et al. (2013). Plant Cell 10.1105/tpc.113.117192 · 2013-11-20 · Mimulus guttatus Popolus...
Transcript of et al. (2013). Plant Cell 10.1105/tpc.113.117192 · 2013-11-20 · Mimulus guttatus Popolus...
Supplemental Data. Hackenberg et al. (2013). Plant Cell 10.1105/tpc.113.117192
Page 1 of 16
Supplemental Data. Hackenberg et al. (2013). Plant Cell 10.1105/tpc.113.117192
Page 2 of 16
Supplemental Figure 1. Complementation of the nca1 mutant phenotype.
(A) Two-week old seedlings grown on plates without hydroxyurea. The genotype is indicated
in the top left corner and the construct introduced is shown in the lower left corner where
applicable. The nca1 mutants are characterized by their small size and yellow cotelydons. Pp:
Physcomitrella patens. Scale bar is 1 mm. All images are to scale. (B) Catalase activities of
nca1-1 mutants carrying the indicated constructs. Three independent transgenic lines were
used as biological replicates and each was measured in technical triplicates. Error bars
indicate SEM. One-way ANOVA followed by Dunnett's post test was used to calculate p-
values. (*: P < 0.05, **: P < 0.01). (C) Ion leakage on challenge with Pto DC3000 (avrRpm1).
Two independent lines, O1 and O2, are shown. These two lines were assayed in the
experiment illustrated in Figure 2A and therefore the Col-0, nca1-1 and rpm1-3 data is
identical to that in Figure 2A.
Supplemental Data. Hackenberg et al. (2013). Plant Cell 10.1105/tpc.113.117192
Page 3 of 16
Species Accession number Arabidopsis thaliana Ath: AT3G54360 NCA1 Arabidopsis lyrata Aly:485837 Cucumis sativus Csa:Cucsa.281150.1 Glycine max 1 Gma:Glyma04g15130.1 Glycine max 2 Gma:Glyma06g47010.1 Mimulus guttatus Mgu:mgf005331m Popolus trichocarpa 1 Ptr:POPTR_0003s18860.1 Popolus trichocarpa 2 Ptr:POPTR_0001s07350.1 Manihot esculenta Mes:cassava1463.valid.m1 Ricinus communis Rco:29686.m000895 Zea mays Zma:GRMZM2G049672_P03 Sorghum bicolor 1 Sbi:Sb03g008890.1 Sorghum bicolor 2 Sbi:Sb07g001060.1 Brachypodium distachyon 1 Bdi:Bradi1g33800.1 Brachypodium distachyon 2 Bdi:Bradi1g09110.1 Oryza sativa 1 Osa:LOC_Os02g55200.2 Oryza sativa 2 Osa:LOC_Os01g01420.2 Physcomitrella patens Ppa:115595 Selaginella moellendorfii Smo:154638
Supplemental Figure 2. NCA1 phylogeny.
Phylogenetic tree of NCA1-related protein sequences. Numbers at nodes show bootstrap
confidence values with 1000 indicated maximum confidence. The bar shows an evolutionary
distance corresponding to 0.2 amino acid substitutions per site. Species used in this study are
shown in bold.
