Environmental Science & Engineering Magazine July-August 2014

76
Advanced wastewater treatment helps stretch water supplies Solving iron and manganese issues Industrial wastewater treatment Can coral reefs be saved? ES&E’s Annual Guide to Government, Associations and Academic Institutions Advanced A d v a nce n c e d www.esemag.com July/August 2 0 1 4

description

Environmental Science and Engineering Magazine's Annual Guide to Government, Associations and Academic Institutions. Featuring articles on solving iron and manganese issues, industrial wastewater treatment and saving the coral reefs.

Transcript of Environmental Science & Engineering Magazine July-August 2014

  • Advanced wastewater treatment helps stretch water supplies

    Solving iron and manganese issues

    Industrial wastewater treatment

    Can coral reefs be saved?

    ES&EsAnnual Guide to Government, Associations and Academic Institutions

    AdvancedAdvancenced

    www.esemag.comJuly/August 2014

  • [email protected]

    And we couldnt have done it without you. Thats why we say were serving the best. Whatever the reason, were glad youre choosing us.

    Again. And again.

    Try our new easy pump selection tool at prominentpumps.ca.

    SERV

    ING

    THE

    BEST

    .

    1-888-709-9933www.prominentpumps.ca

    SANSOMEQUIPMENT LIMITED

    Industrial Pump SystemsIndustrial Pump Sy

    Available from

  • Process Equipment for Wastewater, Biosolids & Biogas

    Providing treatment solutions for more than 25 years.

    Pro Aqua, Inc. carries a complete range of market leading and innovative products. Let us show you

    what we can offer on your next project

    Archimedes Screw Pumps

    Screens Multi-Rake, Perf Plate, Drum, Travelling Band, Step, Climber, Vertical Pump Station Screens, Screenings Washer /Compactors

    Grit Separation, Washing & Dewatering

    Conveyors Shafted & Shaftless Screw, Belt

    Blowers Rotary Screw, Rotary Lobe, Single Stage and Multistage Centrifugal, Turbo, Advanced Control, Rebuilds

    Aeration Surface, Membrane & Ceram-ic, Fine & Coarse Bubble, Gas & Liquid Cleaning, DO Control, AlphaMeter

    Mixers Anoxic & Swing Zones, Sludge Holding, Digester; Mechanical and Hydraulic

    Tank Components Covers, Fabric Baf-fles, Troughs, Weirs, Scum Baffles, Skim-mers, Decanters, Swivel Joints, Telescoping Valves, Stamford Baffles, Launder Covers

    Clarifiers Primary & Secondary, Circu-lar, Chain & Flight, Inclined Plate Settlers, Weir Washing

    Biological SBR, MBR, RBC, MBBR, Oxidation Ditch, BioMag, CoMag

    Polymer Liquid and Dry

    Rotary Lobe Pumps & Grinders

    Disinfection UV, Chlorine Scrubbers, Chlorine Gas Containment

    Tertiary Filters Travelling Bridge, Disk, Membrane

    Sludge Thickening & Dewatering Disk Thickener, Gravity Thickener, Filter Press, Screw Press

    Anaerobic Digesters Sludge Condi-tioning, In-line Screening, Degritting, Membrane Gas Holders, Liquid Mixing, Nutrient Recovery

    Sludge Drying Belt, Fluid Bed and Solar

    Septage Receiving Screens, Dump Stations, Truck Access & ID, data gather-ing & equipment control

    Sludge Treatment, Transport & Stor-age Cake Pumps, Silos, Sliding Frames, Live Bottom Hoppers, Push Floors, Truck Loading, Alkaline Stabilization

    Odour Control Tank Covers, Chemical & Biological Treatment

    CSO, Stormwater & Pump Stations Tipping Buckets, Bending Weirs, Flushing Gates, Flow Regulating, Vortex Valves, Storm Screens

