SANCO support in the form of scientific and technical advice, attendance at

meetings, briefing notes, position papers, reports and including:

Final EU-RL opinion on the dossier of information and data provided by the Autonomous Community

of Galicia, Spain on intensive purification of class C live bivalve molluscs (LBM).

Further technical advice on the statistical equivalence and potential for harmonisation on Codex

requirements for ready to eat LBM (CODEX STAN 292-2008) and EU Food Hygiene legislation as it

applies to class A product.

The EU-RL contributed extensively to EFSA expert working groups, Biological Hazards Panel (BIOHAZ)

concerning norovirus. In 2011 two reports were produced:

o Scientific Opinion on an update on the present knowledge on the occurrence and

control of foodborne viruses

http://www.efsa.europa.eu/en/efsajournal/pub/2190.htm



Page 3 of 19

o Scientific Opinion on Norovirus (NoV) in oysters: methods, limits and control

options http://www.efsa.europa.eu/en/efsajournal/pub/2500.htm

The EU-RL contributed to the ESFA BIOHAZ working group developing a “Scientific Opinion on the

minimum hygiene criteria to be applied to clean seawater and on the public health risks and hygiene

criteria for bottled seawater intended for domestic use”.

The EU-RL represented DG Sanco at the plenary meeting of Microbiology of food and animal feeding

stuffs ISO SC9 and CEN TC275 WG6 in Bournemouth 2011. Following the meeting a joint EU-RLs

summary report was compiled identifying relevant issues and resolutions for DG Sanco desk officers.

The EU-RL presented details of two alternative methods (use of Bactrac 4300 and TBX) validated

according to ISO 16140 against the EU stipulated reference method for enumeration of E. coli in LBM

(ISO TS 16649-3) to the Standing Committee on the Food Chain and Animal Health (SCFCAH). Both

procedures were approved subsequently the EU-RL, in collaboration with the expert laboratories

responsible for the validation studies published EU-RL protocols (see section 5).

The EU-RL provided scientific advice to DG Sanco on Salmonella spp. in raw and live LBM to inform

discussions at Codex.

The EU-RL also provided follow-up technical support in the form of EU-RL scientific opinion to the Food

and Veterinary Office following the Canadian audit mission.

The EU-RL attended the EU-RL directors meeting in Brussels, December 2011.

Two validated alternative methods for enumeration of E. coli in LBM (see section 2) were presented to

the Standing Committee on the Food Chain and Animal Health (SCFCAH).

Note. A full register of advice, copies of paperwork and all supporting information provided by the EU-RL to

the European Union and its divisions is available from the EU-RL co-ordinator on request.

To the EU NRL network, EFTA , accession and third country laboratories

In 2011 the EU-RL provided significant support in the form of advice (briefing notes, technical reports, etc)

to laboratories within the network of National Reference Laboratories and others. Substantive advisory

activities (i.e. those requiring input of half a day or more are listed here):

Comparative testing and statutory determinands

Advice to laboratories on the participation and recommended frequency of proficiency testing for

statutory determinands.

Trend analyses for ongoing performance in statutory comparative testing for E. coli for all NRLs.



Page 4 of 19

Provision of advice and material for comparative analysis of E. coli enumeration methods (including

the stipulated EU reference method) for Official Control programmes in South Korea.

Use of control charts for quality assurance analysis.

Provision of advice covering batch sizes and sampling frequency at purification centres.

Microbiological monitoring and classification

Advice on rainfall based closures, numbers of areas classified as class C areas across MS and

seasonal classifications.

Virus

Substantial advice to various laboratories on norovirus and hepatitis A virus determination in LBM

including - Provision of advice on sample preparation for quantitative detection; use of internal RNA

controls in determination of noroviruses in foodstuffs; use of proteinase K extraction of viruses in LBM;

interpretation of RT-PCR results; practical application of test methods for noroviruses.

The EU-RL provided a preliminary dossier to the US Food and Drug Administration (FDA) and Canadian

Food Inspection Agency, Environment Canada, and Fisheries and Oceans Canada as part of the

Quantitative food safety risk assessment on norovirus in bivalve molluscan shellfish.

Vibrios

Distribution of Vibrio spp. in LBM with respect to analysis using PCR and real time PCR based methods.

Selection of real time PCR primers and probes for quantitative determination of V. parahaemolyticus

in bivalves.

Additionally ad hoc technical advice was provided to laboratories via e-mail or telephone.

A register of advice provided by the EU-RL is available from the EU-RL co-ordinator on request.

Other Scientific activities – Standardisation activities at ISO/CEN

The EURL leads relevant method standardisation activities through coordination of and participation in

food microbiology committees under CEN/TC 275/WG6 and ISO SC9. In 2011 the following key activities

were undertaken:

Launch of the Technical Specification (TS) ISO 15216-1 Microbiology of food and animal feed -

Horizontal method for detection of hepatitis A virus and norovirus in food using real-time RT-

PCR- Part 1: Method for quantitative determination.


Page 5 of 19

Launch of the Technical Specification (TS) ISO 15216-2 Microbiology of food and animal feed -

Horizontal method for detection of hepatitis A virus and norovirus in food using real-time RT-

PCR- Part 1: Method for qualitative determination.

The EU-RL worked with AFNOR to finalize contractual details to enable commencement of the

formal validation of the virus standard.

The EU-RL undertook revision of ISO TS 21872 parts 1 and 2 in preparation for formal validation and

carried out ring trials to generate data in support of the introduction of PCR based tests to

differentiate between pathogenic and non-pathogenic strains of V. parahaemolyticus (see section

5).

Launch of the ISO 16649-3 Microbiology of food and animal feed Error! Reference source not

found. (the EU reference method for E. coli enumeration in LBM) for adoption as a full ISO

standard. This removes the requirement to withdraw the document under ISO rules. The document

was previously revised through WG14 (EU-RL lead) harmonizing the use of control organisms,

refining the scope and introducing a clause for detection.

Revision of ISO 6887-3 Microbiology of food and animal feed— Preparation of test samples, initial

suspension and decimal dilutions for microbiological examination—Part 3: Specific rules for the

preparation of fish and fishery products. This document is cross referenced in official control

methods for LBM.

Other Scientific activities –- participation in international scientific fora

The EU-RL presented key note addresses, research papers, chaired scientific sessions, and led round tables

at a number of international scientific conferences in 2011. To include the 8th International Conference on

Molluscan Shellfish Safety (ICMSS) in Charlottestown, Canada; Vibrio 2011, Santiago de Compostela, Spain;

Food and Environmental Proficiency Testing (FEPTU 2011), London, UK. EU-RL staff covered EU

perspectives on norovirus, Salmonella in bivalves: public health considerations; methods for quantitative

determination of pathogenic Vibrio spp., the impact of climate change (sea water temperature rise) on

prevalence of pathogenic Vibrio spp., reference materials norovirus and hepatitis A virus, comparative

testing schemes. EU-RL staff also participated in the FAO/WHO expert working group on Salmonella in LBM

Ottawa and Canada; COPEPRIS Symposium, Mexico.

The EU-RL is a member of the International Steering Committee responsible for planning and organisation

of the next International Conference Molluscan Shellfish Sanitation (ICMSS) conference in Sydney in March

2012.


Page 6 of 19

EU-RL Publications

In 2011 the EU-RL produced the following peer review publications and book chapters:

1. Baker-Austin, C., J. Trinanes, R. Hartnell, N. Taylor, A. Siitonen, and J. Martinez-Urtaza Emerging Vibrio risk at high-latitudes in response to ocean warming. Nature Climate Change (submitted).

2. R. Hartnell, J. Lowther, J. Avant, D. Dancer, D. Lees and J. Russell The development of LENTICULES™ as

reference materials for noroviruses..Journal of Applied Microbiology, (submitted). 3. J.A. Lowther, N.E. Gustar, R.E. Hartnell, and D.N. Lees Comparison of norovirus RNA levels in outbreak-

related oysters with background environmental levels. Journal of Food Protection, (submitted). 4. Morrison, S. A. Cain, B. Froelich, T. Williams, C. Taylor, D. Verner-Jeffreys, R. Hartnell, J. D. Oliver, C.

Baker-Austin, and C. Gibas Pyrosequencing-based comparative genome analysis of Vibrio vulnificus environmental isolates. PLOS One (submitted).

5. D.W. Verner-Jeffreys, C. Baker-Austin, M.J. Pond, G.S.E. Rimmer, R. Kerr, R. Griffin, P. White, N. Stinton, K.Denham, J. Leigh, N. Jones, M. Longshaw, S.W. Feist. Zoonotic bacterial pathogens isolated from imported Doctor fish (Garra rufa) destined for use in UK pedicure spa treatment centers. Emerging Infectious Diseases (submitted).

6. Dancer D., Rangdale R.E, Lowther J.A. and D.N. Lees (2011). Human norovirus RNA persists in seawater under simulated winter conditions but does not bioaccumulate efficiently in Pacific oysters (Crassostrea gigas) Journal of Food Protection. 73, 11, 2123-7.

7. Lee R.J. and Rangdale R.E. (2011) Tracking pathogens in molluscan shellfish production chains. Edited

by Stanley Brul, Pina M. Fratamico and Tom A. McMeekin, Woodhead Publishing Limited 2011 pp 527 – 544.

8. C.J.A. Campos, K. Hargin, S. Kershaw, R.J. Lee, O.C. Morgan (2011) Rainfall and river flows are

predictors for β-Glucuronidase positive Escherichia coli accumulation in mussels and Pacific oysters from the Dart Estuary (England). Journal of Water and Health 9(2) 368-381.

9. Craig Baker-Austin, Elizabeth Lemm, Rachel Hartnell, James Lowther, Richard Onley Carmen Amaro, James D. Oliver, David Lees. (2011) pilF polymorphism-based real-time PCR to distinguish Vibrio vulnificus strains ofhuman health relevance. Food Microbiology 30 (1) May 2012,pp 17–23.

10. G. D. Reilly, C. A. Reilly, E. G. Smith, C. Baker-Austin (2011) Vibrio alginolyticus-associated wound infection acquired in British waters, Guernsey. Eurosurveillance, 20 October 2011.

11. N.G.H. Taylor, D.W. Verner-Jeffreys and C. Baker-Austin (2011) Aquatic systems: maintaining, mixing and mobilising antimicrobial resistance? Trends in Ecology and Evolution, 26(6); 278-284.

Note. Copies of EU-RL publications can be obtained from the EU-RL co-ordinator on request.


Page 7 of 19

2. Co-ordination of activities of NRL network and provision of technical assistance and training (including

third countries)

UDesignation of NRLs and co-operation with the EU-RL

The EU-RL promotes full and active participation by NRLs in the activities of the network as outlined in

Article 32 of Commission Regulation (EC) No. 882/2004. To assist in co-ordination activities a list of

designated NRLs is updated annually. This information is published on the EU-RL website

Uwww.crlcefas.orgU (Table 1).

Table 1. Designated NRLs in Member States, EFTA and Accession states in 2011.

Member State Laboratory

Austria Austrian Agency for Health and Food Safety, Institute for Food Control, AGES-LMU Wien, Abt. Mikrobiologie, Spargelfeldstraße 191 A-1220 Wien.

Belgium and Luxembourg Scientific Institute of Public Health (IPH), Rue J. Wytsmanstraat, 14, 1050 Brussels.

Bulgaria National Diagnostic and Research Veterinary Institute, Pencho, Slaveikov, 15 BG - 1606 Sofia

Croatia1 No NRL designated

Cyprus No NRL designated

The Czech Republic State Veterinary Institute, Rantirovska 93,Jihlava, CZ - 58605 Jihlava

Denmark Department of Microbiology and Risk Assessment, National Food Institute, Technical University of Denmark, Morkhoj Bygade 19 DK 2860 Soborg.

Estonia No NRL designated

FYR1 No NRL designated

Finland Finnish Food Safety Authority Evira, Research Department Microbiology Unit, Mustialankatu 3, FI-00790, Helsinki

France IFREMER, Departement Microbiologie et phycotoxines, Centre de Nantes, Rue de I'lle de'Yeu, BP 21105, 44311 Nantes Cedex 3.

Germany Federal Institute for Risk Assessment, Diedersdorfer Weg, D-12277, Berlin.

Greece Institute of Food Hygiene of Athens, Neapoleos 25, 15310 Ag. Paraskevi, Attiki, Athens.

Hungary Central Agricultural Institiute, Food and Feed Safety Directorate Mester u. 81 H-1095 Budapest Hungary

Iceland2 Matis, Matvaelarannsoknir Islands, Skulagotu 4, 101 Reykjavik.

Ireland Marine Institute, Orinville, Oranmore, Galway

Italy3 Istituto Zooprofilattico Sperimentale Umbria e Marche, Via Cupa di

Posatora 3, 60131, Ancona.

http://www.crlcefas.org/


Page 8 of 19

Dipartmento di Sanita Pubblica Veterinaria e Sicurezza Alimentare, Viale Regina Elena 299, Roma.

Latvia Institute of Food Safety, Animal Health and Environment (BIOR), Lejupes str.3, LV-1076 Riga.

Lithuania National Veterinary Laboratory, J.Kairiukscio 10, LT-2021 Vilnius.

Malta No NRL designated

The Netherlands National Institute for Public Health and the Environment (RIVM), PO Box 1A van, Leeuwenhoeklaan 9, 3720 BA, Bilthoven.

Norway2 Institute for Food Safety and Infectious Biology, Department for Food Safety, P.O Box 8146 Dep, 0033 Oslo.

Poland National Veterinary Research Institute, Panstwowy Instytut, Weterynaryjny, Al.Partyzantów 57, PL - 24-100 Pulawy.

Portugal Instituto de Investigacao das Pescas e do Mar (IPIMAR), Avenida Brasilia, 1449-006 Lisboa.

Member State Laboratory

Romania Institute for Diagnosis and Animal Health, Str. Dr. Staicovici, nr. 63 Sector 5, cod 050557, Bucuresti.

The Slovak Republic State Veterinary and Food Institute, Janoskova 1611/58 Ministry of Agriculture, SK - 02601 Dolny Kubin.

Slovenia National Veterinary Laboratory, Gerbiceva 60, SI – 1000, Ljubljana.

Spain Centro Nacional de Alimentacion, Agencia Espanola de Seguridad Alimentaria, E-28220 Majadahonda,Madrid.

Sweden National Food Administration, P.O. Box 622, 75126 Upsalla.

Turkey No NRL established

United Kingdom Centre for Environment, Fisheries and Aquaculture Science (Cefas), Weymouth Laboratory, Barrack Road, The Nothe, Weymouth, Dorset, DT4 8UB.

1 Accession State 2 Member of the EFTA 3 2 NRLs established (microbiological monitoring and virology)

UWebsite

The EU-RL website Uwww.eurlcefas.orgU is the one of the primary means of dissemination of information

and is used extensively by stakeholders. The site reviewed annually. Feedback from NRLs and other

stakeholders encouraged throughout the year and requested prior to the annual workshop meetings. In

2011 a number of improvements were undertaken to improve accessibility of information. The public

domain sections of the website comprise details of the designation and contact details of the NRL network,

the EU-RL comparative testing programme and documents supporting laboratory quality assurance. The

Information Centre (which requires registration) enables access to the agreed EU-RL work programmes and

annual technical and comparative testing reports. A section giving advice on the application of sanitary

http://www.crlcefas.org/


Page 9 of 19

survey based upon the EU-RL training courses is also now available. Papers and presentations from the last

5 years of workshops are available to NRLs, The Commission and Competent Authorities on registration.

User statistics for the EU-RL website for 2011 are given in Figures 1 and 2. There are approximately 300

registered users of the website. In 2011 users registered an average of 12,014 hits over visits per month

representing a 4% rise in visitor usage compared with 2009.

Figure 1. Hits requested by users by months in 2011.

A hit is defined as any request for data such as a web page,

bitmap, CGI gateway or file.

Figure 2. Sessions recorded by users by months in 2011

A session reports individual users for any given time interval.

Sessions are tracked per IP address and must register at least

one hit to be included.

U

NRLs workshop May 10-12th Weymouth, UK

The tenth workshop of European NRLs was held at the EURL, Weymouth U.K. Thirty-seven experts

representing the EU-RL, and NRLs from 22 Member States and EFTA countries attended. Representatives

from The State Veterinary Institute, Croatia were also in attendence. A full report of the 10th workshop

including copies of all of the presentations and associated meeting papers are available on the EU-RL

website (www.eurlcefas.org) or directly from the EU-RL co-ordinator. Twenty-two resolutions were passed

by NRL delegates. The workshop resolutions are included as Annex II of this report and the workshop

agenda as Annex III.


Page 10 of 19

UTraining and technical assistance

UFormal training workshops

The EU-RL organised a 4 day workshop on EU statutory requirements and sanitary surveys for EPAGRIL/

Centre for Development of Aquaculture and Fisheries, Brazil. Training in the application of sanitary surveys

was also provided for the Italian network. Further details are available from the EU-RL co-ordinator.

UAdditional ad hoc training and study visits

The EU-RL hosted a study visit for staff from the University of Melbourne, Australia - specifically covering

test methods for norovirus and hepatitis A virus.

UProvision of technical assistance and reference materials

Technical assistance

Harmonised EU-RL protocols for approved alternative methods for enumeration of E. coli in LBM were

distributed to all NRLs and placed on the EU-RL website in 2011. The methods were elaborated in

collaboration with NRL France and NRL The Netherlands and covered:

-1. Enumeration of E. coli in LBM using Bactrac 4300 (impedance),

-2. Enumeration of E. coli in LBM using the TBX method (derived from ISO 16649-2).

EU-RL generic protocols derived from the reference methods for enumeration of E. coli and detection of

Salmonella were reviewed and made available on the website. Laboratory protocols for the quantitative

determination of norovirus and hepatitis A virus were distributed to NRLs and third country laboratories

(including Singapore, Japan, Canada and the US).

Reference control materials in the form of contaminated LBM matrix, norovirus (GI, GII) and hepatitis A

virus (HAV) plasmids, Mengo virus and NoV GI and GII as laboratory constructed materials, V. vulnificus, V.

algoinolyticus and V. parahaemolyticus were distributed to NRLs, official control laboratories and third

country laboratories in France, Italy, Spain, U.K., Australia and Croatia.


Page 11 of 19

3. Proficiency testing and quality assurance

Participation of MS NRLs, accession and third countries in EU-RL organised comparative testing and ring

trials in 2011 is tabulated in Table 2 and summarised in this section. Comparative testing and ring trial

reports are presented in Annexes IV, V, VI, VII and VIII. In 2011 two virus distributions were undertaken

April and December , three sample laboratory constructed and one matrix sample were distributed. A ring

trial to generate data on molecular identification of Vibrio spp. was also undertaken. Reports are

distributed to participants, presented at the annual workshop of NRLs and are available in the Information

Centre of the EU-RL website www.eurlcefas.org

http://www.eurlcefas.org/


Page 12 of 19

Table 2- Summary of participation amongst NRLs and others in EURL organised proficiency testing in 2011

1 no designated NRL

2 did not take part in 3 annual distributions

3 not registered for E. coli/Salmonella EQA scheme

4 more than one laboratory participated

5 intended to provide data for the revision of ISO TS 21872 series, EU-RL prescribed methodology

6 comparative testing for statutory determinands

EUR

L ri

ng

tria

l re

fere

nce

nu

mb

er

Pro

fici

ency

tes

tin

g d

escr

ipti

on

EU NRLs EFTA Third country laboratories A

ust

ria3

Bel

giu

m a

nd

Lu

xem

bo

urg

3

Bu

lgar

ia3

Cyp

rus1

Cze

ch R

epu

blic

3

Den

mar

k

Esto

nia

1

Fin

lan

d3

Fran

ce

Ger

man

y

Gre

ece2

Hu

nga

ry3

Irel

and

Ital

y2, 4

Latv

ia3

Lith

uan

ia2

Mal

ta1

Net

her

lan

ds

Po

lan

d

Po

rtu

gal

Ro

man

ia

Slo

vaki

a3

Slo

ven

ia

Spai

n2

Swed

en3

Un

ited

Kin

gdo

m

Icel

and

3

No

rway

Per

u

New

Zea

lan

d

Sou

th K

ore

a

Ch

ile

Sin

gap

ore

Au

stra

lia

Cro

atia

1,4

Turk

ey3

Can

ada

RT385 Interlaboratory trial for data for revision of ISO TS 21872 (vibrios)

x x x x x x x x x x x x x x x x x x x x x x x

RT39 Norovirus and hepatitis A virus 2011 (April)

x x x x x x x x v x x x x x x x x

RT 416 E.coli/Salmonella whole animal 2011

x x x x x x x x x x x x x x x x x x

RT 43 Norovirus/Hepatitis A 2011 (December)

x x x x x x x x x x x x x x x

RT 44 E. coli/Salmonella EQA 2011 (SF038, SF039 and SF040)

x x x x x x x x x x x x x x x x x x x x


Page 13 of 19

U

Comparative testing for statutory determina

E.coli / Salmonella External Quality Assurance Scheme (EQA) (PT44)

The EU-RL collaborates with the UK Health Protection Agency (HPA) on the application of a Shellfish

External Quality Assurance (EQA) Scheme for proficiency testing among laboratories analysing BMS. The

Shellfish EQA scheme is targeted at analysis of the statutory determinants E. coli and Salmonella spp. in

BMS and is the primary means of measuring performance by NRLs. Participation by NRLs is given in Table 3.

It is noted that at the 10th workshop the following resolution was agreed by laboratories:

Resolution 12. The workshop noted the excellent performance of NRLs in PT for E. coli and

Salmonella spp. Some NRLs requested a reduction in PT frequency. The EU-RL agreed that a minimum

frequency of 2 distributions per year for satisfactory performing laboratories was adequate.

ISO 7218 states that laboratories should regularly participate in proficiency testing schemes which are

relevant to their scope of activity. A minimum participation level of 2 annual distributions is recommended

in the EU-RL guidance document “Microbiological monitoring of bivalve molluscs harvesting areas- guide to

good practice: Technical application http://www.crlcefas.org/Content/GPG_Issue4_Aug2010.pdf. The EU-

RL considers that providing other adequate quality assurance measures are in place participation in two

distributions per year is satisfactory.

Performance assessments for laboratories carrying out 2 and 3 EQA distributions from March, July and

November in 2011 are included in this report and summarized in Tables 4 and 5. A full report of laboratory

performance is included as Annex IV.

http://www.crlcefas.org/Content/GPG_Issue4_Aug2010.pdf


Page 14 of 19

Table 3. Participation in the EU-RL/HPA EQA Shellfish scheme for statutory determinands by NRLs, EFTA and Accession Country laboratories in 2011 Country E. coli

Salmonella

Austria1 Yes Yes

*Belgium and Luxembourg Not registered for the scheme

*Bulgaria Not registered for the scheme

Croatia2 Yes Yes

Cyprus No NRL designated

The Czech Republic Not registered for the scheme

Denmark3 Yes Yes

Estonia No NRL designated

FYR Accession country - NRL not designated

Finland Not registered for the scheme

France3 Yes Yes

Germany3 Yes Yes

Greece One distribution only

Hungary Not registered for the scheme

Iceland4 Not registered for the scheme

Ireland3 Yes Yes

Italy1, 3, 5

Yes Yes

Latvia Not registered for the scheme

Lithuania One distribution only

Malta No NRL designated

The Netherlands Yes Yes

Norway4,6

Yes Yes

Poland Yes Yes

Portugal Yes Yes

Romania Yes Yes

The Slovak Republic Not registered for the scheme

Slovenia Yes Yes

Spain One distribution only

Sweden Yes Yes

Turkey Accession country NRL not designated

United Kingdom Yes Yes 1 two distributions in 2011

2 Accession countries; two laboratories participated in three distributions each in 2011

3 three distributions in 2011

4 Member of EFTA

5 Two laboratories designated as NRLs

Ten designated NRLs (Spain, Greece, Belgium and Luxembourg, Bulgaria, The Czech Republic, Finland,

Hungry, Latvia, Lithuania, and the Slovak Republic) are not considered to be participating in comparative

testing with sufficient frequency for statutory determinands (E. coli and Salmonella). The EU-RL will


Page 15 of 19

investigate further lack of participation in comparative testing with these laboratories according to the

Commission Protocol1.

