1

ERRα coordinatesactinandfocaladhesiondynamics

ViolaineTribollet1,CatherineCerutti1,AlainGéloën2,EmmanuelleDanty-Berger2,

Richard De Mets3, Martial Balland4, Julien Courchet5, Jean-Marc Vanacker1 and

ChristelleForcet1.

1Institut de Génomique Fonctionnelle de Lyon, Université de Lyon, Université Claude Bernard Lyon 1, CNRS UMR5242, EcoleNormaleSupérieuredeLyon,69007Lyon,France.2CarMeNLaboratory,UniversitédeLyon,UniversitéClaudeBernardLyon1,INRAeU1397,InsermU1060,INSALyon,69008Lyon,France.3MechanobiologyInstitute,NationalUniversityofSingapore,Singapore117411.4LaboratoireInterdisciplinairedePhysique,GrenobleAlpesUniversity,38402SaintMartind'Hères,France.5Institut NeuroMyoGène, Université de Lyon, Université Claude Bernard Lyon 1, CNRSUMR-5310, INSERMU-1217, 69008 Lyon,France.CorrespondenceshouldbeaddressedtoC.F.(christelle.forcet@ens-lyon.fr,Tel:+33(0)426731346,Fax:+33(0)426731375).Abstract

Cell migration depends on the dynamic organization of the actin cytoskeleton andassembly and disassembly of focal adhesions (FA). However the precisemechanismscoordinating these processes remain poorly understood.We previously identified theestrogen-related receptor α (ERRα) as a major regulator of cell migration. Here, weshow that loss of ERRα leads to abnormal accumulation of actin filaments that isassociated with an increase in the level of inactive form of the actin-depolymerizingfactor cofilin. We further show that ERRα depletion decreases cell adhesion andpromotesdefectiveFA formationand turnover. Interestingly, specific inhibitionof theRhoA-ROCK-LIMK-cofilin pathway rescues the actin polymerization defects resultingfromERRα silencing,butnot cell adhesion. Insteadwe found thatMAP4K4 isadirecttarget of ERRα and down-regulation of its activity rescues cell adhesion and FAformationintheERRα-depletedcells.Altogether,ourresultshighlightacrucialroleofERRα in coordinating the dynamic of actin network and focal adhesion through theindependentregulationoftheRhoAandMAP4K4pathways.Introduction

Coordinated cell migration is essentialfor embryonic development, woundhealingandimmuneresponse(Gardeletal, 2010). Its dysregulation contributesto many pathologies including cancercell dissemination (Bravo-Corderoetal,2012).

The multistep process of cellmovement requires highly coordinatedchanges in cell morphology andinteractions with the extracellularmatrix (ECM). Cell migration can bedivided into four discrete steps:formationofprotrusion,adhesiontothe

ECM,generationoftractionforcesattheadhesionsitesandreleaseofadhesionatthe rear, which allow the cell to moveforward (Ridley, 2003; Gardel et al,2010).Thegrowingactinnetworkpushsthe membrane and promoteslamellipodial protrusion at the leadingedge.Protrusionsare thenstabilisedbyintegrin-based protein complexesknown as focal adhesions (FA)connectingtheactincytoskeletontotheECM. In addition, actomyosin fiberscontribute to the contraction and theretraction of the cell body. Thereforethis sequence of events involves a

(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted July 23, 2020. ; https://doi.org/10.1101/2020.07.22.216085doi: bioRxiv preprint

2

dynamic organization of the actincytoskeleton and a controlled assemblyand disassembly of FA that must becoordinated both in space and time(Gardel et al, 2010; Blanchoin et al,2014;DePascalis&Etienne-Manneville,2017).

The spatiotemporal regulation ofcellmigrationinvolvestheRhofamilyofsmallGTPases (Ridley, 2015;Lawson&Ridley,2018;Guanetal,2020).Globally,RhoAfirstinducesactinassemblyatthecell front thereby initiating theformationofthelamellipodium,whichisstabilizedthroughtheinductionofactinpolymerisation and FA turnover byRac1. In addition, RhoA promotes theassembly of contractile actin-myosinfilaments. This process participates inFA formation and maturation, andinducescellbodytranslocationandrearretraction(Machaceketal,2009;Martinet al, 2016; Seetharaman & Etienne-Manneville, 2019; Guan et al, 2020).Notably, RhoA regulates actinpolymerisation during cell migrationthrough its effectors mammalianhomolog of Drosophila diaphanous(mDIA) and Rho-associated proteinkinase (ROCK) (Spiering & Hodgson,2011;Ridley,2015).mDIAinitiatesactinfilaments assembly by nucleation,whereas ROCK directly activates actinregulatorssuchasLIMkinase(LIMK)byphosphorylation. Activation of LIMKleads to inhibition of the actin-severingactivity of cofilin. Consequently, thedissociation of inactivated cofilin fromactin filaments promotes actinpolymerisation (Mizuno,2013;Kanellos&Frame,2016).

Rho GTPases control of actinpolymerisation and FA turnover can belocally modulated following interactionwith microtubules near FA.Furthermore, microtubules serve astracks to deliver proteins essential forFAdisassemblyandsubsequentintegrininternalization from the cell surface

(Stehbens & Wittmann, 2012;Seetharaman & Etienne-Manneville,2019). The mitogen-activated proteinkinase kinase kinase kinase (MAP4K4)has been identified as such a keyregulator (Gao et al, 2016). Indeed, inmigrating cells,MAP4K4 is delivered toFAsitesthroughitsassociationwiththemicrotubules to induce FA disassemblyand cell migration (Yue et al, 2014).MAP4K4 also regulates FA disassemblyby phosphorylating moesin, whichdisplaces talin from integrins andinducestheirinactivation(Vitorinoetal,2015). Overall, cell migration is acomplex and dynamic phenomenon,which involves crosstalkbetweenactin,microtubules and FA. However howthese processes are coordinated tosupport cell migration is not clearlyunderstood.

Our team and others havedemonstratedthattheEstrogen-RelatedReceptor α (ERRα) is an importantfactor promoting cellmigration (Dwyeretal, 2010; Sailland etal, 2014; Tam&Giguère, 2016). ERRα is an orphanmember of the nuclear receptorsuperfamily and, as such, acts as atranscriptionfactor(Horard&Vanacker,2003;Ranhotra,2018).ERRαisstronglyexpressed in several types of cancersand its high expression correlates withpoor prognosis (Tam & Giguère, 2016;Ranhotra, 2015, 2018). In addition,accumulating evidence indicates thatERRα plays a major role in tumoralgrowth andprogression via stimulationof cell proliferation (Chang et al, 2011;Biancoetal, 2012), angiogenesis (Aoetal, 2008; Zou et al, 2014; Stein et al,2009; Zhang et al, 2011), aerobicglycolysis(Tennessenetal,2011;Caietal,2013)andECMinvasion(Carnesecchietal,2017;Zhangetal,2018).Inbreastcancercells,wepreviouslyshowedthatERRα promotes directional cellmigration by regulating RhoA stabilityand activity (Sailland et al, 2014).