    Digester Gas Gas Holders, Gas Condi-tioning: chilling; compressing; and remov-al of moisture, sulphur, carbon dioxide and siloxane, complete Co-Generation facilities

    T: (905) 864-9311 F: (905) 864-8469 www.proaquasales.com 7-264 Bronte St., S., Milton, ON L9T 5A3

    We Are The Exclusive Suppliers For:

  • Publication Name Created By

    Booked By Send Files To

    Material Deadline RRU Contact

    Size

    Colour

    PublicPuublicblicccaaPPubluubb caaPPuuubbliccaatiotiioon Nan NaNn Nattittiioonn N mmmeemmee BusiBuuusininneeessBBuuusineeessBBuuussiinneeessss inn VVVaass innn VVVaass innn VVVaannccooouuvvverrnnccooouuvveer CCrreatedreeaaatteeddCCrCrreeaaatteeddCrreeaaatteeddd BByyyByBy BByyyy RRRRU BrRUUU BraaaUU BBrBraaaRRRRUUU Braand Crenddd Cnd Crearreeaannd Creareeandd CCreaaativtivvvee //t vvee //ttivvvee / AATTTATTAAT

    BooBooookkeeeddBBoooBookeeeddookkeeedd BByyBBByyBBByy CCooosssseteettttCCooosssseetttttCCooosssse teeee SeSeenend Findd FFFSend FindSeennd nd FFFilleesss TTes Tooles Tlesss Tol s TTToo Sarah.mSaaararahSarah.mmmSaaarrah.mh.mmSSaaarah.ra orris@coorrris@cs@@corroorrris@@ccss@@coossettessetteseetssetttossetteosssetssessetossettttteeo te ccomom..ccoomm

    MaaatterriaaaMMMaaatteriaaaMMateriaMaatterr aal DDDeeeaadddldll DDeeeaaddlll DDDeeeaadddlliinneineeiinneeeineee 00707//00444//22077//0444//220077//00444//220011444001144444 RRRU ConU CoConnU ConRRRU CononRRRRU C ttataacctttacacctttaactt Brad TrBraBrad Traad TTrTrBrad Trd TTrB ibibbecbeckkbbbbeeckibbbeckec

    SSiizzeeizizeSSizzee 88 112258.1258.125.112258..125125 25 x 1010 7755xx 1x 100.77757510.775 2250.39150.3910.39250.3913399.391250.39122 0.39 .2600.26000600 e00 e0 e266 0 eext.xt. 478xt. 4478xt 8. 78888888

    ColCoColooloourouroulouurr 44c4cc4 brad.trbrad.trad tbrad.trrad.trribbeck@beck@eck@ckbbeck@ibbeec @b ec royalroyalroroyalrooyalroads.caads..ccaas.ads.ca

    Explore the applied nature of the environment and sustainability professions through hands-on research examining environmental management, practice, communication and education, policy, and science.

    Complete your bachelors or masters degree on campus, online, or choose a blend of online learning with on-campus residencies. Discover how the Royal Roads University experience is anything but ordinary.

    Were ready when you are: 1.877.778.6227

    Sustainable solutions start here.

    life.changing

    Environment & Sustainability

    royalroads.ca/environment

  • | 19 www.esemag.com

    Stormwater Management

    For example, residents receiving stormwater management services are owed a duty. They may become more vulnerable, particularly if avoidable potential impacts of climate change are reasonably foreseeable. A valid policy decision, as op-SRVHGWRDQRSHUDWLRQDOGHFLVLRQFDQQHJDWHDQGLQJWKDWDGXW\RIFDUHH[LVWVDQGSUHYHQWDQGLQJRIQHJOLJHQFH

    Standard of care constantly evolvingA negligent act, or omission, is one that breaches the re-

    quired standard of care. The standard of care applicable to the design of infrastructure is likely to be the standard of care at the time of the design. That said, it is possible and perhaps more likely, that actions other than the design of infrastruc-ture will be subject to a claim of negligence. ,QRQHFDVHZKHUHWKHGHFLHQFLHVRIWKHVWRUPZDWHUV\V-

    tem were well documented, the defendant-municipality chose to avoid major infrastructure upgrades. It did, however, im-plement a bylaw requiring that downspouts be disconnect-ed from the municipal sewer system. The municipality then IDLOHGWRHQIRUFHWKHE\ODZDQGZDVIRXQGOLDEOHIRURRGLQJdue to a failure of the municipal system. In that case, the fail-ure to enforce the bylaw was found to be the inaction that determined negligence.