1 Protocol for management of underperformance in comparative testing and/or lack of collaboration of National Reference Laboratories (NRLs)

with Community reference laboratories (CRLs) activities. http://www.crlcefas.org/InformationCentre/docs/WS07_06_Protocol_CRL_NRL_final.pdf

http://www.crlcefas.org/InformationCentre/docs/WS07_06_Protocol_CRL_NRL_final.pdf


Page 16 of 19

Table 4 - Summary of performance of NRLs over distributions, SF038- SF 040- E. coli

Lab no.

Distribution SF038 Distribution SF039 Distribution SF040 All distributions

SF0084 SF0085 SF0086 SF0087 SF0088 SF0089 Cumulative score Max score %

121 12 12 12 12 12 12 72 72 100

391 12 12 12 12 12 12 72 72 100

403 12 12 12 12 12 12 72 72 100

413 12 12 12 12 - - 48 48 100

493 a

- - - - 12 12 - - -

583 12 12 12 12 7 12 67 72 93

597 12 12 12 12 12 12 72 72 100

601 12 12 12 12 - - 48 48 100

604 a

12 12 - - - - - - -

649 12 12 12 12 12 12 72 72 100

651 12 12 12 12 12 12 72 72 100

653 12 12 12 12 12 12 72 72 100

658 a

12 12 - - - - - - -

701 12 12 12 9 12 12 69 72 96

703 12 12 12 12 12 12 72 72 100

715 12 12 12 12 - - 48 48 100

718 12 12 12 12 12 12 72 72 100

719 12 12 12 12 12 12 72 72 100

720 12 12 12 12 12 12 72 72 100

744 12 12 12 12 12 12 72 72 100

1527 12 12 12 12 12 12 72 72 100

Table 5 - Summary of performance of NRLs over distributions, SF038- SF 040-Salmonella

Lab no. Distribution SF038 Distribution SF039 Distribution SF040 All distributions

SF0084 SF0085 SF0086 SF0087 SF0088 SF0089 Cumulative score Max score %

121 2 2 2 2 2 2 12 12 100

391 2 2 2 2 2 2 12 12 100

403 2 2 2 2 2 2 12 12 100

413 2 2 2 2 - - 8 8 100

493 a

- - - - 2 2 - - -

583 2 2 2 2 2 2 12 12 100

597 2 2 2 2 2 2 12 12 100

601 2 2 2 2 - - 8 8 100

604 a

2 2 - - - - - - -

649 2 2 2 2 2 2 12 12 100

651 2 2 2 2 2 2 12 12 100

653 2 2 2 2 2 2 12 12 100

658 a

2 2 - - - - - - -

701 2 2 2 2 2 2 12 12 100

703 2 2 2 2 2 2 12 12 100

715 a

2 2 - 2 - - - - -

718 2 2 2 2 2 2 12 12 100

719 2 2 2 2 2 2 12 12 100

720 2 2 2 2 2 2 12 12 100

744 2 2 2 2 2 2 12 12 100 a full performance assessment not carried out as laboratories did not complete sufficient distributions


Page 17 of 19

UE. coli and Salmonella spp. whole bivalve mollusc ring trial – RT41

In November 2011 the EU-RL organised a comparative test distribution using bivalve mollusc matrix

samples (Pacific oysters, (Crassostrea gigas)) to examine initial sample preparation, preparation of dilutions

and potential matrix effects. Twenty –eight laboratories participated including 17 MS NRL.

Participants examined samples for the statutory determinands (E. coli and Salmonella spp). Reported E. coli

MPN values were compared to the median of all participants’ results. Upper and lower acceptability limits

were calculated as the participants’ median ±3 theoretical standard deviations (SD) and ±5 SD (≈99% and

99.9% confidence intervals respectively). Performance assessment was according to the EU-RL/HPA EQA

scheme for a single distribution, with modifications to reflect replicate analyses of a single sample.

Ninety-six % of laboratories received samples within 48 hours, with 69% arriving within 24 hours. All

laboratories returned results for E. coli and Salmonella spp. Three laboratories returned either duplicate or

single E. coli MPN results outside of the expected range for E. coli. Twenty-eight laboratories cited ISO TS

16649-3 (Anon 2005) or a derivative of this as their laboratory method for enumeration of E. coli. One

laboratory used ISO 16649-2 (as validated for LBM) One laboratory did not return results for Salmonella, all

other laboratories returned the expected result. The ISO 6759 (the EU reference method) was used for the

most part. Overall although performance of laboratories in this single distribution was generally good lower

assessment scores were recorded by some laboratories for these matrix samples, than those returned for

laboratory constructed samples (RT44, see above and Annex VIII). This indicates the importance continuing

to provide matrix based comparative test samples to supplement laboratory EQA for statutory

determinands. A full report of this PT is included as Annex V.

Comparative testing and ring trials for non-statutory determinands

Norovirus and hepatitis A virus comparative tests (RT 39 and RT43)

Two distributions were undertaken in 2011 (April and December) both comprised naturally and artificially

contaminated matrix samples of C. gigas and laboratory constructed lenticule discs. Additionally RT39

included a pilot study on virus determination in freeze dried product (as part of a collaboration with IRMM,

Geel) and RT43 included target DNA sequences at difference concentrations to assist in laboratory

quantitation. Material was distributed to 27 and 26 laboratories, comprising NRLs (n= 15 RT39, n= 14 RT43),

other testing laboratories in MS and third country laboratories. Full reports of performance for both

distributions are included as Annexes V and VII.


Page 18 of 19

In brief, across the two distributions laboratory performance was variable. For qualitative reporting (i.e.

presence / absence) approximately 40%of participants returned the intended results for all test samples.

Accuracy for non matrix samples (reference materials) was greater than that for bivalve matrix, assay

sensitivity was better for hepatitis A virus across all matrix types than for norovirus. Contamination (as

indicated by “false” negative results was generally less than 10% although was notably higher (20%) for one

distribution for Norovirus GII. The CEN method (ISO TS 15216) and its derivatives appeared to perform

better than some laboratory developed procedures. Seventeen (68%) of laboratories returned fully

quantitative data for RT43 compared with 9 (37%) in RT39. Increased application of quantitative methods

was encouraging given their importance in LBM. Uptake was increased through the supply of quantatition

standard curve material by the EURL. Observed variability between quantitative results ranged between 1

log10 and 5log10. Values were influenced by test method, matrix and determinand (in that order). Further

work is required to increase use of standard methods (ISO TS 15216); reference materials developed by the

EU-RL will be a very useful in this respect. U UVibrio parahaemolyticus ring trial (RT38)

A ring trial was carried out to generate data to inform the revision of ISO TS 21872 parts 1 and 2,

laboratories were also able to use the distribution as a comparative test for their own procedures. The

main aim of the ring trial was to test the use of various PCR methods to accuracy detect both total and

potentially pathogenic Vibrio spp. To this end the EU-RL distributed five culture samples and PCR protocols

for detection of total and potentially pathogenic V. parahaemolyticus, V. cholerae and V. vulnificus (as

determined by WHO/FAO as the species of primar food borne importance). Seventeen laboratories

returned classical detection and PCR data. Analysis of results indicated that PCR methods provided higher

levels of accuracy for species and strain assignment than biochemical tests, and enabled determination of

pathogenic strains of V. parahaemolyticus. On the basis of these data primer sets for incorporation into the

revision were recommended. A full report is included as Annex IV.

4. Confirmatory testing

Accreditation to ISO 17025 was retained for the following methods and associated procedures:

Examination of shellfish for Salmonella spp (ISO 6579).

Enumeration of Escherichia coli in bivalve molluscan shellfish (ISO TS 16649-3).

Detection of V. parahaemolyticus in bivalve molluscan shellfish (ISO TS 21872-1).

Determination of norovirus in bivalve molluscan shellfish (ISO TS 15216-1, not yet published).


Page 19 of 19

The EU-RL is accredited by the United Kingdom Accreditation Service (UKAS) schedule number UKAS 2293.

UKAS is a member of the European co-operation for accreditation (EA).

The EU-RL carried out quantitative quality control verification of HAV control plasmids for the Dutch Food

Authority.

5. Development of analytical methods

The EU-RL carried out substantial practical work to develop molecular methods for pathogenic vibrios

through CEN WG6 TC275 TAG3. Real time quantitative PCR methods were further developed and presented

at TAG3 in November. In brief ToxR (total V. parahaemolyticus) and trh1 and 2 (thermostable related

haemolysin positive) primers and probes were designed and used in a direct extraction procedure. It is

anticipated that this approach will ultimately enable quantitation of pathogenic V. parahameolyticus strains

from LBM. Pre-accreditation work was undertaken on the TBX method and on impedance in preparation

for accreditation of both of these approved alternative methods for the enumeration of E. coli in LBM.

The first stage of the work on interpretation of virus PCR results was completed. This was carried out in

conjunction with University of Surrey. EU-RL contribution was through the partial funding of a PhD

studentship. The PhD was awarded by the Faculty of Health and Medical Sciences, University of Surrey in

2011, valuable data were generated to assist in the interpretation of real time PCR results with respect to

human health. The abstract is included as Annex IX. Copies of the PhD thesis are available from the EU-RL

co-ordinator on request.

European Community Reference Laboratory for monitoring bacteriological and viral contamination of bivalve molluscs

CEFAS Laboratory, Weymouth, Dorset, DT4 8UB, UK

Cefas Weymouth Laboratory, Barrack Road, The Nothe, Weymouth, Dorset, DT4 8UB, UK Tel : +44 (0) 1305 206698, Fax : +44 (0) 1305 206601, e-mail : [email protected]

1

WORK PROGRAMME FOR THE EURL FOR BACTERIOLOGICAL AND VIRAL CONTAMINATION OF BIVALVE MOLLUSCS, 2011 LEGAL FUNCTIONS AND DUTIES The functions and duties of the EURL are specified in Article 32 of Regulation (EC) No 882/2004 (Official Journal of the European Communities No L 165 of 30.4.2004). In the 2011 work programme year 27 Member States and 3 candidate countries (Croatia, Turkey and Republic of Macedonia) are considered eligible for EURL assistance and invited to participate in EURL organised training programmes, comparative testing etc. The full integration into the European Union of recent accession Member States continues to be a priority area, and is facilitated via the provision of additional advice, training and assistance. WORK PROGRAMME, 2011 Duration 1. Scientific advice and support

1.1. Assist DG Sanco in functioning and implementation of Community food hygiene legislation, in particular in 2011:

• Consideration of equivalence of US FDA and EU hygiene standards for live bivalve molluscs (LBM).

• Recommendations on harmonisation of standards for class A shellfish and end products in EU hygiene legislation with CODEX standards for LBM.

• Consideration of validation of alternative methods in legislation.

• Considerations of intensive purification for LBM harvested from

class C areas.

And any other activities as required.

50 days

1.2. Participate in relevant EU and International scientific committees (ISO/CEN, WHO/FAO, ICMSS etc). In 2011 the CRL will:

• Chair and co-ordinate the activities of the CEN/TC

275/WG6/TAG4 developing a CEN standard for detection of norovirus and hepatitis A in foodstuffs, including bivalve molluscs.

• Lead and co-ordinate the activities of CEN/TC 275/WG6/TAG3 in

the elaboration of molecular based enumeration methods for pathogenic marine vibrios in bivalve shellfish.

40 days




2

• Lead the revision of the EU reference method for enumeration of

E. coli in LBM for official control (ISO TS 16649-3) to establish the method as a full standard.

• Project leader for the revision of the ISO 6887 series part 3 initial preparation and dilutions for aspects of microbiology associated with LBM.

• Jointly lead the revision of ISO TS 21872-1 and 2 detection of Vibrio spp. in seafood.

• Participate in ISO/TC34/SC9/WG3 working group on validation of

methods (revision of EN ISO 16140).

1.3. Contribute to the joint FAO/WHO expert group on risk assessment

tools for Vibrio parahaemolyticus and V. vulnificus associated with seafood.

1.4. Contribute to EFSA expert working group on foodborne viruses considering control options for viruses in LBM, to include risk based approached, virus standards, improvements in water quality, environmental legislation and improved depuration.

1.5. Assist DG Sanco with specialist assistance in relation to food and

veterinary inspections of Member States, Accession Countries and Third Countries as they arise.

10 days 15 days 10 days

1.6. Co-operate with, and assist DG TAIEX in the provision of training and advice to Accession Counties as required.

4 days

1.7. Undertake EURL missions in support of the above activities.

• During 2011 missions are foreseen in relation to the annual meetings of ISO and CEN (1 mission) the CEN/TAG4 working group on viruses in food (1 mission); CEN/TAG3 working group on vibrios (1 missions); ISO/WG3 working group on validation of methods (2 missions) and up to 6 missions in support of NRLs and DG Sanco activities (items 1.1 and 1.2).

• Mission associated with the joint EU/US FDA workshop on

implementation and approaches to sanitary surveys (item 2.5).

• Mission to JRC/IRMM Geel, Belgium (item 3.4)

Up to a maximum of 30 days Included in above 3 days




3

1.8. Organise an annual review meeting between EURL representatives and designated DG SANCO representative in the area in Brussels or mutually convenient location.

1.9. Participation in relevant international scientific conferences. In 2011 it is foreseen that the EURL will present scientific research at the ICMSS conference in PEI, Canada, Health Related Water Microbiology, New Zealand.

5 days 10 days

2. Co-ordination of activities of NRL network and provision of

technical assistance and training

2.1. Participate in annual EURL Director’s co-ordination meeting and other EURL co-ordination meetings/workshops as appropriate.

5 days

2.2 Organise, host, and participate in the tenth annual EURL workshop, produce resolutions and other workshop outputs (May 2011, EURL Weymouth). To include administrative assistance.

40 days

2.3 Undertake EURL activities and commitments agreed in resolutions at annual workshops (as posted on www.crlcefas.org).

Up to 50 days

2.4 Produce web-based information and guidance on application of sanitary surveys - in accordance with the requirements of 854/2004 on official controls.

2.5 In collaboration with the US FDA organise and participate in the

second joint workshop on implementation and approaches to sanitary surveys in the EU and US.

4 days 15 days

2.6 Supply specialist information and advice on bacteriological and viral methods to NRLs (particularly new MS NRLs and accession countries), Official Control testing laboratories, and third county laboratories. To include assistance on implementation of methods, accreditation to IEC ISO17025, validation of alternative methods according to ISO16140, provision of EURL SOPs and transfer of other technical information.

Up to 6 days

2.7 Provide specialist training and/or training courses to NRLs, accession country NRLs and others in relation to analyses of E.coli, Salmonella spp., Vibrio spp., FRNA bacteriophage, Norovirus, hepatitis A virus and other aspects of bivalve shellfish hygiene as required.

5 days

2.8 Revise the EURL website (www.crlcefas.org) to ensure it is an effective means of dissemination of information to NRLs and other stakeholders.

10 days

http://www.crlcefas.org)/�

http://www.crlcefas.co.uk/�




4

3 Ring trials, comparative testing and quality assurance

3.1 Organise comparative (proficiency) testing for NRLs for E.coli and Salmonella spp. in bivalve molluscs via the EURL/HPA shellfish EQA scheme. Analyse results, produce report, advice and recommendations (by May 2011).

26 days

3.2 Organise norovirus and hepatitis A ring trials, in 2011 for both laboratory constructed and LBM matrix samples for quantitative and qualitative analyses. Analyse results, produce report and recommendations (by May 2011).

70 days

3.3 Undertake Vibrio spp. ring trials to assist in the elaboration of methods enabling detection/enumeration of human pathogenic Vibrio spp. associated with LBM. Analyse results, produce report and recommendations (by May 2011).

Included in item 5.2

3.4 In collaboration with JRC/IRMM Geel continue studies on the production of norovirus reference material using freeze-dried matrix samples.

30 days

4 Confirmatory testing

4.1 Maintenance of EURL laboratory competence and expertise on analytical methods for monitoring virological contaminants of bivalve molluscs (Norovirus and hepatitis A virus).

4.2 Re-accreditation to IEC ISO 17025 of the CEN method for detection of norovirus in bivalve shellfish.

30 days 30 days

4.3 Maintenance of EURL laboratory competence and expertise on analytical methods for monitoring bacteriological contaminants of bivalve molluscs (E.coli, Salmonella spp., FRNA bacteriophage, marine vibrios). To include maintenance of IEC ISO 17025 accreditation of enumeration of E. coli, and the detection of Salmonella spp. and Vibrio parahaemolyticus.

4.4 Contribution to costs of the maintenance of EURL capability to perform analysis for human pathogenic strains of marine vibrios associated with LBM (e.g. serotyping V. parahaemolyticus, molecular characterisation of pathogenic strains of V. parahaemolyticus, V. vulnificus and) non01/0139V. cholerae).

50 days 10 days

4.4 Performance of above tests on outbreak material or on occasion of

disputed test results (on request of DG Sanco).

Included in above




5

5 Development of analytical methods (undertaken at EURL)

5.1 Contribution as the project leader towards the validation of the TAG4 reference method for the detection of viruses in food (CEN/TC 275/WG6/TAG4).

Note. Validation of the TAG4 reference method for viruses in foods, including bivalve shellfish is a priority area. The deadline for a decision on funding of M/381 for full validation is September 30th 2010.

10 days

5.2 Contribution as the project leader towards the elaboration and validation of the TAG3 molecular based standard for the detection of potentially pathogenic vibrios in foodstuff, including bivalve shellfish using molecular methods to include in 2011: • Evaluation of a direct extraction and detection of V.

parahaemolyticus and V. vulnificus in artificially and naturally contaminated samples.

• Performance characterisation of above method to evaluate linearity, limit of detection, limit of quantitation and repeatability.

• Limited comparative testing amongst NRLs with expertise in

testing LBM for Vibrio spp. to examine method reproducibility and inform methodology development.

• Evaluation of PCR targets for inclusion in the revision of ISO

TS 21872- parts 1 and 2 to enable the inclusion of a molecular confirmation step for vibrios of human pathogenic significance.

60 days

Rachel Rangdale EURL Co-ordinator August 2010

Resolutions of the 10th workshop of NRLs for monitoring bacteriological and viral contamination of bivalve molluscs 10-12 May 2011 v1

Resolutions of the 10th

workshop of Microbiological NRLs for Bivalve Molluscs, 10-12th

May 2011

Official controls

1. The workshop considered the EURL recommendations with respect to harmonisation

of Codex Stan (292-2008) and EU hygiene regulations. The adoption of the Codex

3CP (n=5, c=1, m=230, M=700 E. coli MPN/100g) for products placed on the market

was scientifically justified and should be supported.

2. The consequences of the above were considered for harvesting area monitoring in

relation to class A designation. Generally, NRLs supported the adoption of the Codex

criteria for monitoring of class A harvesting areas applied over time where, within a

specified review period, no sample can exceed 700 MPN E. coli/100g and 80% of

samples must be ≤ 230 MPN E. coli/100g.

3. The EURL agreed to conduct modelling to estimate Salmonella spp. compliance and

the correlation between end products and monitoring compliance using the Codex

criteria. To amend the paper (WS10/07) and circulate for comment prior submission to

the Commission.

4. The workshop noted that practices regarding Salmonella spp. monitoring in Class A

areas varied across Member States. The EURL advised NRLs of the Commission

opinion that monitoring for Salmonella spp. in LBM production areas was not foreseen

in the legislation.

5. The NRLs discussed a proposal regarding intensive purification of Class C LBM. The

workshop agreed that, on the basis of data presented, monitoring of all batches for E.

coli post purification would generally secure compliance with the microbiological

criteria for E. coli (Commission Regulation (EC) No. 2073/2005). However, the data

on virus removal did not demonstrate confidence in adequate control of this risk. NRLs

considered that the potential public health risks associated with purification of Class C

LBM were significantly greater than for purification of Class B LBMs.

6. The EURL reported on the continuing negotiations with the US FDA on trade of LBM

and the initial audit of the UK. It was noted that the Good Practice Guide

(http:/www.crlcefas) had been forwarded to the FDA as a reference document.

7. In response to EURL request for information several NRLs reported additional risk

control measures in LBM production areas including: seasonal classifications;

prohibition of harbours; prohibition zones around sewage discharges and management

actions based upon virus monitoring. It was noted that these controls were not

harmonised.

8. The EURL noted the legal requirement for sanitary surveys contained within

Commission Regulation (EC) No. 854/2004 and informed NRLs of the Commission

opinion that this requirement applied to all newly classified LBM harvesting areas

(since 2006) and to any area where the classification had changed (since 2006). NRLs

provided updated information on sanitary survey coverage within their MS. The EURL


agreed to circulate a summary report for comment. The finalised report would be

placed on the website (public domain).

9. The workshop noted the successful validation of both impedance and TBX methods for

E. coli enumeration in LBM. The EURL proposed to discuss formal incorporation of

these alternative methods into EU legislation with the Commission.

10. The EURL noted the responsibilities of NRLs under Article 33 of Commission

Regulation (EC) 882/2004. It was identified that it was the responsibility of Competent

Authorities to designate Official Control laboratories (Article 12, Regulation (EC) No

882/2004).

11. NRLs provided updated information on proficiency testing amongst Official Control

laboratories in their MS. The EURL agreed to circulate a summary report for comment.

NRL Spain agreed to present information on proficiency testing among Spanish

Official Control laboratories at the 11th

workshop.

12. The workshop noted the excellent performance of NRLs in PT for E. coli and

Salmonella spp. Some NRLs requested a reduction in PT frequency. The EURL agreed

that a minimum frequency of 2 distributions per year for satisfactorily performing

laboratories was adequate, and would develop criteria for identifying satisfactory

performance.

13. Several NRLs requested continuation of the whole animal (matrix) distribution to assist

in requirements for ISO 17025 accreditation. The workshop agreed a continuing PT

programme of PT distributions for E. coli and Salmonella spp. comprising EQA (of

which participation in 2 distributions is mandatory) and a whole animal distribution

(optional).

14. The workshop noted that official control laboratories should undertake proficiency

testing using the method of analysis used for official controls.

15. NRLs agreed that in Member States where alternative methods for E. coli enumeration

in LBM were used for official controls, the NRL should be competent in these methods

and should take part in proficiency testing using these methods.