(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted July 23, 2020. ; https://doi.org/10.1101/2020.07.22.216085doi: bioRxiv preprint

3

Consequently, the invalidation of ERRαleadstoimpairedcellmigrationwhichisassociated with cell disorientation,disorganized actin filaments anddefective lamellipodium formation(Sailland et al, 2014). Yet the specificroles of ERRα in the regulation of thediscrete processes involved in cellmigration, such as actin- and FAdynamics,remainsunclear.

Inthepresentstudy,wereportthatERRαcontrolsactinpolymerisationandorganisation by modulating cofilinactivity through the RhoA-ROCK-LIMKpathway. We also found that ERRαpromotescelladhesionindependentlyofitsroleontheactincytoskeleton.Indeed,ERRα directly regulates the expressionofMAP4K4, and thereby contributes tothe modulation of FA formation andturnover. Together, our study identifiesERRα as a major actor involved in thecoordinationofactinandFAdynamics.Results

ERRα regulatesactindynamicsToinvestigatethepotentialroleofERRαintheregulationofactinpolymerisation,we first performed differentialsedimentation of actin filaments (F-actin) and actin monomers (G-actin)using ultracentrifugation. We observedthatinactivationofERRαwithaspecificsiRNA induced a significant increase inF-actin levelwithstableG-actin level inbothMDA-MB231cells (Figure1A)andHeLa cells (Figure S1A). Interestingly,immunofluorescence experimentsshowed that actin filaments mainlylocalized in regions near the plasmamembraneincontrolcellswhereastheywere disorganized in ERRα-depletedcells (Figure 1B). Quantitative analysisof actin staining also revealed asignificant increase in the F-actincontent upon ERRα depletion (Figure1C).

In order to further analyse defectsinactin filamentsassociatedwithERRαdepletion, we used triangle-shapedmicropatterns. When control cellsadhered on these micropatterns, theyspreadandacquireda triangularshape.Actin filaments accumulated in thesecells at the lateral edges of the triangle(Figure1D).Bycontrast,ERRα-depletedcells displayed a random localizationofthe actin filaments and a stronglyaltered triangular morphology (Figure1D and 1E). Once again, depletion ofERRαinducedanincreaseintheF-actincontent as compared to the controlcondition (Figure 1F). Taken together,these results demonstrate that ERRαregulates polymerisation andorganization of actin filaments, thusaffectingcellmorphology.ERRα acts on the RhoA-ROCKpathway to modulate actinpolymerisationThe smallGTPaseproteinRhoAplays amajorroleinregulatingtheorganizationof the actin cytoskeleton through itseffectors mDIA and ROCK (Spiering &Hodgson, 2011; Kanellos & Frame,2016).DownstreamofRhoA/ROCK, theactivation of LIMK results in cofilininactivationandconsecutivedecreaseofactin depolymerisation (Mizuno, 2013;Kanellos&Frame,2016).Wepreviouslyshowed that ERRα regulates cellmigration by modulating RhoA proteinexpression and activation of the RhoA-ROCKpathway(Saillandetal,2014).Wetherefore investigated if the effects ofERRα on the actin cytoskeleton couldresultfromcofilininhibitionandinvolveLIMK.Westernblotexperimentsshowedthat depletion of ERRα stronglyincreased the level of the inactivephosphorylatedformofcofilin,whereastotal levels of cofilin remainedunchanged (Figure 2A). The level ofRhoA also strongly increased in ERRα-depleted cells, as previously described

(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted July 23, 2020. ; https://doi.org/10.1101/2020.07.22.216085doi: bioRxiv preprint

4

(Figure 2B and Figure S1B).Furthermore, treatment with theselective ROCK inhibitor Y27632decreased the phosphorylation level of

cofilin in both control and ERRα-depletedcells(Figure2C).Interestingly,several concentrations of Y27632reduced the phosphorylation level of

(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted July 23, 2020. ; https://doi.org/10.1101/2020.07.22.216085doi: bioRxiv preprint

5

cofilin in ERRα-depleted cells to thelevel observed in control cells.Furthermore,thespecificLIMKinhibitorPyr1 similarly rescued thephosphorylation levelof cofilin in thesecells(Figure2D).Thesefindingsindicatethat ERRα-mediated controls of cofilinactivity involved the RhoA-ROCK-LIMKpathway.Wenext investigatedwhetherthe deregulation of this pathway mayaccount for the defective actin

regulation observed in ERRα-depletedcells.TreatingmicropatternedcellswithY27632 restored the F-actin content ofthe ERRα-depleted cells (Figure 2E).Takentogether, thesedatademonstratethat ERRα regulates actinpolymerisation through the RhoA-ROCK-LIMK-cofilinpathway.ERRα regulatescelladhesionActin filament- and FA dynamics are

(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted July 23, 2020. ; https://doi.org/10.1101/2020.07.22.216085doi: bioRxiv preprint

6

tightlylinked.Notably,RhoGTPasesandactin dynamics play a crucial role in

regulating FA maturation and turnover(Vicente-Manzanaresetal,2009; Juanes

(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted July 23, 2020. ; https://doi.org/10.1101/2020.07.22.216085doi: bioRxiv preprint

7

et al, 2017; Romero et al, 2020).Therefore, we determined whetherERRα is able to regulate cell adhesionthrough its action on actinpolymerisation. Using the xCELLigencesystem, which allows real-timemonitoring of cell adhesion, we firstshowed that depletion of endogenousERRα resulted in a significant decreasein cell adhesion to collagen I comparedtocontrolcondition(Figure3A).SimilareffectswereobservedafterdepletionofERRα in HeLa cells (Figure S2A). Wealso observed that cell adhesion tocollagen IV or fibronectin decreaseduponERRαsilencing(Figure3Band3C).By contrast, control andERRα-depletedcells were not able to adhere on thepositively charged poly-L-lysinesubstrate, showing that the adhesionofMDA-MB231 cells does not rely onelectrostatic interactions (Figure S2B).To investigate whether the aberrantincreaseinF-actincouldaccountforthedefective cell adhesion due to ERRαdepletion, we then tested the effect ofthe ROCK inhibitor Y27632 on theadhesion of ERRα-depleted cells.Y27632 treatment exacerbated, ratherthan rescued, the adhesion defect ofERRα-depleted cells. It also induced adecrease, albeit moderate, of celladhesion under control conditions(Figure 3D). Thus, these results revealthat ERRα promotes cell adhesion toECM proteins independently of its roleintheregulationofactindynamics.FA represent the major sites of cellattachment to the ECM (Gardel et al,2010;DePascalis&Etienne-Manneville,2017). Therefore, to determine howERRα impacts on cell adhesion, weanalysedFAusingvinculinasamarker.Immunofluorescence microscopyshowed that FA appeared smaller inERRα-depleted cells as compared tocontrol cells (Figure 4A). Quantitativeanalysis of vinculin staining revealedindeedasignificantdecreaseofFAarea