    Since inspections, maintenance, repairs and other process decisions may be ongoing, they can be judged against a more recent standard of care. This may include considerations of changing information and climate change. Relying on out-

    dated standards or processes can be negligent, if new infor-mation suggests that they should be reconsidered. This is the case even if the standards and processes were not negligent before the new information came to light.

    This does not mean that decision makers need to change all possible standards and processes and upgrade their entire infrastructure in light of climate change information. After

    continued overleaf...

    Cole Engineering Welcomes Mohsen Mortada to the Leadership TeamMohsen Mortada has a wealth of business experience in Canada as well as on the world stage. He will contribute global consulting strategies complementing Cole Engineerings vast engineering experience to bring clients unsurpassed services and solutions.

    905.940.6161 | 416.987.6161 | www.ColeEngineering.ca

    ENVIRONMENTAL SCIENCES AND ENGINEERING | TRANSPORTATION | URBAN DEVELOPMENT

    Toronto received more than 4,700 basement flood complaints during and after the July storm.

  • Environmental Science & Engineering Magazine

    Utilities

    With a history that dates back over a century in Ontario, it would be easy to assume that the state of science and knowledge in waterpow-er development reached its apex some time ago. While it is certainly true that the sector is mature in its approach to the consideration and incorporation of social, environmental and economic values, there is always new information to be brought to future projects.

    The Ontario Waterpower Associa-tion (OWA) is undergoing collaborative efforts to develop Best Management Practices (BMPs). Building on the cre-ation and implementation of the 2008 Class Environmental Assessment for Waterpower, the OWA has sought to continuously improve the advice pro-vided to proponents, regulators and oth-er interests.

    Species at risk The OWAs BMPs initially focused

    on species at risk, including lake stur-geon, American eel and channel darter. 6SHFLHVDW ULVN%03VVSHFLFDOO\DG-

    dress the relationship between waterpow-er projects and a particular species and offer practical advice using science-based information. A common theme in these documents is the pathways of effects DSSURDFKWRWKHLGHQWLFDWLRQRISRWHQWLDOimpacts and appropriate mitigation strate-gies. In all cases, the BMPs are designed to inform decision making and act to sup-plement professional judgement.

    The OWA has subsequently expand-ed its efforts to develop a series of 38 BMPs associated with facility construc-tion. These provide practical and cur-rent best practices that assist proponents and contractors in determining how to construct, rehabilitate or repair a wa-terpower facility in an environmentally responsible manner.

    Facility construction The BMPs have also been designed

    so that an entire BMP or portions of it

    can be easily incorporated into project tender documents. Professionals work-ing on waterpower construction sites, including contractors, inspectors and FRQWUDFW DGPLQLVWUDWRUV ZLOO DOVR QGthis compendium useful as a reference document. Agency personnel involved in waterpower project design, review and permitting can also use them to help in the execution of their mandates.

    Once again in partnership with key organizations, the Association has add-ed three new products to the series in 2014, with a focus on wetlands, migra-tory birds and water quality.

    Wetlands and migratory birds This project explores the connection

    between waterpower facility develop-ment and key considerations with re-spect to wetlands and migratory birds. The BMPs are structured both as stand-alone documents and also incorporated into the series on construction. Impor-tantly, the initiative brought together subject matter experts from Ducks Un-limited Canada (Ontario), the Canadi-an Wildlife Service and the Ministry

    Best management practices for waterpower projects

    The OWAs Best Management Practices explore the connection between waterpower facility development with respect to wetlands and migratory birds.