Vibrios

16. The workshop supported the introduction of molecular based identification for V.

vulnificus, V. cholerae and toxigenic/non-toxigenic isolates of V. parahaemolyticus in

order to enable rapid, less ambiguous identifications in the revision of ISO TS 21872-1

and 2. However, the need to retain the option for biochemical characterisation was

noted.

Virus

17. Several NRLs presented data on norovirus from LBM production areas. In several

Member States where studies had been undertaken the relatively high prevalence of

norovirus was noted. It was noted that comparable data for hepatitis A virus was

lacking.


18. The workshop noted the progress of EFSA working groups on food borne viruses and

norovirus in oysters. The EURL agreed to circulate reports on publication and

proposed discussion at the next workshop.

19. The workshop noted the need for standards for NoV and HAV to underpin accurate

quantitation. The EURL agreed to explore possibilities for making these more widely

available.

20. The workshop noted encouraging performance in virus proficiency testing. Further

developments should focus on uptake of fully quantitative methodology and accuracy

of quantitation. The EURL agreed to organise further proficiency testing distributions

using matrix samples.

21. The workshop noted the agreement of EU funding for the validation of virus and

Vibrio methods under mandate M/381. However, the extended nature of the funding

model (78 months) was considered problematical for some laboratories. The EURL

would communicate the terms of the validation studies to enable laboratories to

confirm their ability to participate.

Date and time of next meeting

22. The next workshop would provisionally be held in Ljubljana, Slovenia on 24th

, 25th

and

26th

April 2012.

WS10/04v2

- 1 -

AGENDA

10TH WORKSHOP OF MICROBIOLOGICAL NRLS, 10 - 12 MAY 2011

Venue: Centre for Environment, Fisheries and Aquaculture Science (Cefas) Barrack Road The Nothe Weymouth Dorset UK

Tel: +44 (0) 1305 206600 Fax: +44 (0) 1305 206601 Enquiries: Prior to the workshop enquiries should be directed to Rachel Hartnell or Samantha Arkell: EURL for monitoring bacteriological and viral contamination of bivalve molluscs, Cefas Weymouth Laboratory, Barrack Road, The Nothe, Weymouth, Dorset, DT4 8UB, UK Direct line : +44 (0) 1305 206707 E-mail : [email protected] or [email protected]

1 Day 1 - Tuesday 10 May 9:30 – 18:00

1.1 Welcome, introductions and apologies.

Introductory meeting

1.2 Domestic arrangements including reclaim of expenses (papers WS10/01,

WS10/02).

1.3 Actions arising from the 9th workshop 2010 (paper WS10/03).

1.4 Agreement of the agenda (paper WS10/04).

1.5 EURL work programme 2011 (EURL) (paper WS10/05).

2 2.1 Comparison of bivalve molluscs harvesting area classifications under EC

Regulation 854/2004 across EU Member States finalised version 7 – (paper

WS10/06) – (EURL).

Official Controls – Microbiological monitoring

2.2 Equivalence of Codex and EU E. coli standards recommendations (paper

WS10/07, WS10/7a) (EURL).

mailto:[email protected]�

mailto:[email protected]�

WS10/04v2

- 2 -

2.3 Update on Good Practice Guide – (EURL).

2.4 Intensive purification of Class C bivalve molluscs – (All).

Coffee/tea (11:00 am)

2.5 Equivalence of EU and US legislation for the sanitary production of live bivalve

molluscs for human consumption (paper WS10/08) – (EURL).

2.6 Impact of chronic microbial pollution on shellfish – (EURL).

2.7 Progress with the application of sanitary surveys in the UK (NRL UK).

2.8 Update on the current position with respect to application of sanitary surveys in

EU Member States (paper WS10/09) (EURL) (Update from all NRLs with

production areas).

2.9 Options for active management (EURL) (All).

Lunch (1:00 pm)

2.10 Validation of a rapid plate count method for enumeration of E. coli in bivalve

molluscs. – (paper WS10/10) (NRL The Netherlands).

Official Controls – Microbiological monitoring (cont)

2.11 Checking of impedance calibration using bivalve shellfish from contaminated

harvesting areas – (NRL France).

2.12 Recommendations for adoption of ISO TS 16649-3 as a full ISO standard

(EURL).

3 3.1 Official Controls - Proficiency Testing

3.1.1 NRLs participation and performance assessment in the EURL/HPA

Shellfish EQA scheme for E. coli and Salmonella (RT40) (paper WS10/11)

(EURL).

E. coli and Salmonella spp.

3.1.2 NRLs participation and performance assessment in the whole animal

distribution for E. coli and Salmonella (RT37) (paper WS10/12) (EURL).

Coffee/tea (3:30 pm)

WS10/04v2

- 3 -

3.1.3 Update on performance of Official Control Laboratories performance in

proficiency testing (All).

3.1.4 Performance assessment of French official laboratories in proficiency

testing (NRL France).

3.1.5 An update on the UK NRL approach to proficiency testing (NRL UK).

3.1.6 Analysis of NRL performance in ongoing proficiency testing (EURL).

4 Day 2 - Wednesday 13 May 9:00 - 18:00

4.1 Tracking vibrio infections in a changing environment (EURL).

Vibrio spp.

4.2 Developments at Codex control measures for Vibrio parahaemolyticus and V.

vulnificus in molluscan shellfish (tbc).

4.3 Molecular characterisation of Vibrio parahaemolyticus isolated in Italy (NRL

Italy- Ancona).

4.4 Rapid methods for detecting and enumerating Vibrio spp. in bivalve shellfish

matrices (EURL).

4.5 Activities of the AFNOR working group on Vibrio spp. WG for the revision of the

ISO TS 21872 (title to be confirmed - NRL France).

4.6 Vibrio spp ring trial 2011 - RT38, Rationale and intended results (paper WS10/13)

(EURL).

Coffee/tea (11:30 am)

5 5.1 Evaluation of norovirus GI and GII circulation in shellfish and clinical samples in

Italy (NRL Italy, Rome).

Norovirus and hepatitis A virus

5.2 Quantification of noroviruses in field and outbreak related shellfish samples (NRL

Denmark).

Lunch (1:00 pm)

5.3 Reports on norovirus and hepatitis A virus outbreaks/cases associated with

consumption of bivalve shellfish 2010 (All).

5.4 Progress towards virus controls

5.4.1 Virus risk management in an Irish harvest area (NRL Ireland).

WS10/04v2

- 4 -

5.4.2 EFSA mandates on viruses in foods (EURL).

5.4.3 Quantitative (or qualitative) data on hepatitis A virus in bivalve shellfish

(All).

Coffee/tea (3:30 pm

5.5 Norovirus and hepatitis A virus proficiency testing.

5.5.1 The development and use of reference materials for norovirus and hepatitis

A (paper WS10/14) (EURL).

5.5.2 Proficiency testing for viruses (RT39) –NRL participation and performance

assessment (paper WS10/15) (EURL).

5.5.3 Proficiency testing for viruses (RT39) – methods and quantification

(EURL).

5.6 Update on the progress of CEN validation (M/381) (WS10/16) (EURL).

6 Requirements for EU research, knowledge gaps and future research proposals (EURL).

Day 3 - Thursday 13 May 9:30 - 12:30

7 Agreement of Workshop resolutions.

8 Date and venue for next meeting (tentative).

9 Any other business.

Meeting close

European Union Reference Laboratory (EURL) Proficiency Testing scheme Interlaboratory trial for generation of additional data for the revision of ISO TS 21872 series 2011 EURL ring trial reference number: RT 38 Sample distributions: Swabs 1, 2, 3, 4 and 5

RT 34 Page 1 of 17

Contents Page number Introduction 2 Sample preparation 2 Reference results 2 Participant’s results RT 38 vials 1 to 5 3 – 7 Summary 8 References 8 Appendix 1: Vibrio spp. protocol 9 Appendix 2 - PCR reference result gels 16

Distribution period: April 2011

Report date: 8th

July 2011

Report compiled by: Louise Stockley Craig Baker-Austin

Authorisation by: Rachel Hartnell

RT 34 Page 2 of 17

Introduction ISO TS 21872 part 1. Microbiology of food and animal feeding stuffs- Horizontal method for the detection of potentially enteropathogenic Vibrio spp: Part 1. Detection of Vibrio parahaemolyticus and Vibrio cholerae. ISO TS 21872 part 2. Microbiology of food and animal feeding stuffs- Horizontal method for the detection of potentially enteropathogenic Vibrio spp: Part 2. Detection of species other than Vibrio parahaemolyticus and Vibrio cholerae. Under ISO rules technical specifications require review three years after publication. Accordingly the ISO TS 21872 series are now due for review and revision. At the 2010 plenary meeting of ISO SC9 responsible for ISO standards in food microbiology it was resolved that the EU-RL would take co-responsibility for the revision of this series together with Dr Jean-Philippe Rosec (Service Commun des Laboratoires - Ministry of Economy, Montpellier, France – Email: [email protected]). At this meeting a recommendation was made for the inclusion of PCR based identification tests for Vibrio spp. of major human pathogenic significance into to the revised standards. To assist the validation of these 2 ISO standards data was required to demonstrate the efficacy of PCR identification tests for V. cholerae, V. parahaemolyticus (including strains producing thermostable haemolysin and thermostable related haemolysin) and V. vulnificus. Laboratories were invited to participate in an interlaboratory trial to generate data to support the inclusion of PCR techniques. A method protocol including well established primer sets and specific running conditions were produced to accompany test samples. Samples Sample preparation Samples distributed consisted of 10 swabs containing semi-solid marine agar inoculated with known Vibrio spp. strain obtained from the National Collection of Type Cultures and Cefas vibrio strain bank (Table 1). Samples were packaged according to IATA regulations and distributed with a method protocol, preparation instructions and report form. Twenty-three laboratories participated in the distribution. All participants were requested to examine the samples using the protocol provided. Table 1: Source of Vibrio spp. strains

Swab Vibrio species Strain identification

ToxR tdh trh prVC VVH

RT 38 - S1 V. vulnificus NCTC 11067 - - - - + RT 38 - S2 V. parahaemolyticus EURL V05/14 + + + - - RT 38 - S3 V. cholerae NCTC 8042 - - - + - RT 38 - S4 V. mimicus NCTC 11435 - - - - - RT 38 - S5 V. fluvialis NCTC 11327 - - - - -

Results Reference results Reference analyses were performed on 6 replicates of each sample distributed to determine the species type and the presence of tdh and trh pathogenic markers were determined using Cefas standard PCR procedures. The reference results are summarised in Appendix 2 Figures 1 - 7.

RT 34 Page 3 of 17

Swab 1 Contents – V. vulnificus (NCTC 11067) Table 2. Participants’ results for swab 1

Lab ID No.

37°C 41.5°C PCR Primers

BIO PCR BIO PCR ToxR R1 / R2

tdh VP21 / VP22

L-tdh / R-tdh

L-trh / R-trh

trh S1 / S2

prVC-F / prVCM-R

VVHF / VVHR

7 VV a VV VV VV - - - - - - + 10 VV a VV VV VV - - - - - - + 17 VV a VV NT VV - - - - - - + 19 VV a VV + 22 VV a VV 27 VV a VV VV VV - NT NT NT NT - + 32 a - - VV VV - - - - - - + 33 VV a VV VV VV - NT NT NT NT - + 35 VV a VV VV VV - - - - - - + 36 VV a VV - - - - - 41 VV a VV VV VV - - - - - - + 42 VV a VV VV VV - - - - - - + 44 VV a NG - - - - - - - 67 VV VV VV VV - NT NT NT NT - + 68 VV a VV VV VV - NT NT NT NT - + 76 V ND VV 98 VV VV 123 V ND VV 124 VV VV 137 VV VV VV VV - - - - ~280 BP - + 147 VV a VV VV VV - NT NT NT NT - + 167 NG NG VV VV - NR - - NR - + 184 VV VV VV VV - - - - - - +

a

– Designated NRL, BIO – Biochemical identification, PCR – Polymerase chain reaction identification, VV – V. vulnificus, NG – No growth, NT – Not tested, V ND – Vibrio not detected, NR – Not recorded, Red denotes incorrect result

Table 3. Performance summary for swab 1

Biochemical testing

37°C +ve 37°C -ve 41.5°C +ve 41.5°C -ve

PCR

37°C +ve 14 0 12 1 * 37°C -ve 0 2 * 2 * 0

41.5°C +ve 13 2 * 14 1 * 41.5°C -ve 0 0 0 0 Not tested 5 4 * 6 1 *

* Includes results reported as not tested, no growth and Vibrio not detected.

Discussion – Swab 1 Using biochemical testing for identification 19 laboratories (83%) reported the presence of V. vulnificus at 37°C and 20 (87%) reported V. vulnificus presence at 41.5°C. Fifteen laboratories reported PCR results with all correctly identifying the presence of V. vulnificus using the specified primer set. Laboratory 137 reported a non-specific band at 280 base pairs using S1/S2 primer set. Sixteen laboratories (94%) using PCR for identification reported the presence of V. vulnificus using the VVH primer set.

RT 34 Page 4 of 17

Swab 2 Contents – V. parahaemolyticus tdh and trh positive (EURL V05/14) Table 4. Participants’ results for swab 2

Lab ID No.



tdh VP21 / VP22

L-tdh / R-tdh

L-trh / R-trh

trh S1 / S2

prVC-F / prVCM-R

VVHF / VVHR

7 VP a VP VP VP + - + + + - - 10 VP a VP VP VP + - + + - - - 17 VP a VP NT VP + - + + - - - 19 a VM VP 22 VP a VP 27 VP a VP VP VP + - + + + - - 32 VP a VP VP VP + - + + + - - 33 VP a VP VP VP + - + + + - - 35 VP a VP VP VP + - + + + - - 36 VP a VP VP + + + + + 41 VP a VP VP VP + - + + + - - 42 VP a VP VP VP + - + - - - - 44 VP a VP VP VP - - + - - - -

67 NR ID VP NR

ID VP + - + + + - -

68 VP a VP VP VP + - + + + - - 76 VM VM 98 VP VP 123 VP VP 124 VP VP 137 VP VP VP VP + - + + + - - 147 VP a VP VP VP + - + + + NT -

167 VV or VM VP VV or

VM VP + NR + + NR - -

184 VP VP VP VP + - + + + - - a

VM – V. mimicus, VV – V. vulnificus, NT – Not tested, NR ID – Not reliable ID, Red denotes incorrect result – Designated NRL, BIO – Biochemical identification, PCR – Polymerase chain reaction identification, VP – V. parahaemolyticus,

Table 5. Performance summary for swab 2

Biochemical testing

37°C +ve 37°C -ve 41.5°C +ve 41.5°C -ve

PCR

37°C +ve 15 3 14 3 * 37°C -ve 0 0 0 0

41.5°C +ve 14 2 13 3 * 41.5°C -ve 0 0 0 0 Not tested 4 1 5 1

* Includes results reported as not tested and no reliable ID. Discussion – Swab 2 Nineteen (83%) laboratories reported the presence of V. parahaemolyticus at both 37°C and/or 41.5°C using biochemical identification. Three laboratories incorrectly reported the presence of V. mimicus and/or V. vulnificus in this sample. From the 17 laboratories reporting results for PCR, 16 laboratories reported the presence of ToxR and identified the presence of V. parahaemolyticus. For the detection of the tdh pathogenic marker only Lab 36 reported the presence of tdh using VP21/VP22 primer set whilst all 17 laboratories performing PCR using L-tdh/R-tdh primer set detected the tdh pathogenic marker. For the detection of the trh pathogenic marker 12 laboratories (71%) detected the presence of trh using the S1/S2 primer set whilst 15 laboratories (88%) detected the presence of trh using the L-trh/R-trh primer set.

RT 34 Page 5 of 17

Swab 3 Contents – V. cholerae (NCTC 8042) Table 6. Participants’ results for swab 3

Lab ID No.



tdh VP21 / VP22

L-tdh / R-tdh

L-trh / R-trh

trh S1 / S2

prVC-F / prVCM-R

VVHF / VVHR

7 VC a VC VC VC - - - - - + - 10 VC a VC NG NG - - - - - + - 17 VC a VC NT VC - - - - - + - 19 VC a VC 22 VC a VC 27 VC a VC VC VC - NT NT NT NT + - 32 VC a VC VC VC - - - - - + - 33 VC a VC VC VC - NT NT NT NT + - 35 VC a VC VC VC - - - - - + - 36 a VA VA - - - - - 41 VC a VC NG NG - - - - - + - 42 VC a VC NG NG - - - - - + - 44 VC a VC - - - - - - - 67 VA VC VA VC - NT NT NT NT + - 68 a NG NG VC VC - NT NT NT NT + - 76 VA VA 98 VC VC 123 V ND V ND 124 VC VC 137 VC VC VC VC - - - - - + - 147 a ABS ABS VC VC - NT NT NT NT + -

167 AH or VA VC NG NG - NR - - NR + -

184 VC VC VC VC - - - - - + - a

AH - Aeromonas hydrophilia, NT – Not tested, NG – No growth, V ND – Vibrio spp. not detected, ABS – Absence, Red denotes incorrect result – Designated NRL, BIO – Biochemical identification, PCR – Polymerase chain reaction identification, VC – V. cholerae, VA – V. alginolyticus,

Table 7: Performance summary for swab 3

Biochemical testing

37°C +ve 37°C -ve 41.5°C +ve 41.5°C -ve

PCR

37°C +ve 12 2 7 6 * 37°C -ve 0 2 * 2 * 0

41.5°C +ve 8 3 * 9 2 * 41.5°C -ve 3 * 1 * 0 4 * Not tested 4 3 * 4 3 *

* Includes results reported as Vibrio spp. not detected, not tested, No growth and absence.

Discussion – Swab 3 Sixteen laboratories reported the presence of V. chloerae at 37°C and 13 laboratories reported at 41.5°C using biochemical identification. Four laboratories incorrectly reported the presence of V. alginolyticus and/or Aeromonas hydrophilia in this sample. Of the 16 laboratories reporting results for PCR, 15 laboratories (94%) reported the presence of V. chloerae using prVC-F/prVCM-R primer set and only 1 laboratory did not detect the presence of V. cholerae using this primer set.

RT 34 Page 6 of 17

Swab 4 Contents – V. mimicus (NCTC 11435) Table 8. Participants’ results for swab 4

Lab ID No.



tdh VP21 / VP22

L-tdh / R-tdh

L-trh / R-trh

trh S1 / S2

prVC-F / prVCM-R

VVHF / VVHR

7 VM a - VM - - - - - - - - 10 VM a - VM - - - - - - - - 17 VM a - NT - - - - - - - 19 VM a 22 a VV VV 27 VM a b VM VM VM - NT NT NT NT - - 32 VM a - VM - - - - - - - - 33 VM a - VM - - NT NT NT NT - - 35 VM a - NG - - - - - - - - 36 VM a VM - - - - - 41 VM a ND VM ND - - - - - - - 42 a NG NG VM - - - - - - - - 44 VM a VM - - - - - - -

67 NR ID - NR

ID - - - - - - - -

68 VM a - VM - - NT NT NT NT - - 76 VM VM 98 ND ND 123 VM VM 124 VV VV 137 VM ND VM ND - - - - - - - 147 V SP a V SP V SP V SP - NT NT NT NT - -

167 VV or VM

-

VV, VM or VC

- - NR - - NR - -

184 VM - VM - - - - - - - - a – Designated NRL, b

NR ID - No reliable ID, V SP – Vibrio spp. Red denotes incorrect result.

- V. mimicus detected using specific PCR primers, BIO – Biochemical identification, PCR – Polymerase chain reaction identification, VM – V. mimicus, VV – V. vulinificus, VC – V. cholerae, NR – Not recorded, NG – No growth, NT – Not tested, ND – Not detected,


Biochemical testing

37°C +ve 37°C -ve

Biochemical testing

41.5°C +ve 14 1 41.5°C -ve 2 * 5 *

* Includes results reported as not tested, no growth, not detected and No reliable ID. Discussion – Swab 4 Sixteen laboratories reported the presence of V. mimicus at 37°C and 14 laboratories reported at 41.5°C using biochemical identification. Three laboratories incorrectly reported the presence of V. vulnificus and/or V. cholerae in this sample. Of the 17 laboratories reporting results for PCR, all laboratories did not report positive results when using the various primer sets. Laboratory 27 reported the presence of V. mimicus using PCR primer set VMsodB (Tarr et al., 2007).

RT 34 Page 7 of 17

Swab 5

Contents – V. fluvialis (NCTC 11327) Table 10. Participants’ results for swab 5

Lab ID No.



tdh VP21 / VP22

L-tdh / R-tdh

L-trh / R-trh

trh S1 / S2

prVC-F / prVCM-R

VVHF / VVHR

7 VF a - VF - - - - - - - - 10 VF a - VF - - - - - - - - 17 VF a - NT NT - - - - - - -

19 VF or Aero spp.

a

22 VF a VF 27 VF a V SP VF V SP - NT NT NT NT - - 32 a VM - VF - - - - - - - - 33 VF a - VF - - NT NT NT NT - - 35 VF a - VF - - - - - - - - 36 a AH AH - - - - - 41 VF a ND VF ND - - - - - - - 42 VF a - VF - - - - - - - - 44 VF a VF - - - - - - - 67 AH - AH - - - - - - - - 68 VF a - VF - - NT NT NT NT - - 76 VF VF 98 VF VF 123 VF VF

124 VP ND VC ND VV ND

VP ND VC ND VV ND

137 AH/C/S ND AH/C/S//VF ND - - - - - - -

147 V SP a V SP V SP V SP - NT NT NT NT - - 167 AH - AH - - NR - - NR - - 184 - - - - - - - - - - -

a

– Designated NRL, BIO – Biochemical identification, PCR – Polymerase chain reaction identification, VF – V. fluvialis, AH/C/S – Aeromonas hydrophila/caviae/sobria 1, VM - V. mimicus, VV – V. vulinificus, VC – V. cholerae, VP – V. parahaemolyticus, NR – Not recorded, NT – Not tested, ND – Not determined, V SP – Vibrio spp. Red denotes incorrect result.


Biochemical testing

37°C +ve 37°C -ve

Biochemical testing

41.5°C +ve 15 1 41.5°C -ve 1 * 4 *

* Includes results reported as not tested and Aeromonas hydrophila/caviae/sobria. Discussion – Swab 5 Fifteen laboratories (65%) reported the presence of V. vulnificus at 37°C and/or 41.5°C using biochemical identification. Four laboratories incorrectly reported the presence of Aeromonas hydrophila in this sample. Of the 17 laboratories reporting results for PCR, all laboratories did not report positive results when using the various primer sets

RT 34 Page 8 of 17

Summary Eleven laboratories (48%) correctly reported the presence of each Vibrio spp. using both biochemical tests and species specific PCR primers for V. vulnificus, V. parahaemolyticus and V. cholerae. When comparing correct results reported for biochemical tests and PCR 12 laboratories (52%) reported correct results for each swab in comparison to 17 laboratories reporting correct identification using PCR analysis. Of the 17 laboratories reporting PCR results, 10 laboratories performed PCR analysis as described in the protocol. The primer sets used for the detection of V. vulnificus and V. cholerae with 80% of laboratories identifying the presence of both Vibrio spp.. Results reported for detecting V. parahaemolyticus ToxR gene were good with 90% of laboratories reporting its presence. When assessing the performance of the primer sets for detecting the presence of the pathogenic markers of V. parahaemolyticus 1 laboratory detected tdh using VP21/22 primers in comparison to 100% using the L-tdh/R-tdh primers. For trh detection 12 laboratories detected the presence of trh using S1/2 primers in comparison to 15 laboratories using L-trh/R-trh primers.