1000
572872
611
1000998
1000
995
1000978
1000
1000
1000
0,200
580
1000
1000
Magnoliophyta
eudicotyledons
monocotyledons
Arabidopsis thalianaArabidopsis lyrataCucumis sativusGlycine max 1Glycine max 2Mimulus guttatusPopolus trichocarpa 1Popolus trichocarpa 2Manihot esculentaRicinus communisZea maysSorghum bicolor 1Sorghum bicolor 2Brachypodium distachyon 1Brachypodium distachyon 2Oryza sativa 1Oryza sativa 2Physcomitrella patensSelaginella moellendorfii
Supplemental Data. Hackenberg et al. (2013). Plant Cell 10.1105/tpc.113.117192
Page 4 of 16
Ch
r
Po
sition
Ref b
ase
Called
base
Peak d
istance
Co
re sup
po
rt
Co
nco
rdan
ce
Base q
uality
SN
P typ
e
Locatio
n
Gen
e ID
Isofo
rm
OR
F po
sition
Co
do
n p
ositio
n
Co
do
n ch
ang
e
wt A
A
mu
t AA
3 6642770 G A 23485 3 1.00 40 NEWSNP CDS AT3G19190 1 1878 3 Nonsyn W * 3 6691289 G A 25034 3 1.00 40 NEWSNP intronic/noncoding AT3G19300 1 3 6710942 G A 44687 4 1.00 40 NEWSNP intronic/noncoding AT3G19370 1 3 6896641 G A 230386 4 1.00 40 NEWSNP intronic/noncoding AT3G19840 1 3 6918098 G A 251843 6 1.00 40 NEWSNP intronic/noncoding AT3G19895 1 3 6308262 G A 357993 7 1.00 40 NEWSNP CDS AT3G18370 1 889 1 Nonsyn V I 3 7028540 T G 362285 3 1.00 40 NEWSNP CDS AT3G20130 1 1469 2 Nonsyn V G 3 6271374 G T 394881 3 1.00 40 NEWSNP intergenic 3 7081829 G A 415574 5 1.00 40 NEWSNP five_prime_UTR AT3G20300 1 3 6231373 G A 434882 5 1.00 40 NEWSNP CDS AT3G18180 1 902 2 Nonsyn R Q 3 6200949 G A 465306 5 1.00 40 NEWSNP CDS AT3G18100 1 255 3 Syn A A 3 7185705 G A 519450 7 1.00 40 NEWSNP CDS AT3G20560 1 1047 3 Syn K K 3 6106333 G A 559922 3 1.00 40 NEWSNP CDS AT3G17840 1 236 2 Nonsyn G D 3 6101106 G C 565149 4 0.80 40 NEWSNP intergenic 3 6101102 A T 565153 4 0.80 40 NEWSNP intergenic 3 6073730 T A 592525 3 1.00 40 NEWSNP intergenic 3 7306635 G A 640380 7 1.00 40 NEWSNP intronic/noncoding AT3G20860 1 3 7517355 G A 851100 4 1.00 40 NEWSNP CDS AT3G21350 1 244 1 Nonsyn D N 3 7739220 T G 1072965 4 0.80 40 NEWSNP intergenic 3 7739221 T C 1072966 4 0.80 40 NEWSNP intergenic
Supplemental Table 1. SHOREmap output for the atg2-3 mutant. Candidate polymorphisms
for the hydroxyurea resistant mutant with normal catalase activity levels (atg2-3) are shown
prioritized with respect to the allele frequency peak (Peak distance).
Supplemental Data. Hackenberg et al. (2013). Plant Cell 10.1105/tpc.113.117192
Page 5 of 16
Ch
r
Po
sition
Ref b
ase
Called
base
Peak d
istance
Co
re sup
po
rt
Co
nco
rdan
ce
Base q
uality
SN
P typ
e
Locatio
n
Gen
e ID
Isofo
rm
OR
F po
sition
Co
do
n p
ositio
n
Co
do
n ch
ang
e
wt A
A
mu
t AA
3 20140743 C T 93688 3 1.0 40 NEWSNP CDS AT3G54360 1 896 2 Nonsyn G E 3 19898935 C T 148120 3 1.0 40 NEWSNP CDS AT3G53640 1 979 1 Nonsyn A T 3 19681433 C T 365622 9 1.0 40 NEWSNP intergenic 3 19598989 C T 448066 10 1.0 40 NEWSNP CDS AT3G52850 1 13 1 Nonsyn L F 3 19589130 C G 457925 4 0.8 40 NEWSNP CDS AT3G52830 1 148 1 Nonsyn L V 3 19570913 G A 476142 5 1.0 40 NEWSNP intergenic 3 20573676 C T 526621 4 1.0 40 NEWSNP intronic/noncoding AT3G55460 1 3 20744362 A T 697307 4 1.0 40 REFERR intronic/noncoding AT3G55870 1 3 20765256 C T 718201 6 1.0 40 NEWSNP CDS AT3G55950 1 2071 1 Nonsyn D N 3 20805990 A T 758935 4 1.0 40 REFERR CDS AT3G56040 1 1590 3 Nonsyn D G 3 20805991 T C 758936 4 1.0 40 REFERR CDS AT3G56040 1 1589 2 Nonsyn D G 3 19260194 T G 786861 3 1.0 40 REFERR Intergenic 3 19219272 A C 827783 7 1.0 40 REFERR five_prime_UTR AT3G51780 1 3 19219271 A G 827784 7 1.0 40 REFERR five_prime_UTR AT3G51780 1 3 19217855 A T 829200 5 1.0 40 REFERR three_prime_UTR AT3G51780 1 3 19217852 A T 829203 6 1.0 40 REFERR three_prime_UTR AT3G51780 1 3 19217851 A T 829204 6 1.0 40 REFERR three_prime_UTR AT3G51780 1 3 19197345 C T 849710 6 1.0 40 NEWSNP CDS AT3G51720 1 1072 1 Nonsyn L F 3 19093682 G T 953373 4 1.0 40 NEWSNP intergenic 3 19003919 C G 1043136 4 0.8 40 REFERR intergenic
Supplemental Table 2. SHOREmap output for the nca1-1 mutant. The candidate mutations
are prioritized with respect to the allele frequency peak (Peak distance).
