Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación...
Transcript of Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación...
![Page 1: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/1.jpg)
Angel CarracedoFundación Gallega de Medicina Genómica
(SERGAS)
CeGen-ISCIII Universidad de Santiago
Estudio de asociación genética en la leucemia linfocítica crónica
XXXV REUNION DE LA ASOCIACION GALLEGA DE
HEMATOLOGIA Y HEMOTERAPIA. FERROL, MARZO 2011
![Page 2: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/2.jpg)
![Page 3: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/3.jpg)
Biological Complex Systems
• Why is it so complicated?
• Can we make sense of this complexity?
• Can we convey our understanding of this complexity?
![Page 4: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/4.jpg)
Geness
Proteome
microRNA
Epigenetics
Environment
Systems
biology
Transcriptome
Genotype
Phenotype
Enviroment
![Page 5: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/5.jpg)
Genes40%
Environment60%
CONTENT
- How to look for the genetic component of a disease
-An example with CLL
Better understanding of mendelian andcomplex disease
Better classification of diseases
Risk stratification
Pharmacogenetics and pharmacogenomics
![Page 6: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/6.jpg)
Allelic heterogeneity
Locus heterogeneity
Phenocopy
Phenotypic variability
Trait heterogeneity
Gene-gene interactions
Gene-environment
interactions
How to look for low penetrance genes?
![Page 7: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/7.jpg)
Genetic Strategies
Traditional (from the 1980s or earlier)
– Linkage analysis on pedigrees
– Allele-sharing methods: candidate genes, genome screen
– Association studies: candidate genes
– Animal models: identifying candidate genes
Newer (from the 1990s)
– Focus on special populations Haplotype-sharing (Jesus M. Hernández-Fam. Gam.)
– Congenic/consomic lines in mice (new for complex traits)-Animal models
– Single-nucleotide polymorphism (SNPs)-Whole genome scans (Association studies)
– Admixture mapping
– Functional analyses: finding candidate genes
![Page 8: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/8.jpg)
mag
nit
ud
e o
f ef
fect
frequency of trait in the population
Linkage analysis of families
association studies in populations
obtainable sample size
Linkage analysis or association studies ?
•linkage analysis is usually more robust in the identification
of mendelian traits
• association studies have more power to detect genes with
small effects (Risch & Merikangas, Science 1996)
![Page 9: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/9.jpg)
Phenotype A Phenotype B
Allele 1 Allele 2
SNP A is associated with Phenotype
SNP A:
Allele 1 =
Allele 2 =
Human Genetic Association Study Design
![Page 10: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/10.jpg)
• 1,000,000 SNPs
SNP: SINGLE NUCLEOTIDE POLYMORPHISM
ATCGGCGTACCTGATTCCGAATCCGTATCG
ATCGGCGTACCTGAATCCGAATCCGTATCG
1000 PERSONAS -1,000,000 SNPS = 1,000 MILLONES DE ANÁLISIS Y DE DATOS
![Page 11: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/11.jpg)
Characteristics of SNP Variation
• Clustering is observed on
all the autosomes:Haplotype blocks: Blocks
with little evidence
of recombination
• Some clusters appear
functional : MHC on
chromosome 6 (with
extensive replication)
Gabriel et al. Science, 296,2002
cM
Mb
1Mb windows
recombination hotspots
LD blocks (little or no recombination)
![Page 12: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/12.jpg)
![Page 13: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/13.jpg)
HapMap (2002)• Catalogue of variation at Single
nucleotide polymorphisms (SNPs) genome-wide in different populations
• Touted for disease gene identification via linkage disequilibrium mapping
• ‘Tag’ SNPs can cover whole genome
• Reduction of SNPs required to examine the entire genome for association with a phenotype from 20 million to 1,000,000 tagSNPs
![Page 14: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/14.jpg)
• 1,000,000 SNPs
SNP: SINGLE NUCLEOTIDE POLYMORPHISM
ATCGGCGTACCTGATTCCGAATCCGTATCG
ATCGGCGTACCTGAATCCGAATCCGTATCG
1000 PERSONAS -1,000,000 SNPS = 1,000 MILLONES DE ANÁLISIS Y DE DATOS
![Page 15: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/15.jpg)
Coordination
NODE 1Barcelona
(CRG)
NODE 2Santiago de
Compostela (USC)
NODE 3Madrid(CNIO)
Scientific International Committee Ethical International Committeel
Illumina Sequenom /
Affymetrix
Illumina
Spanish National Genotyping Center GeGen-ISCIII
![Page 16: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/16.jpg)
0
5
10
15
20
25
30
CANCER
PSYCHIATRY
NEUROLOGY
ENDOC-METAB
RHEUMATOL
OPHTAL
CARDIOVAS
OTHERS
2005: 55 PROJECTS
2006: 75 PROJECTS
2007: 114 PROJECTS
2008: 135 PROJECTS
ASSOCIATION STUDIES CARRIED OUT IN CEGEN
2009: 4 GWAs2010: 15 GWAS
![Page 17: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/17.jpg)
Association studies
Candidate gene approach
-Causative hypothesis or
candidate genes
Genome wide analysis (GWAs)
-No need of gene selection
-Lack of bias towards specific
genes
Both approaches are complementary
![Page 18: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/18.jpg)
OXALIPLATIN
![Page 19: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/19.jpg)
Previous case-control (association) studies to
identify common, low-penetrance cancer
genes
• Many small-scale studies in past, candidate
genes
• Many positive reports
• A priori p(false+) >>> p(true+)
• Publication bias, failure to match cases and
controls/population stratification, lack of
correction for multiple comparisons, lack of
replicationCorrection for multple comparisons
P> 10-7 required
![Page 20: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/20.jpg)
TYPE I ERRORS: Population stratification
![Page 21: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/21.jpg)
EPICOLON GWASPCA analysis on genotypes: checked genotyping dates, geographical origin, Nsp-Sty and collection hospital
Meixoeiro
Donosti
0.05
N=366
N=167
N=944
![Page 22: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/22.jpg)
Type I errors: random
• Permutations (the most commonly used method-
computational intensive!)