From this interlaboratory trial PCR appeared to be more accurate than biochemical tests for species identification purposes. We recommend PCR testing for vibrio identification purposes but do not preclude the use of biochemical testing in this context. We also recommend the following PCR assays for vibrio strain and phenotype detection: ToxR for V. parahaemolyticus strain identification, trh and tdh primers (Bej et al. 1999) for the detection of pathogenicity markers in V. parahaemolyticus; VVH for V. vulnificus strain identification and prVC for V. cholerae identification. References Bej,A.K.; Patterson,D.P.; Brasher,C.W.; Vickery,M.C.L.; Jones,D.D.; Kaysner,C.A., 1999. Detection of total and hemolysin-producing Vibrio parahaemolyticus in shellfish using multiplex PCR amplification of tl, tdh and trh. Journal of Microbiological Methods 36, 215 – 225. Chun,J.; Huq,A.; Colwell,R.R., 1999. Analysis of 16S-23S rRNA intergenic spacer regions of Vibrio cholerae and Vibrio mimicus. Applied & Environmental Microbiology 65, 2202 – 2208. Hill,W.E.; Keasler,S.P.; Trucksess,M.W.; Feng,P.; Kaysner,C.A.; Lampel,K.A., 1991. Polymerase chain reaction identification of vibrio vulnificus in artificially contaminated oysters. Applied & Environmental Microbiology 57, 707 – 711. Kim,Y.B.; Okuda,J.; Matsumoto,C.; Takahashi,N.; Hashimoto,S.; Nishibuchi,M., 1999. Identification of Vibrio parahaemolyticus strains at the species level by PCR targeted to the toxr gene. Journal of Clinical Microbiology 37, 1173 - 1177. Lee,C.Y.; Pan,S.F., 1993. Rapid and specific detection of the TDH gene in Vibrio parahaemolyticus by the polymerase chain reaction. Journal of General Microbiology 139, 3225 – 3231. Suthienkul,O.; Ishibashi,M.; Iida,T.; Nettip,N.; Supavej,S.; Eampokalap,B.; Makino,M.; Honda,T., 1995. Urease production correlates with possession of the trh gene in Vibrio parahaemolyticus strains isolated in Thailand. Journal of infectious diseases 172, 1405 – 1408. Tarr,C.L.; Patel,J.S.; Puhr,N.D.; Sowera,E.G.; Bopp,C.A.; Strockbine,N.A., 2007. Identification of Vibrio Isolates by a multiplex PCR assay and rpoB sequence determination. Journal of Clinical Microbiology 45, 134 – 140.

RT 34 Page 9 of 17

Appendix 1: Vibrio spp. protocol ISO/TS 21872-1 and 2 Microbiology of food and animal feeding stuffs – Horizontal method for the detection of potentially enteropathogenic Vibrio spp. - Part 1: Detection of Vibrio parahaemolyticus and Vibrio cholerae Microbiology of food and animal feeding stuffs – Horizontal method for the detection of potentially enteropathogenic Vibrio spp. - Part 2: Detection of species other than Vibrio parahaemolyticus and Vibrio cholerae Note: For composition and preparation of media and reagents see Annex B of ISO/TS 21872-1 and 2. Note: This protocol should be read in conjunction with ISO/TS 21872-1 and 2. 1.

Sample preparation and first selective enrichment

1.1. Pre-warm ten 225±5ml volumes of sterile Alkaline Salt Peptone Water (ASPW) to 37±1˚C.

1.2. Remove the swab from the sample tube and place in the pre-warmed ASPW. Snap the stick to release the swab into the ASPW. Use a separate ASPW volume for each swab sample.

1.3. Incubate one replicate of each of the swab samples (S1 – S5) at 41.5±1̊ C (for part 1 of ISO/TS 21872) and the

other replicate swab sample at 37±1˚C (for part 2 of ISO/TS 21872) for 6±1 hours

2.

Second selective enrichment

2.1. Following incubation transfer 1ml from just below the surface of the ASPW without mixing and add to 10±0.5ml of fresh ASPW (pre-warmed to 37±1°C).

2.2. Incubate at 41.5±1˚C for 18±1 hours (part 1 of ISO/TS 21872) or 37±1˚C for 18±1 hours (part 2 of ISO/TS 21872),

according to the incubation conditions of the primary enrichment. 3.

Isolation and identification

3.1. Following incubation of the first (after 6±1 hours) and second enrichment (after a further 18±1 hours), streak each sample onto the surface of a TCBS plate and a second medium of the laboratories own choice (e.g. Chromogenic media) using a sterile 1μl inoculating loop spreading for single colonies.

3.2. Incubate TCBS at 37±1˚C for 24±3 hours and the second media following the manufacturer’s instructions.

3.3. Following incubation examine the plates for the presence of typical colonies of presumptive Vibrio spp. Record the results.

4.

Confirmation

4.1. From each selective medium select two

colonies and spread for single colonies onto individual saline nutrient agar (SNA) plate or equivalent. Label the plates accordingly.

4.2. Incubate at 37±1˚C for 24±3 hours. 5.

Test for presumptive identification

5.1. After incubation examine each plate for purity. Carry out the following tests on each SNA plate prepared in section 4.

5.1.1. PCR

5.1.1.1. Prepare a bacterial suspension by taking a single colony from the plate using a 1µl sterile inoculating loop and inoculate 500µl molecular grade water (MQ) in a suitable tube and mix briefly.

RT 34 Page 10 of 17

5.1.1.2. Heat at 95±1˚C for 5±1 minutes and then centrifuge for a few seconds. 5.1.1.3. Remove the supernatant for PCR analysis. Store boiled cell homogenate until required at <-15°C. 5.1.1.4. Prepare master mix using selected primers as shown in Annex 1 adjusting volumes depending on

the required number of reactions.

5.1.1.5. Place 2.5µl of extracted DNA to a clearly labelled tube and add 47.5µl of master mix. 5.1.1.6. Load PCR tubes into the thermocycler and set the appropriate running conditions depending on the

primer set used. Thermocycler running conditions should be carried out in simplex reactions using the corresponding running conditions highlighted below:

Cycles

V. parahaemolyticus (S trh)

Cycles

V. vulnificus (vvh) and V. parahaemolyticus (Tox-R)

Temp (°C)

Time (mins) Temp (°C)

Time (mins)

1 94 2 1 96 5

40

94 1 20

94 1

48 1 63 1.5

72 1 72 1.5

1 72 5 1 72 7

5.1.1.7. Once the thermocycler programme has finished remove the tubes and store at 4±2°C until required. 5.1.1.8. Prepare a 2% agarose gel by mixing 2g of agarose with 100ml of 1X TAE buffer. Allow to cool before

adding a few drops of Ethidium bromide. 5.1.1.9. Place an appropriate sized gel comb to the mould before pouring the gel and allow to set before

removing the comb.

5.1.1.10. Place an appropriate sized gel comb to the mould before pouring the gel and allow to set before removing the comb.

5.1.1.11. Load the gel with 10µl of 100bp DNA ladder and the following wells with 20µl of PCR product

prepared previously.

5.1.1.12. Run the gel at 130 volts for 25 – 30 minutes.

5.1.1.13. Following electrophoresis visualise the gel using an ultra violet transluminator. The table below

Cycles

V. cholerae (prVC)

V. parahaemolyticus (tdh and trh)

Cycles

V. parahaemolyticus (VP tdh)

Temp (°C)

Time (mins)

Temp (°C)

Time (mins)

Temp (°C)

Time (mins)

1 94 2 94 3 1 94 3

30

94 1 94 1 25

94 1

50 1 58 1 55 1

72 1.5 72 1 72 1

1 72 10 72 5 1 72 10

RT 34 Page 11 of 17

shows the expected band size. Record the results.

PCR assay Product size (bp)

ToxR 368

tdh 269

tdh - VP21 & VP22 400

trh - S1 & S2 460

trh 500

prVC 295 - 310

vvh 519

5.1.2. Oxidase test

5.1.2.1. Perform an oxidase test by streaking a single colony onto the surface of a filter paper moistened with oxidase reagent.

5.1.2.2. Record the results.

Positive reaction Mauve, violet, purple colour (oxidase positive) Negative reaction No colour change (oxidase negative)

Note: Oxidase stripes are available. Please follow manufacture’s instructions.

5.1.3. Microscopic examination – Gram stain

5.1.3.1. Perform a Gram stain on each plate and examine the slide. 5.1.3.2. Record the observations.

5.1.4. Microscopic examination – Motility

5.1.4.1. Inoculate 10±0.5ml of ASPW using a sterile 1µl inoculating loop and incubate at 37±1˚C for 1 -6 hours.

5.1.4.2. After incubation transfer a drop of ASPW suspension onto a slide and cover with a coverslip. 5.1.4.3. Examine the slide for motility and record the results.

5.1.5. Biochemical tests

Biochemical identification kits can be used as mentioned in ISO/TS 21872- 1 and 2

5.1.5.1. Saline TSI agar

5.1.5.1.1. Inoculate by stabbing the main body of the TSI (the butt) and streak the surface (slant) and incubate at 37±1˚C for 24±3 hours.

5.1.5.1.2. Examine the tubes and record the results as follows:

RT 34 Page 12 of 17

5.1.5.2. Detection of Ornithine decarboxlase saline medium, L-lysine decarboxylase saline medium and Arginine dihydrolase saline medium

5.1.5.2.1. Inoculate each liquid medium just below the surface using a 1µl inoculating loop. 5.1.5.2.2. Add approximately 1ml of sterile mineral oil to the top of the medium and incubate at 37±1˚C

for 24±3 hours.

5.1.5.2.3. Examine each medium and record the results as follows:

Positive reaction Turbid and violet colouration

Negative reaction Yellow colouration

5.1.5.3. Detection of β-galactosidase

5.1.5.3.1. Inoculate using a 1µl inoculating loop 0.25ml of saline solution in a tube. 5.1.5.3.2. Add 1 drop of Toluene and shake to mix. 5.1.5.3.3. Place the tube in a waterbath set at 37±1̊ C for approximately 5 minutes. 5.1.5.3.4. Add 0.25ml of β-galactosidase reagent to each tube and invert to mix. 5.1.5.3.5. Incubate at 37±1˚C for 24±3 hours. 5.1.5.3.6. Examine the tubes and record the results as follows:

Positive reaction Yellow colouration

Negative reaction No colour change

Note: Ready-to-use ONPG discs are available. Please follow manufacture’s instructions

5.1.5.4. Detection of iodine

5.1.5.4.1. Inoculate using a 1µl inoculating loop a tube containing 5ml of tryptone-tryptophan saline medium.

5.1.5.4.2. Incubate at 37±1˚C for 24±3 hours. 5.1.5.4.3. Following incubation, add 1ml of Kovacs reagent. 5.1.5.4.4. Examine the tubes immediately and record the results:

Description Agar medium butt Agar medium slant

Yellow Positive glucose Positive lactose and/or sucrose

Red / unchanged Negative glucose Negative lactose and/or sucrose

Black Formation of hydrogen sulphide -

Bubbles / cracks Formation of gas from the glucose -

RT 34 Page 13 of 17

Positive reaction Formation of a red ring

Negative reaction Formation of a yellow-brown ring

5.1.5.5. Halotolerance test

5.1.5.5.1. Prepare a bacterial suspension and inoculate using a 1μl inoculating loop a series of peptone

waters with increased salt (NaCl) concentration: 0%, 2%, 4%, 6%, 8% and 10%.

5.1.5.5.2. Incubate at 37±1˚C for 24±3 hours.

5.1.5.5.3. Examine the tubes for turbidity to demonstrate growth at known concentrations of NaCl and record the results.

6 Interpretation of biochemical results

Tests V.cholerae V.mimicus V.parahaemolyticus V.vulnificus V.fluvialis

Oxidase + + + + +

Production of gas (glucose) - - - - -

Lactose - - - + -

Sucrose + - - - +

ODC + + + + -

LDC + + + + -

ADH - - - - +

ONPG hydrolysis + + - + +

Production of Iodine + + + + d

Growth in 0% NaCl + + - - -

Growth in 2% NaCl + + + + +

Growth in 6% NaCl - - + + +

Growth in 8% NaCl - - + - -

Growth in 10% NaCl - - - - - d: variable result 7 Expression of results Record the results of the biochemical and PCR test on the form.

RT 34 Page 14 of 17

Annex 1 PCR Master mix

*dNTPs – (20mM) (1µl water +4ul 25mM dNTPs) ** Primer sets are given in the table below. Primer sets Primer concentration = 100µM Vibrio spp. Name Primer

V. parahaemolyticus R1 GTCTTCTGACGCAATCGTTG

- Vp-toxR R2 ATACGAGTGGTTGCTGTCATG V. parahaemolyticus L-tdh GTAAAGGTCTCTGACTTTTGGAC

- tdh R-tdh TGGAATAGAACCTTCATCTTCACC

V. parahaemolyticus VP21 TGGTTGACATCCTACATGACTGTG - tdh VP22 GGGGATCCCTCAGTACAAAGCCTT

V. parahaemolyticus L-trh TTGGCTTCGATATTTTCAGTATCT - trh R-trh CATAACAAACATATGCCCATTTCCG

V. parahaemolyticus S1 CTCTACTTTGCTTTCAGT - trh S2 AATATTCTGGAGTTTCAT

V. cholerae prVC-F TTAAGCSTTTTCRCTGAGAATG

prVCM-R AGTCACTTAACCATACAACCCG

V. vulnificus VVHF CCGGCGGTACAGGTTGGCGC

VVHR CGCCACCCACTTTCGGGCC

X 1 reaction Volume (µl)

Reaction buffer 10 MgCl2 5 dNTPs* 0.625 Forward primer** 0.5 Reverse primer** 0.5 Mq water 30.625 Taq polymerase 0.25 DNA (sample) 2.5

RT 34 Page 15 of 17

Flow diagram of procedure

Incubation for 6 h ± 1h at 41.5°C ± 1°C

Take 1ml just below the surface without mixing and add to 10±0.5ml of ASPW.

Subculture onto 1 plate of TCBS and 1 plate chosen by the laboratory. Spread

for single colonies. Incubate TCBS plate at 37±1˚C for 24±3 hours and the

laboratories media of choice as specified by the manufacturer.

Pre-warm 10 x 225±5ml of ASPW and add one duplicate swab to each volume. Clearly label with the sample letter A - E. For each letter incubate one at 41.5±1˚C and the other at 37±1˚C for 6±1 hours. These are primary enrichments, part 1 and 2 respectively

Incubation for 6 h ± 1h at 37°C ± 1°C




Take 1ml just below the surface without mixing and add to

10±0.5ml of ASPW.

Subculture onto 1 plate of TCBS and 1 plate chosen by the laboratory. Spread for single colonies. Incubate TCBS plate at 37±1˚C for

24±3 hours and the laboratories media of choice as specified by the manufacturer.




Incubation for 18h ± 3 h at 41.5°C ± 1°C

Incubation for 18h ± 3 h at 37°C ± 1°C

After incubation examine the plates for typical colonies of Vibrio spp. Select 2 colonies from each media type and subculture onto individual saline nutrient agar (SNA) plates or equivalent. Incubate at 37±1̊ C for 24±3 hours.

After incubation check SNA plates for purity. Carry out an oxidase test on each plate. Reject all oxidase negative colonies. Carry out biochemical tests and PCR on all oxidase positive colonies.

Record all results obtained from each test on the form.

RT 34 Page 16 of 17

Appendix 2: PCR reference results gels Figure 1: ToxR primer set (Kim et al, 1999)

Figure 2: tdh primer set (Bej et al, 1999)

Figure 3: tdh primer set (Lee and Pan, 1993)

100bp VP VP VP VP VP VP VC VC VC VV VV VV VF VF VF VM VM VM ToxR Ladder 1 2 3 4 5 6 1 2 3 1 2 3 1 2 3 1 2 3 Control

100bp VP VP VP VP VP VP VC VC VC VV VV VV VF VF VF VM VM VM tdh Ladder 1 2 3 4 5 6 1 2 3 1 2 3 1 2 3 1 2 3 Control

100bp VP VP VP VP VP VP VC VC VC VV VV VV VF VF VF VM VM VM VP21tdh Ladder 1 2 3 4 5 6 1 2 3 1 2 3 1 2 3 1 2 3 Control

RT 34 Page 17 of 17

Figure 4: trh primer set (Bej et al, 1999)

Figure 5: trh primer set (Suthienkul et al, 1995)

Figure 6: VC primer set (Chun et al, 1999)

Figure 7 : VVh primer set (Hill et al, 1991)

100bp VV VV VV VV VV VV VC VC VC VP VP VP VF VF VF VM VM VM VVH Ladder 1 2 3 4 5 6 1 2 3 1 2 3 1 2 3 1 2 3 Control

100bp VC VC VC VC VC VC VP VP VP VV VV VV VF VF VF VM VM VM VC Ladder 1 2 3 4 5 6 1 2 3 1 2 3 1 2 3 1 2 3 Control

100bp VP VP VP VP VP VP VC VC VC VV VV VV VF VF VF VM VM VM S1 trh Ladder 1 2 3 4 5 6 1 2 3 1 2 3 1 2 3 1 2 3 Control

100bp VP VP VP VP VP VP VC VC VC VV VV VV VF VF VF VM VM VM trh Ladder 1 2 3 4 5 6 1 2 3 1 2 3 1 2 3 1 2 3 Control

Head officeCentre for Environment, Fisheries & Aquaculture SciencePakefield Road, Lowestoft, Suffolk NR33 0HT UK

Tel +44 (0) 1502 56 2244Fax +44 (0) 1502 51 3865 Web www.cefas.co.uk

About usCefas is a multi-disciplinary scientific research and consultancy centre providing a comprehensive range of services in fisheries management, environmental monitoring and assessment, and aquaculture to a large number of clients worldwide.

We have more than 500 staff based in 2 laboratories, our own ocean-going research vessel, and over 100 years of fisheries experience.

We have a long and successful track record in delivering high-quality services to clients in a confidential and impartial manner. (www.cefas.co.uk)

Cefas Technology Limited (CTL) is a wholly owned subsidiary of Cefas specialising in the application of Cefas technology to specific customer needs in a cost-effective and focussed manner.

CTL systems and services are developed by teams that are experienced in fisheries, environmental management and aquaculture, and in working closely with clients to ensure that their needs are fully met. (www.cefastechnology.co.uk)

Customer focusWith our unique facilities and our breadth of expertise in environmental and fisheries management, we can rapidly put together a multi-disciplinary team of experienced specialists, fully supported by our comprehensive in-house resources.

Our existing customers are drawn from a broad spectrum with wide ranging interests. Clients include:

• international and UK government departments

• the European Commission

• the World Bank

• Food and Agriculture Organisation of the United Nations (FAO)

• oil, water, chemical, pharmaceutical, agro-chemical, aggregate and marine industries

• non-governmental and environmental organisations

• regulators and enforcement agencies

• local authorities and other public bodies

We also work successfully in partnership with other organisations, operate in international consortia and have several joint ventures commercialising our intellectual property.

printed on paper made from a minimum 75% de-inked post-consumer waste

© Crown copyright 2010

Centre for Environment, Fisheries & Aquaculture ScienceWeymouth Laboratory, Barrack Road, The Nothe, Weymouth, Dorset DT4 8UB

Tel +44 (0) 1305 206600Fax +44 (0) 1305 206601

C3677.indd 2 13/01/2010 08:59:11

European Union Reference Laboratory

(EURL)

Proficiency Testing scheme

Norovirus and hepatitis A virus ring trial 2011

EURL ring trial reference number: RT39

Sample distributions: Samples 1 and 2, Freeze dried 1, Lenticules 1, 2, 3 and 4.

RT33 Page 1 of 16

Contents Page number Sample preparation 2 Results 3 Conclusion and discussion 6 References 7 Appendices 8

Distribution date: April 2011

Report date: 7th

July 2011

Report compiled by: Louise Stockley James Lowther


RT33 Page 2 of 16

Sample preparation Material dispatched comprised of naturally contaminated and bio-accumulated Pacific oysters (Crassostrea gigas) (Samples 1 and 2), laboratory constructed Lenticules (vials 1 - 4) and a glass vial containing freeze-dried digestive glands from naturally contaminated Pacific oysters. The reference results for each sample are included as Appendix I. Sample 1 A batch of approximately 500 Pacific oysters (Crassostrea gigas) were placed in trays and re-immersed in 500 litres of re-circulating natural seawater at 16±1°C and 36.5ppt. The shellfish were left for 30 hours to acclimatise before HAV cell culture supernatant (see table 1) was added to the tank. After approximately 17 hours the shellfish were removed from the tank and rinsed in fresh water. Immediately the oysters were randomly sorted into samples of 10 animals and sealed in plastic bags. Bags were held at <-15ºC until required for quality control testing, dispatch or reference analysis. Sample 2 Sample 2 comprised shucked, frozen Pacific oysters (Crassostrea gigas), originating from Korea, that had been involved in a norovirus outbreak that occurred in New Zealand on the 17th

June 2006 with a total of 115 cases being identified. Prior testing of the sample had indicated the shellfish contained both norovirus genogroup I and genogroup II. The oysters were randomly sorted into samples of 10 animals and sealed in plastic bags. Bags were held at <-15ºC until required for quality control testing, dispatch or reference analysis.

Lenticules 1 - 4 Four batches of laboratory constructed LENTICULES™ were prepared following the method of Codd et al (1998) with minor modifications. Table 1 shows details of the stock viruses used in the preparation of the lenticules. Freeze-dried vial The digestive glands of approximately 400 Pacific oysters (Crassostrea gigas), derived from the same origin as sample 2, were removed, chopped and split into separate 2g aliquots. These were then dispatched frozen to IRMM for freeze-drying. Following the freeze-drying process, samples were stored at 3±2°C until required for quality control testing, dispatch or reference analysis. Twenty-seven laboratories participated in the distribution. All participants were requested to examine the samples using their routine method. Table 1: The origin and designation of viruses used for bioaccumulation of shellfish and lenticule preparation

Description Source Sequence type

Hepatitis A Cell culture supernatant Strain HM175/43c

Norovirus genogroup I Faecal material GI.4 capsid type; 96.2% sequence homology to Chiba virus (AB022679)

Norovirus genogroup II Faecal material GII.4 capsid type; 99.6% sequence homology to Monastir strain (EU650225)

RT33 Page 3 of 16

Results Reference results Reference analyses were performed by the EURL on samples stored at <-15˚C. Six randomly selected samples from each sample type were extracted in duplicate and RT-PCR (TaqMan™) was carried out using triplicate PCR reactions for each RNA and each target. Reference results for each sample are shown in Table 2, with box and whisker plots included in Appendix I. Table 2: Reference results for RT 33 ring trial material

Sample Norovirus

GI GII HAV

RT 39 – Sample 1 - - + (5.1 x 102)

RT 39 – Sample 2 + (4.8 x 102 + (2.3 x 10) 3 - )

RT 39 – Lenticule 1 - + (4.8 x 103 - )

RT 39 – Lenticule 2 - - -

RT 39 – Lenticule 3 - - + (4.9 x 105)

RT 39 – Lenticule 4 + (1.7 x 104 - ) -

RT 39 – Freeze-dried 1 + (6.2 x 102 + (3.6x 10) 2 - ) Average quantities in copies/g or copies/lenticule shown in brackets Participants’ results Performance assessment was assessed as percentage relative accuracy, specificity and sensitivity for each determinant according to the calculations described in Appendix II. As this ring trial distribution included both shellfish matrices and LENTICULE™ discs, an overall performance assessment was performed to assess each laboratory’s performance (Table 3) as well as assessing the performance on shellfish matrices (Table 4) and LENTICULE™ discs (Table 5).