Supplemental Data. Hackenberg et al. (2013). Plant Cell 10.1105/tpc.113.117192
Page 6 of 16
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 S. bicolor 1 1 90 85 77 79 72 74 52 53 53 51 51 53 53 51 53 51 46 39 Z. mays 2 90 90 81 77 76 77 54 55 55 53 53 54 54 53 54 52 48 40 S. bicolor 2 3 85 90 79 76 74 76 54 54 54 53 53 54 54 54 54 53 48 39 B. distachyon 2 4 77 81 79 91 74 76 55 56 56 54 53 56 55 53 54 52 46 40 B. distachyon 1 5 79 77 76 91 69 71 52 54 54 52 51 54 54 52 53 51 45 38 O. sativa 2 6 72 76 74 74 69 92 57 58 58 52 53 57 57 52 53 52 47 41 O. sativa 1 7 74 77 76 76 71 92 57 58 58 53 54 56 56 52 54 52 49 42 M. guttatus 8 52 54 54 55 52 57 57 70 69 60 67 70 69 57 56 55 44 42 G. max 1 9 53 55 54 56 54 58 58 70 96 65 68 70 71 60 60 59 47 43 G. max 2 10 53 55 54 56 54 58 58 69 96 65 67 70 71 58 60 58 46 43 R. communis 11 51 53 53 54 52 52 53 60 65 65 75 71 72 60 56 56 47 41 M. esculenta 12 51 53 53 53 51 53 54 67 68 67 75 75 76 60 59 58 48 42 P. trichocarpa 2 13 53 54 54 56 54 57 56 70 70 70 71 75 89 60 60 58 45 41 P. trichocarpa 1 14 53 54 54 55 54 57 56 69 71 71 72 76 89 60 59 58 44 42 C. sativus 15 51 53 54 53 52 52 52 57 60 58 60 60 60 60 64 65 46 39 A. thaliana 16 53 54 54 54 53 53 54 56 60 60 56 59 60 59 64 92 46 38 A. lyrata 17 51 52 53 52 51 52 52 55 59 58 56 58 58 58 65 92 46 38 P. patens 18 46 48 48 46 45 47 49 44 47 46 47 48 45 44 46 46 46 45 S. moellendorfii 19 39 40 39 40 38 41 42 42 43 43 41 42 41 42 39 38 38 45
Supplemental Table 3. Comparison of NCA1 protein sequences across species. Percent
amino acid identity is shown. Accession numbers for individual sequences are given in
Supplemental figure 2.
Supplemental Data. Hackenberg et al. (2013). Plant Cell 10.1105/tpc.113.117192
Page 7 of 16
Supplemental Table 4. Unique catalase peptides. Replicate indicates the biological replicate
number. *No unique CAT2 peptides were detected in the cat2 mutant.