• Other methods:
-False discovery rate (FDR)
-Sum Statistics
-Single Nucleotide Polymorphism Spectral
Decomposition
-Others
Corrections for multiple comparisons (p= 0.01
1 false positive every 100 comparisons)
• Bonferroni method
Pcor = 1-(1-Pnoncor)n new signif = alfa/n.
comparisons
-Very conservative-Assumption of independence
![Page 23: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/23.jpg)
T. Manolio/ N Engl J Med 2010;363:166-76
![Page 24: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/24.jpg)
Whole-genome association analysis
1 million
![Page 25: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/25.jpg)
Genome-wide association study
(GWAS) to identify low-penetrance
genes
• Require many (>1000) cases and controls (but not always)-Consortia
• Can improve power by selecting cases (early-onset, familial) and controls (cancer-free)
• Search for alleles or genotypes over-represented in cases
• Verify in other sample sets
![Page 26: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/26.jpg)
![Page 27: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/27.jpg)
Chronic lymphocytic leukemia accounts for ~25% of all
leukemia and is the most common form of lymphoid
malignancy in Western countries.
Despite a strong familial basis to CLL, with risks in first-
degree relatives of cases being increased ~8-fold, to date the
inherited genetic basis of the disease is largely unknown.
.
Chronic lymphocytic leukemia
![Page 28: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/28.jpg)
All association studies with candidate genes inconsistent
![Page 29: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/29.jpg)
![Page 30: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/30.jpg)
CLL
299,983 tagging SNPs
Stage 1: 505 cases and 1,438 controls (UK/Spain)
Stage 2: 180 SNPs in 540 UK cases
Stage 3: 19 SNPs
UK replication series 2 (660 cases, 809 controls)
Spanish replication series (424 cases, 450 controls).
Stage 4, 10 SNPs with the strongest association from a
combined analysis of stages 1–3 in a Swedish replication
series (395 cases, 397 controls)
![Page 31: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/31.jpg)
![Page 32: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/32.jpg)
![Page 33: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/33.jpg)
![Page 34: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/34.jpg)
![Page 35: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/35.jpg)
T. Manolio/ N Engl J Med 2010;363:166-76
![Page 36: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/36.jpg)
D. Crowther-Swanepoel D, Ana Vega, K.. Smedby, C. Ruiz-Ponte, J. Jurlander,
E. Campo, A. Carracedo, R. Houlston, British Journal of Haematology, 2010
![Page 37: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/37.jpg)
Cumulative impact of 10 common genetic variants on colorectal cancer risk in 42,333 individuals from eight populations (Lancet, in press)
This study demonstrates that population subgroups can be identified with a predicted absolute CRC risk sufficiently high as to merit surveillance/intervention, although individualized CRC risk profiling is not currently feasible. Nonetheless, the findings provide the first tangible evidence of public health relevance for data from genome-wide studies in CRC
![Page 38: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/38.jpg)
Spanish data GWAS
Birdsuite uses two different approaches for CNV detection:
- Canary: 1500 probes directed to CN Polymorphisms (as
described in the Human Variation Database browser)
-Birdseye: CNV detection
These data were also analysed with CNVAssoc
Preliminary results pending on stratification correction
![Page 39: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/39.jpg)
From tagSNP to causal variation …..
Why is this important?