RT33 Page 4 of 16

Note: Participants’ results were expressed as percentage concordance with intended results generated by the EURL. In this assessment presence/absence data was used and no consideration of quantitative measurements (Ct values) were made. Table 3: Participants’ results for all dispatched material

Lab ID No.

GI GII HAV

AC SP SE AC SP SE AC SP SE

2 57 100 0 71 100 33 100 100 100 3 100 a 100 100 100 100 100 NT NT c NT 7 86 a 100 67 71 100 33 100 100 100 10 100 a 100 100 100 100 100 100 100 100 17 100 a 100 100 86 75 100 100 100 100 19 100 a 100 100 86 75 100 100 100 100 24 100 100 100 100 100 100 100 100 100 25 100 a 100 100 100 100 100 100 100 100 27 100 a 100 100 100 100 100 100 100 100 32 71 a 100 33 71 100 33 100 100 100 33 71 a 100 33 71 100 33 86 100 50 39 100 a 100 100 86 100 67 100 100 100 41 100 a 100 100 100 100 100 100 100 100 43 57 a 75 33 71 100 33 86 80 100 44 71 a 100 33 57 75 33 86 100 50 47 71 a 100 33 100 100 100 86 100 50 53 57 100 0 43 0 100 29 0 100 62 100 100 100 100 100 100 100 100 100 83 71 100 33 57 75 33 86 100 50 94 100 100 100 100 100 100 100 100 100 95 71 100 33 71 100 33 100 100 100 97 100 b 100 100 - - - 86 80 100 122 100 100 100 100 100 100 NT NT NT 133 100 100 100 100 100 100 100 100 100 145 100 100 100 100 100 100 100 100 100 146 100 100 100 100 100 100 100 100 100 147 71 a 100 33 71 100 33 100 100 100

a - Designated NRL, b - Did not distinguish between norovirus genogroups, c

– NT= Not tested, AC - Relative accuracy, SP – Relative specificity, SE – Relative sensitivity

RT33 Page 5 of 16

Table 4: Participants’ results for all shellfish material (Samples 1 and 2 and freeze-dried vial)

Lab ID No.

GI GII HAV


2 33 100 0 67 100 50 100 100 100 3 100 a 100 100 100 100 100 NT NT NT 7 33 a 100 0 33 100 0 100 100 100 10 100 a 100 100 100 100 100 100 100 100 17 100 a 100 100 100 100 100 100 100 100 19 100 a 100 100 100 100 100 100 100 100 24 100 100 100 100 100 100 100 100 100 25 100 a 100 100 100 100 100 100 100 100 27 100 a 100 100 100 100 100 100 100 100 32 33 a 100 0 33 100 0 100 100 100 33 33 a 100 0 33 100 0 67 100 0 39 67 a 100 50 67 100 50 100 100 100 41 100 a 100 100 100 100 100 100 100 100 43 67 a 100 50 67 100 50 67 50 100 44 33 a 100 0 33 100 0 67 100 0 47 100 a 100 100 100 100 100 67 100 0 53 100 100 100 67 0 100 33 0 100 62 100 100 100 100 100 100 100 100 100 83 33 100 0 33 100 0 67 100 0 94 100 100 100 100 100 100 100 100 100 95 33 100 0 33 100 0 100 100 100 97 100 b 100 100 - - - 100 100 100 122 100 100 100 100 100 100 NT NT NT 133 100 100 100 100 100 100 100 100 100 145 100 100 100 100 100 100 100 100 100 146 100 100 100 100 100 100 100 100 100 147 33 a 100 0 33 100 0 100 100 100



RT33 Page 6 of 16

Table 5: Participants’ results for all LENTICULES™ (L1 – L4)

Lab ID No.

GI GII HAV


2 75 100 0 75 100 0 100 100 100 3 100 a 100 100 100 100 100 NT NT NT 7 100 a 100 100 100 100 100 100 100 100 10 100 a 100 100 100 100 100 100 100 100 17 100 a 100 100 75 67 100 100 100 100 19 100 a 100 100 75 67 100 100 100 100 24 100 100 100 100 100 100 100 100 100 25 100 a 100 100 100 100 100 100 100 100 27 100 a 100 100 100 100 100 100 100 100 32 100 a 100 100 100 100 100 100 100 100 33 100 a 100 100 100 100 100 100 100 100 39 100 a 100 100 100 100 100 100 100 100 41 100 a 100 100 100 100 100 100 100 100 43 75 a 67 100 75 100 0 100 100 100 44 100 a 100 100 75 67 100 100 100 100 47 100 a 100 100 100 100 100 100 100 100 53 75 100 0 25 0 100 25 0 100 62 100 100 100 100 100 100 100 100 100 83 100 100 100 100 100 100 100 100 100 94 100 100 100 100 100 100 100 100 100 95 100 100 100 100 100 100 100 100 100 97 100 b 100 100 - - - 75 67 100 122 100 100 100 100 100 100 NT NT NT 133 100 100 100 100 100 100 100 100 100 145 100 100 100 100 100 100 100 100 100 146 100 100 100 100 100 100 100 100 100 147 100 a 100 100 100 100 100 100 100 100



Conclusion and discussion General comments Twenty-seven laboratories (15 NRLs and 12 other laboratories) received samples. Laboratories 3 and 122 did not examine for HAV. Laboratory 97 did not differentiate between norovirus genogroups. Laboratory 133 did not examine the freeze-dried material. Results reported to the EURL are shown in Appendices III, IV and V. Discussion Twelve (44%) of the participating laboratories obtained intended results (as determined by EURL reference designations) for all the different materials sent and determinands tested. The overall accuracies across all laboratories were 87%, 85% and 94% for GI, GII and HAV respectively. The false positive reporting rates for GI, GII and HAV were 1%, 8% and 6% respectively. The false negative reporting rates for GI, GII and HAV were 28%, 24% and 8% respectively. Comparing the overall accuracies of LENTICULES against shellfish matrices, the accuracies for LENTICULES were 97%, 92% and 96% for GI, GII and HAV respectively and for shellfish matrices they were 78%, 77% and 91% for GI, GII and HAV respectively. The false positive reporting rates for GI, GII and HAV were 1%, 9% and 5% and 0%, 4% and 6% for LENTICULES and shellfish matrices respectively. The false negative reporting rates for GI, GII and HAV were 7%, 8% and 0% and 33%, 33% and 16% for LENTICULES and shellfish matrices respectively. Twenty laboratories (74%) returned semi-quantitative data expressed at Ct values (Appendix IV). Nine laboratories (37%) returned quantitative data expressed as detectable copies per g or copies per LENTICULES™ (Appendix V). Of these 6, 9 and 5 laboratories reported quantitative results for GI, GII and HAV respectively. One further laboratory

RT33 Page 7 of 16

reported semi-quantitative data in terms of PCR units. Quantitative results from individual labs alongside reference results are shown in Appendix VI. References Codd AA, Richardson IR, Andrews N. 1998. Lenticules for the control of quantitative methods in food microbiology. J Appl Microbiol. 85(5):913–7.

RT33 Page 8 of 16

Appendix I: EURL reference results displayed as box and whisker plots of detectable genome copies per gram or 25μl LENTICULE™. Sample 1 Sample 2

GIIGI

3.25

3.00

2.75

2.50

2.25

2.00

1.75

1.50

Target Virus

Lo

g c

op

ies p

er

g

3.4

3.2

3.0

2.8

2.6

2.4

2.2

2.0

HAV

Lo

g c

op

ies p

er

g

Lenticules 1, 3 and 4 Freeze-dried digestive gland

L4 - GIL3 - HAVL1 - GII

6.0

5.5

5.0

4.5

4.0

3.5

3.0

Target Virus

Lo

g c

op

ies p

er

Le

nti

cu

le

GIIGI

3.6

3.4

3.2

3.0

2.8

2.6

2.4

2.2

2.0

Target Virus

Lo

g c

op

ies p

er

g

RT33 Page 9 of 16

Appendix II: Percentage relative sensitivity: Relative sensitivity (SE) = TP (TP+FN) Percentage relative specificity: Relative specificity (SP) = TN (TN+FP) Percentage relative accuracy: Relative accuracy (AC) = N

TP+TN

Where TP = true positives FN = false negatives FP = false positives TN = true negatives N = total number of tests Note: Participants’ results were expressed as percentage concordance with intended results generated by the EURL. In this assessment presence/absence data was used and no consideration of quantitative measurements (Ct

values) was made.

x 100%

x 100%

x 100%

RT33 Page 10 of 16

Appendix III: Participants’ presence/absence results for all samples

Lab ID No.

Sample 1 Sample 2 Lenticule 1 Lenticule 2 Lenticule 3 Lenticule 4 Freeze-dried sample

GI GII HAV GI GII HAV GI GII HAV GI GII HAV GI GII HAV GI GII HAV GI GII HAV

- - + + + - - + - - - - - - + + - - + + -

2 - - + - + - - - - - - - - - + - - - - - - 3 - - NT + + NT - + NT - - NT - - NT + - NT + + NT 7 - - + + - - - + - - - - - - + + - - - - - 10 - - + + + - - + - - - - - - + + - - + + - 17 - - + + + - - + - - + - - - + + - - + + - 19 - - + + + - - + - - + - - - + + - - + + - 24 - - + + + - - + - - - - - - + + - - + + - 25 - - + + + - - + - - - - - - + + - - + + - 27 - - + + + - - + - - - - - - + + - - + + - 32 - - + - - - - + - - - - - - + + - - - - - 33 - - - - - - - + - - - - - - + + - - - - - 39 - - + + + - - + - - - - - - + + - - + - - 41 - - + + + - - + - - - - - - + + - - + + - 43 - - + - + + + - - - - - - - + + - - - - - 44 - - - - - - - + - - + - - - + + - - - - - 47 - - - - + - - + - - - - - - + + - - - + - 53 - + + - + + - + + - + + - + + - + + - + + 62 - - + + + - - + - - - - - - + + - - + + - 83 - - - - - - - + - - - - - + + + - - - - - 94 - - + + + - - + - - - - - - + + - - + + - 95 - - + - - - - + - - - - - - + + - - - - - 97a - + + - + - - + - + + - + - 122 - - NT + + NT - + NT - - NT - - NT + - NT + + NT 133 - - + + + - - + - - - - - - + + - - NT NT NT 145 - - + + + - - + - - - - - - + + - - + + - 146 - - + + + - - + - - - - - - + + - - + + - 147 - - + - - - - + - - - - - - + + - - - - -

a - Did not distinguish between norovirus genogroups

RT33 Page 11 of 16

Appendix IV: Participants’ reported Ct

values for all samples

Lab ID No.

Sample 1 Sample 2 Lenticule 1 Lenticule 2 Lenticule 3 Lenticule 4 Freeze-dried sample

GI GII HAV GI GII HAV GI GII HAV GI GII HAV GI GII HAV GI GII HAV GI GII HAV

- - + + + - - + - - - - - - + + - - + + -

2 - - + - + - - - - - - - - - + - - - - - -

3 - - NT 35.62, 35.90

34.70, 33.87 NT - 35.99,

35.15 NT - - NT - - NT 39.39, 39.62 - NT 37.40,

35.64 34.67, 35.24 NT

7 - - + + - - - + - - - - - - + + - - - - - 10 - - 38.10 37.50 35.20 - - 35.40 - - - - - - 29.10 34.80 - - 38.90 36.60 - 17 - - + + + - - + - - + - - - + + - - + + - 19 - - 40.00 37.29 38.05 - - 36.22 - - 39.11 - - - 30.03 35.78 - - 38.39 36.79 - 24 - - + + + - - + - - - - - - + + - - + + - 25 - - 34.42 33.85 32.40 - - 33.27 - - - - - - 27.29 33.16 - - 36.63 33.32 -

27 - - 46,93, 45,35, 44,76

39,97, 38,74 40,24 - - 41,0,

39,40 - - - - - - 46,87, 43,93, 44,82

39,76, 41,00, 41,19

- - 38,64 39,70 -

32 - - 36.80 - - - - 35,6 - - - - - - 30,6 39.40 - - - - - 33 - - - - - - - 34.47 - - - - - - + 38.40 - - - - -

39 - - 33.10, 34.30 39.26 38.55 - - 36.40,

37.03 - - - - - - 26.82, 28.65

36.25, 36.43 - - 39.71,

39.56 - -

41 - - 37.85 34.17 32.55 - - 33.73 - - - - - - 28.96 34.88 - - 35.35 33.11 - 43 - - + - + + + - - - - - - - + + - - - - - 44 - - - - - - - + - - + - - - + + - - - - - 47 - - - - 35.00 - - 36.00 - - - - - - 30.20 39.00 - - - 36.10 -

53 - 31.15, 32.19

26.45, 28.13 - 30.59,

32.43 27.66, 28.87 - 30.87,

25.23 28.35, 27.40 - 30.30,

31.34 28.41, 26.39 - 30.70,

31.53 27.80, 28.29 - 30.15,

31.90 27.29, 27.88 - 30.50,

32.15 28.29, 25.58

62 - -

33.98, 34.20 31.26, 31.12

28.88, 28.95 32.12, 34.03

28.48, 28.57 31.19, 32.06

- - 30.01, 30.41 - - - - - - 26.56,

26.33 30.77, 31.21 - - 32.04,

32.55 30.60, 30.33 -

83 - - - - - - - 36,47 - - - - - 38,59 30,92 32,55 - - - - - 94 - - 34,64 31,88 32,13 - - 34.00 - - - - - - 27,94 35,8 - - 34,20 36,0 - 95 - - + - - - - 40.55 - - - - - - + 40.56 - - - - - 97a - + + - + - - + - + + - + -

122 - - NT 39.0, 37.4

32.6, 33.1 NT - 35.3,

35.5 NT - - NT - - NT 37.3, 37.1 - NT 39.7,

38.4 34.9 34.7 NT

133 - - 33.17 35.60 34.60 - - 39.70 - - - - - - 29.30 36.19 - - NT NT NT 145 - - 36.00 33.50 35.00 - - 37.00 - - - - - - 30.40 36.00 - - 39.00 38.00 -

146 - - * -, 38.63, -, -

* -, -, 38.84, -

34.68, 34.10, 34.83, 35.42

- - 35.32, 34.30 - - - - - - 29.39,

29.41 36.10, 36.28 - -

* 41.01, -, -, -

36.55, 35.53, 35.91, 37.20

-

147 - - 39.00 - - - - 45.00 - - - - - - 31.00 39.00 - - - - -

RT33 Page 12 of 16

Appendix V: Participants reported quantities for each target (copies/g digestive tissues or copies/lenticule)

Lab ID No.

Sample 1 Sample 2 Lenticule 1 Lenticule 3 Lenticule 4 Freeze-dried sample

GI GII HAV GI GII HAV GI GII HAV GI GII HAV GI GII HAV GI GII HAV

- - + + + - - + - - - + + - - + + -

3 713 5868 9010 644 659 2750 10 975 267 569 6762 373341 7410 <100 162 24 520 150 2040 1065 41200 7430 80 580 25 28 6800 1000 2300 32000 75000 1900 510 32 28000 41 a 970 5700 14000 280000 33000000 110000 2200 5400 47 920 3200 210 94 4400 26000 11000 86000 30000000 9600 3100 4200 122 66000 88000 40000

a – Results for shellfish matrix samples corrected using extraction efficiency

RT33 Page 13 of 16

Appendix VI: Participants’ and reference quantities for each target. Sample 1 - HAV

Sample 2 – GI

10

100

1000

10000

100000

1000000

10000000

100000000

3 10 24 25 32 41 47 94 122 ref ref ref ref ref ref ref ref ref ref ref ref

copi

es/g

HAV SF1

1.0E+01

1.0E+02

1.0E+03

1.0E+04

1.0E+05

1.0E+06

1.0E+07

1.0E+08


copi

es/g

GI SF2

RT33 Page 14 of 16

Sample 2 - GII

Lenticule 1 – GII

1.0E+01

1.0E+02

1.0E+03

1.0E+04

1.0E+05

1.0E+06

1.0E+07

1.0E+08


copi

es/g

GII SF2

1.0E+01

1.0E+02

1.0E+03

1.0E+04

1.0E+05

1.0E+06

1.0E+07

1.0E+08


copi

es/d

isc

GII L1

RT33 Page 15 of 16

Lenticule 3 – HAV

Lenticule 4 – GI

10

100

1000

10000

100000

1000000

10000000

100000000


copi

es/d

isc

HAV L3

1.0E+01

1.0E+02

1.0E+03

1.0E+04

1.0E+05

1.0E+06

1.0E+07

1.0E+08


copi

es/d

isc

GI L4

RT33 Page 16 of 16

Freeze-dried material – GI

Freeze-dried material - GII

1.0E+01

1.0E+02

1.0E+03

1.0E+04

1.0E+05

1.0E+06

1.0E+07

1.0E+08


copi

es/g

GI F1

1.0E+01

1.0E+02

1.0E+03

1.0E+04

1.0E+05

1.0E+06

1.0E+07

1.0E+08


copi

es/g

GII F1

Head officeCentre for Environment, Fisheries & Aquaculture SciencePakefield Road, Lowestoft, Suffolk NR33 0HT UK

Tel +44 (0) 1502 56 2244Fax +44 (0) 1502 51 3865 Web www.cefas.co.uk

About usCefas is a multi-disciplinary scientific research and consultancy centre providing a comprehensive range of services in fisheries management, environmental monitoring and assessment, and aquaculture to a large number of clients worldwide.

We have more than 500 staff based in 2 laboratories, our own ocean-going research vessel, and over 100 years of fisheries experience.

We have a long and successful track record in delivering high-quality services to clients in a confidential and impartial manner. (www.cefas.co.uk)

Cefas Technology Limited (CTL) is a wholly owned subsidiary of Cefas specialising in the application of Cefas technology to specific customer needs in a cost-effective and focussed manner.

CTL systems and services are developed by teams that are experienced in fisheries, environmental management and aquaculture, and in working closely with clients to ensure that their needs are fully met. (www.cefastechnology.co.uk)

Customer focusWith our unique facilities and our breadth of expertise in environmental and fisheries management, we can rapidly put together a multi-disciplinary team of experienced specialists, fully supported by our comprehensive in-house resources.

Our existing customers are drawn from a broad spectrum with wide ranging interests. Clients include:



• the World Bank

• Food and Agriculture Organisation of the United Nations (FAO)

• oil, water, chemical, pharmaceutical, agro-chemical, aggregate and marine industries




We also work successfully in partnership with other organisations, operate in international consortia and have several joint ventures commercialising our intellectual property.



Centre for Environment, Fisheries & Aquaculture ScienceWeymouth Laboratory, Barrack Road, The Nothe, Weymouth, Dorset DT4 8UB

Tel +44 (0) 1305 206600Fax +44 (0) 1305 206601

C3677.indd 2 13/01/2010 08:59:11

European Union Reference Laboratory (EU-RL) Proficiency Testing scheme Enumeration of Escherichia coli and the detection of Salmonella spp. in Pacific oysters (Crassostrea gigas) EURL proficiency testing reference number: RT 41

Sample number: RT 41

RT 41 Page 1

Contents Page number Sample RT 41 2 Results 2 General comments 4 References 5 Results chart RT 41 6 Appendices 7

Distribution date: 28th November 2011

Report date: 10th

January 2011

Report compiled by: Louise Stockley Rachel Rangdale

Authorisation by: Rachel Rangdale

This scheme is intended to provide proficiency testing samples for laboratories undertaking examination of live bivalve molluscs from production areas in accordance with Regulation (EC) No. 854/2004 and from throughout the production chain in accordance with Regulation (EC) No. 2073/2005. The scheme is organised by the European Union Reference laboratory (EURL) for monitoring bacteriological and viral contamination of bivalve molluscs. The NRL is designated by the European Union in accordance with Regulation (EC) No. 882/2004. The scheme is intended to compliment the EURL/HPA Shellfish Scheme (www.hpa.org.uk) through examination of aspects of the methods not covered under the Shellfish Scheme (initial sample preparation and preparation of initial dilutions) and to provide additional data for laboratories for ISO 17025 accreditation purposes. The EU stipulated reference method for enumeration of E. coli in live bivalve molluscs in ISO TS 16649-3, Microbiology of food and animal feeding stuffs - Horizontal method for the enumeration of β-glucuronidase-positive Escherichia coli Part 3: Most probable number technique using 5-bromo-4-chloro-3-indolyl-β-D-glucuronide (Anon 2005). The EU stipulated reference method for detection of Salmonella spp. in live bivalve molluscs is ISO 6579, Microbiology of food and animal feeding stuffs – Horizontal method for the detection of Salmonella spp. (Anon 2002). A scoring system is used to help assess participants’ performance. Details of this system are included as Appendix II of this report. The purpose of scoring is to help the EURL, member state NRLs and other participating laboratories identify incorrect or outlying results. Further information on the use of scoring in proficiency testing and on recommended procedures for following up poor performance can be accessed via the EURL website (www.eu rlcefas.co.uk) or obtained by contacting the EURL. The European Union has produced a protocol for management of underperformance in comparative testing and/or lack of collaboration of NRLs with EURLs activities. If you are experiencing problems with any aspects of these distributions please contact the EURL (contact details below), or alternately refer to the troubleshooting guide included as Appendix III of this report. Further advice on microbiological testing of bivalve mollluscan shellfish can be obtained via the EURL website (www.eurlcefas.co.uk) Due to the nature of this scheme repeat samples are not available.

http://www.hpa.org.uk/�




RT 41 Page 2

Samples Sample preparation One batch consisting of approximately 1200 (120kg) Pacific oysters (Crassostrea gigas) was collected from a UK commercial harvesting area. Approximately 100 oysters were evenly spread on individual trays and immersed in a small scale depuration unit that had been filled with 500 litres of filtered (50 micron filter) seawater and maintained at a temperature of 12°C (approximate temperature of seawater in harvesting area). Six trays were prepared for each depuration tank. Seawater was re-circulated at 28 litres per min (with UV) for 96 hours to allow the shellfish to acclimatize. E. coli previously isolated from shellfish matrix was exposed to stress conditions in seawater to mimic the natural marine environment and screened raw sewage collected from a local sewage treatment works were analysed to determine the E. coli levels using membrane filtration (Anon 2000). All oyster trays were removed from the tanks and 1 litre of screened raw sewage (≈1 x 108 cfu/100ml) and 100ml of stressed E. coli cells (≈1.5 x 109

cfu/100ml) was added to each tank and thoroughly mixed. The oysters were re-immersed in the tank and the temperature of the seawater was increased to 16°C with constant re-circulation (without UV). After 3 hours of exposure the oysters were removed. Each sample comprised of 35 randomly selected oysters.