Peptide'sequence cat2/wt ncat1/wt Replicate Peptide'sequence cat2/wt ncat1/wt Replicate
CAT1 %& %& %& %& CAT3 dGIQFPDVVHALkPNPk 13.1% 9.5% 1yRPSSAYNAPFYTTNGGAPVSNNISSLTIGER 50.3% 47.7% 1
CAT2 gPILLEDYHLVEk ND* 15.3% 2 yRPSSAYNAPFYTTnGGAPVSNNISSLTIGER 71.7% 65.2% 1gPILLEDYHLVEk ND* 5.3% 2 iFAYGDTQR 46.1% 30.9% 2fPDMVHALkPNPk ND* 1.8% 2 tNIQEYWR 48.5% 33.2% 2fPDMVHALkPNPk ND* 1.8% 3 tNIQEYWR 43.3% 34.5% 2
CAT2%average 6.1% aPGVQTPVIVR 56.5% 60.3% 2aPGVQTPVIVR 40.8% 30.2% 2
CAT3 iFAYGDTQR 16.6% 19.6% 1 aPGVQTPVIVR 34.1% 27.8% 2tNIQEYWR 28.5% 27.8% 1 vPTPTNSYTGIR 48.1% 23.0% 2aPGVQTPVIVR 32.5% 33.9% 1 gPVLLEDYHLIEk 43.5% 20.2% 2eGNFDLVGNNTPVFFIR 18.1% 10.6% 1 gPVLLEDYHLIEk 45.6% 18.4% 2iFAYGDTQR 50.4% 36.9% 1 gPVLLEDYHLIEk 48.3% 20.2% 2tNIQEYWR 23.6% 20.7% 1 vPTPTNSYTGIR 49.0% 26.6% 2aPGVQTPVIVR 18.7% 14.7% 1 vPTPTNSYTGIR 45.6% 21.7% 2vPTPTNSYTGIR 34.9% 22.8% 1 eGNFDLVGNNTPVFFIR 53.7% 55.8% 2eGNFDLVGNNTPVFFIR 9.5% 7.0% 1 dLHDAIASGNYPEWk 79.8% 88.7% 2gPVLLEDYHLIEk 14.1% 8.8% 1 dGIQFPDVVHALkPNPk 44.1% 22.5% 2iFAYGDTQR 5.1% 10.3% 1 aPGVQTPVIVR 25.9% 14.7% 3tNIQEYWR 26.8% 16.1% 1 aPGVQTPVIVR 29.7% 16.1% 3aPGVQTPVIVR 50.9% 52.5% 1 vPTPTNSYTGIR 35.5% 16.0% 3eGNFDLVGNNTPVFFIR 11.1% 6.7% 1 tNIQEYWR 46.8% 33.6% 3vPTPTNSYTGIR 23.4% 15.6% 1 aPGVQTPVIVR 27.2% 17.1% 3gPVLLEDYHLIEk 19.0% 10.6% 1 eGNFDLVGNNTPVFFIR 25.1% 10.7% 3dLHDAIASGNYPEWk 36.0% 38.2% 1 aPGVQTPVIVR 27.8% 14.4% 3vPTPTNSYTGIR 19.6% 9.0% 1 vPTPTNSYTGIR 33.5% 17.0% 3vPTPTNSYTGIR 27.7% 16.0% 1 tNIQEYWR 44.0% 27.8% 3hMEGFGVHTYTLIAk 18.5% 11.7% 1 aPGVQTPVIVR 38.9% 29.8% 3eGNFDLVGNNTPVFFIR 46.7% 37.4% 1 eGNFDLVGNNTPVFFIR 24.6% 7.6% 3sWAPDRQDR 6.1% 3.7% 1 aPGVQTPVIVR 25.1% 15.3% 3dLHDAIASGNYPEWk 50.7% 38.3% 1 vPTPTNSYTGIR 32.1% 14.2% 3dLHDAIASGNYPEWk 17.3% 11.0% 1 fHWkPTcGIk 31.7% 12.0% 3dGIQFPDVVHALkPNPk 11.1% 8.7% 1 dLHDAIASGNYPEWk 33.7% 19.4% 3
continues)next)column dLHDAIASGNYPEWk 44.1% 28.5% 3CAT3%average 34.0% 24.1%
Supplemental Data. Hackenberg et al. (2013). Plant Cell 10.1105/tpc.113.117192
Page 8 of 16
Biological replicate 114 115 116 117
1 wild type cat2 nca1 1/3 wild type, cat2, and nca1
2 wild type cat2 nca1 1/3 wild type, cat2, and nca1
3 wild type cat2 nca1 1/3 wild type, cat2, and nca1
Supplemental Table 5. iTRAQ proteomics experiment setup. Four technical replicates were
performed for each of the three biological replicates. The resulting data can be found in
Supplemental Data Set 2 online.