    Photo by Rick Robb Ducks Unlimited Canada.

    Specializing in the science of corrosion prevention, ICCC

    has been providing high quality products and engineering services

    for the Cathodic Protection/Corrosion Control industry for over

    50 years.

    Magnesium & Zinc Anodes Impressed Current Anodes Rectifiers/Junction Boxes Pipeline Cleaning Swabs Cadweld/Thermoweld Products Monolithic Isolating Joints Pipeline Coatings

    Contact ICCC for competitive pricing and on-time delivery.

    E-mail: [email protected] Central Fax: 905-333-4313

    www.Rustrol.com

    INTERNATIONAL CORROSION CONTROL INC.

    INTERPROVINCIAL CORROSION CONTROL COMPANY LTD.Industry Leaders since 1957

  • #!,,

    6)3)43MITHAND,OVELESSCOM

    3EEFORYOURSELF2EQUESTAVIEWATYOURFACILITYWITHAVISITFROMONEOFOURTRAVELINGDEMO0UMP3TATIONSAT3MITH!ND,OVELESSCOM

    (AVEYOUUEVER LR LOOKOOKOKEDE ATTAT THTHEH TTTRUECOSTOFOWNEN RSHIPFORRYOURLIFTSSTATIONSNS 77HE7HENYYOOUSEE BEBB YONDINITTIALPURCHRCHASEAS PRICETOOOTHERLIFIFECECCYCLYCLC ECOSTTSTSLSS IKEINSTALLAL TIONN PUMPUMPPEFlCIENCCYANDPPOWEOWER DRDR DRARAWW OOPERATIONANDA MAMAINTENAENANCENCEASSOCIATTEDLABOABOR TRTIMEIMEIMEANAN DEQQUIQ PMENTANDPPARTRTSS YOUYOUWIWILLLLAPPRECIAATETHEE3MI3M TH,, OVEOVEVELLESSAPPRP ROACCH/URROPOPERAERATORTOR

    SAFEABBOVEVEGRAGRADEDEE7ET7E7 LL-OUNTED0UMPMP3T3 ATITIONSNSWIWITHTHLONGLAASTINGNGHIGHGHLYLYLYEFlEFlFlCIEIECIENTNT 3,33 .O. N#LOG 0U0UMPSMPS DEDELIVLIVERERTHELOWWESTLT LIFTSTSTSTATIATATIONONO OPEERARATTINGCOC STSnINCINCLUDUDINGINGSAVINGGSVVSSUBSUBMERMERMERSISIBSIBLESES

  • 50 | July/August 2014

    Trenchless Technology

    and 57% have a population less than 50,000. While staff training was noted by about 50% of the respondents to be very important, 40% of the respondents reported a training budget of less than $5,000. Respondents noted that open-cut construction methods are still the dominant method for water and waste-water pipeline renewal and construc-tion. &ULWLFDO LVVXHV LGHQWLHGE\ WKHVXU-

    vey included:

    Improving water quality and flows, ensuring pipe integrity, and reducing watermain leaks and breaks.

    Inflow/infiltration, flow capacity and root intrusion in wastewater pipelines.

    Flow capacity, surcharging, pipe col-lapse and infiltration in stormwater pipelines.In order to address the critical issues,

    respondents to the survey noted that: Rate increases are important. Access to government grants and long-

    term financing is needed. Public education is considered import-

    ant. Government regulatory requirements

    are needed.The information provided by the Bur-

    ied Infrastructure Survey is designed for use by municipal infrastructure manag-ers, contractors, consultants, manufac-turers and political decision makers, for market analysis and assessment.

    This is an annual survey and the

    The 2014 Trenchless Technology Roadshow in Niagara Falls featured over 60 exhibitors and 400 attendees.