Note: Repeat samples were not available for this scheme Sample distribution and examination Samples were packed in accordance with Cefas protocol for packaging shellfish for transportation and distributed on 28th November 2011 to 29 participating laboratories. Participants were required to analyse the material in duplicate immediately on receipt using their routine laboratory procedures. Supplementary advice on sample acceptance, receipt and processing is available via the EURL website (www.eurlcefas.org

).

Sample temperature Temperature recorders (Thermotrack, Progress Plus) were included in each consignment. Participants were required to record the internal air and sample temperature on arrival and to return the recorder. Temperatures recorded by participants are shown in Appendix I. Results Reference results - E. coli Ten randomly selected sub-samples were analysed in duplicate on 2 consecutive days (29.11.11 and 30.11.11) for E. coli using EURL SOP No. 1175 http://www.eurlcefas.org/InformationCentre/docs/CRL_SOP_E_coli_04_04_08.pdf

(Table 1).

Table 1: Reference results

GM- geometric mean, SDT

– theoretical standard deviation

Reference results – Salmonella spp. Ten randomly selected sub-samples were analysed on 2 consecutive days (29.11.11 and 30.11.11) for Salmonella spp. based on the mini-MSRV MPN technique (Fravalo et al, 2003) (Table 2). Note: Regulation (EC) No. 2073/2005 requires presence/absence testing for Salmonella spp. in live bivalve molluscs. Table 2: Reference results

Sample analyses dates

E. coli MPN/100g Range Median GM Median ±3*SDT

29.11.11 1.6 x 106 – 1.6 x 106 5.4 x 105 6.1 x 105 9.0 x 104 - 3.3 x 106

30.11.11 1.6 x 106 – 1.6 x 106 5.4 x 105 6.1 x 105 9.0 x 104 - 3.3 x 106

Sample analyses dates

Salmonella spp. No. of replicates giving positive results

29.11.11 Not detected in 25g 12

30.11.11 Not detected in 25g 12

http://www.crlcefas.org/�

http://www.crlcefas.org/InformationCentre/docs/CRL_SOP_E_coli_04_04_08.pdf�

RT 41 Page 3

Participants’ results Performance assessment was according to the procedures described in the EURL/HPA EQA shellfish scheme for a single distribution, with minor modifications (Appendix I). Participants’ results and scores allocated for RT 41 are shown in Tables 3, 4 and Figure 1. Note: The median and upper and lower limits (±3 SD and ±5 SD) were calculated from participants’ results. SD calculations were based on the inherent variability of the 5 x 3 MPN method (0.26 log10

). Reference values were excluded from the calculation of participants’ median.

E. coli summary statistics Participants reporting MPN results within the expected range1

Participants reporting MPN results outside the expected range for one replicate 0 25

Participants reporting MPN results outside the expected range for both replicates 3 Participants reporting MPN results inconsistent with ISO 7218 (Anon 2007)2 4 1expected range = participants’ median ± theoretical 3SD 2

points deducted from participants returning results inconsistent with ISO 7218.

Salmonella spp. summary statistics Participants reporting expected result 28 Table 3: Participants results and allocated scores

Lab ID E. coli MPN/100g Salmonella spp. in 25g

Replicate 1 Replicate 2 Score Result Score

3 * 350000 540000 12 Not detected 2 7 * 540000 920000 12 Not detected 2 9 * 920000 540000 12 Not detected 2 10 * 1600000 540000 12 Not detected 2 13 * 350000 350000 12 Not detected 2 19 * 1600000 540000 12 Not detected 2 20 920000 350000 12 Not detected 2 21 540000 350000 12 Not detected 2 22 540000 350000 12 Not detected 2 27 * 540000 1600000 12 Not detected 2 30 170000 170000 10 Not detected 2 32 * 110000 160000 10 Not detected 2 33 * 170000 240000 12 Not detected 2 35 * 240000 240000 12 Not detected 2 41 * 920000 350000 12 Not detected 2 44 * 930000 430000 12 Not detected 2 47 * 240000 130000 10 Not detected 2 54 160000 140000 12 Not detected 2 68 * 1600000 1600000 12 Not detected 2 69 350000 170000 10 Not detected 2 76 >48000 a

>48000 2 Not detected 2 86 * 920000 1600000 12 Not detected 2 90 920000 540000 12 Not detected 2 92 350000 540000 12 Not detected 2 106 >18000 a

>18000 2 Not detected 2 111 NR NR 0 NR 0 147 * 1600000 540000 12 Not detected 2

RT 41 Page 4

Lab ID E. coli MPN/100g Salmonella spp. in 25g

Replicate 1 Replicate 2 Score Result Score

170 * 15300 15960 2 Not detected 2 189 >18000 a

>18000 2 Not detected 2 * Designated NRL’s, a

– high censored values doubled for data assessments, NR – Not returned

Table 4: Participants results

E. coli MPN/100g Range Median GM Median±3*SDT

Participants results >1.8 x 104 – 1.6 x 106 3.5 x 105 3.2 x 105 5.8 x 104 - 2.1 x 106 GM- geometric mean, SDT

– theoretical standard deviation

General comments Twenty-nine laboratories (17 NRL and 12 other laboratories) received material for this distribution. Sixty-nine percent of samples arrived within 24 hr of dispatch. One sample arrived more than 48 hours after dispatch. Sixteen laboratories analysed the samples on the day of arrival. The remaining laboratories analysed the samples the following day. It is recommended in ISO 7218 that shellfish material should be analysed within 24 hr after sampling. Temperature loggers stored in each consignment showed an in transit temperature range of 0.5 - 8°C. All temperature data, arrival and analysis dates and times recorded by participants are given in Appendix II. E. coli comments Twenty-eight laboratories returned results with 25 participants duplicate E. coli MPN/100g results falling between ±3 SD of the participants’ median. Laboratories 76, 106 and 189 reported both replicate results as high censored values due to the analysis of insufficient dilutions. All high censored results were doubled to enable MPN values to be plotted. Laboratories 106 and 189 reported both replicate results between -3 SD and -5 SD of the participants’ median and laboratory 170 reported both replicate results outside -5 SD of the participants’ median. It is recommended that this laboratory critically examine its procedures for analysis of bivalve shellfish for E. coli and if necessary consult the EURL for assistance. Laboratory 111 did not return their results. Laboratories 30, 32, 47 and 69 reported one or both MPN value(s) that were not consistent with the guidance given in ISO 7218 for interpretation of 5 x 3 MPN tables or those previously supplied to NRLs by the EURL. Laboratory 44 reported results as a 3 x 3 MPN. This form of MPN is not consistent with the guidelines given in ISO 16649-3 point 9.2.1 which states for live shellfish 5 tubes per dilution should be prepared.

Twenty-six laboratories cited ISO TS 16649-3 (Anon 2005), 1 laboratory cited Donovan et al (1998) and 1 laboratory cited ISO 16649-2 (Anon 2001) as their laboratory method for enumeration of E. coli. Laboratories are reminded that 5 x 3 MPN tables in Donovan et al (1998) and those contained in ISO 7251 (2005) Microbiology of food and animal feeding stuffs – Horizontal method for the detection and enumeration of presumptive Escherichia coli – Most probable number technique, differ slightly from those contained in ISO 7218. Laboratories are reminded that for enumeration of E. coli in live bivalve molluscs for official control testing using ISO 16649-3 should use 5 x 3 MPN tables in ISO 7218 or those provided by the EURL should be used.

Salmonella spp. comments Twenty-eight laboratories returned expected results for RT 41 with the exception of laboratory 111 who did not return their results. Twenty-one laboratories used the EU specified reference method for detection of Salmonella spp (ISO 6579). Five laboratories referenced NMKL 71: Salmonella detection in foods and 1 laboratory reported the use of PCR for the Salmonella spp. detection. Laboratories are reminded that for official control testing of live bivalve molluscs for Salmonella spp the EU reference method is ISO 6579, Microbiology of food and animal feeding stuffs – Horizontal method for the detection of Salmonella spp. (Anon 2002).

RT 41 Page 5

References Anon 2000. Microbiology of recreational and environmental waters 2000. Detection and enumeration of coliform organisms and faecal coliform organisms by membrane filtration. Fravalo P, Hascoet Y, Le Fellic M, Queguiner S, Petton J and Salvat G. (2003). ‘Convenient method for rapid and quantitative assessment of Salmonella enterica contamination: The mini-MSRV MPN technique. Regulation (EC) No 2073/2005 on microbiological criteria for foodstuffs on the microbiological criteria relating to bivalve molluscs. Anon 2007. ISO 7218. Microbiology of food and animal feeding stuffs - General recommendations and guidance for microbiological examinations. Geneva, Switzerland. Anon 2005. ISO TS 16649-3. Microbiology of food and animal feeding stuffs - Horizontal method for the enumeration of β-glucuronidase-positive Escherichia coli Part 3: Most probable number technique using 5-bromo-4-chloro-3-indolyl-β-D-glucuronide. Geneva, Switzerland.

Donovan TJ, Gallacher S, Andrews NJ, Greenwood MH, Graham J, Russel JE, Roberts D, Lee R. (1998). ‘Modification of the standard method used in the united kingdom for counting Escherichia coli in live bivalve molluscs’. Communicable disease and public health 1: 188-96. Anon 2001. ISO TS 16649-2. Microbiology of food and animal feeding stuffs - Horizontal method for the enumeration of β-glucuronidase-positive Escherichia coli Part 2: Colony-count technique at 44̊C using 5 -bromo-4-chloro-3-indolyl-β-D-glucuronide. Geneva, Switzerland.

Anon 2005. ISO 7251. Microbiology of food and animal feeding stuffs – Horizontal method for the detection and enumeration of presumptive Escherichia coli – Most probable number technique. Anon 2002. ISO 6579. Microbiology of food and animal feeding stuffs – Horizontal method for the detection of Salmonella spp. Geneva, Switzerland.

RT 41 Page 6

Results chart – RT 41 Note: The median and upper and lower limits (±3 SD and ±5 SD) were calculated from participants’ results. SD calculations were based on the inherent variability of the 5 x 3 MPN method (0.26 log10

). Reference values were excluded from the calculation of participants’ median.

RT 41 Page 7

Appendix I: E. coli MPN scores allocated to participants returning 2 replicate results

Result Returning of results

Score allocated Total score Replicate 1 Replicate 2

One replicate MPN result reported is outside the expected range and falls between the median ±3SD and median ±5SD value

2 5 2 9

Both replicates MPN results are outside the expected range and fall between the median ±3SD and median ±5SD value 2 2 2 6

One replicate MPN result reported is outside the median ±5SD value 2 5 0 7

Both replicates MPN results are outside the expected range. The first falls between the median ±3SD and median ±5SD value and the second falls outside the median ±5SD value.

2 2 0 4

Both replicates MPN results reported is outside the median ±5SD value 2 0 0 2

E. coli MPN scores allocated to participants returning 1 single replicate results


Score allocated

Total score

Single replicate MPN result reported is within the expected range 2 5 7

Single replicate MPN result reported only and falls between the median ±3SD and median ±5SD value 2 2 4

Single replicate MPN result reported is outside the median ±5SD value 2 0 2

E. coli score deductions

Result Score deducted

Tube combination inconsistent with MPN reported, ISO 7218 or 5 x 3 MPN tables provided by the EURL. 2

Sample not examined or results returned late - no explanation received 2

High censored result (e.g. MPN = >18000 per 100g) No score allocated Salmonella spp scoring

Result Score allocated

Fully correct results 2 Misleading result, e.g. failure to isolate Salmonella 0

RT 41 Page 8

Appendix II Sample arrival and temperature

* Designated NRL’s

Lab ID Date arrived

Time of arrival

Temp. logger (°C)

Sample (°C)

Storage (°C)

Date analysed

Time of analysis 3 * 29.11.11 09:45 3 - 7.5 4.1 4 29.11.11 12:30

7 * 29.11.11 13:20 2.5 - 7.5 6 29.11.11 15:00 9 * 29.11.11 16:30 2 - 7.5 6 5.3 30.11.11 09:00 10 * 30.11.11 7.2 30.11.11 14:00 13 * 29.11.11 12:25 5 - 8 4.8 2.9 30.11.11 13:15 19 * 29.11.11 13:30 2.5 - 7.5 9 4 30.11.11 10:30 20 29.11.11 10:00 3.5 - 7 2 2 29.11.11 11:00 21 30.11.11 11:30 4.6 5 30.11.11 13:30 22 29.11.11 11:15 4.5 - 8 4.8 4.5 29.11.11 12:15 27 * 29.11.11 12:45 1 - 6 1.8 3 30.11.11 10:00 30 29.11.11 13:45 2.5 - 8 4.3 2 30.11.11 10:30 32 * 29.11.11 11:50 2.5 - 7.5 2.2 4 29.11.11 12:15 33 * 29.11.11 13:00 3 - 7.5 4.2 2 30.11.11 10:00 35 * 29.11.11 12:50 2.8 29.11.11 13:30 41 * 29.11.11 11:10 3 - 6.5 4.5 4 29.11.11 13:00 44 * 29.11.11 12:25 3 - 7 5 3 29.11.11 14:30 47 * 29.11.11 15:00 2 - 6.5 4.2 4 29.11.11 16:15 54 30.11.11 12:50 2 - 6.5 6 4 30.11.11 12:50 68 * 30.11.11 0.5 - 6.5 4 2 1.12.11 69 30.11.11 14:30 2.5 - 5 4.2 30.11.11 14:45 76 30.11.11 10:15 3 - 6 5.1 3 30.11.11 13:00 86 * 29.11.11 11:10 2.5 - 8 3 4.8 30.11.11 09:00 90 02.12.11 12:10 1.5 - 7.5 3.2 2.12.11 13:30 92 30.11.11 15:30 3.5 - 7 5.5 3.5 30.11.11 17:00 106 29.11.11

10:30 1.5 - 7 4 2 30.11.11 10:00 111 29.11.11 147 * 29.11.11 11:00 3.5 - 7 4 4 30.11.11 13:00 170 * 29.11.11 13:30 2.5 - 7.5 9 4 30.11.11 10:30 189 30.11.11

16:00 3 3 01.12.11 08:00

RT 41 Page 9

Appendix III: Troubleshooting advice

1. Methods – Ensure that the method used is appropriate for the examination of the sample.

a. Ensure that any dilutions have been calculated correctly. b. Ensure that MPN tables (if used) are interpreted correctly.

2. Culture Medium - Check the quality control data for media to ensure that they are within specifications and

performing adequately. 3. Equipment - Check that the equipment used for the procedures (incubators, refrigerators, measuring instruments)

are calibrated and performing adequately. 4. Staff Training - Check that the staff performing the tests are fully trained and familiar with all the procedural steps. 5. Clerical Procedures - Check that the sample labeling, laboratory numbering and clerical procedures are adequate

have you procedures for ensuring that test results are reported accurately and on time. 6. Accreditation- Check that quality procedures are documented and adhered to at all times. 7. Internal quality controls (IQC) – Ensure that adequate controls are in place and that and documentation for

dealing with IQC failures is appropriate. Further advice can be obtained from the EURL on request.


About us Cefas is a multi-disciplinary scientific research and

consultancy centre providing a comprehensive range

of services in fisheries management, environmental

monitoring and assessment, and aquaculture to a large

number of clients worldwide.

We have more than 500 staff based in 2 laboratories,

our own ocean-going research vessel, and over 100 years

of fisheries experience.

We have a long and successful track record in

delivering high-quality services to clients in a confidential

and impartial manner.

(www.cefas.co.uk)

Cefas Technology Limited (CTL) is a wholly owned

subsidiary of Cefas specialising in the application of Cefas

technology to specific customer needs in a cost-effective

and focussed manner.

CTL systems and services are developed by teams that

are experienced in fisheries, environmental management

and aquaculture, and in working closely with clients to

ensure that their needs are fully met.

(www.cefastechnology.co.uk)

Customer focus With our unique facilities and our breadth of expertise in

environmental and fisheries management, we can rapidly put

together a multi-disciplinary team of experienced specialists,

fully supported by our comprehensive in-house resources.

Our existing customers are drawn from a broad spectrum

with wide ranging interests. Clients include:



• the World Bank

• Food and Agriculture Organisation of the United Nations

(FAO)

• oil, water, chemical, pharmaceutical, agro-chemical,

aggregate and marine industries




We also work successfully in partnership with other

organisations, operate in international consortia and have

several joint ventures commercialising our intellectual

property

.

Head office

Centre for Environment,

Fisheries & Aquaculture Science

Pakefield Road, Lowestoft,

Suffolk NR33 0HT UK

Tel +44 (0) 1502 56 2244

Fax +44 (0) 1502 51 3865

Web www.cefas.co.uk



Weymouth Laboratory,

Barrack Road, The Nothe, Weymouth,

Dorset DT4 8UB

Tel +44 (0) 1305 206600

Fax +44 (0) 1305 206601


European Union Reference Laboratory

(EU-RL) Proficiency Testing scheme

Norovirus and hepatitis A virus proficiency

testing 2011

EURL ring trial reference number: RT 43

Sample distributions: Shellfish samples 1 and 2, LENTICULESTM 1 and 2.

RT 43 Page 1 of 16

Contents Page number Samples 2 Results 2 Conclusion and discussion 5 References 6 Appendices 7

Distribution date: December 2011

Report date: 22nd

February 2012

Report compiled by: Louise Stockley James Lowther


RT 43 Page 2 of 16

Samples Sample preparation Material dispatched comprised of naturally contaminated and bioaccumulated Pacific oysters (Crassostrea gigas) (Samples 1 and 2), laboratory constructed LENTICULES™ (Vial 1 and 2) and standard curve material (plasmid solutions for each target virus at concentrations of 104, 103, 102, 101 and 100

copies/µl) to estimate the levels of virus in the samples. The reference results for each sample are included as Appendix I.

Sample 1 Sample 1 comprised shucked, frozen Pacific oysters (Crassostrea gigas), originating from Korea, that had been involved in a norovirus outbreak that occurred in New Zealand on the 17th

June 2006 with a total of 115 cases being identified. Prior testing of the sample had indicated the shellfish contained both norovirus genogroup I and genogroup II. The oysters were randomly sorted into samples of 10 animals and sealed in plastic bags. Bags were held at <-15ºC until required for quality control testing, dispatch or reference analysis.

Sample 2 A batch of approximately 500 Pacific oysters (Crassostrea gigas) were placed in trays and re-immersed in 500 litres of re-circulating natural seawater at 16±1°C and 36.5ppt. The shellfish were left for 30 hours to acclimatise before 50ml of shellfish food containing known levels of Genogroup I and II (GI and GII) and HAV cell culture supernatant (see table 1) was added to the tank. After approximately 17 hours the shellfish were removed from the tank and rinsed in fresh water. The oyster sample was then shucked and randomly sorted into samples of 10 animals and sealed in plastic bags. Bags were held at <-15ºC until required for quality control testing, dispatch or reference analysis. LENTICULES 1 and 2 Two batches of laboratory constructed LENTICULES™ were prepared following the method of Codd et al (1998) with minor modifications. Table 1 shows details of the stock viruses used in the preparation of the LENTICULES™. Table 1: The origin and designation of viruses used for shellfish bioaccumulation and LENTICULES™

Description Source Sequence type

Hepatitis A Cell culture supernatant Strain HM175/43c

Norovirus genogroup I Faecal material GI.4 capsid type

Norovirus genogroup II Faecal material GII.4 capsid type

Sample distribution Samples were dispatched on dry ice in accordance with IATA packing instructions 650 for UN3373 ‘Diagnostic Specimens’ on 12th

December 2011 to 26 participating laboratories. All participants were requested to examine the samples using their routine method. Those laboratories using quantitative real-time PCR were requested to calculate the quantity of target virus in each sample using both their own standard materials and using the standard materials provided with this PT distribution.

Results Reference results Reference analyses were performed by the EURL on samples stored at <-15˚C. Six randomly selected samples from each sample type were extracted in duplicate and RT-PCR (TaqMan™) was carried out using triplicate PCR reactions for each RNA and each target. Reference results for each sample are shown in Table 2, with box and whisker plots included in Appendix I. Table 2: Reference results for RT 43 proficiency testing material

Sample Norovirus

HAV GI GII

RT 43 – Shellfish sample 1 + (4.3 x 102 + (2.2 x 10) 3 - ) RT 43 – Shellfish sample 2 + (3.2 x 103 + (4.6 x 10) 2 + (1.0 x 10) 4

RT 43 – LENTICULE™ 1 )

- - - RT 43 – LENTICULE™ 2 + (4.8 x 103 + (4.2 x 10) 3 + (3.0 x 10) 5)

Average quantities in copies/g or copies/lenticule shown in brackets

RT 43 Page 3 of 16

Participants’ results Performance assessment was assessed as percentage relative accuracy, specificity and sensitivity for each determinant according to the calculations described in Appendix II. As this ring trial distribution included both shellfish matrices and LENTICULE™ discs, an overall performance assessment was performed to assess each laboratory’s performance (Table 3) as well as assessing the performance on shellfish matrices (Table 4) and LENTICULE™ discs (Table 5). Note: Participants’ results were expressed as percentage concordance with intended results generated by the EURL. In this assessment presence/absence data was used and no consideration of quantitative measurements (Ct values) were made. Table 3: Participants’ results for all dispatched material

Lab ID No.

GI GII HAV


2 50 100 33 75 100 67 100 100 100 3 50 a 100 33 100 100 100 NT NT NT 7 100 a 100 100 25 100 0 100 100 100 10 100 a 100 100 100 100 100 100 100 100 11 100 100 100 100 100 100 100 100 100 17 100 a 100 100 100 100 100 100 100 100 19 75 a 100 67 100 100 100 100 100 100 24 100 100 100 100 100 100 100 100 100 25 100 a 100 100 100 100 100 100 100 100 27 100 a 100 100 100 100 100 100 100 100 32 75 a 100 67 75 0 100 100 100 100 35 NR a NR NR NR NR NR NR NR NR 39 75 a 100 67 75 100 67 100 100 100 41 100 a 100 100 100 100 100 100 100 100 43 50 a 100 33 50 100 33 75 100 50 47 100 a 100 100 100 100 100 100 100 100 48 50 100 33 50 100 33 100 100 100 94 100 100 100 100 100 100 100 100 100 95 75 100 67 50 100 33 100 100 100 98 100 100 100 75 100 67 100 100 100 113 25 100 0 50 100 33 NT NT NT 147 a 50 100 33 25 0 33 100 100 100 178 25 100 0 50 0 67 100 100 100 179 100 100 100 100 100 100 100 100 100 186 25 100 0 25 100 0 50 50 50 190 100 100 100 100 100 100 100 100 100

a

- Designated NRL, NT= Not tested, NR = Not returned, AC - Relative accuracy, SP – Relative specificity, SE – Relative sensitivity

RT 43 Page 4 of 16

Table 4: Participants’ results for all shellfish material (Samples 1 and 2)

Lab ID No.