Supplemental Data. Hackenberg et al. (2013). Plant Cell 10.1105/tpc.113.117192
Page 9 of 16
Name Sequence Target gene Used with Purpose
PM-01910 TTACGAAGGCGGTGTTTTTC At5g25760 PM-01911 transcript quantification
PM-01911 CAAGCAGGACTCCAAGCATT At5g25760 PM-01910 transcript quantification
PM-01912 TGCGAAATACCGAACATCAA At1g13320 PM-01913 transcript quantification
PM-01913 GGCCAAAATGATGCAATCTC At1g13320 PM-01912 transcript quantification
PM-01794 TTCAAACCCGTGTCTTCTCC At3g35090 (CAT2 ) PM-02549 transcript quantification
PM-02549 TTCTCAGCATGACGAACCTG At3g35090 (CAT2 ) PM-01794 transcript quantification
PM-04120 ttaaGGTACCcttgcaacacgtttcatctacg At3g54360 (NCA1) PM-04284 amplify pNCA1
PM-04284 atatAAGCTTtcgtgaaggtagcaacaacc At3g54360 (NCA1) PM-04120 amplify pNCA1
PM-04453 tataAAGCTTAAAGCAGGCTTCATGGTGAG eYFP PM-04454 amplify eYFP
PM-04454 tataAAGCTTTgtggtggtggtggtggtgGTACAGCTCGTCCATGCC
eYFP PM-04453 amplify eYFP
PM-03812 GGGGACAAGTTTGTACAAAAAAGCAGGCTCTATGACGACGACTTCTGTTTGC
At3g54360 (NCA1) PM-03815 amplify NCA1 cDNA & gDNA
PM-03815 GGGGACCACTTTGTACAAGAAAGCTGGGTTttcacagctgtagccgctta
At3g54360 (NCA1) PM-03812 amplify NCA1 gDNA
PM-03813 GGGGACCACTTTGTACAAGAAAGCTGGGTTTTAGAGTGCAGTTTCAGCATCG
At3g54360 (NCA1) PM-03812 amplify NCA1 cDNA
PM-03858 GGGGACAAGTTTGTACAAAAAAGCAGGCTCTATGGAAGTTTGTGAGGCGAAAG
PP_12622_C1 PM-03859 amplify PpNCA1 cDNA
PM-03859 GGGGACCACTTTGTACAAGAAAGCTGGGTTCTATGATGCAGAGTCGGTGAGC
PP_12622_C1 PM-03858 amplify PpNCA1 cDNA
PM-03807 GGGGACAAGTTTGTACAAAAAAGCAGGCTCTATGGATCCTTACAAGTATCGTC
At3g35090 (CAT2 ) PM-03808 amplify CAT2 cDNA
PM-03808 GGGGACCACTTTGTACAAGAAAGCTGGGTTTTAGATGCTTGGTCTCACGTTC
At3g35090 (CAT2 ) PM-03807 amplify CAT2 cDNA
PM-04122 TTAAGGTACCAGAAAATTGTTAAGACCAAACTACCC
At3g35090 (CAT2 ) PM-04285 amplify CAT2 promoter
PM-04285 ATATAAGCTTGGTTTGATGAGAAGAGAGCTTG
At3g35090 (CAT2 ) PM-04122 amplify CAT2 promoter
Supplemental Table 6. Oligonucleotide sequences.