• Population portability
• Targeted interventions
• Learn more about how cancer develops
• Plan: Resequencing
• Check information from WGS
![Page 40: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/40.jpg)
![Page 41: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/41.jpg)
Nature last week: Identified the first CLL genetic mutations through NGS
![Page 42: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/42.jpg)
NGS: SOLiD 4 System
Throughput: Up to 100 Gb/run
Fragment length:
Fragment: 50 bp
Mate-pair: 2 x 50 bp
Paired-end: 50 x 25 bp
Multiplexing:
96 DNA barcodes
48 RNA barcodes
Targeted resequencing
Exome sequencing
Whole genome sequencing
Panelso All Exon Kit (50 Mb Exome)oAll Exon Kit (38
o Mb Exome) (tiling 1x)o All Exon Plus Kit (38 Mb Exome + 3,3 Mb custom)
Customo < 200 Kbo 200 -500 Kbo 500 Kb – 1,5 Mbo 1,5 – 3 Mbo>3 Mb
![Page 43: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/43.jpg)
Ion Torrent Personal Genome Machine (PGMTM)
Throughput: Up to 10/100 Mb/run
2012 - 1 Gb/run
2 hours/run
Fragment length:
Fragment: 100-150 bp
Unidirectional sequencing
Bidirectional sequencing
Multiplexing:
2011 - 96 DNA barcodes
![Page 44: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/44.jpg)
SINGLE DNA MOLECULE SEQUENCING
![Page 45: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/45.jpg)
Genetic variegation
of clonal
architecture
and propagating
cells in leukaemia,
Anderson et al.
Nature 2010
Isidro Sánchez-GarcÍa.
U. Salamanca
![Page 46: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/46.jpg)
GWAS in pharmacogenetics-Differences with common diseases
Sample size: For ADRs the number of cases and controls can be much lower than for common diseases. However a number of published GWAs on pharmacogenomics have failed to show a large enough effect for genome-wide signifcance; the main reason for this is probably the small sample size with insufficient power to detect small or moderate effects.
Reasons: Phenotypic characterization- Some pharmacogenomics effects tend to be larger and involve fewer genes than in studies on common complex diseases.
Obtaining adequate number of cases for pharmacogenomics GWAs is more challenging than for common diseases. In many case serious ADRs often only affect on in every 10,000 to 100,000 patients treated.
![Page 47: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/47.jpg)
Manhattan plot of −log P-value against chromosomal position of each marker from a study on simvastatin-induced muscle toxicity on 85 cases and 90 drug-exposed controls (A. Daly, 2009).
![Page 48: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/48.jpg)
GWAS for pharmacogenomics
SNPs (chromosomal locations) shown previously to be associated with CRC risk are: rs6983267 (chr 8q24), rs4779584 (chr 15q23), rs4939827 (chr 18q21), rs3802842(chr 11q23), rs10795668 (chr 10p14), rs16892766 (chr 8q23), rs4444235(chr 14q22), rs9929218 (chr 16q22), rs10411210 (chr 19q13), rs961253 (chr 20p12).
![Page 49: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/49.jpg)
5FU, oxaliplatino e irinotecan
Eficacia: RECISTToxicidad: CTC
Strong: Al menos un “grado 3-4” entre todos los efectos secundarios.Weak: Al menos un “grado 3-4” entre diarrea y náuseas, o al menos un “grado 1-2” en el resto de efectos secundarios (que se consideran más graves que diarrea o náuseas).Digestive: Al menos un “grado 3-4” entre diarrea y náuseas, o al menos un “grado 1-2” en mucositis.Circulatory: Al menos un “grado 1-2” entre leucopenia, trombopenia, anemia, y neutropenia.Others: Al menos un “grado 1-2” entre neuropatía y síndrome mano/pie.
EPICOLON GWAS (300 cases) 9 SNPs (p< 10-10) being replicated
OXFORD GWAS (620 cases, Capecitabine (5FU) and then randomised to oxaliplatin or no oxaliplatin, phenotypes by syntoms (i.e.Diarrhoea and Handfoot syndrome) 11 SNPs being replicated
EPICOLON GWAS TOXICITY
![Page 50: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/50.jpg)
Methotrexate consolidation treatment according to pharmacogenetics of
MTHFR ameliorates event-free survival in childhood acute lymphoblastic
leukemia Running Title Methotrexate pharmacogenetics in childhood
acute lymphoblastic leukemia
Salazar et al. 2011 (Pharmacogenomics Journal ,submitted)
We investigated the usefulness of the MTHFR genotype to increase the
methotrexate dosage in the consolidation phase in 141 childhood ALL patients
enrolled in the ALL/SHOP-2005 protocol. Patients with a favourable MTHFR
genotype (normal enzymatic activity) treated with methotrexate doses of 5 g/m2
had a significantly lower-risk of suffering an event than patients with an
unfavourable MTHFR genotype (reduced enzymatic activity) that were treated
with the classical methotrexate dose of 3 g/m2 (p=0.012). Our results indicate
that analysis of the MTHFR genotype is a useful tool to optimize methotrexate
therapy in childhood patients with ALL.
![Page 51: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/51.jpg)
Fenotipo Genotipo
Cuanto mejor definido es el fenotipo más fácil es encontrar el gen
del que depende. Cuanto más complejo es el sistema más difícil es
de definir su fenotipo
En todo aquello que tiene variación y esta es relevante clínicamente
se puede buscar el gen causal y así empezar a entender el fenotipo
y en consecuencia la enfermedad.
![Page 52: Estudio de asociación genética en la leucemia linfocítica ... · Estudio de asociación genética en la leucemia linfocítica crónica XXXV REUNION DE LA ASOCIACION GALLEGA DE](https://reader034.fdocuments.net/reader034/viewer/2022042208/5eac4dea5bc13457f439d806/html5/thumbnails/52.jpg)