GI GII HAV

AC SE AC SE AC SP SE

2 0 0 100 100 100 100 100 3 50 a 50 100 100 NT NT NT 7 100 a 100 0 0 100 100 100 10 100 a 100 100 100 100 100 100 11 100 100 100 100 100 100 100 17 100 a 100 100 100 100 100 100 19 50 a 50 100 100 100 100 100 24 100 100 100 100 100 100 100 25 100 a 100 100 100 100 100 100 27 100 a 100 100 100 100 100 100 32 50 a 50 100 100 100 100 100 35 NR a NR NR NR NR NR NR 39 50 a 50 50 50 100 100 100 41 100 a 100 100 100 100 100 100 43 0 a 0 0 0 50 100 0 47 100 a 100 100 100 100 100 100 48 0 0 0 0 100 100 100 94 100 100 100 100 100 100 100 95 50 50 0 0 100 100 100 98 100 100 50 50 100 100 100 113 0 0 50 50 NT NT NT 147 a 0 0 50 50 100 100 100 178 0 0 100 100 100 100 100 179 100 100 100 100 100 100 100 186 0 0 0 0 50 0 100 190 100 100 100 100 100 100 100

a


RT 43 Page 5 of 16

Table 5: Participants’ results for all LENTICULES™ (L1 – L2)

Lab ID No.

GI GII HAV


2 100 100 100 50 100 0 100 100 100 3 50 a 100 0 100 100 100 NT NT NT 7 100 a 100 100 50 100 0 100 100 100 10 100 a 100 100 100 100 100 100 100 100 11 100 100 100 100 100 100 100 100 100 17 100 a 100 100 100 100 100 100 100 100 19 100 a 100 100 100 100 100 100 100 100 24 100 100 100 100 100 100 100 100 100 25 100 a 100 100 100 100 100 100 100 100 27 100 a 100 100 100 100 100 100 100 100 32 100 a 100 100 50 0 100 100 100 100 35 NR a NR NR NR NR NR NR NR NR 39 100 a 100 100 100 100 100 100 100 100 41 100 a 100 100 100 100 100 100 100 100 43 100 a 100 100 100 100 100 100 100 100 47 100 a 100 100 100 100 100 100 100 100 48 100 100 100 100 100 100 100 100 100 94 100 100 100 100 100 100 100 100 100 95 100 100 100 100 100 100 100 100 100 98 100 100 100 100 100 100 100 100 100 113 50 100 0 50 100 0 NT NT NT 147 a 100 100 100 0 0 0 100 100 100 178 50 100 0 0 0 0 100 100 100 179 100 100 100 100 100 100 100 100 100 186 50 100 0 50 100 0 50 100 0 190 100 100 100 100 100 100 100 100 100

a


Conclusion and discussion General comments Twenty-six laboratories (14 NRLs and 12 other laboratories) received samples. Laboratories 3 and 113 did not examine for HAV. Laboratory 35 did not return results. Results reported to the EURL are shown in Appendices I and V. Discussion Ten (38%) of the participating laboratories obtained intended results (as determined by EURL reference designations) for all the different materials sent and determinands tested. The overall accuracies across all laboratories were 77%, 77% and 97% for GI, GII and HAV respectively. The false positive reporting rates for GI, GII and HAV were 0%, 12% and 2% respectively. The false negative reporting rates for GI, GII and HAV were 31%, 27% and 4% respectively. Comparing the overall accuracies of LENTICULES against shellfish matrices, the accuracies for LENTICULES were 86%, 76% and 91% for GI, GII and HAV respectively and for shellfish matrices they were 62%, 72% and 96% for GI, GII and HAV respectively. The false positive reporting rates for GI, GII and HAV were 8%, 20% and 9% for LENTICULES and 4% for HAV in shellfish matrices. The false negative reporting rates for GI, GII and HAV were 20%, 28% and 9% for LENTICULES and 38%, 28% and 4% for shellfish matrices respectively. Twenty-three laboratories (92%) returned data expressed as Ct

values (Appendix III). Seventeen laboratories (68%) returned quantitative data using their own routine method and/or using the standard materials provided expressed as detectable copies per g or copies per LENTICULES™ (Appendix IV). Quantitative results from individual labs alongside reference results are shown in Appendix V. Reference results were not corrected using extraction efficiency data; where labs provided both corrected and uncorrected quantities, the latter are shown in Appendices IV and V.

Methods used by participants to analyse the shellfish matrix, with the labs listed according to their overall accuracy score for the shellfish samples, are shown in Appendix VI.

RT 43 Page 6 of 16

References Codd AA, Richardson IR, Andrews N. 1998. Lenticules for the control of quantitative methods in food microbiology. J Appl Microbiol. 85(5):913–7.

RT 43 Page 7 of 16

Appendix I: EURL reference results displayed as box and whisker plots of detectable genome copies per gram or 25μl LENTICULE™. Shellfish sample 1 Shellfish sample 2

GIIGI

10000

1000

100

Co

pie

s p

er

gra

m

HAVGIIGI

10000

1000

100C

op

ies p

er

gra

m

LENTUCLE 2

HAVGIIGI

1000000

100000

10000

1000

Co

pie

s p

er

LEN

TIC

ULE

RT 43 Page 8 of 16

Appendix II: Percentage relative sensitivity: Relative sensitivity (SE) = TP (TP+FN) Percentage relative specificity: Relative specificity (SP) = TN (TN+FP) Percentage relative accuracy: Relative accuracy (AC) = N

TP+TN

Where TP = true positives FN = false negatives FP = false positives TN = true negatives N = total number of tests Note: Participants’ results were expressed as percentage concordance with intended results generated by the EURL. In this assessment presence/absence data was used and no consideration of quantitative measurements (Ct

values) was made.

x 100%

x 100%

x 100%

RT 43 Page 9 of 16

Appendix III: Participants’ presence/absence results and Ct

values for all samples

Lab ID No.

Shellfish sample 1 Shellfish sample 2 Lenticule 1 Lenticule 2

GI GII HAV GI GII HAV GI GII HAV GI GII HAV

+ CT + CT - CT + CT + CT + CT - CT - CT - CT + CT + CT + CT

2 - + - - + + - - - W+ - + 3 + a 36.4 + 34.02 NT - + 34.59 NT - - NT - + 37.42 NT 7 + a - - + - + - - - + - + 10 + a 36.48 + 33.97 - + 33.91 + 34.05 + 30.1 - - - + 35.51 + 36.69 + 30.57 11 + 40.21 + 33.51 - + 35.03 + 33.92 + 30.58 - - - + 38.55 + 36.2 + 31.65 17 + a 35.52 + 31.75 - 45 + 33.61 + 30.55 + 29.57 - 45 - 45 - 45 + 36.68 + 34.24 + 29.2 19 a - + 37.86 - + 35.26 + 37.26 + 32.71 - - - + 34.62 + 36.62 + 20.23 24 + 35.6 + 32.9 - + 30.3 + 31.7 + 27.3 - - - + 32.8 + 36.3 + 28.7 25 + a 33.73 + 31.77 - + 31.68 + 31.14 + 28.66 - - - + 36.51 + 35.91 + 28.26 27 + a 37.73 + 38.1 - + 35.05 + 34 + 31.39 - - - + 37.09 + 37.22 + 29.37 32 + a 34.05 + 38.17 - - + 37.44 + 30.08 - + 45.6 - + 41.19 + 43.37 + 28.66 35 NR a NR NR NR NR NR NR NR NR NR NR NR 39 a - - - + 41.08 + 40.38 + 32.8 - - - + 38.45 + 39.89 + 35.35 41 + a 34.46 + 33.52 - + 34.69 + 37.06 + 28.02 - - - + 34.96 + 34.49 + 29.08 43 a - - - - - - - - - + 47.02 + 46.79 + 47 + a 35.6 + 33.5 - - + 35.8 + 32.2 + 30.6 - - - - - - + 38.8 + 34.9 + 29.7 48 - - - - - + 30.17 - - - + 37.13 + 35.02 + 25.92 94 + 33.35 + 32.95 - - + 33.84 + 37.36 + 28.31 - - - - - - + 40.38 + 36.04 + 29.77 95 - - - + 42.42 - + - - - + 39.65 + 40.64 + 98 + 36.58 + 35.47 - + 45.12 - + 36.54 - - - + 38.71 + 35.23 + 28.42 113 - - NT - + 33.48 NT - - NT - - NT 147 a - + 47.1 - - - + 36.15 - + 46.75 - + 46 - + 34.23 178 - + - - + + 33.72 - + - - - + 36.56

179 + 40.96 + 42.49 - + 35.86 + 39.07 + 33.91 - - - - - - + 39.27 37.67 + 42.28 + 31.7

186 - - + 35.45 - - + 35.03 - - - - - - 190 + 37.51 + 35.19 - X + 38.41 + 36.41 + 30.97 - X - X - X + 38.31 + 35.91 + 29.08

NR – Results not returned, NT – Not tested, W+ - Weak positive, Yellow denotes false negatives, Red denotes false positives

RT 43 Page 10 of 16

Appendix IV: Participants reported quantities for each target (copies/g (shellfish) or copies/LENTICULE)

Lab ID No.

Shellfish sample 1 Shellfish sample 2 LENTICULE 2

GI GII GI GII HAV GI GII HAV

A B A B A B A B A B A B A B A B

3 1.38x10 3.91x103 4.88x102 1.48x103 ND 3 ND 3.19x10 6.80x103 x 2 x ND 4.90x10 4.74x101 2.04x102 x 2 x 10 1.26x10 3.02x103 1.89x103 1.29x103 6.77x104 1.71x103 1.90x104 1.30x103 7.95x104 7.90x104 1.86x106 4.54x103 2.57x103 1.89x102 5.24x103 5.22x104 6 11 7.52x10 x 2 2.18x10 x 4 3.35x10 x 4 1.98x10 x 4 1.11x10 x 4 2.37x10 x 3 2.85x10 x 3 4.30x10 x 3 17 5.30x10 x 3 2.80x10 x 3 1.70x10 x 4 6.90x10 x 3 5.70x10 x 4 4.30x10 x 3 7.50x10 x 2 1.40x10 x 4 19 x ND x 4.96x10 x 2 1.30x10 x 3 7.10x10 x 2 3.40x10 x 4 1.10x10 x 3 5.20x10 x 2 1.40x106 24 7.94X10 x 1 1.26x10 x 3 2.51x10 x 3 2.51x10 x 3 7.94x10 x 3 5.01x10 x 2 1.58x10 x 2 3.98x10 x 3 25 4.22x10 2.59x103 4.05x102 5.71x102 1.38x102 1.00x104 6.02x103 8.45x102 x 2 7.68x10 4.39x104 2.16x103 2.64x102 3.81x102 x 2 5.44x105 27 x 3.41x10 x 3 3.98x10 x 3 1.41x10 x 4 3.20x10 x 4 1.06x10 x 6 5.22x10 x 3 5.72x10 x 3 5.28x106 32 x 1.17x10 5.28x104 4.34x102 x 3 ND 9.70x10 7.33x102 x 3 9.65x10 x 5 1.09x10 6.10X102 2.04x101 x 3 1.56x106 39 x ND x ND x 4.90x10 x 2 5.10x10 x 2 x x 3.10x10 x 2 6.80X10 x 1 x 41 2.00x10 3.90x103 5.70x103 8.20x102 4.40x103 8.50x103 1.10x103 9.30x102 3.30x102 1.70x106 8.50x107 2.50x102 1.30x103 1.80x103 3.50x103 3.30x104 6 47 1.10x10 2.00x103 5.50x103 2.10x102 8.80x103 1.70x102 1.30x103 6.40x103 x 3 2.70x10 2.50x105 5.00x102 4.60x102 1.30x102 x 3 9.00x105 94 7.90x10 7.20x103 8.10x103 5.10x103 5.80x103 5.10x103 5.40x103 5.10x102 8.90x102 x 4 9.10x10 6.40x102 7.60x102 1.10x104 3.60x104 x 5 178 ND ND ND ND ND ND ND ND 4.09x10 x 5 ND ND ND ND 4.78x10 x 5 179 x 1.80X10 x 1 9.10x10 x 3 5.70x10 x 3 1.90x10 x 3 1.70x10 x 5 5.00x10 x 2 1.00x10 x 4 4.50x105 186 ND ND ND ND ND ND ND ND x 1.54x10 ND 3 ND ND ND ND ND 190 5.50x10 x 2 1.70x10 x 3 2.90x10 x 2 6.70x10 x 2 2.90x10 x 5 1.20x10 x 2 3.90x10 x 2 4.30x10 x 5

A - Quantity determined using routine method, B - Quantity determined using standard material provided, ND – not detected, x – not tested

RT 43 Page 11 of 16

Appendix V: Participants’ and reference quantities for each target.

Shellfish sample 1 - GI

Shellfish sample 1 – GII

1

10

100

1,000

10,000

100,000

1,000,000

10,000,0003 10 11 17 19 24 25 27 32 39 41 47 94 178

179

186

190

REF

REF

REF

REF

REF

REF

copi

es/g

Lab ID numbers

Own standards

Cefas standards

1

10

100

1,000

10,000

100,000

1,000,000

10,000,000

3 10 11 17 19 24 25 27 32 39 41 47 94 178

179

186

190

REF

REF

REF

REF

REF

REF

copi

es/g

Lab ID numbers

own standards

cefas standards

RT 43 Page 12 of 16

Shellfish Sample 2 – GI

Shellfish Sample 2 – GII

1

10

100

1,000

10,000

100,000

1,000,000

10,000,000

3 10 11 17 19 24 25 27 32 39 41 47 94 178

179

186

190

REF

REF

REF

REF

REF

REF

copi

es/g

Lab ID numbers

own standards

cefas standards

1

10

100

1,000

10,000

100,000

1,000,000

10,000,000

3 10 11 17 19 24 25 27 32 39 41 47 94 178

179

186

190

REF

REF

REF

REF

REF

REF

copi

es/g

Lab ID numbers

own standards

cefas standards

RT 43 Page 13 of 16

Shellfish Sample 2 - HAV

LENTICULE 2 - GI

10

100

1,000

10,000

100,000

1,000,000

10,000,000

100,000,000

3 10 11 17 19 24 25 27 32 39 41 47 94 178

179

186

190

REF

REF

REF

REF

REF

REF

copi

es/g

Lab ID numbers

own standards

cefas standards

1

10

100

1,000

10,000

100,000

1,000,000

10,000,000

3 10 11 17 19 24 25 27 32 39 41 47 94 178

179

186

190

REF

REF

REF

REF

REF

REF

copi

es/L

ENTI

CULE

Lab ID numbers

own standards

cefas standards

RT 43 Page 14 of 16

LENTICULE 2 - GII

LENTICULE 2 – HAV

1

10

100

1,000

10,000

100,000

1,000,000

10,000,000

3 10 11 17 19 24 25 27 32 39 41 47 94 178

179

186

190

REF

REF

REF

REF

REF

REF

copi

es/L

ENTI

CULE

Lab ID numbers

own standards

cefas standards

1

10

100

1,000

10,000

100,000

1,000,000

10,000,000

3 10 11 17 19 24 25 27 32 39 41 47 94 178

179

186

190

REF

REF

REF

REF

REF

REF

copi

es/L

ENTI

CULE

Lab ID numbers

own standards

cefas standards

RT 43 Page 15 of 16

Appendix VI: Results and methods used for shellfish samples. For key to method codes see next page.

SF1 SF2 Virus extraction

RNA extraction

RT-PCR method

RT-PCR reagentsb

Primers b LAB ID ACC SF GI a GII HAV GI GII HAV GI GII HAV

10 100.00% + + - + + + Ac E K O AA CC CC 11 100.00% + + - + + + A F K O BB BB CC 17 100.00% + + - + + + A E K O CC CC CC 24 100.00% + + - + + + A G L P DD BB CC 25 100.00% + + - + + + A E K O CC CC CC 27 100.00% + + - + + + A F K O AA CC CC 41 100.00% + + - + + + B E K O CC CC CC 47 100.00% + + - + + + A E K Q CC CC CC 94 100.00% + + - + + + B E K R EE EE EE

179 100.00% + + - + + + A E K Q FF CC CC 190 100.00% + + - + + + A E K R EE EE EE 19 83.33% - + d - + + + A E K O CC CC CC 32 83.33% + + - - + + A E K O CC CC CC 98 83.33% + + - + - + A E K R EE EE EE 3 75.00% + + NTe - + NT A E K O CC CC - 2 66.67% - + - - + + B H M S BB BB JJ 7 66.67% + - - + - + A E N T GG GG KK

39 66.67% - - - + + + A F K U BB BB LL 178 66.67% - + - - + + B H K V HH BB JJ 95 50.00% - - - + - + A F L W BB BB MM

147 50.00% - + - - - + A F L X CC CC EE 48 33.33% - - - - - + B H K S II II CC

113 25.00% - - NT - + NT C F K S BB BB - 186 16.67% - - + - - + A H L Y CC CC CC 43 16.67% - - - - - - D J K S BB BB LL

a - ACC SF = accuracy for shellfish samples 1 & 2 b - where labs used different methods for different targets, method used with majority of targets shown c - cells highlighted in grey indicate method taken or adapted from CEN bench protocols d - cells highlighted in yellow indicate false negative results, cells highlighted in red indicate false positive results e – NT = not tested

RT 43 Page 16 of 16

Key to method codes Virus extraction methods A Proteinase K B Glycine buffer, PEG precipitation C Ultracentrifugation/choloroform extraction D MagNa Lyser Green Beads (Roche) RNA extraction methods E NucliSens Magnetic extraction reagents (BioMerieux) F QIAamp/Rneasy kits (Qiagen) G High Pure Viral Nucleic Acid (Roche) H Trizol/TriReagent methods J Total RNA Isolation NucleoSpin RNA II Kit (Macherey-Nagel) RT-PCR methods K real-time, one-step L real-time, two-step M conventional, one-step N conventional, two-step RT-PCR reagents O RNA Ultrasense (Invitrogen) P Superscript III & Platinum® qPCR SuperMix-UDG (Invitrogen) Q Quantitect (Qiagen) R ceeram Tools S OneStep RT-PCR kit (Qiagen) T MuLV & Ampli Taq Gold (Applied Biosystems) U SuperScriptTM III Platinum® One-Step qRT-PCR System (Invitrogen) V Brilliant II QRT-PCR one-step kit (Agilent) W High Capacity cDNA RT Kit & ABI Taqman Universal Mastermix (Applied Biosystems) X Transcriptor high fidelity cDNA synthesis (Roche) & TaqMan Universal MasterMix (Applied Biosystems) Y Thermoscript RT-PCR (Invitrogen) Primers/probes AA Primers; CEN. Probe; Hohne and Schreier, 2006 BB Kageyama et al., 2003 CC CEN bench protocols DD Wolf et al., 2010 EE ceeram Tools FF Primers; Ifremer (detailed in Lowther et al., 2010). Probe; Jothikumar et al., 2005 GG Kojima et al., 2002 HH Primers; Kageyama et al., 2003. Probe; Vega et al., 2011 II Hohne and Schreier, 2006 JJ Guevremont et al., 2006 KK Bosch et al., 2000 LL Cromeans et al., 1997 MM Goswami et al., 1993













(www.cefas.co.uk)


















• the World Bank


(FAO)









property

.

Head office




Suffolk NR33 0HT UK

Tel +44 (0) 1502 56 2244

Fax +44 (0) 1502 51 3865

Web www.cefas.co.uk





Dorset DT4 8UB

Tel +44 (0) 1305 206600

Fax +44 (0) 1305 206601


European Union Reference Laboratory (EU-RL) and Health Protection Agency (HPA) EQA Shellfish Scheme Escherichia coli and Salmonella spp. EQA EU-RL ring trial reference number: RT 44

Sample distributions: SF038, SF039 and SF040

RT 44 Page 1 of 18

Contents Page number Samples 2 Results 2 Distribution results SF038 to SF040 3 Performance assessment 9 Summary 10 References 10 Charts 11 Appendices 16

Distribution period: March – November 2011

Report date: 5th

March 2011

Report compiled by: Louise Stockley


Article 32 of Regulation (EC) 882/2004 sets out the organisational responsibilities for EU Reference Laboratories (EU-RL) with respect to comparative (proficiency) testing (PT). This PT scheme is intended to provide comparative testing samples for laboratories undertaking examination of live bivalve molluscs from production areas in accordance with Regulation (EC) No. 854/2004 and products placed on the market in accordance with Regulation (EC) No. 2073/2005. The scheme is organised in collaboration with the Health Protection Agency (HPA) (http://www.hpa.org.uk/ProductsServices/InfectiousDiseases/ExternalQualityAssessmentProficiencyTesting/EQAOrPTForFoodWaterAndEnvironmentalMicrobiology/ShellfishScheme/). The EU stipulated reference method for enumeration of E. coli in live bivalve molluscs in ISO TS 16649-3, Microbiology of food and animal feeding stuffs - Horizontal method for the enumeration of β-glucuronidase-positive Escherichia coli Part 3: Most probable number technique using 5-bromo-4-chloro-3-indolyl-β-D-glucuronide (Anon 2005). The EU stipulated reference method for detection of Salmonella spp. in live bivalve molluscs is ISO 6579, Microbiology of food and animal feeding stuffs – Horizontal method for the detection of Salmonella spp. (Anon 2002). These methods, or an alternative method validated according to ISO 16140 must be used for official control testing of live bivalve molluscs for compliance with EU Regulations (Anon 2003). Performance assessments are carried out on participants results. Performance assessments are valuable tools to help laboratories identify any ongoing problems with their procedures or analyses. Scores are given for results returned for each distribution and cumulative scores are calculated for 2 and 3 distributions. If you are experiencing problems please contact the EU-RL (contact details below), or alternately refer to the troubleshooting guide included as Appendix I of this report. Further advice on microbiological testing of bivalve mollluscan shellfish can be obtained via the EU-RL website www.eurlcefas.org

http://www.hpa.org.uk/ProductsServices/InfectiousDiseases/ExternalQualityAssessmentProficiencyTesting/EQAOrPTForFoodWaterAndEnvironmentalMicrobiology/ShellfishScheme/�

http://www.hpa.org.uk/ProductsServices/InfectiousDiseases/ExternalQualityAssessmentProficiencyTesting/EQAOrPTForFoodWaterAndEnvironmentalMicrobiology/ShellfishScheme/�

http://www.eurlcefas.org/�

RT 44 Page 2 of 18

Samples Sample preparation Samples distributed consisted of LENTICULE™ discs containing fully characterised bacterial isolates. The proportions and types of organisms were designed to mirror those found in freshly harvested bivalve molluscs. Samples were packaged according to IATA regulations and distributed with preparation instructions and report forms. Participation Twenty laboratories participated in the EQA scheme comprising 16 Member State NRLs, 1 EFTA NRL and 2 laboratories in accession countries. All participants were requested to examine the samples using Official Control methods i.e. those methods routinely used for official control analysis of live bivalve molluscs. NRLs Belgium, Bulgaria, The Czech Republic, Finland, Greece, Hungary, Latvia, Lithuania, Slovakia and Spain did not participant in the mandatory 2 distributions per year. Results Reference results For each distribution 10 reference samples were examined by the organising laboratory. Reference analyses were performed using ISO TS 16649-3 for the enumeration of Escherichia coli and ISO 6579 for the detection of Salmonella spp..