Supplemental Data. Hackenberg et al. (2013). Plant Cell 10.1105/tpc.113.117192
Page 10 of 16
Gene Mutant Background Gene ID References NCA1 nca1-‐1 Col-‐0 At3g54360 current study NCA1 nca1-‐2 Col-‐0 At3g54360 current study CAT2 cat2-‐2 Col-‐0 At4g35090 5,6 NDR1 ndr1-‐1 Col-‐0 At3g20600 7
EDS1 eds1-‐1 Ws At3g48090 8
RPM1 rpm1-‐3 Col-‐0 At3g07040 9
ATG2 atg2-‐1 Col-‐0 At3g19190 10
ATG2 atg2-‐3 Col-‐0 At3g19190 current study ATG4A and ATG4B atg4a4b-‐1 Ws At2g44140, At3g59950 11
ATG5 atg5-‐1 Col-‐0 At5g17290 11
ATG7 atg7-‐1 Ws At5g45900 12
CAT1 -‐ -‐ At1g20630 -‐ CAT3 -‐ -‐ At1g20620 -‐ PEX4 -‐ -‐ At5g25760 13 PP2A -‐ -‐ At1g13320 13 UGT74E2 -‐ -‐ At1g05680 14 FES1A -‐ -‐ At3g09350 15
Supplemental Table 7. Accession numbers.
Supplemental Data. Hackenberg et al. (2013). Plant Cell 10.1105/tpc.113.117192
Page 11 of 16
Supplemental experimental procedures
Phylogenetic analysis
The phytozome family 23259700 comprises twenty-one protein member sequences, which
were downloaded from phytozome.net. The sequence Cpa:evm.model.supercontig_33.143
was disregarded, as it appears to be a partial sequence. For the sequence
Mes:cassava1463.valid.m1, the N-terminal part of the sequences up until the consensus start
methionine was disregarded to include only coding sequence. The phylogenetic tree was
generated by aligning using the T-Coffee and UPGMA implementations in CLC workbench
v. 5.6 with standard settings and 1000-fold bootstrap testing.
Cloning NCA1 and CAT2 constructs
The NCA1 promoter was amplified from Col-0 gDNA and cloned into a pGreen00291 vector
carrying a Gateway (GW) cassette using restriction sites KpnI and HindIII followed by eYFP2
amplification and cloning into the pGreen0029-pNCA1-GW plasmid using the HindIII site to
construct a pGreen0029-pNCA1-eYFP-GW (pMC-00637) plasmid. The same strategy was
used for cloning the CAT2 promoter to construct the pGreen0029-pCAT2-eYFP-GW (PMC-
00642) plasmid. NCA1 gDNA excluding promoter was amplified from Col-0 gDNA and
recombined into the pMC-00637 plasmid to create the pGreen0029-pNCA1-eYFP-NCA1
(pMC-00638, pNCA1:NCA1) in-frame fusion expression construct. NCA1 cDNA was
amplified from the U13379 clone, obtained from the Arabidopsis Biological Resource Center,
Columbus, USA and then recombined into a pEarleyGate1043 vector to create the
Supplemental Data. Hackenberg et al. (2013). Plant Cell 10.1105/tpc.113.117192
Page 12 of 16
pEarleyGate-35S-YFP-NCA1 (pMC-00570, 35S:NCA1) construct. P. patens NCA1 cDNA
was amplified from RNA extracted as described4 and recombined into pEarleyGate104 to
create the pEarleyGate-35S-YFP-PpNCA1 (pMC-00588, 35S:PpNCA1) construct. CAT2
cDNA was amplified from RNA extracted as described4 and recombined into PMC-00642 to
create the pGreen0029-pCAT2-eYFP-CAT2 (PMC-00647) expression construct.
iTRAQ proteomics
Samples were kept on ice and centrifuged at 4°C throughout the protein extraction procedure.