andlengthuponERRαdepletion(Figure4B and 4C). The distance of FA to themembrane was also impaired in thesecells, reflecting FA mislocalization,which canbe secondary tomislocalizedMAP4K4 activity due to itsoverexpression (Vitorino et al, 2015)(Figure4D).Todetermine thepotentialrole of ERRα in FA dynamics, we nextused live-cell imaging on MDA-MB231cells stably expressing GFP-paxillin, afluorescent FA marker protein. As fortheirwildtypecounterparts,adhesionofthesecells tocollagenIdecreaseduponERRαdepletion,demonstrating that theGFP tag did not compromise ERRαinvolvement in cell adhesion (FigureS2C). Image analyses showed that FAdisplayed more rapid phases ofassembly and disassembly in ERRα-depleted cells as compared to controlcells. Representative examples of theseperturbationsinFAdynamicsareshowninmontages in Figure 4E (red arrows).Quantification of the kinetics ofindividual FA demonstrated thatdepletion of ERRα resulted in asignificantincreaseinboththeassemblyanddisassemblyratesofFA(Figure4F).Altogether, these data indicate thatERRα regulates cell adhesion bymodulation of FA formation andturnover.

ERRα regulates FA dynamics via itstranscriptionaltargetMAP4K4To investigate the molecularmechanisms through which ERRαcontrols cell adhesion,weexamined itstranscriptional targets. TranscriptomicandGeneOntology (GO)analyseshavebeen previously performed to identifyERRα target genes and associatedbiological functions (Sailland et al.2014). Of particular interest, theseanalyses revealed MAP4K4, whichencodes a Ser/Thr kinase involved inthe regulationofFAdynamics and cellmigration (Yue et al, 2014; Vitorino et

(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted July 23, 2020. ; https://doi.org/10.1101/2020.07.22.216085doi: bioRxiv preprint

8

al, 2015; Gao et al, 2016). RT-qPCR experiments verified our finding,

(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted July 23, 2020. ; https://doi.org/10.1101/2020.07.22.216085doi: bioRxiv preprint

9

showingthatsilencingofERRαledtoanup-regulation ofMAP4K4 expression atthe mRNA level (Figure 5A).Examination of publicly availablechromatin immunoprecipitationsequencing (ChIP-Seq) data performedon BT-474 cells (Deblois et al, 2016)indicated the recruitment of ERRα ontwo distinct regions of intron 2 of theMAP4K4 gene, each displaying twoputative ERRα response elements(ERREs). ChIP-qPCR experimentsrevealed thatERRαbinds these regionsin MDA-MB231 cells (Figure 5B). Next,anup-regulationoftheMAP4K4proteinexpression resulting from ERRα-depletion was confirmed by Westernblot (Figure 5C). Similar results wereobservedinHeLaandMDA-MB231GFP-paxillin cells (Figure S2D). Consistently,an enhanced activity of MAP4K4 wasobserved in ERRα depleted cells, asindicated by an increased

phosphorylation of moesin, a substrateof MAP4K4 involved in FA turnover(Figure 5D) (Vitorino et al, 2015).Together, these data demonstrate thatERRα directly regulates the expressionof MAP4K4, and consequentlyinfluencesitsactivity.

MAP4K4promotesFAdisassemblyby inducing integrin recycling (Yue etal, 2014) and inactivation (Vitorino etal, 2015). These data raise thepossibility that the over-activation ofMAP4K4 observed in ERRα-depletedcellsmay account for the defects of FAidentified in these cells. To investigatethis hypothesis, cellswere treatedwiththe specific MAP4K4 inhibitor PF-06260933. We found that a lowconcentration of PF-06260933 rescuedcelladhesiononthecollagenIsubstrate(Figure 6A) and restored FA area andlengthinERRα-depletedcells(Figure6Band 6C). PF-06260933 also nearly

(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted July 23, 2020. ; https://doi.org/10.1101/2020.07.22.216085doi: bioRxiv preprint

10

completelyrescuedtherelativedistanceofFAtothemembraneinthesecells,butinduced FA mislocalization in control

cells (Figure 6D). Thus, ERRα regulatescelladhesionthroughMAP4K4.

As shown above, impacting on the

(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted July 23, 2020. ; https://doi.org/10.1101/2020.07.22.216085doi: bioRxiv preprint

11

RhoA-ROCKaxis inERRα-depleted cellsrescued the defects in actinpolymerisation but not the reducedadhesion capacities. We thus examinedthe converse possibility, questioningwhether impactingon theMAP4K4axiscould reduce the increased actinpolymerisation observed upon ERRαinactivation. As shown on Figure 6E,treatment with the MAP4K4 inhibitorPF-06260933 did not rescued the actinstatusinERRα-depletedcellsbutratherincreased actin polymerisation incontrol cells. Altogether our data showthat ERRα regulates actinpolymerisationandFAdynamicsviatwoindependentpathways.Discussion

TheinvolvementofERRαinthecontrolof cancer cellmigration and invasion iswell documented (Dwyer et al. 2010;Tam et Giguère 2016; Sailland et al.2014;Carnesecchi et al. 2017;Zhangetal. 2018). ERRα also contributes to cellmigration under physiologicalconditions such as morphogeneticmovements during gastrulation of thezebrafish embryo and chemotacticmigration of activated macrophages(Bardetetal,2005;Saillandetal,2014).Although some molecular mechanismsthrough which ERRα promotes cellmigration have been described, howthese signallingactorsare connected tothe precise morphological changesrequiredforcellmigrationperseisstillunclear. In this report, we show thatERRα coordinates actin and FAdynamics, through the independentmodulation of the RhoA-ROCK-LIMK-cofilin pathway and MAP4K4respectively.

A proper interaction between cellsandECMisanessentialprerequisiteforcell migration, and it needs to beprecisely regulated. Nascent adhesioncomplexesrecruitactin-bindingproteins

toestablishalinkbetweenECMandtheactin cytoskeleton (Gardel et al, 2010).RhoA contributes to FA maturation bycontrolling the growth of FA-associatedactinfilamentsthroughtheactivationofthe formin mDIA and inhibition ofsevering activity of cofilin (Mizuno,2013; Kanellos& Frame, 2016; Lawson& Ridley, 2018). RhoA also regulatesactin binding tomyosin II filaments viaROCK, which subsequently inducescontractilityrequiredforFAmaturation(Seetharaman & Etienne-Manneville,2019; Guan etal, 2020).We previouslyreported that ERRα depletionsignificantlyimpactsonRhoAactivation(Saillandetal,2014).Weshowherethatthe upregulation of RhoA activityinduces an increase in actinpolymerisation resulting from anenhancedphosphorylation status of theROCK downstream target cofilin. Thissuggests that an excess of actinfilaments may impair their interactionwith FA and impact on FA maturation.However, it is unclear whether globalderegulation ofRhoA activity can affectthe precise control of actinpolymerisation at the FA sites.Unexpectedly,RhoAdoesnotcontributetotheregulationofcelladhesion inourconditions.Thus,ourresultsreveal thatERRα regulates actin dynamicsindependentlyofcelladhesion.