    Open-cut is the dominant method for pipeline construction and renewal.

    HUBER Technology selects new president

    Henk-Jan van Ettekoven has been appointed as the new President at HUBER Technology, Inc., headquar-tered in Huntersville, NC.

    Van Ettekoven served as the companys Director of Manufacturing and Service since 2007. There, he was responsible for strategic growth opportunities, the development of new programs and products, along with directing aftermarket sales ac-tivities in North America.

    HUBER Technology provides state-of-the-art equipment for munic-ipal and industrial water and waste-water treatment.

    For more information, E-mail: [email protected]

  • PRIMARY TREATMENT Complete line of ne screening equipment Selfcleaning perforated plate screens FlexRake frontraked ne screens FlexRake frontraked bar screens FlexRake low ow Screenings washer/compactor Auger conveyor SelfCleaning trashracks Mufn Monster grinder for sludge, scum,

    septage, screenings & wastewater Channel Monster grinder for pump staons

    and sewage treatment plant headworks Honey Monster septage receiving staon Auger Monster ne screen system Monster ne screen & band screen perforated

    plate ne screens with 2, 3 & 6mm perforaons Screenings washer/compactors Rotang drum screens down to 2mm perfs Raptor screenings washer pressSECONDARY TREATMENT AquaJet direct drive oang aerator Aqua DDM mechanical oang mixer Fine bubble aeraon systems using membrane or

    ceramic diusers with gas cleaning systems Stainless steel coarse bubble aeraon systems Mul stage acvated biological process MSABP Two & three rotary lobe P/D blowers Centrifugal mulstage blowers Floang diversion curtains for aerated lagoons,

    activated sludge systems & clear wells Subsurface jet aeraon/mixing systems

    for high rate & low rate treatment systems Drop in jet aerators/mixers Spirao & Spiravac peripheral feed clariers Closed loop reactor oxidaon ditch systems Rotary brush aerators High eciency single stage integrally geared blowers Direct drive turbo type blowers Aeraon system controls & instrumentaon Chain & ight clarier systems & components

    plasc, cast iron or stainless steel Half bridge, centre feed, circular clariers Spiral blade clariersTERTIARY TREATMENT AquaDisk cloth media tertiary lter AquaDiamond terary cloth media for traveling

    bridge lters

    CALL 905.856.1414 131 Whitmore Rd., Unit 13, Woodbridge, ON L4L 6E4

    www.envirocan.ca

    Ontario Pollution Control Equipment Association

    Two Companies Many LinesOne Number To Call

    and more

    TANK COVERS & DOMES Aluminum and FRP geodesic domes Flat aluminum tank covers Aluminum channel and launder covers Aluminum hatch coversDISINFECTION UV disinfecon systems Package & custom ozone systemsBIOSOLIDS PROCESSING/HANDLING Sludge storage bins & live boom dischargers GBT & RDT for sludge thickening Belt filter presses & screw presses Centrifuges for thickening & dewateringODOUR CONTROL Biofilters Bioscrubbers Carbon adsorbers Chemical wet scrubbersBULK MATERIAL HANDLING Shaftless & shafted screw conveyors Screw pumps open & closed designsFLOWMETERS Open channel ow metering portable and

    permanent; wireless data transmission Inseron mag ow meters with wireless

    data transmission Data loggers with wireless data transmissionINDUSTRIAL WASTEWATER TREATMENT PCl Series DAF with corrugated plates PWl Series DAF low prole, from 20800 GPM Pipe occulators Industrial wastewater treatment systems Coalescing oil/water separators Inclined plate clariersPACKAGE TREATMENT PLANTS Package potable water treatment plants Package sanitary wastewater treatment plants Package industrial wastewater treatment plants Package industrial process water treatment plantsWATER TREATMENT Pressure ltraon systems removal of iron

    and manganese, arsenic, fluoride, radium,uranium

    www.acgtechnology.com