For each of the three biological replicates, between 50 and 60 mg of leaves were transferred
to 400 µL of PBS and ground using the Tissuelyser (Qiagen) for 3 min. Then, the sample was
centrifuged for 5 min at 14,000g and the supernatant was transferred and centrifuged at
100,000g for 45 min. The supernatant was transferred and (2 % SDS and 0.1g/mL sucrose)
were added to a final volume of 500 µL, mixed 1:1 with phenol (AppliChem, pH 8.0),
vortexed, and centrifuged at 10,000g for 5 min. The lower phase was transferred and proteins
were precipitated using 5 volumes of pre-chilled (-20°C) 100 mM ammonium acetate in
methanol for 30 min at - 20°C and centrifuged at 10.000g for 5 min. The pellet was washed
twice in 100 mM ice-cold ammonium acetate in methanol and twice in 80% acetone. The
pellet was dried and re-dissolved in 50 µL sample buffer (7 M urea, 2 M thiourea, and 200
mM triethylammonium hydrogen bicarbonate buffer (TEAB)) for 3 hours and the protein
concentration was determined using Qubit Quantitation Kit (Invitrogen). The disulfide bonds
were reduced using 10 mM DTT for 1 hour at 25°C followed by alkylation using 40 mM
iodoacetamide for 40 min in the dark. Then, 50 µg protein was transferred and diluted to 1 M
urea and digested overnight at 37°C with 1:50 of trypsin (Promega). A final concentration of
Supplemental Data. Hackenberg et al. (2013). Plant Cell 10.1105/tpc.113.117192
Page 13 of 16
1 % FA was added and clean-up of peptides was performed using half of POROS 50 R2 and
POROS 50 R3 as previously described (Larsen et al., 2002) and dried. Peptides were
redissolved in 50 µL 200 mM TEAB (pH 8,5) and the peptide concentration was determined
using Qubit Quantitation Kit (Invitrogen). The labelling with the 4-plex iTRAQ reagents
(Applied Biosystems) was performed according to the manufacturer’s recommendations. To
each vial, 70 µL of ethanol was added, combined with peptides, and incubated 1 hour and
dried. Supplemental table S6 shows the experimental set-up together with the amount of
peptides used for each biological replicate. Prior to LC-MS, peptides were redissolved in (90
% acetonitrile and 0.1 % TFA) and cleaned up and fractionated using a TSK Amide-80 HILIC
column in a microHPLC system as previously described (Palmisano et al., 2010).
Then, the labelled peptides were redissolved in mobile phase A buffer (aqueous 0.1 % formic
acid) for the LC-MS/MS analysis. A nanoflow RP HPLC (EASY-nanoLC, Proxeon
Biosystems, Denmark) in line with a nano-electrospray LTQ-Orbitrap XL mass spectrometer
(Thermo Fisher Scientific, USA) was used. The labelled peptides were separated on a two
column system with a C18 pre- and analytical column (home-packed with either ReproSil-Pur
(5 µm material) or C18-AQ (3 µm material)). The labelled peptides were either analysed as
one total fraction (3 µg peptides) or separated into ten sub-fractions where each sub-fraction
was analysed individually and subsequently combined. For elution, a 150 min gradient for the
total fraction and a 100 min gradient for the sub-fraction from 0 % to 28 % of mobile phase B
buffer (0.1 % formic acid in acetonitrile) was used with a constant flow of 250 nl/min. Mass
spectra were generated in the positive ion mode with data dependent acquisition. Survey MS
scans in the m/z range 400–1800 were acquired in the Orbitrap at a resolution of 60000 at 400
m/z. Data-dependent collision induced dissociation (CID) MS/MS analysis of the three most
Supplemental Data. Hackenberg et al. (2013). Plant Cell 10.1105/tpc.113.117192
Page 14 of 16
intense ions was performed in the LTQ followed by higher energy collision dissociation
(HCD) MS/MS analysis of the corresponding ions with detection in the Orbitrap.
For MS/MS, the instrument was set at 30.000 at 400 m/z resolution, 15.000 signal threshold,
500-ms maximum ion injection time, 2.5 m/z isolation width, 30-ms activation time at 35
normalized collision energy and dynamic exclusion enabled for 30 s with a repeat count of 1
to do CID. MS/MS for acquiring HCD was set at 7,500 at 400 m/z resolution, 30.000 signal
threshold, 5-ms activation time at 48 normalized collision energy and dynamic exclusion
enabled for 30 s with a repeat count of 1.
Finally, the raw data were deconvoluted and converted into peak lists by ProteomeDiscoverer
software version 1.2 (Thermo Scientific), which were then used for searches against the
Arabidopsis proteome using Mascot version 2.3. The searches were performed with the
following parameters: MS accuracy 10 ppm, MS/MS accuracy 0.6 Da for CID and 0.1 Da for
HCD, trypsin digestion, two missed cleavage allowed and fixed carbamidomethyl
modification of cysteine. Variable modifications were oxidized methionine together with
iTRAQ 4plex (monoisotopic mass = 144.102) for N-terminus and lys amino acid residues.
iTRAQ quantification was performed using Proteome Discoverer based in reporter ion
integration within 50 ppm window.