A recent study found that theCFL1gene encoding cofilin could be a directtarget of ERRα (Vargas et al, 2019).Hence ERRαmay play a crucial role inregulation of actin polymerisation bydirectlyandindirectlycontrollingcofilinexpressionandcofilinactivity.However,our previous RNAseq data reveal thatCFL1 expression is not regulated byERRαintheMDA-MB231cells (Saillandet al, 2014). It has been reported thatcofilin andmyosin compete for bindingto actin filaments. As a consequence,cofilin depletion induces aberrantactomyosin contractility (Kanellos &

(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted July 23, 2020. ; https://doi.org/10.1101/2020.07.22.216085doi: bioRxiv preprint

12

Frame,2016).Weshowhere thatRhoAupregulation in ERRα-depleted cellsleads to an increase in cofilinphosphorylation, which inhibits itsinteraction with actin. Therefore ourdatasuggest thatERRαmayfunctionasa regulator of actomyosin contractility,which is crucial for cell migration, bycontrollingtheRhoA-ROCK-LIMK-cofilinpathway. Whether ERRα can alsomodulate actin polymerisation andcontractility through the RhoA effectormDIAremainstobedetermined.

Although numerous studiesdemonstrate a role of ERRα in cellmigration, its involvement in celladhesion has been only recentlyreported. Indeed, bioinformaticsanalysis of the ERRα regulatoryinteractomeleadstotheidentificationofproteins and ERRα target genesassociated with cell adhesion and cellmigration (Vargas etal, 2019). Anotherreport also shows that cell adhesiongenes are upregulated upon ERRαdepletion (Likhite et al, 2019). Thus,these studies highlight new potentialmolecular mechanisms of the role ofERRα in cell adhesion to furtherinvestigate. Here, our data are the firstdemonstrating that ERRα acts on cell-matrixadhesionthroughtranscriptionalregulationofMAP4K4.

Upon ERRα silencing, cell adhesiondecreases as a result from impaired FAformation and dynamics. These defectscanberescuedbydown-modulatingtheactivity of MAP4K4. Interestingly, weshow that ERRα depletion increasesboth FA assembly and FA disassembly.This is consistent with the reportshowingthatlossofMAP4K4exertstheinverseeffectonFAdynamics(Yueetal,2014). MAP4K4 has been previouslyidentified as a FA disassembly factor(Yue et al, 2014; Vitorino et al, 2015).Nevertheless it has been recentlyreported that MAP4K4 promotes theactivation of β1-integrins and its

downstream effector Focal AdhesionKinase (FAK) (Tripolitsioti et al, 2018),suggesting that itmay also regulate FAassembly. Therefore, furtherinvestigations will be needed todetermine the potential contribution ofthese MAP4K4-dependent mechanismsin the regulation of FA assembly andmaturationbyERRα.

MAP4K4 regulates FA dynamics bypromoting internalization andinactivation of β1-integrins (Yue et al,2014;Vitorinoetal,2015).Inmigratingcells, MAP4K4 is delivered to FA sitesthrough its association with themicrotubule end-binding protein EB2(ending binding 2). MAP4K4subsequentlyactivatesIQSEC1(IQmotifand SEC7domain-containing protein 1)andArf6 to induce FA disassembly andcell migration (Yue et al, 2014).Furthermore, MAP4K4 is involved inphosphorylation of moesin, whichcompetes with talin for binding to β1-integrins. This leads to β1-integrininactivation and FA disassembly(Vitorinoetal,2015).Sinceupregulationof MAP4K4 expression leads tomoesinactivation in ERRα-depleted cells, ourresults strongly suggest that ERRαinduces FA disassembly through theMAP4K4-moesin pathway. We cannotcompletely exclude the possibility thatERRαalsoregulatesFAdisassemblyviathe regulation of IQSEC1 and arf6activation. However, ERRα is moreprobably involved in the regulation ofintegrin inactivation rather than theirrecycling because surface expression ofβ1-integrins(andothertestedintegrins)is not modified upon ERRα depletion(Tribollet and Forcet, unpublished).Furthermore, ERRα promotes celladhesion to different ECM proteins,suggesting the involvement of theMAP4K4-moesin pathway in theregulation of distinct type of integrins.Inlinewiththatobservation,theroleoftalin in activation of multiple integrins

(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted July 23, 2020. ; https://doi.org/10.1101/2020.07.22.216085doi: bioRxiv preprint

13

beenreported(Klapholz&Brown,2017;Sun et al, 2019). Therefore, it isplausiblethatERRα,byinducingmoesincompetitionwithtalinviaMAP4K4,havea more general role in regulation ofintegrinactivationandFAturnover.A role of MAP4K4 in regulation ofcortical actin dynamics has beenpreviously shown (Ma & Baumgartner,2014; LeClaire et al, 2015; SanthanaKumar etal, 2015). Notably, these datashow that MAP4K4 silencing decreasesthe accumulation of actin filaments incell protrusions (Ma & Baumgartner,2014; Santhana Kumar et al, 2015).Thus,itsuggeststhattheupregulationofMAP4K4 may lead to the aberrantregulation of actin filaments observedupon ERRα depletion. However wedemonstrate here that MAP4K4 is notinvolved in the regulation of the actinnetwork downstream of ERRα.Altogether,ourdatafirmlydemonstratethat ERRα coordinates actinpolymerisation and adhesion via twoindependentpathways.