Participants’ analysis and scoring system Results reported by NRLs for E. coli and Salmonella spp. examinations are shown in Tables 2, 4, 6, 8, 10 and 11. Reported E. coli MPN values were compared to the median MPN from all participants’ results, reference results were omitted from this calculation. The result charts were compiled using log10 transformed MPN values (Figures 1 - 5). Upper and lower acceptability limits were calculated as the participants’ median ±3 standard deviations (SD) and ±5 SD. SD calculations were based on the expected inherent variability of the five tube 3 dilution MPN method which is 0.26 log10

. Performance assessment was according to the algorithm in Appendix II.

RT 44 Page 3 of 18

Distribution SF038: Sample SF0084 Contents – Escherichia coli (102), Enterobacter agglomerans and Klebsiella oxytoca (103 – 104

).

Table 1 Participants and reference results median, median ±3 and ±5 SD - SF0084

Median MPN/100g

Median -3SD MPN/100g


Median +3SD MPN/100g


Reference results 1.1 x 10 1.8 x 102 5.5 x 101 6.6 x 100 2.2 x 102 3 Participants results 1.1 x 10 1.8 x 102 5.5 x 101 6.6 x 100 2.2 x 102 3

Reference results E. coli MPN – <20 – 6.5 x 102

per 100g. Salmonella spp. – Not detected in 25g.

Participants results - SF0084 (Figure 1) Table 2 Results reported by participants and scores allocated - SF0084

DNP – Did not participate in this distribution, Discussion – SF0084 Participation – Seventeen NRLs, 1 EFTA and 2 accession country laboratories received material for examination. All laboratories returned results and were included in the assessment. Laboratory 1527 did not examine the sample for Salmonella spp.. Laboratory 493 did not take part in this distribution. E.coli MPN – All laboratories reported replicate results within the expected range and received a maximum score of 12. Salmonella spp. – All laboratories that reported results for Salmonella spp. correctly reported Salmonella spp. as not detected and received a maximum score of 2.

Lab E. coli (per 100g) Salmonella spp. (per 25g)

Number Replicate 1 Replicate 2 Score Salmonella spp. Score

121 110 170 12 Not detected 2 391 330 330 12 Not detected 2 403 130 170 12 Not detected 2 413 140 140 12 Not detected 2 493 DNP DNP - DNP - 583 80 80 12 Not detected 2 597 78 20 12 Not detected 2 601 40 70 12 Not detected 2 604 230 130 12 Not detected 2 649 110 110 12 Not detected 2 651 170 490 12 Not detected 2 653 110 50 12 Not detected 2 658 110 70 12 Not detected 2 701 170 80 12 Not detected 2 703 50 130 12 Not detected 2 715 40 20 12 Not detected 2 718 20 50 12 Not detected 2 719 230 80 12 Not detected 2 720 330 230 12 Not detected 2 744 130 110 12 Not detected 2 1527 100 100 12 - -

RT 44 Page 4 of 18

Distribution SF038: Sample SF0085 Contents – Escherichia coli (103), Salmonella London 3,10:l,v;1,6 (10 – 20) and Proteus mirabilis (102

).


Median MPN/100g






Reference results E. coli MPN – 1.4 x 102 – 4.6 x 103

per 100g. Salmonella spp. – Detected in 25g.


DNP – Did not participate in this distribution, Discussion – SF0085 Participation - Seveteen NRLs, 1 EFTA and 2 accession country laboratories received material for examination. All laboratories returned results and were included in the assessment. Laboratory 1527 did not examine the sample for Salmonella spp.. Laboratory 493 did not take part in this distribution. E.coli MPN – All laboratories reported replicate results within the expected range and received a maximum score of 12. Salmonella spp. – All laboratories that reported results for Salmonella spp. correctly reported Salmonella spp. as detected and received a maximum score of 2.

Lab E. coli (per 100g) Salmonella spp. (per 25g) Number Replicate 1 Replicate 2 Score Salmonella spp. Score

121 700 2400 12 Detected 2 391 790 1300 12 Detected 2 403 1300 1100 12 Detected 2 413 1700 1700 12 Detected 2 493 DNP DNP - DNP - 583 1100 1700 12 Detected 2 597 490 460 12 Detected 2 601 790 490 12 Detected 2 604 1700 1300 12 Detected 2 649 1700 1300 12 Detected 2 651 790 1300 12 Detected 2 653 790 2400 12 Detected 2 658 500 750 12 Detected 2 701 790 790 12 Detected 2 703 790 330 12 Detected 2 715 310 750 12 Detected 2 718 460 1700 12 Detected 2 719 1300 1400 12 Detected 2 720 1300 2400 12 Detected 2 744 790 1300 12 Detected 2 1527 520 520 12 - -

RT 44 Page 5 of 18

Distribution SF039: Sample SF0086 Contents – Escherichia coli (104), Candida tropicalis (104), Clostridium perfringens (102) and Pseudomonas aeruginosa (103

).


Median MPN/100g







per 100g. Salmonella spp. - Not detected in 25g.


DNP – Did not participate in this distribution, NE – Not examined. Discussion – SF0086 Participation - Fifteen NRLs, 1 EFTA and 2 accession country laboratories received material for examination. All laboratories returned results and were included in the assessment. Laboratories 715 and 1527 did not examine the sample for Salmonella spp.. Laboratories 493, 604 and 658 did not take part in this distribution. E.coli MPN – All laboratories reported replicate results within the expected range and received a maximum score of 12. Salmonella spp. – All laboratories that reported results for Salmonella spp. correctly reported Salmonella spp. as not detected and received a maximum score of 2.



121 3500 5400 12 Not Detected 2 391 16000 16000 12 Not Detected 2 403 9200 9200 12 Not Detected 2 413 17000 17000 12 Not Detected 2 493 DNP DNP - DNP - 583 22000 17000 12 Not Detected 2 597 2400 9200 12 Not Detected 2 601 7900 7900 12 Not Detected 2 604 DNP DNP - DNP - 649 22000 17000 12 Not Detected 2 651 7000 5400 12 Not Detected 2 653 7900 14000 12 Not Detected 2 658 DNP DNP - DNP - 701 5400 16000 12 Not Detected 2 703 9200 16000 12 Not Detected 2 715 5400 9100 12 NE - 718 11000 11000 12 Not Detected 2 719 4900 3300 12 Not Detected 2 720 9200 16000 12 Not Detected 2 744 11000 3500 12 Not Detected 2 1527 9160 10600 12 - -

RT 44 Page 6 of 18

Distribution SF039: Sample SF0087 Contents Escherichia coli (102), Salmonella London 3,10:l,v;1,6 (103) and Proteus mirabilis (102

).


Median MPN/100g





Reference results 1.1 x 10 1.8 x 103 5.5 x 102 6.6 x 101 2.2 x 103 4 Participants results 7.0 x 10 1.2 x 102 3.5 x 102 4.2x 101 1.4 x 103 4


per 100g. Salmonella spp. - Detected in 25g.

Participants results - SF0087 Table 8 Results reported by participants and scores allocated - SF0087

DNP – Did not register for this distribution, Discussion – SF0087 Participation – Fifteen NRLs, 1 EFTA and 2 accession country laboratories received material for examination. All laboratories returned results and were included in the assessment. Laboratory 1527 did not examine the sample for Salmonella spp.. Laboratory 493, 604 and 658 did not take part in this distribution. E.coli MPN – Seventeen laboratories reported replicate results within the expected range and received a maximum score of 12. Laboratories 701 reported one replicate MPN result between ±3 and ±5 SD of the participants’ median. Salmonella spp. – All laboratories that reported results for Salmonella spp correctly reported Salmonella spp. as detected and received a maximum score of 2.



121 1700 700 12 Detected 2 391 790 790 12 Detected 2 403 2400 1300 12 Detected 2 413 490 490 12 Detected 2 493 DNP DNP - DNP - 583 330 490 12 Detected 2 597 1300 490 12 Detected 2 601 330 490 12 Detected 2 604 DNP DNP - DNP - 649 1700 2400 12 Detected 2 651 1100 1300 12 Detected 2 653 1300 1700 12 Detected 2 658 DNP DNP - DNP - 701 460 80 9 Detected 2 703 230 230 12 Detected 2 715 700 310 12 Detected 2 718 940 330 12 Detected 2 719 700 1100 12 Detected 2 720 1300 1700 12 Detected 2 744 700 1300 12 Detected 2 1527 380 260 12 - -

RT 44 Page 7 of 18

Distribution SF040: Sample SF0088 Contents – Escherichia coli (103), Salmonella Liverpool (serotype 1,3,19:d,e,n,z15) (104), Hafnia spp. (103) and Pseudomonas putida (103

).


per 100g. Salmonella spp. – Detected in 25g.


Median MPN/100g







DNP – Did not register, NR – No results returned. Discussion – SF0088 Participation – Thirteen NRLs, 1 EFTA and 2 accession country laboratories received material for examination. All laboratories returned results and were included in the assessment. Laboratory 1527 did not examine the sample for Salmonella spp.. Laboratory 715 did not return results for this distribution. Laboratory 413, 601, 604 and 658 did not take part in this distribution. E.coli MPN – Thirteen laboratories reported replicate results within the expected range and received a maximum score of 12. Laboratory 583 reported one replicate MPN result as a high censored result. Salmonella spp. – All laboratories that reported results for Salmonella spp. correctly reported Salmonella spp. as detected and received a maximum score of 2.



121 5400 9200 12 Detected 2 391 5400 9200 12 Detected 2 403 2300 7900 12 Detected 2 413 DNP DNP - DNP - 493 11000 11000 12 Detected 2 583 9200 >18000 7 Detected 2 597 3500 5400 12 Detected 2 601 DNP DNP - DNP - 604 DNP DNP - DNP - 649 1100 2400 12 Detected 2 651 4600 3500 12 Detected 2 653 7900 4900 12 Detected 2 658 DNP DNP - DNP - 701 5400 3500 12 Detected 2 703 1700 9200 12 Detected 2 715 NR NR - NR - 718 4900 3300 12 Detected 2 719 13000 11000 12 Detected 2 720 9200 5400 12 Detected 2 744 16000 5400 12 Detected 2 1527 6020 6080 12 - -

RT 44 Page 8 of 18

Distribution SF040: Sample SF0089 Contents – Bacillus pumilus (103), Hafnia alvei (102) and Serratia liquefaciens (102

).

Reference results E. coli MPN – <20 - 0 per 100g. Salmonella spp. – Not detected in 25g. Participants results - SF0089 (Figure 5) Table 11 Results reported by participants and scores allocated - SF0089

DNP – Did not register, NR – No results returned. Discussion – SF0089 Participation - Thirteen NRLs, 1 EFTA and 2 accession country laboratories received material for examination. All laboratories returned results and were included in the assessment. Laboratory 1527 did not examine the sample for Salmonella spp.. Laboratory 715 did not return results for this distribution. Laboratory 413, 601, 604 and 658 did not take part in this distribution. E.coli MPN – All laboratories reported replicate results within the expected range and received a maximum score of 12. Salmonella spp. – All laboratories that reported results for Salmonella spp. correctly reported Salmonella spp. as not detected and received a maximum score of 2. .



121 <20 <20 12 Not detected 2 391 <20 <20 12 Not detected 2 403 <20 <20 12 Not detected 2 413 DNP DNP - DNP - 493 <20 <20 12 Not detected 2 583 <20 <20 12 Not detected 2 597 <18 <18 12 Not detected 2 601 DNP DNP - DNP - 604 DNP DNP - DNP - 649 <20 <20 12 Not detected 2 651 <20 <20 12 Not detected 2 653 <20 <20 12 Not detected 2 658 DNP DNP - DNP - 701 <20 <20 12 Not detected 2 703 <20 <20 12 Not detected 2 715 NR NR - NR - 718 <20 <20 12 Not detected 2 719 <20 <20 12 Not detected 2 720 <20 <20 12 Not detected 2 744 <20 <20 12 Not detected 2 1527 <20 <20 12 - -

RT 44 Page 9 of 18

Participation At the 10th

workshop of microbiological NRLs for bivalve shellfish it was noted (Resolution 12) that the performance of NRLs in PT for E. coli and Salmonella spp. was excellent. The EURL agreed that NRLs may participate in a minimum of 2 distributions each year if showing satisfactory performance. Table 12 shows the participation of NRLs for 2011 with 62% (16 NRLs) participating in 2 or more distributions and 7 NRLs not participating in 1 distribution. The EURL recommends that NRLs not registered to the EURL/HPA scheme should join this scheme.

Table 12 : Number of EURL/HPA EQA distributions analysed by NRLs in 2011

Country Number of EQA distributions

None 1 2 3

Austria Belgium/ Luxembourg Bulgaria Croatia Czech Republic Denmark Finland France Germany Greece Hungary Ireland Italy Italy Latvia Lithuania Netherlands Norway Poland Portugal Romania Slovakia Slovenia Spain Sweden UK

Performance Assessment A cumulative performance assessment was undertaken on participant’s results over two and three distributions for both E. coli MPNs and Salmonella spp. from March 2011 to November 2011 and are summarised in Tables 13 and 14 respectively. For participants analysing the mandatory 2 distributions a year, a performance assessment was based on the rules for participation in 3 distributions, where a cumulative score of >70% identifies good performance. Performance assessment for participation in 2 distributions is under review and a percentage for good performance will be calculated for future reports. Participant’s who achieved <40% of the maximum possible score in a single distribution and <70% over two or three distributions for E. coli enumeration and/or Salmonella spp. detection should in the first instance refer to the troubleshooting guide included as Appendix I.

RT 44 Page 10 of 18

E. coli MPN assessment Eighteen laboratories completed 2 or 3 distributions in 2011 and were therefore subject to a full performance assessment. All laboratories achieved a cumulative total of >70% for the two or three distributions analysed. Table 13 Summary of performance of participants over three distributions, SF038 to SF040 - E. coli

Lab no.


SF0084 SF0085 SF0086 SF0087 SF0088 SF0089 Cumulative score

Max score %

121 12 12 12 12 12 12 72 72 100 391 12 12 12 12 12 12 72 72 100 403 12 12 12 12 12 12 72 72 100 413 12 12 12 12 - - 48 48 100 493 - a - - - 12 12 - - - 583 12 12 12 12 7 12 67 72 93 597 12 12 12 12 12 12 72 72 100 601 12 12 12 12 - - 48 48 100 604 12 a 12 - - - - - - - 649 12 12 12 12 12 12 72 72 100 651 12 12 12 12 12 12 72 72 100 653 12 12 12 12 12 12 72 72 100 658 12 a 12 - - - - - - - 701 12 12 12 9 12 12 69 72 96 703 12 12 12 12 12 12 72 72 100 715 12 12 12 12 - - 48 48 100 718 12 12 12 12 12 12 72 72 100 719 12 12 12 12 12 12 72 72 100 720 12 12 12 12 12 12 72 72 100 744 12 12 12 12 12 12 72 72 100 1527 12 12 12 12 12 12 72 72 100

a

full performance assessment was not carried as laboratories completed less than two distributions during 2011.

RT 44 Page 11 of 18

Salmonella spp. Assessment Sixteen laboratories completed either 2 or 3 distributions in 2011 and were therefore subject to a full performance assessment. All laboratories achieved a cumulative total of >70% for the two or three distributions analysed. Table 14 Summary of performance of particiants over three distributions, SF038 to SF040 Salmonella spp.

Lab no.


SF0084 SF0085 SF0086 SF0087 SF0088 SF0089 Cumulative score

Max score

%

121 2 2 2 2 2 2 12 12 100 391 2 2 2 2 2 2 12 12 100 403 2 2 2 2 2 2 12 12 100 413 2 2 2 2 - - 8 8 100 493 - a - - - 2 2 - - - 583 2 2 2 2 2 2 12 12 100 597 2 2 2 2 2 2 12 12 100 601 2 2 2 2 - - 8 8 100 604 2 a 2 - - - - - - - 649 2 2 2 2 2 2 12 12 100 651 2 2 2 2 2 2 12 12 100 653 2 2 2 2 2 2 12 12 100 658 2 a 2 - - - - - - - 701 2 2 2 2 2 2 12 12 100 703 2 2 2 2 2 2 12 12 100 715 2 a 2 - 2 - - - - - 718 2 2 2 2 2 2 12 12 100 719 2 2 2 2 2 2 12 12 100 720 2 2 2 2 2 2 12 12 100 744 2 2 2 2 2 2 12 12 100 1527 - a - - - - - - - -

a

Summary full performance assessment was not carried as laboratories completed less than two distributions during 2011.

In 2011 Sixteen laboratories completed two or three distributions between March 2011 and November 2011 and therefore were subject to a full performance assessment. For E. coli examination and Salmonella spp. detection all laboratories achieved a score of >70% over two or three distributions.

References Anon 2005. ISO TS 16649-3:2005. Microbiology of food and animal feeding stuffs - Horizontal method for the enumeration of β-glucuronidase-positive Escherichia coli Part 3: Most probable number technique using 5-bromo-4-chloro-3-indolyl-β-D-glucuronide. Geneva, Switzerland . Anon. 2002. ISO 6579:2002. Microbiology of food and animal feeding stuffs - Horizontal method for the detection of Salmonella spp. Geneva, Switzerland. Anon 2003. ISO 16140 Microbiology of food and animal feeding stuffs - Protocol for the validation of alternative methods, Geneva, Switzerland.

RT 44 Page 12 of 18

Figure 1. Distribution SF038: Sample SF0084

RT 44 Page 13 of 18


RT 44 Page 14 of 18


RT 44 Page 15 of 18


RT 44 Page 16 of 18


RT 44 Page 17 of 18

Appendix I: Troubleshooting advice

1. Methods – Ensure that the method used is appropriate for the examination of the sample.

a. Ensure that any dilutions have been calculated correctly. b. Ensure that MPN tables (if used) are interpreted correctly.

2. Culture Medium - Check the quality control data for media to ensure that they are within specifications and

performing adequately. 3. Equipment - Check that the equipment used for the procedures (incubators, refrigerators, measuring instruments)

are calibrated and performing adequately. 4. Staff Training - Check that the staff performing the tests are fully trained and familiar with all the procedural steps. 5. Clerical Procedures - Check that the sample labeling, laboratory numbering and clerical procedures are adequate

have you procedures for ensuring that test results are reported accurately and on time. 6. Accreditation- Check that quality procedures are documented and adhered to at all times. 7. Internal quality controls (IQC) – Ensure that adequate controls are in place and that and documentation for dealing

with IQC failures is appropriate. Further advice can be obtained from the EU-RL on request.

RT 44 Page 18 of 18

Appendix II: E. coli MPN scores allocated to participants returning 2 replicate results


Score allocated Total score Replicate 1 Replicate 2

One replicate MPN result reported is outside the expected range and falls between the median ±3SD and median ±5SD value

2 5 2 9

Both replicates MPN results are outside the expected range and fall between the median ±3SD and median ±5SD value 2 2 2 6

One replicate MPN result reported is outside the median ±5SD value 2 5 0 7

Both replicates MPN results are outside the expected range. The first falls between the median ±3SD and median ±5SD value and the second falls outside the median ±5SD value.

2 2 0 4

Both replicates MPN results reported is outside the median ±5SD value 2 0 0 2

E. coli MPN scores allocated to participants returning 1 single replicate results


Score allocated

Total score

Single replicate MPN result reported is within the expected range 2 5 7

Single replicate MPN result reported only and falls between the median ±3SD and median ±5SD value 2 2 4

Single replicate MPN result reported is outside the median ±5SD value 2 0 2

E. coli score deductions

Result Score deducted

Tube combination inconsistent with MPN reported, ISO 7218 or 5 x 3 MPN tables provided by the EURL. 2

Sample not examined or results returned late - no explanation received 2

High censored result (e.g. MPN = >18000 per 100g) No score allocated Salmonella spp scoring

Result Score allocated

Fully correct results 2 Misleading result, e.g. failure to isolate Salmonella 0













(www.cefas.co.uk)


















• the World Bank


(FAO)









property

.

Head office




Suffolk NR33 0HT UK

Tel +44 (0) 1502 56 2244

Fax +44 (0) 1502 51 3865

Web www.cefas.co.uk





Dorset DT4 8UB

Tel +44 (0) 1305 206600

Fax +44 (0) 1305 206601


Annex IX - The public health implications of real time PCR detection of norovirus in bivalve

molluscan shellfish

ABSTRACT

Norovirus (NoV) cannot be routinely cultured in the laboratory and therefore existing methods for

detection are based on molecular assays. Application of these assays has shown that a high

percentage of bivalve molluscan shellfish (BMS) production areas in the UK are contaminated with

NoV. It is unclear whether detection of viral genome always correlates with presence of whole

infectious virus and thus public health risk.

This project aimed to investigate the significance of detecting norovirus in the environment and in

BMS by real-time PCR. Murine norovirus (MNV), a closely related NoV, was used as a surrogate in

experimental work to determine the behaviour of NoV in the environment and in the BMS matrix in

terms of viability and infectivity. A real-time PCR assay for MNV was developed and characterised,

and was determined to be equivalent to the in-house real-time PCR assay for human NoV at this

laboratory. This assay was then used alongside an existing cell culture method for MNV that was

adopted and optimised in this project. The development of a plaque assay with both sufficient

robustness and sensitivity for application to bioaccumulated oysters was unsuccessful. These

methods, and existing methods for human NoV were used to evaluate environmental persistence of

the human NoV genome, human NoV and its surrogate in seawater under artificial environmental

conditions simulating winter in the United Kingdom (U.K). The ability of Pacific oysters (Crassostrea

gigas) to bioaccumulate both untreated and heat treated NoV particles (from human faeces) and

RNA fragments was compared using real-time PCR. Finally, the potential application and

incorporation of a pre-extraction treatment into the BMS testing method was assessed.

The results presented in this project indicated that NoV RNA may reside in seawater for up to 2

weeks, and that there was no significant difference between the rates of degradation in seawater of

naked RNA transcripts and NoV particles from faecal material. However MNV-1 persisted longer in

seawater than human NoV under the same conditions. The results presented also indicated that

BMS bioaccumulate NoV RNA fragments signifcantly less efficiently than NoV particles from faecal

material. Furthermore, the uptake of untreated human NoV and MNV occurred at similar rates to

the uptake of heat-treated viruses. It was also determined that using RNaseONE as a pre-extraction

treatment to remove PCR signal from ‘free’ RNA and damaged viruses provided scope for the

inclusion into the BMS testing method to provide a better prediction of human health risk, however

further work would be required to demonstrate its efficacy in a standardised method.













(www.cefas.defra.gov.uk)
















international and UK government departments

the European Commission

the World Bank

Food and Agriculture Organisation of the United Nations

(FAO)

oil, water, chemical, pharmaceutical, agro-chemical,


non-governmental and environmental organisations

regulators and enforcement agencies

local authorities and other public bodies




property

.

Head office




Suffolk NR33 0HT UK

Tel +44 (0) 1502 56 2244

Fax +44 (0) 1502 51 3865

Web www.cefas.defra.gov.uk





Dorset DT4 8UB

Tel +44 (0) 1305 206600

Fax +44 (0) 1305 206601


http://www.cefas.defra.gov.uk/

http://www.cefastechnology.co.uk/

European Union Reference Laboratory for Monitoring ... · PDF fileEuropean Union Reference...

Documents

Transcript of European Union Reference Laboratory for Monitoring ... · PDF fileEuropean Union Reference...