Supplemental Data. Hackenberg et al. (2013). Plant Cell 10.1105/tpc.113.117192
Page 15 of 16
Supplemental references:
1 Hellens, R. P., Edwards, E. A., Leyland, N. R., Bean, S. & Mullineaux, P. M. pGreen: a versatile and flexible binary Ti vector for Agrobacterium-mediated plant transformation. Plant Mol Biol 42, 819-832 (2000).
2 Shaner, N. C. et al. Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat Biotechnol 22, 1567-1572, doi:10.1038/nbt1037 (2004).
3 Earley, K. W. et al. Gateway-compatible vectors for plant functional genomics and proteomics. Plant J 45, 616-629, doi:10.1111/j.1365-313X.2005.02617.x (2006).
4 Cove, D. J. et al. Isolation of DNA, RNA, and protein from the moss Physcomitrella patens gametophytes. Cold Spring Harb Protoc 2009, pdb.prot5146, doi:10.1101/pdb.prot5146 (2009).
5 Bueso, E. et al. The lithium tolerance of the Arabidopsis cat2 mutant reveals a cross-talk between oxidative stress and ethylene. Plant J 52, 1052-1065, doi:10.1111/j.1365-313X.2007.03305.x (2007).
6 Queval, G. et al. Conditional oxidative stress responses in the Arabidopsis photorespiratory mutant cat2 demonstrate that redox state is a key modulator of daylength-dependent gene expression, and define photoperiod as a crucial factor in the regulation of H2O2-induced cell death. Plant J 52, 640-657, doi:10.1111/j.1365-313X.2007.03263.x (2007).
7 Century, K. S. et al. NDR1, a pathogen-induced component required for Arabidopsis disease resistance. Science 278, 1963-1965 (1997).
8 Aarts, N. et al. Different requirements for EDS1 and NDR1 by disease resistance genes define at least two R gene-mediated signaling pathways in Arabidopsis. Proc Natl Acad Sci USA 95, 10306-10311 (1998).
9 Grant, M. R. et al. Structure of the Arabidopsis RPM1 gene enabling dual specificity disease resistance. Science 269, 843-846 (1995).
10 Yoshimoto, K. et al. Autophagy negatively regulates cell death by controlling NPR1-dependent salicylic acid signaling during senescence and the innate immune response in Arabidopsis. Plant Cell 21, 2914-2927, doi:10.1105/tpc.109.068635 (2009).
11 Yoshimoto, K. et al. Processing of ATG8s, ubiquitin-like proteins, and their deconjugation by ATG4s are essential for plant autophagy. Plant Cell 16, 2967-2983, doi:10.1105/tpc.104.025395 (2004).
12 Doelling, J. H., Walker, J. M., Friedman, E. M., Thompson, A. R. & Vierstra, R. D. The APG8/12-activating enzyme APG7 is required for proper nutrient recycling and senescence in Arabidopsis thaliana. J Biol Chem 277, 33105-33114, doi:10.1074/jbc.M204630200 (2002).
13 Czechowski, T., Stitt, M., Altmann, T., Udvardi, M. K. & Scheible, W.-R. Genome-wide identification and testing of superior reference genes for transcript normalization in Arabidopsis. Plant Physiol 139, 5-17, doi:10.1104/pp.105.063743 (2005).
14 Tognetti, V. B. et al. Perturbation of indole-3-butyric acid homeostasis by the UDP-glucosyltransferase UGT74E2 modulates Arabidopsis architecture and water stress tolerance. Plant Cell 22, 2660-2679, doi:10.1105/tpc.109.071316 (2010).
Supplemental Data. Hackenberg et al. (2013). Plant Cell 10.1105/tpc.113.117192
Page 16 of 16
15 Inzé, A. et al. A subcellular localization compendium of hydrogen peroxide-induced proteins. Plant Cell Environ 35, 308-320, doi:10.1111/j.1365-3040.2011.02323.x (2012).