In conclusion,we report that ERRαmodulatesactinpolymerizationthroughthe RhoA-ROCK axis and FA formationand turnover through the MAP4K4pathway. As a consequence, thederegulationofERRαexpressiondeeplyimpacts cell adhesion and cellmorphology,thispointstoacriticalroleplayedbyERRαincellmigration.MaterialsandmethodsCelllinesandtransfectionMDA-MB231 and HeLa cells werecultured in 4.5 g/L glucose DMEMsupplementedwith10%FCS(Gibco),10U/mL penicillin (Gibco) and 10 µg/mLstreptomycin (Gibco). Cells weremaintained in a humidified 5% CO2atmosphere at 37°C. The stable MDA-MB231 cell line expressing ectopicpaxillin was obtained by transfecting

MDA-MB231 cells with pEGFP-paxillinplasmid (a generous gift from SandrineEtienne-Manneville,InstitutCurie,Paris,France). Cells were selected with 1mg/mL G418 (Sigma-Aldrich) andmaintainedascellpopulations.All siRNA were transfected usingINTERFERin (Polyplus Transfection)according to the manufacturer’sprotocol. Briefly, 3x105 cells per mLwere seeded in 6-well plates andtransfectedwith25pmol/mLofcontrolor ERRα siRNAs. Cells were thenharvested 48 or 72 hours aftertransfection. Control siRNAswere fromThermo (medium GC Stealth RNAinterferencenegative controlduplexes).ERRα siRNAs were from Eurogentec;ERR#1(GGCAGAAACCUAUCUCAGGUU);ERR#2(GAAUGCACUGGUGUCACAUCUGCUG).BiochemicalreagentsY27632 dihydrochloride monohydrate(Sigma-Aldrich,Y0503)wasusedat2.5;5 or 10 µM; PF-06260933dihydrochloride (Sigma-Aldrich,PZ0272)wasusedat0.25or0.5µM;andPyr1 (Lim K inhibitor) (a gift fromLaurence Lafanachère, Institute forAdvanced Biosciences, Grenoble,France)wasusedat1;5or10µM.Cellswere pre-treated (Western blot,xCELLigence) for 1h30 at 37°C beforecell lysis or cell adhesion assay, orincubated (micropatterns) with theseinhibitorsfor4hat37°Cbeforefixation.RNAextractionandreal-timePCRTotal RNAs were extracted byguanidinium thiocyanate / phenol /chloroform.1µgofRNAwasconvertedto first strand cDNA using RevertAidFirst Strand cDNA Synthesis kit(Thermoscientific). Real-time PCRwereperformed in a 96-well plate using theIQSYBRGreenSupermix (Biorad).Datawere quantified by the ∆∆-Ct methodand normalized to 36b4 expression.

(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted July 23, 2020. ; https://doi.org/10.1101/2020.07.22.216085doi: bioRxiv preprint

14

Sequences of the oligonucleotides(Eurogentec) used for expressionstudies were: ESRRA, forward 5’-CAAGCGCCTCTGCCTGGTCT-3’, reverse5’- ACTCGATGCTCCCCTGGATG-3’;MAP4K4, forward 5’-GGGATATCAAGGGCCAGAAT-3’, reverse5’- CTCAGGCGCCATCCAGTAGG -3’;36b4, forward 5’-GTCACTGTGCCAGCCCAGAA -3’, reverse5’-TCAATGGTGCCCCTGGAGAT-3’.ChromatinImmunoPrecipitation10x106cellswerecross-linkedwith1%formaldehydeandquenchedfor5minin0.125 M Glycine. After centrifugation,cell pellets were resuspended in lysisbuffer(1%SDS,50mMTris-HClpH8,10mM EDTA). Sonication was performedwith Bioruptor (Diagenode). Lysatesfrom5x106cellswere incubatedwith2μg of antibody overnight at 4°C onrotation and then, for1hwith40μl ofDynabead-proteinG(LifeTechnologies).BeadswerewashedwithTSE-150(0.1%SDS,1%Triton,2mMEDTA,20mMTrispH8.1,150mMNaCl),TSE-500(asTSE-150with500mMNaCl), LiCl detergent(0.25 M LiCl, 1% NP40, 1% SodiumDeoxycholate, 1mMEDTA, 10mMTrispH8.1) and Tris-EDTA (5 mM-1 mM).Elution was performed in SDS/NaHCO3buffer twice for 20min at 65°C. Cross-linking was reversed with RNAse andNaCl overnight at 65°C. DNA fragmentswere purified using NucleoSpin(Macherey-Nagel) and diluted to 1/100for input and to the half forimmunoprecipitated fractions.Quantitative PCRs were performedusing 2 μL of DNA in duplicate andenrichment was calculated related toinput values. Antibodies used were:ERRα antibody (GTX108166, Genetex);rabbitIgG(Diagenode)usedasacontrol.Sequences of oligonucleotides used forqPCRonMAP4K4genewere:

ESRRA1/2: 5’-AGCCAATCCATTAGCTGCAT -3’; 5’-ACACCTAATGGCCACTGCTC-3’ESRRA3/4: 5’-CTGCTCTGTGTGCAGGTAGC -3’; 5’-CTTCCTGTAACGGGACCTGA-3’Non-specific: 5’-AGGGTCCAGATTCTGCCTTT -3’; 5’-CATTCATTCCTGGCCAACTT-3’.WesternblotanalysisFor western blot analysis, cells werelysedinNP40buffer(20mMTris-HclpH7.5,150mMNaCl,2mMEDTAand1%NP40) supplemented with ProteaseInhibitor Cocktail (Sigma-Aldrich).Proteins (25-50µg) were resolved on 8to 15% SDS-PAGE and blotted ontoPVDF membrane (Millipore).Membranes were blocked for 1 h atroom temperature with TBS-0.1%Tween20 and 5% milk or 1% bovineserum albumin (BSA), and incubatedovernight at 4°C with the primaryantibodies, followed by 1 h at roomtemperature with with HRP-conjugatedsecondary antibody. Revelation wasperformed using an enhancedchemiluminescence detection system(ECL kit, GE Healthcare). Primaryantibodies used were: ERRα(GTX108166,Gentex),Hsp90 (ADI-SPA-830, Enzo life science),MAP4K4 (3485,Cell signalling), RhoA (sc-418, SantaCruz),Moesin(sc-13122,SantaCruz),P-T558-Moesin (ab177943,Abcam),Actin(A5060, Sigma-Aldrich), Cofilin (5175,Cell signalling) and P-S3-Cofilin (3311,Cell signalling). The peroxidase-conjugated secondary antibodies weregoat anti-mouse IgG (715-035-151,Promega)andanti-rabbitIgG(711-035-152, Promega). Protein expressionlevels were quantified with ImageJsoftwareandanalysisrevealedtheratioof the protein of interest related to ahousekeepinggene(actin,hsp90).

(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted July 23, 2020. ; https://doi.org/10.1101/2020.07.22.216085doi: bioRxiv preprint

15

AdhesionAssayE-plates 16 PET (ACEA Biosciences)were coatedwith1.5µg/cm² collagen I(Corning, 354236), Fibronectin (Sigma-Aldrich, F2006), collagen IV (Sigma-Aldrich, C7521) or 3 µg/cm² poly-L-lysine(Sigma-Aldrich,P6407)overnightat 4°C. 16-well xCELLigence microtiterplates(E-plates)wereblockedwith1%BSAinPBSfor1hatroomtemperature.Then, 2.104 cells were seeded on E-platesandcell adhesionwasmonitoredcontinuously using the xCELLigencesystem (ACEA biosciences) in serum-deprived conditions.The cell indexwasmeasuredinrealtimeevery2minfor3h,andevery15min for20h.After3h,10% fetal calf serumwas added to thecell medium to allow cell proliferation.The cell adhesion rate (Δcellindex/Δtime) was calculated betweenevery two consecutive time points, andexpressed as real-time slope by thexCELLigence software. Results areshown as mean of slopes measured inthe specific interval of timecorrespondingtotheadhesionphase.Actin segmentation byultracentrifugationActin segmentation was performedusingtheprotocoladaptedfromQiaoetal., 2017. Briefly, cells were lyseddirectly in the dish with the actinstabilization buffer (50 mM PIPES pH6.9, 50 mM NaCl, 5 mM MgCl2, 5 mMEGTA, 2 mM ATP, 5% glycerol, 0.1%NP40, 0.1% Triton X-100, 0.1%Tween20, 0.1% B-mercaptoethanol)supplemented with Protease InhibitorCocktail (Sigma-Aldrich) for 10 min at37°C,followedbycentrifugationat3000g at room temperature to removeinsoluble particles. Cell lysates weredilutedwithactinstabilizationbuffertoachieve the same concentration amongall samples. 10% of the volume of thediluted cell lysateswas kept separatelyas‘‘totalproteininputs’’.TheF-actinand

G-actin pools of the diluted cell lysateswereseparatedbyultracentrifugationat100 000 g for 1 h at 37°C. Thesupernatant containing G-actin wastransfered to a fresh tube, while thepellet containing F-actin wasresuspendedincolddistilledwaterwith1 mM cytochalasin D (Sigma-Aldrich)andkepton ice for1h.Laemmlibufferwas added to all fractions before beingboiledandanalysedbywesternblotting.G-actin extraction and F-actinstainingCells plated on coverslips were firsttreated with 200 nM Latrunculin A(Abcam,ab144290)for20min,thedrugwas removed and replaced withcomplete medium. After 2 h of drugremoval,monomericactinwasextractedusing a protocol adapted from DanijelaMatic Vignjevic (Institut Curie, Paris,France) indications. Briefly, cells wererinsed with PBS followed by 30 secextractionwithextractionBuffer(0.1%Triton X-100, 4% PEG in PEM Buffer).Cellswerewashedtwicefor1mineachwithPEMbuffer(100mMPIPESpH6.9;1mMMgCl2; 1mM EGTA) and fixatedfor 20 min with 4% paraformaldehyde(Merck). Then, coverslipswere blockedfor30minwith5%FCSinPBSatroomtemperature. The same solution wasused for incubation with TRITC–Phalloidin (Sigma-Aldrich, P1951) for 1h at room temperature. Then nucleiwere stained with 1 µg/mL Hoechst33258 (Sigma-Aldrich, 861405), andcoverslips were mounted inFluoromount(Dako).CellScatteringonmicropatternsTriangle patterned coverslips (4Dcell)were coatedwith1.5µg/cm² collagen I(BD-Biosciences) for 1 h and blockedwith 1% BSA in PBS for 1 h at roomtemperature. 1x104 cells were seeded,and after 4 h, cells were incubatedovernightwith0.5µMSiR-actin and10

(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted July 23, 2020. ; https://doi.org/10.1101/2020.07.22.216085doi: bioRxiv preprint

16

µMVerapamil(Spirochrome).Cellswerefixed with 4% paraformaldehyde(Merck) for 10 min at roomtemperature. Nuclei were stained withHoechst 33258 and coverslips weremounted in Fluoromount as describedabove.FAimmunostainingCells plated on coverslips were fixedwith4%paraformaldehyde (Merck) for10 min at room temperature, washedwithPBS, and thenpermeabilized for 5min in PBS containing 0.1% Triton(Sigma-Aldrich).Cellswereblockedwith5%FCS inPBS containing5%FCS.Thesame solution was used for incubationwith Vinculin antibody (Sigma-Aldrich,V4505)for2handwithanti-mouseIgG(Alexa fluor 555, Life Technologies) for1 h at room temperature. Nuclei werestained with Hoechst 33258 andcoverslips were mounted inFluoromountasdescribedabove.FAassembly/disassemblyassayCells were plated at 4x104cells per35 mmglassbottomdish (Inaki)coatedwith 1.5µg/cm2 collagen I. After 24 h,cellswereculturedintheHBSSmedium(HBSS1X,2.5mMHepespH7.4,30mMD-glucose,1mMCacl2,1mM,MgSO4,4mMNaHCO2)forimageacquisition.ImageacquisitionFor micropatterns, actin and FAimmunostaining experiments, imageswereacquiredin1024x1024modewitha Zeiss LSM780 confocal microscopeequipped with x40 PlanApo; NA 1.3objectiveandrecordedonaCCDcamerawith Zen software. For FAassembly/disassembly experiments,images were acquired in 1024x1024mode with a Nikon Ti-E microscopeequippedwith a ORCA-Flash 4.0 digitalCMOScamerausing theNikon softwareNIS-Elements (Nikon). We used thefollowing objective lenses (Nikon): ×40

PlanApo;NA0.95.FAwereimagedevery15secondsfor1h.QuantificationofimagesandmoviesF-actinstainingwasquantifiedusingtheImageJsoftware.MeanintensitylevelofF-actinrelativetocellareafromimages(actinimmunostaining)orfromZ-stacks(micropatterns)wasrepresentedontheplots. Morphology of micropatternedcells is measured using a quantitativeshape descriptor (roundness) fromImageJ as follow: Roundness=4*area/(pi*major_axis2).ThequantificationoftheFAdistributionwas done using a Matlab (MathWorks,Natick, MA) algorithm developed byM.BallandandR.Demets.Fluorescencecellintensity was first normalized bysubtractingtheendogenousbackground,thenbinarizedusing a user-determinedthreshold value to detect every focaladhesion larger than 0.25 μm2. Thearea,meanintensity,lengthandnumberof adhesions per cell were measuredusing the binarized image. The samethresholdvaluewasusedforcontrolanddrug conditions. Mean intensity ratherthan total intensity was used to avoiddependenciesofthesizeoftheobject.To measure the distance to themembrane,theperipheryofthecellwasdetermined by hand drawing thecontour of the cell. The minimumdistance between the centroid of thefocal adhesion and every pixel of themembranewas analysed, and took intoaccount the cell area (1% of FA-cellmembrane distance means closeproximity between FA and cellmembrane).To quantify FA dynamics, integratedfluorescent intensity of single FA wasanalysed over time using the FocalAdhesion Analysis Server developed byM Berginski: https://faas.bme.unc.edu/(Berginski et al, 2011; Berginski &Gomez,2013).

(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted July 23, 2020. ; https://doi.org/10.1101/2020.07.22.216085doi: bioRxiv preprint

17

StatisticalanalysesAll graphical and statistical analyseswere performed with GraphPad Prism8.3.0. Variables showing a hugevariability across observations in oneexperiment were submitted to outlierexclusionusingtheROUTmethod(falsediscovery rate < 1%). This led to theremovalof15%extremevalues in focaladhesion experiments and 5-10%extreme values in micropatternexperiments.Cell adhesion slopes were comparedusing a 2-way ANOVA (factorsexperiment and condition) followed byDunnett’s multiple comparison test.Because the other studied variableswerenotnormallydistributed(Shapiro-Wilktest) inmostoftheconditionsandexhibited variance heterogeneity, weused non-parametric tests. Variablesobtained from focal adhesions(intensity, assembly/disassembly rates)and from micropatterns (intensity,roundness) were compared betweenconditionsusingeitheraKruskal-Wallistest followed by Dunn’s multiplecomparisons test, or a Mann-Whitneytest according to the number ofconditions. p-value<0.05was taken assignificant.AcknowledgementsThe authors thank members of theVanackerlabforsupportanddiscussion,aswell as Séverine Périan for technicalassistance.We thank Sandrine Etienne-Manneville(InstitutCurie)andLaurenceLafanachère (Institute for AdvancedBiosciences) for reagents.We thank thestaff of PLATIM microscopy facility(UMS3444/CNRS, US8/INSERM, ENS deLyon, ICBL), in particular Elodie Chatreand Claire Lionnet for their help withmicroscopy studies. Work in ourlaboratory is funded by Ligue contre leCancer (comité Rhône), RégionAuvergne Rhône Alpes (grant SCUSI

OPE2017_004), ANSES (grant EST15-076), and ENS Lyon (programmeJoRISS).Authorcontributions

V.T., J.-M.V. and C.F. designed research;V.T., C.C., E.D.-B, J.C. andC.F. performedresearch; R.D.M., M. B., and A.G.contributedtoanalytictools;V.T.,C.C.,J.-M.V. and C.F. analyzed data; and C.F.wrotethepaper.ConflictofinterestThe authors declare no conflict ofinterest.ReferencesAoA,WangH, Kamarajugadda S& Lu J (2008)

Involvement of estrogen-relatedreceptorsintranscriptionalresponsetohypoxia and growth of solid tumors.Proc.Natl.Acad.Sci.U.S.A. 105: 7821–7826

BardetP-L,HorardB, LaudetV&Vanacker J-M(2005) The ERRα orphan nuclearreceptor controls morphogeneticmovements during zebrafishgastrulation.Dev.Biol.281:102–111

Berginski ME & Gomez SM (2013) The FocalAdhesionAnalysisServer:awebtoolforanalyzing focal adhesion dynamics.F1000Research2:68

BerginskiME,VitriolEA,HahnKM&GomezSM(2011) High-Resolution Quantificationof Focal Adhesion SpatiotemporalDynamics in Living Cells. PLoS ONE 6:e22025

BiancoS,SaillandJ&VanackerJ-M(2012)ERRsandcancers:Effectsonmetabolismandon proliferation and migrationcapacities. J. Steroid Biochem. Mol. Biol.130:180–185

Blanchoin L, Boujemaa-Paterski R, Sykes C &Plastino J (2014) Actin dynamics,architecture, and mechanics in cellmotility.Physiol.Rev.94:235–263

(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted July 23, 2020. ; https://doi.org/10.1101/2020.07.22.216085doi: bioRxiv preprint

18

Bravo-Cordero JJ, Hodgson L & Condeelis J(2012) Directed cell invasion andmigrationduringmetastasis.Curr.Opin.CellBiol.24:277–283

Cai Q, Lin T, Kamarajugadda S & Lu J (2013)Regulation of glycolysis and theWarburg effect by estrogen-relatedreceptors.Oncogene32:2079–2086

Carnesecchi J, Forcet C, Zhang L, Tribollet V,Barenton B, Boudra R, Cerutti C, BillasIML,SérandourAA,CarrollJS,BeaudoinC&Vanacker J-M(2017)ERRα inducesH3K9 demethylation by LSD1 topromote cell invasion. Proc. Natl. Acad.Sci.U.S.A.114:3909–3914

ChangC,KazminD,JasperJS,KunderR,ZuercherWJ & McDonnell DP (2011) Themetabolic regulator ERRα, adownstreamtargetofHER2/IGF-1,asatherapeutic target in breast cancer.CancerCell20:500–510

De Pascalis C & Etienne-Manneville S (2017)Single and collective cellmigration: themechanics of adhesions. Mol. Biol. Cell28:1833–1846

DebloisG, SmithHW,Tam IS,Gravel S-P,CaronM, Savage P, Labbé DP, Bégin LR,Tremblay ML, Park M, Bourque G, St-Pierre J,MullerWJ&Giguère V (2016)ERRα mediates metabolic adaptationsdriving lapatinib resistance in breastcancer.Nat.Commun.7:12156

Dwyer MA, Joseph JD, Wade HE, Eaton ML,Kunder RS, Kazmin D, Chang C &McDonnell DP (2010) WNT11expression is induced by estrogen-relatedreceptoralphaandbeta-cateninand acts in an autocrine manner toincrease cancer cell migration. CancerRes.70:9298–9308

GaoX, GaoC, LiuG&Hu J (2016)MAP4K4: anemerging therapeutic target in cancer.CellBiosci.6:56

Gardel ML, Schneider IC, Aratyn-Schaus Y &Waterman CM (2010) MechanicalIntegration of Actin and AdhesionDynamics in Cell Migration. Annu. Rev.CellDev.Biol.26:315–333

Guan X, Guan X, Dong C & Jiao Z (2020) RhoGTPases and related signaling

complexes in cell migration andinvasion.Exp.CellRes.388:111824

Horard B & Vanacker J-M (2003) Estrogenreceptor-related receptors: orphanreceptors desperately seeking a ligand.J.Mol.Endocrinol.31:349–357

Juanes MA, Bouguenina H, Eskin JA, Jaiswal R,Badache A & Goode BL (2017)Adenomatous polyposis coli nucleatesactin assembly to drive cell migrationandmicrotubule-inducedfocaladhesionturnover.J.CellBiol.216:2859–2875

Kanellos G & Frame MC (2016) Cellularfunctions of theADF/cofilin family at aglance.J.CellSci.129:3211–3218

Klapholz B & Brown NH (2017) Talin – themaster of integrin adhesions. J. Cell Sci.130:2435–2446

Lawson CD & Ridley AJ (2018) Rho GTPasesignaling complexes in cell migrationandinvasion.J.CellBiol.217:447–457

LeClaire LL, Rana M, Baumgartner M & BarberDL (2015) The Nck-interacting kinaseNIK increases Arp2/3 complex activitybyphosphorylating theArp2 subunit. J.CellBiol.208:161–170

LikhiteN,YadavV,MillimanEJ, SopariwalaDH,LorcaS,NarayanaNP,ShethM,ReinekeEL,GiguèreV&NarkarV(2019)LossofEstrogen-Related Receptor AlphaFacilitates Angiogenesis in EndothelialCells.Mol.Cell.Biol.39:e00411-18

Ma M & Baumgartner M (2014) IntracellularTheileria annulata Promote InvasiveCellMotility throughKinaseRegulationof the Host Actin Cytoskeleton. PLoSPathog.10:e1004003

MachacekM,HodgsonL,WelchC,ElliottH,PertzO,NalbantP,AbellA, JohnsonGL,HahnKM&DanuserG(2009)CoordinationofRho GTPase activities during cellprotrusion.Nature461:99–103

MartinK,ReimannA,FritzRD,RyuH,JeonNL&Pertz O (2016) Spatio-temporal co-ordination of RhoA, Rac1 and Cdc42activation during prototypical edgeprotrusionandretractiondynamics.Sci.Rep.6:1–14

(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted July 23, 2020. ; https://doi.org/10.1101/2020.07.22.216085doi: bioRxiv preprint

19

Mizuno K (2013) Signaling mechanisms andfunctional roles of cofilinphosphorylation anddephosphorylation.Cell.Signal.25:457–469

Ranhotra HS (2015) Estrogen-related receptoralpha and cancer: axis of evil. J.Recept.SignalTransduct.35:505–508

Ranhotra HS (2018) The estrogen-relatedreceptors in metabolism and cancer:newer insights. J. Recept. SignalTransduct.38:95–100

Ridley AJ (2003) Cell Migration: IntegratingSignalsfromFronttoBack.Science302:1704–1709

Ridley AJ (2015) Rho GTPase signalling in cellmigration.Curr.Opin.CellBiol.36:103–112

RomeroS,LeClaincheC&GautreauAM(2020)Actin polymerization downstream ofintegrins: signaling pathways andmechanotransduction. Biochem. J. 477:1–21

Sailland J, Tribollet V, Forcet C, Billon C,BarentonB,CarnesecchiJ,BachmannA,GauthierKC,YuS,GiguèreV,ChanFL&Vanacker J-M (2014) Estrogen-relatedreceptor α decreases RHOA stability toinduce orientated cell migration. Proc.Natl. Acad. Sci. U. S. A. 111: 15108–15113

Santhana Kumar K, Tripolitsioti D, Ma M,GrählertJ,EgliKB,FiaschettiG,ShalabyT,GrotzerMA&BaumgartnerM(2015)The Ser/Thr kinase MAP4K4 drives c-Met-induced motility and invasivenessin a cell-based model of SHHmedulloblastoma.SpringerPlus4:19

Seetharaman S & Etienne-Manneville S (2019)Microtubules at focal adhesions – adouble-edged sword. J. Cell Sci. 132:jcs232843

SpieringD&HodgsonL(2011)DynamicsoftheRho-family small GTPases in actinregulationandmotility.CellAdhes.Migr.5:170–180

StehbensS&WittmannT(2012)Targetingandtransport: how microtubules control

focal adhesion dynamics. J. Cell Biol.198:481–489

Stein RA, Gaillard S & McDonnell DP (2009)Estrogen-relatedreceptoralphainducesthe expression of vascular endothelialgrowth factor in breast cancer cells. J.SteroidBiochem.Mol.Biol.114:106–112

Sun Z, Costell M & Fässler R (2019) Integrinactivation by talin, kindlin andmechanicalforces.Nat.CellBiol.21:25–31

Tam IS & Giguère V (2016) There and backagain: The journey of the estrogen-relatedreceptors in thecancerrealm. J.SteroidBiochem.Mol.Biol.157:13–19

Tennessen JM, Baker KD, Lam G, Evans J &Thummel CS (2011) The Drosophilaestrogen-related receptor directs ametabolic switch that supportsdevelopmental growth. Cell Metab. 13:139–148

TripolitsiotiD,KumarKS,NeveA,MigliavaccaJ,Capdeville C, Rushing EJ, Ma M, KijimaN, Sharma A, Pruschy M, McComb S,TaylorMD,GrotzerMA&BaumgartnerM (2018) MAP4K4 controlled integrin&#x3B2;1 activation and c-Metendocytosisareassociatedwithinvasivebehavior of medulloblastoma cells.Oncotarget9:23220-23236

Vargas G, Bouchet M, Bouazza L, Reboul P,BoyaultC,GervaisM,KanC,BenetolloC,Brevet M, Croset M, Mazel M,Cayrefourcq L, Geraci S, Vacher S,PantanoF,FilipitsM,DriouchK,BiecheI, GnantM, JacotW, et al (2019) ERRαpromotes breast cancer celldissemination to bone by increasingRANK expression in primary breasttumors.Oncogene38:950–964

Vicente-Manzanares M, Choi CK & Horwitz AR(2009) Integrins in cellmigration– theactin connection. J. Cell Sci. 122: 199–206

VitorinoP,YeungS,CrowA,BakkeJ,SmyczekT,West K, McNamara E, Eastham-AndersonJ,GouldS,HarrisSF,NdubakuC & Ye W (2015) MAP4K4 regulatesintegrin-FERM binding to controlendothelial cell motility. Nature 519:425–430

(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted July 23, 2020. ; https://doi.org/10.1101/2020.07.22.216085doi: bioRxiv preprint

20

YueJ,XieM,GouX,LeeP,SchneiderMD&WuX(2014) Microtubules regulate focaladhesion dynamics through MAP4K4.Dev.Cell31:572–585

Zhang K, Lu J, Mori T, Smith-Powell L, SynoldTW, Chen S & Wen W (2011) Baicalinincreases VEGF expression andangiogenesis by activating theERR{alpha}/PGC-1{alpha} pathway.Cardiovasc.Res.89:426–435

Zhang L, Carnesecchi J, Cerutti C, Tribollet V,PérianS,ForcetC,WongJ&VanackerJ-M(2018)LSD1-ERRαcomplex requiresNRF1 to positively regulatetranscriptionandcell invasion.Sci.Rep.8:10041

ZouC,YuS,XuZ,WuD,NgC-F,YaoX,YewDT,Vanacker J-M & Chan FL (2014) ERRαaugments HIF-1 signalling by directlyinteractingwithHIF-1αinnormoxicandhypoxic prostate cancer cells. J. Pathol.233:61–73

(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted July 23, 2020. ; https://doi.org/10.1101/2020.07.22.216085doi: bioRxiv preprint

21

(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted July 23, 2020. ; https://doi.org/10.1101/2020.07.22.216085doi: bioRxiv preprint